Dopamine Receptors

Dopamine receptor decline fuels pornography addictionOne of the main hallmarks of an addiction process involves changes in dopamine receptor numbers and types on key nerve cells in the brain. To hear the message, dopamine attaches to receptors on cells. With addiction, some types of receptors decrease, while other types increase. We focus on dopamine (D2) receptor, as it decreases, causing the reward circuitry to become "numbed". This leads to cravings and repeated porn use.

This section contains both lay articles for the general public, and research articles. If you are not an expert in addiction, I suggest starting with the lay articles, they are marked with an "L"

(L) Volkow May Have Uncovered Answer to Addiction Riddle (2004)

Comments: Nora Volkow is the head of NIDA. This covers the role of dopamine (D2) receptors and desensitization in addiction.


Volkow May Have Uncovered Answer to Addiction Riddle

Psychiatric News June 4, 2004

Volume 39 Number 11 Page 32

Jim Rosack

Addictive disorders may be a "shift in the salience meter" in which normal stimuli are no longer recognized as salient, yet the effects of drugs of abuse on the brain's dopamine system are highly salient, NIDA's director believes.

Nora Volkow, M.D., has studied the human brain's response to addictive substances for nearly 25 years. Now, after all those years of clinical observation and research, she is using her position as the director of the National Institute on Drug Abuse (NIDA) to find the answer to a fundamental question: why does the human brain become addicted?

Indeed, after a quarter of a century pondering that deceptively simple question, Volkow—using her own research and that of other addiction researchers—now believes the field is well on its way to an answer.

Under her direction, NIDA-funded researchers are in hot pursuit of the answer. Last month, Volkow shared her thoughts with an overflow crowd during a distinguished psychiatrist lecture at APA's annual meeting in New York City.

An extensive body of research has shown that all drugs of addiction increase dopamine activity in the human brain's limbic system. But, Volkow stressed, "while this increase in dopamine is essential to create addiction, it does not actually explain addiction. If you give a drug of abuse to anyone, their dopamine levels increase. Yet the majority do not become addicted."

Over the past decade, brain-imaging studies have indicated that the increase in dopamine associated with drugs of abuse is less in those who are addicted than in those who are not addicted. Yet in those vulnerable to addiction, this comparatively smaller increase in dopamine levels leads to a subjectively intense desire to seek out the drug of abuse again and again.

Is dopamine playing a role in this transition?" Volkow asked. "What actually leads to the compulsion to take the drug of abuse? What fuels the addict's loss of control?"

Imaging Fills In Some Blanks

Advances in brain-imaging techniques have allowed researchers to use different biochemical markers to look at the components of the dopamine system—the dopamine transporter and the dopamine receptors (at least four different subtypes of dopamine receptors have been identified to date). In addition, researchers are now able to watch changes in the brain's metabolism over time, using biochemical markers for glucose, to see how drugs of abuse affect that metabolism.

These advances have allowed us to look at the different drugs of abuse and what specific effects and changes [in the dopamine system] are associated with each of them," Volkow explained. "What we need to know is what effects and changes are common to all drugs of abuse."

" It became apparent early on that some drugs of abuse appeared to affect the dopamine transporter, yet others did not. Research then focused on dopamine receptors and metabolism to find common effects, Volkow explained. One of her studies in the 1980s showed consistent decreases in dopamine receptor concentration, particularly in the ventral striatum, of patients addicted to cocaine, compared with control subjects. Volkow was intrigued to find that these decreases were long-lasting, well beyond the resolution of acute withdrawal from the cocaine.

"The reduction in dopamine type-2 receptors is not specific to cocaine addiction alone," Volkow continued. Other research found similar results in patients addicted to alcohol, heroin, and methamphetamine.

"So, what does it mean, this common reduction in D2 receptors in addiction?" Volkow asked.

Resetting the Salience Meter

"I always start with the simpler answers, and if they don't work, then I allow my brain to become convoluted," Volkow noted, to the crowd's delight.

The dopamine system, she said, responds to salient stimuli—to something that is either pleasurable, important, or worth paying attention to. Other things can be salient as well, such as novel or unexpected stimuli or aversive stimuli when they are threatening in nature.

"So dopamine is really saying, `Look, pay attention to this—it is important,'" Volkow said. "Dopamine signals salience."

But, she continued, dopamine generally stays within the synapse for only a short time—less than 50 microseconds—before it is recycled by the dopamine transporter. So under normal circumstances, dopamine receptors should be plentiful and sensitive if they are going to pay attention to a short burst of dopamine that is intended to carry the message, "Pay attention!"

With the decrease in D2 receptors associated with addiction, the individual has a decreased sensitivity to salient stimuli acting as natural reinforcers for behaviors.

"Most drugs of abuse, however," Volkow said, "block the dopamine transporter in the brain's reward circuits, allowing the neurotransmitter to remain in the synapse for a comparative eternity. This results in a large and lasting reward, even though the individual has reduced numbers of receptors.

"Over time, addicts learn that natural stimuli are no longer salient," Volkow stressed. "But the drug of abuse is."

So, she asked, "How do we know which is the chicken and which is the egg?" Does the continued use of a drug of abuse lead to decreases in D2 receptors, or does an innately lower number of receptors lead to addiction?

Research is now addressing that question, Volkow confirmed. And it appears that the latter may be the answer. In nonaddicted individuals who have not been exposed to drugs of abuse, there is a widely varying range of D2 receptor concentrations. Some normal control subjects have D2 levels as low as some cocaine-addicted subjects.

In one study, Volkow said, researchers gave intravenous methylphenidate to non-addicted individuals and asked them to rate how the drug made them feel.

"Those with high levels of D2 receptors said it was awful, and those with lower levels of D2 receptors were more likely to say it made them feel good," Volkow reported.

"Now," she continued, "this does not necessarily mean that those individuals with low levels of D2 receptors are vulnerable to addiction. But it may mean that individuals who have high levels of D2 receptors end up having too intense a response to the large increase in dopamine seen in drugs of abuse. The experience is inherently aversive, potentially protecting them from addiction."

In theory, she suggested, if addiction treatment researchers could find a way to cause an increase in D2 receptors in the brain, "you might be able to transform those individuals with lower D2 levels and create aversive behavior in response to drugs of abuse."

Recent findings from one of Volkow's postdoctoral research fellows showed that it is possible in mice to introduce into the brain an adenovirus with the gene for D2 receptor production, causing an increase in D2 receptor concentration. In response, the mice correspondingly reduce their self controlled intake of alcohol. Other researchers recently replicated the findings with cocaine as well.

"But," Volkow cautioned, "you need more than just a low level of D2 receptors." Imaging studies of glucose metabolism have indicated that metabolism decreases significantly in the orbital frontal cortex (OFC) and cingulate gyrus (CG) in response to cocaine, alcohol, methamphetamine, and marijuana in those addicted, compared with control subjects. And, she added, this decrease in metabolism is strongly correlated with decreased levels of D2 receptors.

Volkow postulated that dysfunction in the OFC and CG "causes individuals to no longer be able to judge the salience of the drug—they take the drug of abuse compulsively, yet it does not give them pleasure and, in most instances, has negative consequences." Yet still, they cannot stop using the drug.

Other research is showing that inhibitory control; reward, motivation, and drive; and learning and memory circuits are all abnormal in individuals with an addictive disorder, she noted. As a result, treatment of addiction requires an integrated, systems approach.

"No one chooses to become addicted," Volkow concluded. "They simply are cognitively unable to choose not to be addicted."

Addiction and Dopamine (D2) Receptor Levels (2006)

Low dopamine receptors may be behind porn addiction as well as cocaine addictionCOMMENTS: First study to show that drug use causes a decline in dopamine (D2) receptors. Important because addicts have a low number of such receptors, which may contribute to addiction. Also shows that receptors can bounce back, but rate is highly varaible and not related to baseline D2 receptors.

Cocaine Abuse And Receptor Levels: PET Imaging Confirms Link

14 Jul 2006

Using positron emission tomography (PET), researchers have established a firm connection between a particular brain chemistry trait and the tendency of an individual to abuse cocaine and possibly become addicted, suggesting potential treatment options.

The research, in animals, shows a significant correlation between the number of receptors in part of the brain for the neurotransmitter dopamine - measured before cocaine use begins - and the rate at which the animal will later self-administer the drug. The research was conducted in rhesus monkeys, which are considered an excellent model of human drug users.

Generally the lower the initial number of dopamine receptors, the higher the rate of cocaine use, the researchers found. The research was led by Michael A. Nader, Ph.D., professor of physiology and pharmacology at Wake Forest University School of Medicine.

It was already known that cocaine abusers had lower levels of a particular dopamine receptor known as D2, in both human and animal subjects, compared to non-users. But it was not known whether that was a pre-existing trait that predisposed individuals to cocaine abuse or was a result of cocaine use.

"The present findings in monkeys suggest that both factors are likely to be true,"

Nader and colleagues write in a study published online this week in the journal Nature Neuroscience. "The present findings also suggest that more vulnerable individuals are even more likely to continue using cocaine because of the cocaine-induced reductions in D2 receptor levels."

This was the first study ever to measure the baseline D2 levels of animals that had never used cocaine and compare those levels to changes in D2 receptors after the animals had started using. This kind of comparison is not possible with human subjects, and in previous monkey research, the brain chemistry of animals exposed to cocaine was compared only with non-using "controls."

The research also showed that starting to use cocaine caused the D2 levels to drop significantly and that continuing to use the drug kept the D2 levels well below the baseline.

"Overall, these findings provide unequivocal evidence for a role of [dopamine] D2 receptors in cocaine abuse and suggest that treatments aimed at increasing levels of D2 receptors may have promise for alleviating drug addition," the researchers write.

The study suggested that increasing D2 receptors might be done "pharmacologically" or by improving environmental factors, such as reducing stress. But, the study notes, "at present there are no clinically effective therapies for cocaine addiction, and an understanding of the biological and environmental mediators of vulnerability to cocaine abuse remains elusive."

Dopamine, like other neurotransmitters, moves between nerve cells in the brain to convey certain "messages." It is released by one nerve cell and taken in by the receptors on the next nerve cell, some of which are D2. Unused dopamine is collected in "transporters" that return it to the sending cell.

Cocaine operates by entering the transporter, blocking the "reuptake" of dopamine and leaving more of it in the space between the cells. It is thought that this overload of dopamine gives the user the cocaine "high."

But this dopamine overload also overwhelms the D2 receptors on the receiving cells, and those cells eventually react by reducing the number of D2 receptors. Drug researchers hypothesize that it is this change that creates a craving for cocaine: once the receptor level drops, more dopamine is needed for the user even to feel "normal."

Like cocaine use, stress can also increase the dopamine levels and apparently cause a reduction in the D2 receptors. Earlier research by Nader's team at Wake Forest showed a connection between stress and a tendency to abuse cocaine.

The current study also observed differences in the time it took for the D2 receptors to return to normal levels once cocaine use ended. Monkeys that used only for one week had only a 15 percent reduction in D2 receptors and recovered completely within three weeks.

But monkeys that used for a year averaged a 21 percent reduction in D2 receptors. Three of those monkeys recovered within three months, but two of those monkeys still had not returned to their baseline D2 levels after one year of abstinence.

Lack of recovery was not related to initial baseline D2 levels. The study suggests that "other factors, perhaps involving other neurotransmitter systems, mediate the recovery of D2 receptor function."


THE STUDY: PET imaging of dopamine D2 receptors during chronic cocaine self-administration in monkeys.

Nader MA, Morgan D, Gage HD, Nader SH, Calhoun TL,

Buchheimer N, Ehrenkaufer R, Mach RH.

Nat Neurosci. 2006 Aug;9(8):1050-6. Epub 2006 Jul 9.

Department of Physiology and Pharmacology, Wake Forest University School of Medicine, Medical

Center Boulevard, Winston-Salem, North Carolina 27157, USA. mnader@wfubmc.edu

Dopamine neurotransmission is associated with high susceptibility to cocaine abuse. Positron emission tomography was used in 12 rhesus macaques to determine if dopamine D2 receptor availability was associated with the rate of cocaine reinforcement, and to study changes in brain dopaminergic function during maintenance of and abstinence from cocaine. Baseline D2 receptor availability was negatively correlated with rates of cocaine self-administration. D2 receptor availability decreased by 15-20% within 1 week of initiating self-administration and remained reduced by approximately 20% during 1 year of exposure. Long-term reductions in D2 receptor availability were observed, with decreases persisting for up to 1 year of abstinence in some monkeys. These data provide evidence for a predisposition to self-administer cocaine based on D2 receptor availability, and demonstrate that the brain dopamine system responds rapidly following cocaine exposure. Individual differences in the rate of recovery of D2 receptor function during abstinence were noted.

Cdk5 Phosphorylates Dopamine D2 Receptor and Attenuates Downstream Signaling (2013)

Comments: Appears to show that Cdk5 causes down regulation of dopamine D2 receptors. Amazingly, translation factor deltafosb induces the production of Cdk5.


Jeong J, Park Y-U, Kim D-K, Lee S, Kwak Y, et al. (2013) PLoS ONE 8(12): e84482. doi:10.1371/journal.pone.0084482

Abstract

The dopamine D2 receptor (DRD2) is a key receptor that mediates dopamine-associated brain functions such as mood, reward, and emotion. Cyclin-dependent kinase 5 (Cdk5) is a proline-directed serine/threonine kinase whose function has been implicated in the brain reward circuit. In this study, we revealed that the serine 321 residue (S321) in the third intracellular loop of DRD2 (D2i3) is a novel regulatory site of Cdk5. Cdk5-dependent phosphorylation of S321 in the D2i3 was observed in in vitro and cell culture systems.

We further observed that the phosphorylation of S321 impaired the agonist-stimulated surface expression of DRD2 and decreased G protein coupling to DRD2. Moreover, the downstream cAMP pathway was affected in the heterologous system and in primary neuronal cultures from p35 knockout embryos likely due to the reduced inhibitory activity of DRD2. These results indicate that Cdk5-mediated phosphorylation of S321 inhibits DRD2 function, providing a novel regulatory mechanism for dopamine signaling.

Figures

12

Citation: Jeong J, Park Y-U, Kim D-K, Lee S, Kwak Y, et al. (2013) Cdk5 Phosphorylates Dopamine D2 Receptor and Attenuates Downstream Signaling. PLoS ONE 8(12): e84482. doi:10.1371/journal.pone.0084482

Editor: James Porter, University of North Dakota, United States of America

Received: May 20, 2013; Accepted: November 14, 2013; Published: December 31, 2013

Copyright: © 2013 Jeong et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Funding: This work was supported by the grants (NRF-2012R1A2A2A01012923 and NRF-2012R1A4A1028200) from the Korean government (MSIP) and also supported under the framework of international cooperation program managed by NRF of Korea (2012K2A1A2033117) and the Korea Brain Research Institute (KBRI) Basic Research Program of MSIP (2031-415). SKP was a recipient of the 2004 and 2006 National Alliance for Research on Schizophrenia and Depression (NARSAD) Young Investigator Awards. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Competing interests: The authors have declared that no competing interests exist.

Introduction

Dopamine signaling is involved in various brain functions including motor coordination, mood control and reward mechanisms [1]. A major component of dopamine signaling in vertebrates is exerted by striatal medium spiny neurons (MSNs) which selectively express a subset of dopamine receptors and receive dopaminergic input mainly from the ventral tegmental area (VTA) and substantia nigra (SN) [2]. Dopamine receptors are G protein-coupled receptors (GPCR) with seven transmembrane domains and consist of two subtypes, D1-like and D2-like receptors, that mediate reciprocal actions in dopamine signaling [1]. For example, dopamine D1-like receptors (D1, D5) activate adenylyl cyclase through Gαs and increase the intracellular level of cAMP, but dopamine D2-like receptors (D2, D3, D4) inhibit adenylyl cyclase through Gαi and decrease the intracellular level of cAMP [1], [3].

Among dopamine receptors, the D2 receptor (DRD2) is implicated in the pathophysiology of multiple major psychiatric disorders including schizophrenia and drug addiction [4], such that many antipsychotic drugs at least partially target DRD2. It is also known that DRD2 activity correlates well with the behavioral consequences of drugs of abuse in animal models [5]. Antidepressants and mood stabilizer efficacy have also been linked to alterations in the cell surface expression of DRD2 or downstream intracellular signaling mediated by PKA, ERK and GSK3 [1], [4], [6]. Despite these critical roles for DRD2 in the brain, the detailed regulatory mechanisms that confer heterogeneity and complexity to DRD2 properties are not completely understood.

Converging lines of evidence indicate that multiple posttranslational modifications are involved in the fine-tuning of DRD2 activity. Extensive glycosylation of DRD2 was revealed in early photo-affinity labeling studies [7], and disulfide bond formation within DRD2 was also identified as an important modification for ligand binding [8]. Furthermore, phosphorylation sites of DRD2 were initially identified by in vitro assay with radioisotopes, providing routes for various regulatory pathways mediated by various kinases [9]. Indeed, protein kinase C (PKC) regulates DRD2-mediated mobilization of intracellular calcium and modulates the interaction of DRD2 with cytoskeletal proteins [10]. Phosphorylation by GPCR kinase 2 (GRK2) regulates agonist-induced resensitization patterns of DRD2 [11].

Cyclin-dependent kinase 5 (Cdk5) is a proline-directed serine/threonine kinase that has preferential activity due to brain-specific expression of its essential activators, p35 and p39 [12]. Cdk5 is involved in various neuronal processes including neuronal migration and axon guidance, and Cdk5 and p35 null mice show defects in cortical layering [13]. Recently, it was shown that phosphorylation of WAVE1 and ephexin by Cdk5 regulates dendritic spine morphogenesis [14]. Furthermore, Cdk5 also regulates surface expression levels of the NMDA receptor, NR2B, and NR2A-mediated NMDA currents [15], [16]. It is noteworthy that multiple pieces of evidence suggest an intimate relationship between Cdk5 and the dopamine system. Cdk5 phosphorylates tyrosine hydroxylase (TH), regulating its stability, and thus maintaining dopaminergic homeostasis [17]. In postsynaptic neurons, when the T75 residue of dopamine and cyclic-AMP regulated phosphoprotein-32kD (DARPP-32) is phosphorylated by Cdk5, it can inhibit PKA activity and thus antagonize dopamine DRD1-mediated PKA signaling [18]. Interestingly, when cocaine, an indirect agonist of dopamine receptors, is administrated chronically in rats, mRNA and protein levels of Cdk5 increase in medium spiny neurons [19]. Collectively, Cdk5 appears to be involved in drug-induced synaptic adaptations. In this study, we show a functional interaction of DRD2 and Cdk5 that further extends the role of Cdk5 in dopamine signaling.

Materials and Methods

Antibodies

Anti-rabbit serums were raised against peptides containing phospho-serine 321 (pS321) of the third intracellular loop of DRD2 (D2i3). Phospho-peptide, CNPDpSPAKPEK (PEPTRON), was used to make a peptide-conjugated column for affinity purification (20401, PIERCE). Anti-pS321 antibody was enriched by an affinity purification system following the manufacturer’s instruction. Purified phospho-antibody was stored in PBS with 0.1% sodium azide and 0.1% gelatin. Anti-mouse anti-Cdk5 antibody (sc-249) and anti-rabbit anti-p35 antibody (sc-820) were used for the Western blotting and immunocytochemistry of Cdk5/p35. Anti-mouse anti-GFP antibody (sc-9996) was used for the immunoprecipitation and Western blotting of DRD2-GFP. Anti-rabbit anti-FLAG antibody (sc-807), anti-rabbit anti-HA antibody (sc-805), anti-mouse anti-GST antibody (sc-138), and anti-mouse anti-GAPDH antibody (sc-32293) were purchased from Santa Cruz Biotechnologies.

Animals

The p35 knockout mouse was a kind gift from Dr. Katsuhiko Mikoshiba at RIKEN Brain Science Institute in Japan and used for primary neuron culture. Primer sets for genotyping were 5′- GGTCTCCTCTTCTGTCAAGAAG, 5′-GCTCTGCTAGACACATACTGTAC and 5′- TCCATCT GCACGAGACTAGT as previously described [20]. ICR mice and Sprague Dawley rats were used for brain lysate preparation. All animal procedures were approved by the Pohang University of Science and Technology Institutional Animal Care and Use Committee.

Plasmid Constructs

Human DRD2 long isoform in an EGFP-N1 plasmid vector and the third intracellular loop of DRD2 (212–373 amino acid residues including the 29 additional amino acid residues unique to DRD2 long isoform) in a pFLAG-CMV-2 plasmid vector were used. Human Cdk5 was inserted in a pCMV-HA plasmid vector and human p35 was inserted in a pcDNA 3.1 plasmid vector. Human Cdk5 was inserted under a cytomegalovirus (CMV) promoter along with human p35 in a pcDNA 3.1 vector to make a dual expression construct (Cdk5/p35) for immunocytochemistry, receptor internalization assay, [35S]-GTPγS binding assay, radioligand binding assay and cAMP enzyme immunoassay.

In Vitro Kinase Assay

IP-linked in vitro kinase assay was performed as following. One whole mouse brain was lysed in 3 mL erythrocytes lysis buffer (ELB) (50 mM Tris (pH 8.0), 250 mM NaCl, 5 mM EDTA, 0.1% NP-40) by 20 strokes of a Dounce homogenizer to get homogenized brain lysates. The lysates were incubated on ice for 30 min, sonicated, and centrifuged at 16,000 × g for 10 min. The supernatants were immunoprecipitated with anti-rabbit anti-p35 antibody to obtain an active Cdk5/p35 complex. Cdk5/p35 complex and purified GST fusion protein was mixed with adenosine 5′-triposphate, [γ-32P] (NEG-502H, PerkinElmer) and incubated in kinase buffer (30 mM HEPES (pH 7.2), 10 mM MgCl2, 0.2 mM DTT) for 1 h at room temperature [18], [21]. Purified Cdk5/p25 complex (14–516, Millipore) was also used for in vitro kinase assay as described above. The 2× sample loading buffer was added to the reaction mixture and boiled at 100°C. The samples were then subjected to SDS-PAGE and the dried gel was assessed by autoradiography.

Liquid Chromatography (LC)-Mass Spectrometry (MS)/MS Analysis

The recombinant GST-D2i3 protein was analyzed by LC-MS/MS following IP-linked in vitro kinase assay. We performed peptide identification of LC-MS/MS data using X!!Tandem (version Dec-01-2008). Each RAW data file was first converted to mzXML using the trans-proteomic pipeline (TPP; version 4.3). MS/MS scans in the converted mzXMLs were then subjected to search against the UniProt mouse protein sequence database (release 2010_07) including GST-D2i3 sequence using X!!Tandem. The tolerance was set to 3 Da for precursor ions and 2 Da for fragment ions. Enzyme specificity for trypsin was used. Variable modification options were used for the carbamidomethylation of cysteine (57.021 Da), the oxidation of methionine (15.995 Da), the hydrolysis of asparagine (0.987 Da) and the phosphorylation of serine (79.966 Da).

Immunoprecipitation

Immunoprecipitation was performed on cell lysates in ELB lysis buffer. Anti-GFP antibody was added to the lysates and incubated for 3 h at 4°C. Immunocomplexes were purified using protein-A agarose. The precipitates were incubated with SDS sample loading buffer for 30 min at 37°C, and subjected to SDS-PAGE and Western blots.

GST Pull-down Assay

10 µg of purified GST and GST–D2i3 were incubated with rat brain lysate for 1.5 h at 4°C. 30 µL of glutathione (GSH)-conjugated Sepharose 4B beads (17-0756-01, GE Healthcare) equilibrated with lysis buffer was added and incubated for additional 1 h. Beads were collected by centrifugation at 2,000×g and rinsed with lysis buffer 4 times [22], [23]. Precipitates were analyzed by Western blotting using anti-Cdk5 and anti-p35 antibodies.

Immunocytochemistry

Transfected HEK 293 cells and striatal neurons cultured on coverslips were washed once with phosphate buffered saline (PBS) and fixed by immersion in cold 4% paraformaldehyde/PBS for 30 min. Primary antibody was diluted in the blocking solution (2% horse serum and 1% Triton X-100 in PBS). Alexafluor-647-conjugated anti-mouse antibody (A20990, Invitrogen) and Alexafluor-568-conjugated anti-rabbit antibody (A11011, Invitrogen) were used as secondary antibodies. Hoechst were used for nucleus staining. Images were obtained by confocal microscopy (Olympus, FluoView-1000).

Receptor Internalization Assay

24 h after transfection, cells were treated with 1 µM quinpirole (Q102, Sigma) for 30 min and 90 min at 37°C. Cells were re-suspended in 2 mL cold PBS and 200 µL aliquots were used for each reaction. Drug treatments were carried out at room temperature for 3 h at the following concentrations; 3 nM [3H]-spiperone (NET-565, PerkinElmer), 3 µM sulpiride (895, TOCRIS), 10 µM haloperidol (H1512, Sigma). Hydrophobic [3H]-spiperone was used to label total expressed receptors and hydrophilic sulpiride was used to replace membranous receptor-bound [3H]-spiperone signals. Membrane-associated receptor signals were calculated by subtracting intracellular receptor values from the total expressed receptor values. Cells were filtered on a GF/B (Millipore) filter and washed 3 times with washing buffer (50 mM Tris-HCl (pH 7.4), 100 mM NaCl). Filters were dried out and residual radioactivity was measured using a liquid scintillation counter [24].

Cell Membrane Preparation

Confluent cells in 100 mm culture-dishes after transfection were washed with ice-cold PBS and harvested in 1 mL HME buffer (25 mM HEPES (pH 7.5), 2 mM MgCl2, 1 mM EDTA). Homogenized lysates were centrifuged with 500×g for 15 min and the supernatants were subsequently centrifuged with 36,000×g for 30 min. Pellets re-suspended in HME buffer were used for assays.

[35S]-GTPγS Binding Assay

Cell membrane fractions were pre-incubated with 1 µM quinpirole (Q102, Sigma) in the assay buffer (25 mM HEPES (pH 7.5), 1.5 mM MgCl2, 100 mM NaCl, 1 mM EDTA and 0.01 mM GDP) for 10 min. [35S]-GTPγS (NET-030H, PerkinElmer) was added to the final concentration of 3 nM in 30 µL and further incubated for 90 min. 170 µL of ice-cold buffer (10 mM Tris-HCl (pH 8.0), 100 mM NaCl, 10 mM MgCl2, and 0.1 mM GTP) was added to stop the reaction. Membranes were filtered on a GF/B filter (Millipore) and washed 3 times with washing buffer (50 mM Tris-HCl (pH 7.4), 100 mM NaCl). Filters were dried and radioactivity was measured using the scintillation counter [25], [26].

Radioligand Binding Assay

Prepared cell membranes were incubated with 0.01 nM [3H]-spiperone (NET-565, PerkinElmer) and increasing concentrations of quinpirole (Q102, Sigma) for 30 min in the assay buffer (25 mM HEPES (pH 7.5), 1.5 mM MgCl2, 100 mM NaCl, 1 mM EDTA). Membranes were filtered on a GF/B filter (Millipore) and washed 3 times with washing buffer (50 mM Tris-HCl (pH 7.4), 100 mM NaCl). The reaction was terminated by rapid filtration through GF/C filters. Residual radioactivity was measured using a liquid scintillation counter [27][29].

cAMP Enzyme Immunoassay

Transfected HEK 293 cells were pretreated with 10 µM rolipram (R6520, Sigma) for 1 h, and then treated with 0.1 µM forskolin (F6886, Sigma) and increasing concentrations of quinpirole (Q102, Sigma) for 30 min. Primary cultured striatal neurons were treated with 10 µM rolipram for 1 h, and then 1 µM dopamine for 1 h [22]. Cell lysates were prepared with 0.1 M HCl and cAMP levels were detected by cAMP enzyme immunoassay kit (Sapphire Bioscience) following the manufacturer’s instruction.

Primary Cultured Striatal Neuron

Striatal area was isolated from the mouse embryonic brain (E15). Dissected tissue was dissociated in minimal essential media (MEM) (11095, Invitrogen) containing 0.25% trypsin (T4549-100, Sigma) and 0.1% DNase I for 6 min at 37°C. Cells were re-suspened in the plating media (MEM with 0.01 M HEPES (pH 7.4) and 10% (vol/vol) horse serum (16050-122, GIBCO)). Neurons were cultured for 7 days in vitro (DIV 7) in MEM with B27 supplement (17504-044, Invitrogen) before being applied to cAMP enzyme immunoassays.

Results

Cdk5 Phosphorylates Serine 321 in the Third Intracellular Loop of DRD2 in vitro

To identify novel Cdk5 substrates, we performed a systematic search using (S/T)PX(K/H/R) as the Cdk5 recognition consensus sequences [30] and identified DRD2 as a candidate substrate. The consensus sequence, including serine 321, is located in the third intracellular loop of DRD2 (D2i3) where various regulatory mechanisms have been implicated [3], [10], [11]. The sequence is evolutionarily conserved in DRD2 in vertebrates, implying a functional importance of the residue (Fig. 1A).

thumbnail

Figure 1. Cdk5 phosphorylates serine 321 in the third intracellular loop of DRD2 in vitro.

(A) Amino acid sequence alignment showing conserved regions of the DRD2 from various species (shaded). The potential Cdk5 phosphorylation site is indicated by an asterisk. (B) IP-linked in vitro kinase assay with recombinant GST-D2i3 and GST-D2i3 mutant proteins. Cdk5/p35 complex enriched from mouse brain extract by anti-p35 immunoprecipitation was used for kinase reactions. An autoradiograph of phosphorylated proteins is shown along with Coomassie brilliant blue staining of the same gel. Arrowhead indicates radioactive signal corresponding to GST-D2i3s and open arrowhead indicates radioactive signals from p35. (C) MS/MS spectrum of the phosphorylated peptide fragment of D2i3. The theoretical fragmentation patterns are shown below the spectrum. Among all the fragment ions, the detected y- and b-ions are denoted in the spectrum. The y6 and y7 ions strongly indicate the phosphorylation of serine 321. (D) In vitro kinase assay with purified Cdk5/GST-p25 complex using GST-D2i3 and GST-D2i3 mutant proteins. Phosphorylated proteins were shown in an autoradiograph, along with Coomassie brilliant blue staining. Arrowhead indicates radioactive signal corresponding GST-D2i3 and open arrowhead indicates radioactive signals from GST-p25.

doi:10.1371/journal.pone.0084482.g001

To assess the capacity of Cdk5 to phosphorylate D2i3, we performed IP-linked in vitro kinase assays using an active Cdk5/p35 complex enriched from mouse brain lysate by p35 immunoprecipitation with purified recombinant GST-D2i3 (amino acid residues 212–373) proteins as the substrates. We observed phosphorylation signals in the purified GST-D2i3 and GST-D2i3 S297A proteins, but the signal was significantly diminished using GST-D2i3 S321A (Fig. 1B). To further verify phosphorylation of serine 321 in the GST-D2i3, we performed LC-MS/MS analysis of the samples from IP-linked in vitro kinase assays using LTQ XL mass spectrometry. Consistently, phospho-peptides corresponding to the mass of phospho-serine 321 peptides were recovered (Fig. 1C). Considering that the data-dependent acquisition during LC-MS/MS analysis tends to detect abundant proteins in the sample [31], this data suggests that the serine 321 residue is the dominant phosphorylation site of Cdk5 in the D2i3 region. To prove direct phosphorylation of serine 321 in the GST-D2i3 by Cdk5, in vitro kinase assay using purified Cdk5/GST-p25 complex with purified recombinant GST-D2i3 proteins was performed. We identified a significant phosphorylation signal in the GST-D2i3 that was absent in the GST-D2i3 S321A (Fig. 1D). Taken together, these results indicate that the D2i3 S321 residue is a preferential target for Cdk5-mediated phosphorylation.

Cdk5 Phosphorylates Serine 321 in the Third Intracellular Loop of DRD2 in Cells

To identify the phosphorylation of serine 321, we raised antibody specific for phospho-serine 321 (pS321). Samples from the IP-linked in vitro kinase assay were analyzed by Western blotting using anti-pS321 antibody. Blots showed a distinct band in the kinase reaction that was dependent on GST-D2i3 (Fig. 2A). To verify the potential phosphorylation of serine 321 in DRD2 by Cdk5 in cells, anti-GFP immunoprecipitates from HEK 293 cells expressing DRD2-GFP and DRD2 S321A-GFP with or without HA-Cdk5 and p35 were analyzed by Western blotting using anti-GFP and anti-pS321 antibodies. Characteristic smeared band signals by anti-GFP antibody that are known to be due to excessive glycosylation of DRD2 are observed only in the presence of DRD2-GFP, and anti-pS321 antibody detected similar DRD2 signals only with Cdk5/p35 co expression (Fig. 2B) [7]. To further verify the phosphorylation of serine 321 by Cdk5, D2i3 (FLAG-D2i3) and mutant form of D2i3 (FLAG-D2i3 S321A) were generated. FLAG-D2i3 and FLAG-D2i3 S321A expressed with or without HA-Cdk5 and p35 in HEK 293 cells were analyzed by an SDS-gel mobility shift assay. A significant Cdk5-dependent mobility shift was observed for FLAG-D2i3, but not for FLAG-D2i3 S321A (Fig. 2C). We also assessed the phosphorylation level of DRD2 at Ser321 upon agonist stimulation. HEK 293 cells expressing DRD2-GFP and Cdk5/p35 complex were stimulated by quinpirole, and anti-GFP immunoprecipitates from the cell lysates were analyzed by Western blotting using anti-GFP and anti-pS321 antibodies. We found that Cdk5-mediated phosphorylation of DRD2 at Ser321 was not affected by agonist stimulation, which appears different from GRK- and PKC-mediated phosphorylations (Fig. 2D) [32], [33]. Together, these results indicate that Cdk5 can phosphorylate the serine 321 residue of DRD2 in the cellular environment.

thumbnail

Figure 2. Cdk5 phosphorylates serine 321 in the third intracellular loop of DRD2 in cells.

Cdk5-mediated phosphorylation of serine 321 was analyzed using anti-pS321 antibody. (A) Samples from IP-linked in vitro kinase assay using GST-D2i3 proteins were analyzed by Western blotting (WB) with indicated antibodies. Arrowheads indicate GST-D2i3s. (B) DRD2-GFP and DRD2 S321A-GFP was expressed with or without HA-Cdk5 and p35 in HEK 293 cells. Anti-GFP immunoprecipitates were analyzed by Western blotting using anti-GFP and anti-pS321 antibodies. The bracket indicates DRD2 signals and open arrowhead indicates nonspecific signals from the anti-GFP immunoprecipitates. ‘% input’ is % volume of total lysate for an IP reaction. Weak endogenous Cdk5 signals were indicated by asterisks. (C) Gel mobility shift assay. HEK 293 cells transfected as indicated were analyzed by Western blotting. (D) Transfected HEK 293 cells were treated with quinpirole and anti-GFP immunoprecipitates were analyzed by Western blotting with anti-GFP and anti-pS321 antibodies. Open arrowhead indicates nonspecific signals from anti-GFP immunoprecipitates.

doi:10.1371/journal.pone.0084482.g002

Cdk5/p35 Complex and DRD2 are Physically Associated

We investigated the potential physical interaction between the Cdk5/p35 complex and DRD2 because many Cdk5 substrates are known to be physically associated with Cdk5/p35 complex [23], [34], [35]. First, the GST pull-down experiment was performed. Purified recombinant GST-D2i3 protein was incubated with rat brain lysate and GST pull-down precipitates were analyzed for Western blotting. As shown in Fig. 3A, endogenous Cdk5 and p35 were identified in the pull-down precipitates, indicating a physical interaction between DRD2 and the Cdk5/p35 complex (Fig. 3A). Moreover, HA-Cdk5 and p35 were detected in the anti-GFP immunoprecipitates from HEK 293 cell lysates expressing DRD2-GFP and Cdk5/p35 (Fig. 3B). In addition, we performed immunocytochemical analyses and observed that DRD2-GFP, HA-Cdk5 and p35 show significant co-localization signals at the membranous area of HEK 293 cells (Fig. 3C, upper panels). We also investigated co-localization of DRD2 and Cdk5/p35 in the neuronal context. Consistently, DRD2-GFP also showed significant co-localization with endogenous Cdk5 and p35 in the cultured striatal neurons (DIV7), further supporting functional links between DRD2 and Cdk5/p35 (Fig. 3C, bottom panels). The results indicate that DRD2 and Cdk5/p35 can form a complex and thus, support the notion that DRD2 is a physiological substrate of Cdk5.

thumbnail

Figure 3. Cdk5/p35 can form a complex with DRD2.

(A) GST pull-down assay using purified recombinant GST-D2i3 protein with rat brain extract. GST pull-down precipitates were subjected to Western blotting analyses. ‘Bead’ indicates the pull-down precipitate without GST proteins. (B) Immunoprecipitation of DRD2 and Cdk5/p35 complex. Anti-GFP IP from lysates from transfected cells were subjected to Western blotting analyses. The bracket indicates DRD2 signals and open arrowhead indicates nonspecific signals from the anti-GFP immunoprecipitates. An overexposed blot for inputs is also shown in the right. (C) Immunocytochemical analyses of DRD2 and Cdk5/p35. HEK 293 cells expressing DRD2-GFP and Cdk5/p35 were stained with anti-Cdk5 and anti-p35 antibodies (Upper panels). DRD2-GFP was expressed alone in the cultured striatal neurons and stained with anti-Cdk5 and anti-p35 antibodies (Lower panels). Hoechst were used for nucleus staining. The scale bar is 5 µm. All images were obtained using confocal microscopy (Olympus, FluoView-1000).

doi:10.1371/journal.pone.0084482.g003

Cdk5-mediated Phosphorylation of DRD2 Attenuates Receptor Activity

It has been reported that phosphorylation modulates critical properties of GPCRs such as G protein coupling, receptor internalization, intracellular localization, and association with modulator proteins [9], [11], [24]. Agonist-induced receptor internalization is a critical regulatory process of signal transduction. We investigated Cdk5-mediated modulation of DRD2 internalization. HEK 293 cells expressing DRD2-GFP and DRD2 S321A-GFP with or without Cdk5/p35 were incubated with 1 µM quinpirole to induce agonist-stimulated DRD2 internalization (Fig. 4A). [3H]-spiperone signals of DRD2-GFP expressing cells were significantly reduced at 30 min quinpirole treatment and recovered at 90 min. Interestingly, [3H]-spiperone signals of DRD2-GFP and Cdk5/p35 expressing cells were also reduced at 30 min quinpirole treatment but not recovered at 90 min (Fig. 4A, second section). On the other hand, [3H]-spiperone signals of DRD2 S321A-GFP expressing cells were reduced at 30 min and recovered at 90 min, regardless of the co-expression with Cdk5/p35. Previous studies have shown that the internalized DRD2 recycles back to the plasma membrane upon prolonged agonist stimulation [11]. Thus it appears that Cdk5-mediated phosphorylation of DRD2 is involved in the resensitization processes following agonist-induced DRD2 internalization.

thumbnail

Figure 4. Cdk5-mediated phosphorylation attenuates DRD2 surface expression and downstream signaling.

(A) DRD2 surface expression measured by [3H]-spiperone binding assay. Transfected HEK293 cells were stimulated with 1 µM quinpirole for the indicated time and harvested, followed by 3 nM [3H]-spiperone treatment for 3 h. Radioactivity was measured and surface signals were calculated. Error bars represent mean ± SE (n = 8; *p<0.05, **p<0.01; One-way ANOVA with Dunnett post hoc test: compare all columns vs. control column). (B) [35S]-GTPγS binding assay. Cell membranes were prepared from the cells transfected as indicated. Membrane preparations were incubated with 1 µM quinpirole followed by 3 nM [35S]-GTPγS for 90 min. Error bars represent mean ± SE (n = 8; *p<0.05, **p<0.01, ***p<0.001; One-way ANOVA with Bonferroni post hoc test: compare all pairs of columns). (C) Quinpirole-competing [3H]-spiperone binding assay. Membrane preparations from transfected cells were incubated with 0.01 nM [3H]-spiperone and increasing concentrations of quinpirole for 30 min. Non-linear regression was obtained by GraphPad. Error bars indicate mean ± SE (n = 3). (D) cAMP enzyme immunoassays in transfected HEK 293 cells. Transfected cells were pretreated with 10 µM rolipram for 1 h, and subsequently co-treated with 0.1 µM forskolin and increasing concentrations of quinpirole for 30 min. Non-linear regression was obtained by GraphPad. Error bars represent mean ± SE (n = 4; **p<0.01; two-tailed t-tests). (E) Cultured striatal neurons from wild type and p35 knockout embryos (DIV 7) were treated with 10 µM rolipram for 1 h followed by 1 µM dopamine for 1 h. Error bars represent mean ± SE (n = 4; **p<0.01; two-tailed t-tests).

doi:10.1371/journal.pone.0084482.g004

We further evaluated a potential change of agonist-stimulated G protein coupling to DRD2 associated with Cdk5-mediated phosphorylation using [35S]-GTPγS binding assay [25], [26]. DRD2-GFP and DRD2 S321A-GFP with or without Cdk5/p35 were expressed in HEK 293 cells. Membranes were prepared and stimulated with 1 µM quinpirole and further allowed [35S]-GTPγS incorporation. DRD2-GFP and Cdk5/p35 expressing cell membrane showed significantly impaired [35S]-GTPγS binding compared to all the other cell membranes (Fig. 4B). These results indicate that Cdk5-mediated phosphorylation down-regulates agonist-stimulated G protein binding at DRD2.

Additionally, quinpirole-competing [3H]-spiperone binding assays were performed to investigate any potential change in agonist-affinity at DRD2 by Cdk5-mediated phosphorylation. Competitive binding of [3H]-spiperone upon treatment of increasing concentrations of quinpirole to the membrane preparation from transfected was measured. Competing binding of quinpirole and [3H]-spiperone at DRD2-GFP and DRD2 S321A-GFP made similar logKi values (−9.789 for DRD2-GFP; −9.691 for DRD2 S321A-GFP), indicating that the affinity of ligand to DRD2 is not significantly affected by Cdk5-mediated phosphorylation at DRD2 (Fig. 4C).

Cdk5-mediated Phosphorylation Down-regulates the DRD2-cAMP Signaling Pathway

Next, we investigated whether the modification of DRD2 by Cdk5 affects downstream signaling pathways. We monitored DRD2-mediated inhibition of forskolin-stimulated cAMP production by adenylyl cyclase in the cells expressing DRD2-GFP and DRD2 S321A-GFP using cAMP enzyme immunoassay. DRD2-expressing cells showed decreased cAMP levels in response to quinpirole in a dose-dependent manner. Remarkably, co-expression of Cdk5/p35 significantly reduced the maximal inhibition of cAMP formation (Fig. 4D, left panel). On the other hand, in the DRD2 S321A-GFP expressing cells, the cAMP formations were effectively inhibited in response to quinpirole treatment regardless of the expression of Cdk5/p35 (Fig. 4D, right panel). These results indicate that Cdk5-mediated phosphorylation of DRD2 attenuates the inhibitory activity of DRD2 on the downstream cAMP signaling pathway. To further confirm the phenomena in a more physiologically relevant setting, we made use of primary cultured neurons from knockout embryos deficient in p35, an essential Cdk5 activator. Primary cultured striatal neurons were treated with 1 µM dopamine and analyzed by cAMP enzyme immunoassay. Neurons from p35 knockout mice exhibited reduced cAMP levels compared to wild-type neurons when stimulated with dopamine (Fig. 4E). Taken together, we concluded that Cdk5-mediated phosphorylation of DRD2 results in a decrease in the inhibitory tone on the cAMP pathway exerted by DRD2.

Discussion

We identified DRD2 as a novel substrate of Cdk5. The phosphorylation appears to down-regulates DRD2 surface expression by affecting the fate of DRD2 following receptor internalization thereby reducing DRD2 Gi-coupling and downstream cAMP pathway. As the phosphorylation residue S321 exists both in DRD2 long and short isoforms, the mechanism proposed in this study may be a general mode of regulation in DRD2-mediated signaling.

DRD2 in medium spiny neurons has not only been regarded as a major dopamine receptor subtype but has also been recognized for its susceptibility to changes in availability in response to environmental stimuli. Agonist-induced desensitization and resensitization of DRD2 have been extensively studied [11], [24]. In particular, a number of studies have shown that the effects of chronic psychostimulant exposure, such as cocaine and amphetamine, which raise the extracellular level of dopamine in the striatal synapse, are accompanied by dynamic changes of DRD2 postsynaptically [36]. Indeed, chronic cocaine users are known to have reduced DRD2 levels in the striatal area, and DRD2 availability in the nucleus accumbens (NAcc) shows a negative correlation with the drug seeking and reinforcement behaviors in mice and primates [37][39]. These findings indicate that the functionality of DRD2 is highly susceptible to adaptive or compensatory regulation in response to various stimuli including chronic drug exposure. Our results show that the S321 residue in the third intracellular loop of DRD2 can be phosphorylated by Cdk5, which results in a decrease in inhibitory influence of DRD2 on the cAMP pathway. This interaction proposes a novel regulatory mechanism associated with Cdk5 in dopaminoceptive neurons that might be linked to the dynamic nature of DRD2 surface availability.

It should be noted that Cdk5 is known to be a key component in mediating adaptive changes of the neuronal environment. For instance, structural and functional alterations of dendritic spines in the neurons of the limbic circuit are one of the consequences of repeated psychostimulant exposure [40]. These changes are accompanied by various molecular changes including the induction of cAMP response element-binding protein (CREB) and ΔFosB, transcription factors that exhibit an enduring up-regulation in response to chronic cocaine administration [41], [42]. Importantly, Cdk5 is a target of ΔFosB [19], and many critical components involved in dendritic spine dynamics, such as PSD-95, p21-activated kinase (PAK), β-catenin, and spinophilin, were reported as Cdk5 substrates [43][46]. Consistently, genetic or pharmacological manipulations of Cdk5 activity elicit alterations of dendritic spine morphology and behavioral responses to cocaine, implying critical roles for Cdk5 in the molecular and morphological changes of mesolimbic dopamine circuits [47], [48]. Our results showing that DRD2 is a novel target of Cdk5 provides additional insight into the adaptive changes of the dopamine system in response to chronic drug exposures because of the subsequent ΔFosB-mediated up-regulation of Cdk5 may induce a tonic increase in the phosphorylation of DRD2. Moreover, DRD2 is known to affect numerous cellular processes, including regulation of cAMP and MAP kinase pathways and downstream transcriptional events [42], [49]. Thus, the findings in this study might not only depict a direct regulation of DRD2 by Cdk5 but also provide a novel insight into the adaptive responses of dopamine system to chronic drug exposure.

Author Contributions

Conceived and designed the experiments: JJ YUP DH SKP. Performed the experiments: JJ YUP DKK YK. Analyzed the data: JJ YUP DKK SL YK SAL HL YSG DH SKP. Contributed reagents/materials/analysis tools: YHS. Wrote the paper: JJ SKP.

References

  1. 1. Missale C, Nash SR, Robinson SW, Jaber M, Caron MG (1998) Dopamine receptors: from structure to function. Physiol Rev 78: 189–225.
  2. 2. Wise RA (2002) Brain reward circuitry: insights from unsensed incentives. Neuron 36: 229–240. doi: 10.1016/s0896-6273(02)00965-0
  3. View Article
  4. PubMed/NCBI
  5. Google Scholar
  6. View Article
  7. PubMed/NCBI
  8. Google Scholar
  9. View Article
  10. PubMed/NCBI
  11. Google Scholar
  12. View Article
  13. PubMed/NCBI
  14. Google Scholar
  15. View Article
  16. PubMed/NCBI
  17. Google Scholar
  18. View Article
  19. PubMed/NCBI
  20. Google Scholar
  21. View Article
  22. PubMed/NCBI
  23. Google Scholar
  24. View Article
  25. PubMed/NCBI
  26. Google Scholar
  27. View Article
  28. PubMed/NCBI
  29. Google Scholar
  30. View Article
  31. PubMed/NCBI
  32. Google Scholar
  33. View Article
  34. PubMed/NCBI
  35. Google Scholar
  36. View Article
  37. PubMed/NCBI
  38. Google Scholar
  39. View Article
  40. PubMed/NCBI
  41. Google Scholar
  42. View Article
  43. PubMed/NCBI
  44. Google Scholar
  45. View Article
  46. PubMed/NCBI
  47. Google Scholar
  48. View Article
  49. PubMed/NCBI
  50. Google Scholar
  51. View Article
  52. PubMed/NCBI
  53. Google Scholar
  54. View Article
  55. PubMed/NCBI
  56. Google Scholar
  57. View Article
  58. PubMed/NCBI
  59. Google Scholar
  60. View Article
  61. PubMed/NCBI
  62. Google Scholar
  63. View Article
  64. PubMed/NCBI
  65. Google Scholar
  66. View Article
  67. PubMed/NCBI
  68. Google Scholar
  69. View Article
  70. PubMed/NCBI
  71. Google Scholar
  72. View Article
  73. PubMed/NCBI
  74. Google Scholar
  75. View Article
  76. PubMed/NCBI
  77. Google Scholar
  78. View Article
  79. PubMed/NCBI
  80. Google Scholar
  81. View Article
  82. PubMed/NCBI
  83. Google Scholar
  84. View Article
  85. PubMed/NCBI
  86. Google Scholar
  87. View Article
  88. PubMed/NCBI
  89. Google Scholar
  90. View Article
  91. PubMed/NCBI
  92. Google Scholar
  93. View Article
  94. PubMed/NCBI
  95. Google Scholar
  96. View Article
  97. PubMed/NCBI
  98. Google Scholar
  99. View Article
  100. PubMed/NCBI
  101. Google Scholar
  102. View Article
  103. PubMed/NCBI
  104. Google Scholar
  105. View Article
  106. PubMed/NCBI
  107. Google Scholar
  108. View Article
  109. PubMed/NCBI
  110. Google Scholar
  111. View Article
  112. PubMed/NCBI
  113. Google Scholar
  114. View Article
  115. PubMed/NCBI
  116. Google Scholar
  117. View Article
  118. PubMed/NCBI
  119. Google Scholar
  120. View Article
  121. PubMed/NCBI
  122. Google Scholar
  123. View Article
  124. PubMed/NCBI
  125. Google Scholar
  126. View Article
  127. PubMed/NCBI
  128. Google Scholar
  129. View Article
  130. PubMed/NCBI
  131. Google Scholar
  132. View Article
  133. PubMed/NCBI
  134. Google Scholar
  135. View Article
  136. PubMed/NCBI
  137. Google Scholar
  138. View Article
  139. PubMed/NCBI
  140. Google Scholar
  141. View Article
  142. PubMed/NCBI
  143. Google Scholar
  144. 3. Neve KA, Seamans JK, Trantham-Davidson H (2004) Dopamine receptor signaling. J Recept Signal Transduct Res 24: 165–205. doi: 10.1081/lrst-200029981
  145. 4. Amar S, Shaltiel G, Mann L, Shamir A, Dean B, et al. (2008) Possible involvement of post-dopamine D2 receptor signalling components in the pathophysiology of schizophrenia. Int J Neuropsychopharmacol 11: 197–205. doi: 10.1017/s1461145707007948
  146. 5. Caine SB, Negus SS, Mello NK, Patel S, Bristow L, et al. (2002) Role of dopamine D2-like receptors in cocaine self-administration: studies with D2 receptor mutant mice and novel D2 receptor antagonists. J Neurosci 22: 2977–2988.
  147. 6. Lee S, Jeong J, Park YU, Kwak Y, Lee SA, et al. (2012) Valproate alters dopamine signaling in association with induction of Par-4 protein expression. PLoS One 7: e45618. doi: 10.1371/journal.pone.0045618
  148. 7. Fishburn CS, Elazar Z, Fuchs S (1995) Differential glycosylation and intracellular trafficking for the long and short isoforms of the D2 dopamine receptor. J Biol Chem 270: 29819–29824. doi: 10.1074/jbc.270.50.29819
  149. 8. Reader TA, Molina-Holgado E, Lima L, Boulianne S, Dewar KM (1992) Specific [3H]raclopride binding to neostriatal dopamine D2 receptors: role of disulfide and sulfhydryl groups. Neurochem Res 17: 749–759. doi: 10.1007/bf00969008
  150. 9. Ng GY, O’Dowd BF, Caron M, Dennis M, Brann MR, et al. (1994) Phosphorylation and palmitoylation of the human D2L dopamine receptor in Sf9 cells. J Neurochem 63: 1589–1595. doi: 10.1046/j.1471-4159.1994.63051589.x
  151. 10. Li M, Bermak JC, Wang ZW, Zhou QY (2000) Modulation of dopamine D(2) receptor signaling by actin-binding protein (ABP-280). Mol Pharmacol 57: 446–452.
  152. 11. Cho D, Zheng M, Min C, Ma L, Kurose H, et al. (2010) Agonist-induced endocytosis and receptor phosphorylation mediate resensitization of dopamine D(2) receptors. Mol Endocrinol 24: 574–586. doi: 10.1210/me.2009-0369
  153. 12. Tsai LH, Delalle I, Caviness VS Jr, Chae T, Harlow E (1994) p35 is a neural-specific regulatory subunit of cyclin-dependent kinase 5. Nature 371: 419–423. doi: 10.1038/371419a0
  154. 13. Dhavan R, Tsai LH (2001) A decade of CDK5. Nat Rev Mol Cell Biol 2: 749–759. doi: 10.1038/35096019
  155. 14. Fu AK, Ip NY (2007) Cyclin-dependent kinase 5 links extracellular cues to actin cytoskeleton during dendritic spine development. Cell Adh Migr 1: 110–112. doi: 10.4161/cam.1.2.4617
  156. 15. Wang J, Liu S, Fu Y, Wang JH, Lu Y (2003) Cdk5 activation induces hippocampal CA1 cell death by directly phosphorylating NMDA receptors. Nat Neurosci 6: 1039–1047. doi: 10.1038/nn1119
  157. 16. Zhang S, Edelmann L, Liu J, Crandall JE, Morabito MA (2008) Cdk5 regulates the phosphorylation of tyrosine 1472 NR2B and the surface expression of NMDA receptors. J Neurosci 28: 415–424. doi: 10.1523/jneurosci.1900-07.2008
  158. 17. Moy LY, Tsai LH (2004) Cyclin-dependent kinase 5 phosphorylates serine 31 of tyrosine hydroxylase and regulates its stability. J Biol Chem 279: 54487–54493. doi: 10.1074/jbc.m406636200
  159. 18. Bibb JA, Snyder GL, Nishi A, Yan Z, Meijer L, et al. (1999) Phosphorylation of DARPP-32 by Cdk5 modulates dopamine signalling in neurons. Nature 402: 669–671.
  160. 19. Bibb JA, Chen J, Taylor JR, Svenningsson P, Nishi A, et al. (2001) Effects of chronic exposure to cocaine are regulated by the neuronal protein Cdk5. Nature 410: 376–380.
  161. 20. Ohshima T, Ogawa M, Veeranna, Hirasawa M, Longenecker G, et al. (2001) Synergistic contributions of cyclin-dependant kinase 5/p35 and Reelin/Dab1 to the positioning of cortical neurons in the developing mouse brain. Proc Natl Acad Sci U S A 98: 2764–2769. doi: 10.1073/pnas.051628498
  162. 21. Morabito MA, Sheng M, Tsai LH (2004) Cyclin-dependent kinase 5 phosphorylates the N-terminal domain of the postsynaptic density protein PSD-95 in neurons. J Neurosci 24: 865–876. doi: 10.1523/jneurosci.4582-03.2004
  163. 22. Park SK, Nguyen MD, Fischer A, Luke MP, Affar el B, et al. (2005) Par-4 links dopamine signaling and depression. Cell 122: 275–287. doi: 10.1016/j.cell.2005.05.031
  164. 23. Niethammer M, Smith DS, Ayala R, Peng J, Ko J, et al. (2000) NUDEL is a novel Cdk5 substrate that associates with LIS1 and cytoplasmic dynein. Neuron 28: 697–711. doi: 10.1016/s0896-6273(00)00147-1
  165. 24. Kim KM, Valenzano KJ, Robinson SR, Yao WD, Barak LS, et al. (2001) Differential regulation of the dopamine D2 and D3 receptors by G protein-coupled receptor kinases and beta-arrestins. J Biol Chem 276: 37409–37414. doi: 10.1074/jbc.m106728200
  166. 25. Waldhoer M, Bofill-Cardona E, Milligan G, Freissmuth M, Nanoff C (1998) Differential uncoupling of A1 adenosine and D2 dopamine receptors by suramin and didemethylated suramin (NF037). Mol Pharmacol 53: 808–818.
  167. 26. Bofill-Cardona E, Kudlacek O, Yang Q, Ahorn H, Freissmuth M, et al. (2000) Binding of calmodulin to the D2-dopamine receptor reduces receptor signaling by arresting the G protein activation switch. J Biol Chem 275: 32672–32680. doi: 10.1074/jbc.m002780200
  168. 27. List SJ, Seeman P (1981) Resolution of dopamine and serotonin receptor components of [3H]spiperone binding to rat brain regions. Proc Natl Acad Sci U S A 78: 2620–2624. doi: 10.1073/pnas.78.4.2620
  169. 28. Gardner B, Strange PG (1998) Agonist action at D2(long) dopamine receptors: ligand binding and functional assays. Br J Pharmacol 124: 978–984. doi: 10.1038/sj.bjp.0701926
  170. 29. Seeman P, Tallerico T, Ko F (2003) Dopamine displaces [3H]domperidone from high-affinity sites of the dopamine D2 receptor, but not [3H]raclopride or [3H]spiperone in isotonic medium: Implications for human positron emission tomography. Synapse 49: 209–215. doi: 10.1002/syn.10232
  171. 30. Obenauer JC, Cantley LC, Yaffe MB (2003) Scansite 2.0: Proteome-wide prediction of cell signaling interactions using short sequence motifs. Nucleic Acids Res 31: 3635–3641. doi: 10.1093/nar/gkg584
  172. 31. Liu H, Sadygov RG, Yates JR 3rd (2004) A model for random sampling and estimation of relative protein abundance in shotgun proteomics. Anal Chem 76: 4193–4201. doi: 10.1021/ac0498563
  173. 32. Ito K, Haga T, Lameh J, Sadee W (1999) Sequestration of dopamine D2 receptors depends on coexpression of G-protein-coupled receptor kinases 2 or 5. Eur J Biochem 260: 112–119. doi: 10.1046/j.1432-1327.1999.00125.x
  174. 33. Namkung Y, Sibley DR (2004) Protein kinase C mediates phosphorylation, desensitization, and trafficking of the D2 dopamine receptor. J Biol Chem 279: 49533–49541. doi: 10.1074/jbc.m408319200
  175. 34. Wong AS, Lee RH, Cheung AY, Yeung PK, Chung SK, et al. (2011) Cdk5-mediated phosphorylation of endophilin B1 is required for induced autophagy in models of Parkinson’s disease. Nat Cell Biol 13: 568–579. doi: 10.1038/ncb2217
  176. 35. Kesavapany S, Lau KF, McLoughlin DM, Brownlees J, Ackerley S, et al. (2001) p35/cdk5 binds and phosphorylates beta-catenin and regulates beta-catenin/presenilin-1 interaction. Eur J Neurosci 13: 241–247. doi: 10.1046/j.1460-9568.2001.01376.x
  177. 36. Kuhar MJ, Ritz MC, Boja JW (1991) The dopamine hypothesis of the reinforcing properties of cocaine. Trends Neurosci 14: 299–302. doi: 10.1016/0166-2236(91)90141-g
  178. 37. Volkow ND, Fowler JS, Wolf AP, Schlyer D, Shiue CY, et al. (1990) Effects of chronic cocaine abuse on postsynaptic dopamine receptors. Am J Psychiatry 147: 719–724.
  179. 38. Dalley JW, Fryer TD, Brichard L, Robinson ES, Theobald DE, et al. (2007) Nucleus accumbens D2/3 receptors predict trait impulsivity and cocaine reinforcement. Science 315: 1267–1270. doi: 10.1126/science.1137073
  180. 39. Nader MA, Morgan D, Gage HD, Nader SH, Calhoun TL, et al. (2006) PET imaging of dopamine D2 receptors during chronic cocaine self-administration in monkeys. Nat Neurosci 9: 1050–1056. doi: 10.1038/nn1737
  181. 40. Robinson TE, Kolb B (1997) Persistent structural modifications in nucleus accumbens and prefrontal cortex neurons produced by previous experience with amphetamine. J Neurosci 17: 8491–8497.
  182. 41. Robinson TE, Kolb B (1999) Alterations in the morphology of dendrites and dendritic spines in the nucleus accumbens and prefrontal cortex following repeated treatment with amphetamine or cocaine. Eur J Neurosci 11: 1598–1604. doi: 10.1046/j.1460-9568.1999.00576.x
  183. 42. McClung CA, Nestler EJ (2003) Regulation of gene expression and cocaine reward by CREB and DeltaFosB. Nat Neurosci 6: 1208–1215. doi: 10.1038/nn1143
  184. 43. Feng J, Yan Z, Ferreira A, Tomizawa K, Liauw JA, et al. (2000) Spinophilin regulates the formation and function of dendritic spines. Proc Natl Acad Sci U S A 97: 9287–9292. doi: 10.1073/pnas.97.16.9287
  185. 44. Prange O, Murphy TH (2001) Modular transport of postsynaptic density-95 clusters and association with stable spine precursors during early development of cortical neurons. J Neurosci 21: 9325–9333.
  186. 45. Murase S, Mosser E, Schuman EM (2002) Depolarization drives beta-Catenin into neuronal spines promoting changes in synaptic structure and function. Neuron 35: 91–105. doi: 10.1016/s0896-6273(02)00764-x
  187. 46. Hayashi ML, Choi SY, Rao BS, Jung HY, Lee HK, et al. (2004) Altered cortical synaptic morphology and impaired memory consolidation in forebrain- specific dominant-negative PAK transgenic mice. Neuron 42: 773–787. doi: 10.1016/j.neuron.2004.05.003
  188. 47. Benavides DR, Quinn JJ, Zhong P, Hawasli AH, DiLeone RJ, et al. (2007) Cdk5 modulates cocaine reward, motivation, and striatal neuron excitability. J Neurosci 27: 12967–12976. doi: 10.1523/jneurosci.4061-07.2007
  189. 48. Meyer DA, Richer E, Benkovic SA, Hayashi K, Kansy JW, et al. (2008) Striatal dysregulation of Cdk5 alters locomotor responses to cocaine, motor learning, and dendritic morphology. Proc Natl Acad Sci U S A 105: 18561–18566. doi: 10.1073/pnas.0806078105
  190. 49. Impey S, Obrietan K, Storm DR (1999) Making new connections: role of ERK/MAP kinase signaling in neuronal plasticity. Neuron 23: 11–14. doi: 10.1016/s0896-6273(00)80747-3

A preliminary study of dopamine D2/3 receptor availability and social status in healthy and cocaine dependent humans imaged with [(11)C](+)PHNO (2015)

Drug Alcohol Depend. 2015 Sep 1;154:167-73. doi: 10.1016/j.drugalcdep.2015.06.039. Epub 2015 Jun 30.

Matuskey D1, Gaiser EC2, Gallezot JD3, Angarita GA4, Pittman B4, Nabulsi N3, Ropchan J3, MaCleod P4, Cosgrove KP2, Ding YS5, Potenza MN6, Carson RE3, Malison RT4.

Abstract

BACKGROUND:

Previous work in healthy non-human primates and humans has shown that social status correlates positively with dopamine 2/3 receptor (D2/3R) availability imaged with antagonist radioligands and positron emission tomography (PET). Further work in non-human primates suggests that this relationship is disrupted by chronic cocaine administration. This exploratory study examined the relationship between social status and D2/3R availability in healthy (HH) and cocaine dependent (CD) humans using the D3-preferring, agonist radioligand, [(11)C](+)PHNO.

METHODS:

Sixteen HH and sixteen CD individuals completed the Barratt Simplified Measure of Social Status (BSMSS) and underwent [(11)C](+)PHNO scanning to measure regional brain D2/3R binding potentials (BPND). Correlations between BPND and BSMSS scores were then assessed within each group.

RESULTS:

Within HH and CD groups, inverse associations between BSMSS score and BPND were observed in the substantia nigra/ventral tegmental area (SN/VTA) and the ventral striatum, and for the CD group alone, the amygdala. After adjusting for body mass index and age, negative correlations remained significant in the SN/VTA for HH and in the amygdala for CD subjects.

CONCLUSION:

These preliminary data utilizing a dopamine agonist tracer demonstrate, for the first time, an inverse association between social status and D2/3R availability in the D3R rich extrastriatal regions of HH and CD humans.

Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

KEYWORDS:

Cocaine; Dopamine; PET imaging; Social status; [(11)C](+)PHNO

 

Abstinence from chronic cocaine self administration alters striatal dopamine systems in rhesus monkeys. (2009)

Study of other addictions may suggest how long the most severe effects of porn addiction lastCOMMENTS: One of the few studies that covers how abstinence affects the levels of dopamine receptors in primates.

  • D2 receptors bounce back fairly quickly - less than a month
  • D1 receptors are way too high at a month, but bounce back within 90 days.
  • High or low D1 receptors may be keys to acute withdrawal and cravings

Neuropsychopharmacology (2009) 34, 1162–1171; doi:10.1038/npp.2008.135; published online 3 September 2008

Thomas J R Beveridge1, Hilary R Smith1, Michael A Nader1 and Linda J Porrino1

1Department of Physiology and Pharmacology, Center for the Neurobiological Investigation of Drug Abuse, Wake Forest University School of Medicine, Winston-Salem, NC, USA

Correspondence: Dr LJ Porrino, Department of Physiology and Pharmacology, Center for the Neurobiological Investigation of Drug Abuse, Wake Forest University School of Medicine, Medical Center Boulevard, Winston-Salem, NC 27157-1083, USA. Tel: +1 336 716 8575; Fax: +1 336 716 8501; E-mail: lporrino@wfubmc.edu

Received 29 April 2008; Revised 25 July 2008; Accepted 30 July 2008; Published online 3 September 2008.

Top

Abstract

Although dysregulation within the dopamine (DA) system is a hallmark feature of chronic cocaine exposure, the question of whether these alterations persist into abstinence remains largely unanswered. Nonhuman primates represent an ideal model in which to assess the effects of abstinence on the DA system following chronic cocaine exposure. In this study, male rhesus monkeys self-administered cocaine (0.3mg/kg per injection, 30 reinforcers per session) under a fixed-interval 3-min schedule for 100 days followed by either 30 or 90 days abstinence. This duration of cocaine self-administration has been previously shown to decrease DA D2-like receptor densities and increase levels of D1-like receptors and DA transporters (DAT). Responding by control monkeys was maintained by food presentation under an identical protocol and the same abstinence periods. [3H]SCH 23390 binding to DA D1 receptors following 30 days of abstinence was significantly higher in all portions of the striatum, compared to control animals, whereas [3H]raclopride binding to DA D2 receptors was not different between groups. [3H]WIN 35 428 binding to DAT was also significantly higher throughout virtually all portions of the dorsal and ventral striatum following 30 days of abstinence. Following 90 days of abstinence, however, levels of DA D1 receptors and DAT were not different from control values. Although these results indicate that there is eventual recovery of the separate elements of the DA system, they also highlight the dynamic nature of these components during the initial phases of abstinence from chronic cocaine self-administration.

Keywords:

cocaine, dopamine, autoradiography, abstinence, striatum

Top

INTRODUCTION

Chronic cocaine use among human addicts has been associated with neuroadaptations in the dopamine (DA) system (Malison et al, 1998; Volkow et al, 1993, 1997). These include increases in the density of DA transporters (DAT) and decreases in the concentrations of DA D2-like receptors (Little et al, 1999; Mash et al, 2002; Volkow et al, 1993). In addition, alterations in DA release have also been observed. For example, investigators using positron emission tomography (PET) studies with [11C]raclopride and methylphenidate have demonstrated decreases in DA release in the striatum of chronic cocaine users (Volkow et al, 1997; Wong et al, 2006). One problem, however, is that it is often difficult to exclude the influence of other factors such as the use of other illegal and legal drugs, differences in prior drug intake and use patterns, and differences in lifestyle. These differences, as well as the existence of conditions that may predate drug use, can limit the interpretation of studies in human patients.

Nonhuman primate models, in which variables can be systematically manipulated, represent an alternative approach to the study of the consequences of chronic cocaine self-administration and subsequent abstinence. Previous studies have demonstrated that chronic cocaine exposure is accompanied by significant decreases in the concentrations of DA D2 receptors as well as elevations in the levels of D1 receptors and the density of the DAT (Letchworth et al, 2001; Moore et al, 1998a, 1998b; Nader et al, 2002, 2006). These effects mirror those seen in humans, thus substantiating the utility of these models of drug exposure.

Although there is considerable evidence for dysregulation of DA systems, it has proven more difficult to evaluate whether there is any evidence for recovery following cessation of drug use (Malison et al, 1998; Jacobsen et al, 2000; Volkow et al, 1993) or whether these changes persist beyond the time frame of continued cocaine exposure. Again, nonhuman primate models can provide insights into this phase of addiction. Farfel et al (1992) reported decreased concentrations of DAT and D1-like receptors in the striatum of monkeys following abstinence from chronic noncontingent exposure to cocaine. However, the specific role of abstinence was difficult to determine because of the lack of measurements in a group with no abstinence period. In a similar fashion, Melega et al (2008) reported significantly decreased levels of DAT in the striatum of vervet monkeys following 3 weeks of abstinence from an escalating methamphetamine regimen. The administration of stimulants in both studies, however, was noncontingent. The route of administration (contingent vs noncontingent) has been shown to impact the brain differentially with respect to both DA release (Hemby et al, 1997) and glucose metabolism (Graham and Porrino, 1995; Porrino et al, 2002). Thus, the use of self-administration in the present study circumvents this issue. In addition, the effects of long-term cocaine self-administration on brain DA systems has been extensively studied using this model of self-administration in rhesus monkeys, thereby providing a baseline from which to assess the neuroadaptations that occur during abstinence.

The purpose of these studies, therefore, was to determine whether the changes in DAT and DA D1 and D2 receptor concentrations that have been demonstrated previously in animals exposed to cocaine self-administration (Letchworth et al, 2001; Moore et al, 1998a, 1998b; Nader et al, 2002) would be reversed following extended periods of abstinence. On the basis of studies in human drug users (cf Volkow et al, 1993), we hypothesized that these changes in the DA system would persist even after 3 months of abstinence. To this end, monkeys self-administered cocaine for 100 sessions, with total intakes of 900mg/kg, followed by either 30 or 90 days of abstinence from the drug. DA D1 and D2 receptors, as well as the DAT, were measured with quantitative in vitro receptor autoradiography.

Top

METHODS

Subjects

A total of 17 experimentally-naive adult male rhesus monkeys (Macaca mulatta) weighing between 7.7 and 13kg (mean±SD, 10.2±1.32) at the start of the study served as subjects. All procedures were performed in accordance with established practices as described in the National Institutes of Health Guide for Care and Use of Laboratory Animals. In addition, all procedures were reviewed and approved by the Animal Care and Use Committee of Wake Forest University. Monkeys were individually housed in stainless steel cages with water ad libitum; animals had physical and visual contact with each other. Their body weights were maintained at approximately 90–95% of free-feeding weights by banana-flavored pellets earned during the experimental sessions and by supplemental feeding of Lab Diet Monkey Chow, provided no sooner than 30min post-session. In addition, they were given fresh fruit or peanuts at least three times per week. Each monkey was weighed once a week, and if necessary, their diets were adjusted to maintain stable weights.

Behavioral Apparatus

Experimental sessions were conducted in ventilated and sound-attenuated operant chambers (1.5 × 0.74 × 0.76m; Med Associates Inc., East Fairfield, VT) designed to accommodate a primate chair (Model R001; Primate Products, Redwood City, CA). The chamber contained an intelligence panel (48 × 69cm), which consisted of two retractable levers (5cm wide) and three stimulus lights. The levers were positioned within easy reach of the monkey sitting in the primate chair. Banana-flavored food pellets (1g; Bio-Serv, Frenchtown, NJ) were delivered from a feeder located on top of the chamber. A peristaltic infusion pump (7531-10; Cole-Parmer Co., Chicago, IL) was used to deliver drug injections at a rate of approximately 1ml per 10s to those animals self-administering cocaine. Operation of the chambers and data acquisition was accomplished with a Power Macintosh computer system with an interface (Med Associates Inc.).

Surgical Procedures

All monkeys, including controls, were surgically prepared, under sterile conditions, with indwelling intravenous catheters and vascular access ports (Model GPV; Access Technologies, Skokie, IL). Monkeys were anesthetized with a combination of ketamine (15mg/kg, i.m.) and butorphanol (0.03mg/kg, i.m.) and an incision was made near the femoral vein. After blunt dissection and isolation of the vein, the proximal end of the catheter was inserted into the vein for a distance calculated to terminate in the inferior vena cava. The distal end of the catheter was threaded subcutaneously to an incision made slightly off the midline of the back. The vascular access port was placed within a pocket formed by blunt dissection near this incision. Monkeys were given 24–48h recovery time before returning to food-reinforced responding. Approximately 5 days before the terminal procedure, each monkey was implanted with a chronic indwelling catheter into the adjacent femoral artery for collection of timed arterial blood samples. The surgical procedures were identical to those described for the venous catheters. On the day of the final session, a terminal cerebral glucose metabolism study was conducted in which monkeys were injected with 2-[14C]deoxyglucose (2-DG) approximately 2min after the end of the session and blood samples were obtained through the arterial catheter over a 45min period (see Beveridge et al, 2006 for details). Metabolism data from these studies are not presented here.

Self-Administration Procedures

Monkeys were initially trained to respond on one of two levers by reinforcing each response on the correct lever with a food pellet. Over approximately a 3-week period the interval between availability of food pellets was gradually increased until a 3-min interval was achieved (ie fixed-interval 3-min schedule of reinforcement; FI 3-min). Under the final schedule conditions, the first response on the lever after 3min resulted in the delivery of a food pellet; sessions ended after 30 food presentations. At the end of each session, the response levers were retracted, houselights and stimulus lights were extinguished, and animals remained in the darkened chamber for approximately 30min before they were returned to their home cages. All monkeys responded under the FI 3-min schedule of food presentation for at least 20 sessions and until stable performance was obtained (±20% of the mean for three consecutive sessions, with no trends in response rates). When food-maintained responding was stable, the feeder was unplugged and the effects of extinction on responding were examined for five consecutive sessions, after which responding was reestablished and maintained by food presentation.

After baseline performance had been established, all monkeys were surgically prepared with venous catheters, as described above, and randomly assigned to one of three groups. One group of monkeys served as controls and continued to respond under the FI 3-min schedule of food presentation for a total of 100 sessions (N=6). The remaining 11 monkeys were assigned to the cocaine self-administration groups (0.3mg/kg per injection). Because 0.3mg/kg cocaine per injection was considered a high dose for previously cocaine-naive monkeys, for most animals this dose was achieved within two sessions by first allowing the monkey to self-administer 0.1mg/kg cocaine. Food-maintained performance was allowed to stabilize after surgery (approximately 4–6 days) before cocaine self-administration sessions were begun. Before each experimental session, the back of the animal was cleaned with 95% ethanol and betadine scrub and a 22 gauge Huber Point Needle (Model PG20-125) was inserted into the port leading to the venous catheter, connecting an infusion pump containing the cocaine solution to the catheter. Before the start of the session, the pump was operated for approximately 3s, filling the port with the dose of cocaine that was available during the experimental session. Sessions ended after 30 injections; as under control conditions, monkeys remained in the darkened chamber for approximately 30min. At the end of each session, the port was filled with heparinized saline (100U/ml) to help prevent clotting.

Experimental sessions were conducted at approximately the same time each day and continued for a total of 100 sessions. Following the completion of the 100 sessions, an abstinence period of 30 or 90 days was introduced during which time catheters were flushed daily with heparinized saline, but no cocaine or food self-administration sessions were conducted. For the control group, abstinence periods of 30 days were imposed in four animals and 90 days in the two others. For the cocaine group, abstinence periods of 30 days were imposed on eight animals and 90 days on three animals. At the end of the period of abstinence one final self-administration session (food control or cocaine) was conducted and the 2-DG procedure was initiated immediately following the session. In two controls and four cocaine self-administration animals in the 30-day abstinence group, no cocaine was received at the final session. Animals were humanely killed with an overdose of pentobarbital (100mg/kg, i.v.) at the end of the 45min tracer uptake period.

Tissue Processing

After killing, brains were immediately removed, blocked, and frozen in isopentane at −35 to −55°C and then stored at −80°C. The tissue blocks containing the striatum were then cut in a cryostat at −20°C in the coronal plane into 20μm sections, collected onto electrostatically charged slides, desiccated under a vacuum overnight at 4°C, then stored at −80°C until processed for autoradiography. Brain sections were collected from the portions of the caudate nucleus, putamen, and nucleus accumbens that lie rostral to the anterior commissure. This region is referred to as the precommissural striatum. Further, rostral and caudal levels of the precommissural striatum were designated with reference to the nucleus accumbens. The rostral precommissural striatum is the region where the nucleus accumbens is not differentiated into distinct shell and core subcompartments. The caudal precommissural striatum is the region congruent with the appearance of the shell and core of the nucleus accumbens, which is posterior to the emergence of the olfactory tubercle. For each of the binding studies, two adjacent sections were taken at each of five levels (two rostral and three caudal) through the precommissural striatum for a total of 10 sections per animal.

D1 Receptor Binding

DA D1 receptor binding site densities were determined with [3H]SCH 23390 (specific activity—85Ci/mmol; PerkinElmer, Boston, MA) by quantitative in vitro receptor autoradiography according to procedures adapted from Lidow et al (1991) and Nader et al (2002). Sections were preincubated for 20min in buffer (50mM Tris, 120mM NaCl, 5mM KCl, 2mM CaCl2, 1mM MgCl2, pH 7.4, 25°C) to remove endogenous DA, cocaine and [14C] from the 2-DG procedure. Sections were then incubated for 30min in the same buffer, pH 7.4, 25°C, containing 1mM ascorbic acid, 40nM ketanserin, and 1nM [3H]SCH 23390. After incubation, sections were rinsed twice for 20s in buffer containing 1mM ascorbic acid at pH 7.4, 4°C, then dipped in distilled water at 4°C, and dried under a stream of cool air. Nonspecific binding was defined by incubation of adjacent sections in the incubation solution in the presence of 5μM (+)-butaclamol. Sections, along with calibrated [3H] autoradiographic standards (Amersham, Piscataway, NJ), were apposed to Kodak Biomax MR film (Fisher Scientific, Pittsburgh, PA) for 6 weeks.

D2 Receptor Binding

The density and distribution of DA D2 receptor binding sites were determined with [3H]raclopride (specific activity, 87Ci/mmol; PerkinElmer) according to procedures adapted from Lidow et al (1991) and Nader et al (2002). Sections were preincubated for 20min in buffer (50mM Tris, 120mM NaCl, 5mM KCl, pH 7.4, 25°C) to remove endogenous DA, cocaine, and [14C] from the 2-DG procedure. Slides were then incubated for 30min in the same buffer, containing 5mM ascorbic acid and 2nM [3H]raclopride. Sections were rinsed 3 × 2min in buffer at pH 7.4, 4°C, then dipped in distilled water at 4°C, and dried under a stream of cool air. Nonspecific binding was defined by incubation of adjacent sections in the incubation solution in the presence of 1μM (+)–butaclamol. Sections, along with calibrated [3H] autoradiographic standards, were apposed to Kodak Biomax MR film for 8 weeks.

Dopamine Transporter Binding

The density of DAT binding sites was determined using [3H]WIN 35,428 (specific activity, 87Ci/mmol; PerkinElmer) autoradiography according to procedures adapted from Canfield et al (1990) and Letchworth et al (2001). Tissue sections were preincubated in buffer (50mM Tris, 100mM NaCl, pH 7.4, 4°C) for 20min to remove any residual DA, cocaine, and [14C] from the 2-DG procedure. Sections were then incubated for 2h at 4°C in the same buffer containing 5nM [3H]WIN 35 428. Sections were rinsed for a total of 2min in buffer at 4°C, then dipped in distilled water at 4°C, and dried under a stream of cold air. Nonspecific binding was defined by incubation of adjacent sections in the incubation solution in the presence of 30μM cocaine. Sections, along with calibrated [3H] autoradiographic standards, were apposed to Kodak Biomax MR film for 6 weeks.

Densitometry and Data Analysis

Films were developed with Kodak GBX developer, stopbath and Rapid Fixer (VWR, West Chester, PA), and then rinsed. Analysis of autoradiograms was conducted by quantitative densitometry with a computerized image processing system (MCID, Imaging Research; InterFocus Imaging Ltd, Cambridge, UK). Optical density values were converted to fmol/mg (of wet-weight tissue) by reference to the calibrated [3H] standards. Specific binding was determined by digitally subtracting images of nonspecific binding from superimposed adjacent images of total binding. Structures were identified by Nissl staining of sections adjacent to those analyzed for receptor binding. Data from each assay were analyzed independently by means of a one-way analysis of variance followed by least-square differences post hoc tests for multiple comparisons. Each region consisted a separate analysis. Because binding data obtained from the control animals abstinent for 30 and 90 days were not significantly different from one another, similar to previous studies (Nader et al, 2002), data from the control groups were combined. In addition, there were no significant differences between the data from those animals who received cocaine and those that did not at their final session, so data from these groups were also combined.

Top 

RESULTS

Effects of Abstinence from Chronic Cocaine Self-Administration for 30 Days

Concentrations of [3H]SCH 23390 binding to DA D1 receptors in the precommissural striatum are shown in Table 1. Specific binding of [3H]SCH 23390 accounted for greater than 90% of total binding. Consistent with previous reports (Moore et al, 1998a; Nader et al, 2002), the binding of [3H]SCH 23390 to D1 receptors in non-drug-exposed control animals was heterogeneous with appreciable differences in the degree of binding among subregions of the striatum. Labeling was denser in the more rostral and medial portions throughout the striatum.

 

After 30 days of abstinence from cocaine exposure, binding to D1 receptors was characterized by widespread elevations across the entire rostral-caudal extent of the precommissural striatum, when compared to binding densities in non-drug-exposed control animals (Table 1; Figure 1). In the more rostral striatum, concentrations were significantly higher in the caudate nucleus including the dorsolateral (+27%), central (+27%), dorsomedial (+27%), and ventromedial (+23%) portions, as well as in the dorsal (+17%), central (+22%), and ventral (+23%) portions of the putamen, when compared to the densities in non-drug-exposed controls animals. Significant elevations were also evident in the nucleus accumbens (+23%) at this level. At the level of the striatum where the core and shell of the nucleus accumbens are most differentiated, densities of D1-like receptors were also significantly higher throughout the dorsolateral (+31%), central (+29%), dorsomedial (+30%), and ventromedial (+18%) caudate nucleus, as well as the dorsal (+23%), central (+29%), and ventral (+28%) putamen, as compared to densities of non-drug-exposed controls. Within the ventral striatum at this level, the concentration of D1 receptor binding sites was higher in the nucleus accumbens core (+45%) and shell (+20%), as well as in the olfactory tubercle (+26%), as compared to the densities in controls.

Figure 1.

Figure 1 - Unfortunately we are unable to provide accessible alternative text for this. If you require assistance to access this image, please contact help@nature.com or the authorRepresentative autoradiograms of [3H] SCH 23390 binding to D1 receptors (top panel) and [3H]WIN 35428 binding to dopamine transporters (bottom panel) in coronal sections of rhesus monkey striatum. (a, d) Control animal responding for food reinforcement. (b, e) Cocaine self-administration animal with 30 days abstinence. (c, f) Cocaine self-administration animal with 90 days abstinence.

Full figure and legend (328K)

 

Concentrations of [3H]raclopride binding to DA D2 receptors in the precommissural striatum are shown in Table 2. Specific binding with [3H]raclopride accounted for greater than 90% of total binding. The distribution of [3H]raclopride binding to D2 receptors was also heterogeneous across subregions of the dorsal and ventral striatum as in previous reports (Moore et al, 1998b; Nader et al, 2002). In the non-drug-exposed controls, higher concentrations of D2 binding sites were present in the dorsal as compared to the ventral striatum. In addition, there was evidence of a medial to lateral gradient with the higher concentrations of binding sites present in the more lateral portions of the striatum.

 

After 30 days of abstinence, levels of D2 receptor binding in cocaine-exposed and food-reinforced animals were not significantly different from one another in most regions of the striatum. Higher concentrations of binding sites were observed in the ventral putamen (+10%) and anterior nucleus accumbens (+12%) in tissue from the cocaine-exposed monkeys compared to controls. No other significant differences were noted.

Concentrations of [3H]WIN 35428 binding to DAT in the precommissural striatum are shown in Table 3. Consistent with previous reports (Letchworth et al, 2001), binding to DAT sites in non-drug-exposed animals was higher in dorsal as compared to ventral striatum. Within the nucleus accumbens, higher densities were observed in the core as compared to the shell divisions. Finally, nonspecific binding accounted for less than 10% of the total.

 

After 30 days of abstinence from cocaine exposure, binding to the DAT was significantly higher throughout the majority of regions of the striatum rostral to the anterior commissure when compared to binding in non-drug-exposed control animals (Figure 1). Specifically, the concentrations of DAT binding sites at rostral levels were significantly higher in central (+22%), dorsomedial (+25%), and ventromedial (+28%) caudate nucleus, and in the dorsal (+16%) and central (+23%) putamen, compared to food-reinforced controls. In addition, there was also significantly higher binding to DAT in the anterior nucleus accumbens (+37%) in cocaine- compared to food-reinforced monkeys. Within the more caudal portions of the precommissural striatum, densities of DAT binding sites were significantly higher in the central caudate nucleus (+21%), and putamen, central (+20%) and ventral (+19%; Figure 1). Within the ventral striatum at this level, binding to DAT was significantly higher in the nucleus accumbens core (+20%) and olfactory tubercle (+24%) in tissue from cocaine- vs food-reinforced monkeys.

Effects of Abstinence from Chronic Cocaine Self-Administration for 90 Days

In contrast to the widespread differences in the density of D1 receptor binding sites observed in cocaine-exposed animals following 30 days of abstinence, after 90 days of abstinence, there were no significant differences when compared to food-reinforced controls in any portion of the precommissural striatum (Table 1; Figure 1). Similarly, concentrations of [3H]raclopride binding to DA D2 receptors in the precommissural striatum after 90 days of abstinence were also not significantly different from those in non-drug-exposed animals (Table 2).

The concentrations of [3H]WIN 35428 binding to DAT exhibited a similar pattern to that observed with D1 and D2 receptors. There were no significant differences in the density of DAT between cocaine-exposed monkeys following 90 days of abstinence as compared to levels in non-drug-exposed controls (Table 3; Figure 1), although it should be noted that there was a trend toward higher levels of binding in the anterior nucleus accumbens.

Top 

DISCUSSION

Previous studies from our group have shown that chronic exposure to cocaine self-administration is accompanied by significant dysregulation of the DA system of nonhuman primates (Letchworth et al, 2001; Moore et al, 1998a, 1998b; Nader et al, 2002, 2006). The results of the present study demonstrate that this dysregulation remains evident after cessation of cocaine exposure. Following 30 days of abstinence, the concentrations of DA D1 receptors and the DAT were significantly elevated throughout the striatum of monkeys with histories of chronic cocaine self-administration when compared to food-reinforced controls. However, the present study also provides clear evidence for recovery within the DA system after more prolonged periods of abstinence (90 days), as evidenced by the lack of significant differences between cocaine-exposed and controls animals at this time point. These data suggest that cocaine exposure may not produce permanent alterations in the DA system, but that recovery may occur with prolonged abstinence from drug use.

The dysregulation of DAT concentrations shown here following abstinence is consistent with previous reports in nonhuman primates (Letchworth et al, 2001), which showed significant elevations in the densities of DAT binding sites in both ventral and dorsal striatum. Although not explicitly tested, it appears that after cessation of drug exposure the elevations in DAT binding site density are at least as great in magnitude and more widespread across the regions of the striatum than those reported without any withdrawal period (Letchworth et al, 2001). Similarly, the elevated concentrations of D1 receptor binding sites observed here following 30 days of abstinence are also consistent with previous studies that showed increased D1-like receptor binding densities in the striatum of nonhuman primates exposed to an identical regimen of cocaine self-administration (Nader et al, 2002). In contrast there were no significant differences observed between the levels of D2-like receptor binding densities in the striatum of cocaine-exposed and control animals. This lack of dysregulation was present, despite the large decreases in the concentrations of D2 receptors that have been reported in both human addicts (Volkow et al, 1993) and animal models of cocaine self-administration (Moore et al, 1998a, 1998b; Nader et al, 2002, 2006). The present data, then, suggest a more rapid normalization to control levels in this system as compared to D1-like receptors and the DAT. Taken together, the changes in DA receptors and the DAT clearly show that the period immediately following cessation of cocaine self-administration is highly labile with considerable changes in the regulation of the DA system taking place, but that this is followed by re-regulation of the system approaching a more normal distribution of DA receptors and the DAT after more prolonged abstinence.

D1 Receptor Changes

The widespread elevations in the density of D1 receptors observed here after the cessation of cocaine use are consistent with reports demonstrating an increased sensitivity of D1 receptors during withdrawal. Measurement of D1 sensitivity was undertaken in a study by Henry and White (1991), in which single unit recordings of neurons in the nucleus accumbens were found to be more sensitive to the D1 receptor agonist SKF 38393 following chronic daily injections of cocaine compared to saline-treated controls. This effect was persistent, in that increased sensitivity remained evident up to one month into withdrawal. The authors hypothesized that the D1 receptor sensitization was due to D2 autoreceptor subsensitivity in the somatodendritic A10 area, thereby reducing inhibitory impulse flow throughout the mesoaccumbens DA system (Henry and White, 1991). The data from the present study suggest increased D1 receptor binding sites in abstinence, which could explain this increased sensitivity of dopaminergic neurons to a direct-acting D1 receptor agonist. Furthermore, the enhanced effect of SKF 38393 on nucleus accumbens neurons was not apparent two months following withdrawal, suggesting that there was recovery of the D1 receptor sensitivity (Henry and White, 1991); an outcome consistent with the recovery of D1 receptor densities noted in the present study after 90 days of abstinence. Other reports also support an important role for D1 receptors in relapse. The direct stimulation of D1 receptors in the shell of the nucleus accumbens can reinstate cocaine seeking in abstinent rodents (Schmidt et al, 2006). However, the literature is somewhat inconsistent in that both D1 agonists and antagonists can attenuate drug seeking elicited by cocaine primes or cocaine-related stimuli (Alleweireldt et al, 2002; De Vries et al, 1999; Khroyan et al, 2000; Self et al, 1996; Weiss et al, 2001). Recently, Khroyan et al (2003) reported that D1 agonists and antagonists reduce relapse in a nonhuman primate model of cocaine seeking. These authors suggested that there may be a critical range of D1 receptor activity necessary for cocaine seeking, and that both antagonists and agonists could shift activity out of this window. The increased concentrations of D1 receptors that accompany abstinence might modify this range, resulting in an alteration in the sensitivity of this system. Another consideration is that D1 activity may act to modulate activity at D2 receptors (Nolan et al, 2007; Ruskin et al, 1999; Walters et al, 1987). The present data suggest that the ratio of D1 to D2 receptors shifts during the course of abstinence and may thereby alter the efficacy of this modulation.

Although, in contrast to the present data, there have been reports of decreased levels of D1 receptors following chronic cocaine self-administration (Moore et al, 1998a), considerable differences exist between these studies, such as dose and length of exposure to cocaine, total intake, and comparative control groups. Taken together, therefore, converging evidence strongly indicates that the D1 system is in considerable flux following withdrawal from chronic cocaine administration.

Dopamine Transporter Changes

The findings of elevated concentrations of DAT across the striatum of cocaine-exposed animals after cessation of drug use extend those of our previous studies showing increased levels of DAT binding sites that accompany cocaine self-administration in nonhuman primates. The present data demonstrate that this dysregulation persists during the initial phases of abstinence. Furthermore, they suggest that recovery to control levels follows a relatively long time course (up to 90 days in the present study). In our previous studies we showed that although initially restricted to largely ventral striatal regions, changes in the density of DAT binding sites expanded to encompass more dorsal and rostral portions of the striatum with longer periods of exposure to cocaine (Letchworth et al, 2001; Porrino et al, 2004). In the present study the return to control levels of DAT concentrations during abstinence appeared to be greater and more rapid in the dorsal striatum than in the ventral striatum, and thus seemed to follow a reverse anatomical trajectory to the pattern of effects induced by chronic cocaine exposure.

The present data are also consistent with reports in human cocaine users (Little et al, 1999; Malison et al, 1998; Mash et al, 2002; Staley et al, 1994) that have shown elevated levels of binding to DAT sites in the striatum compared to controls, with the most marked increases located in the ventral striatum. Recently, these elevations have been shown to be accompanied by significant decreases in vesicular monoamine transporter 2 (VMAT2) binding (Little et al, 2003), suggestive of an actual loss of DA neurons. The authors concluded that the elevated DAT was likely directly due to a compensatory response to the pharmacological blockade by cocaine, whereas the decreases in VMAT2 more likely reflected overall changes in DA metabolism, resulting in hypodopaminergic function.

Human cocaine addicts have been reported to have reduced DA concentrations in the ventral striatum, as measured with PET, in response to methylphenidate challenge when compared to healthy controls (Volkow et al, 1997). Recently, Martinez et al (2007) reported that cocaine users had a blunted response to an amphetamine challenge in the ventral striatum and putamen. Furthermore, this decrease in amphetamine-induced DA release was correlated with the choice for cocaine in separate self-administration sessions, such that those users with the lowest degree of DA release in response to amphetamine were most likely to choose cocaine over an alternative reinforcer (Martinez et al, 2007). Recent studies in rodent models of cocaine use support this idea as well. Mateo et al (2005), for example, reported that exposure to chronic cocaine self-administration is associated with alterations in DAT function. These investigators showed that baseline DA uptake was increased, resulting in more rapid clearance of synaptic DA, and therefore, decreased basal levels of extracellular DA, or a hypodopaminergic state. Thus, it is likely that the increased DAT concentrations following withdrawal from chronic cocaine self-administration observed in the present study represent a compensatory response, resulting in lower baseline levels of extracellular DA.

D2 Receptor Changes

One result from the present study was that the concentrations of D2 receptor levels had returned to control values following 30 days of abstinence, compared to the significant decreases observed in animals with no withdrawal period (Nader et al, 2002). In contrast to the present investigation, human imaging studies have generally found that D2 receptor levels are lower than those of controls following prolonged abstinence from chronic cocaine exposure (Martinez et al, 2004; Volkow et al, 1993). Potential explanations of the differences between these human studies and the present nonhuman primate investigation include differences in the pattern and duration of cocaine intake, as well as the possibility of preexisting lower levels of D2 receptors in human addicts.

Consistent with the latter idea, there is evidence to suggest that lower basal levels of D2 receptors in healthy humans predict increased reinforcing efficacy of stimulants such as methylphenidate (Volkow et al, 1999), and similarly in monkeys, baseline levels of D2 receptors predicted the propensity to self-administer cocaine (Morgan et al, 2002; Nader et al, 2006). In keeping with the parallel nature of these findings across species, both human (Volkow et al, 1993) and nonhuman primate (Nader et al, 2006) imaging studies have demonstrated lower levels of D2 receptor availability following abstinence from cocaine exposure. Notably, the schedule of cocaine self-administration in the latter experiment (Nader et al, 2006) was similar to the schedule of reinforcement used in this study. Thus, the dissimilar outcomes from these two studies are unlikely to have been due to methodological differences, such as the schedule of reinforcement or cumulative intake during cocaine self-administration.

A more likely explanation involves the functional dynamics of the DA system. Measures of D2 receptor availability with PET have been described as ‘functional’ because the signal is related to the amount of protein (in this case densities of D2 receptors) and the levels of circulating neurotransmitter (see Laruelle, 2000; Nader and Czoty, 2008 for further discussion). In contrast, receptor autoradiography is uncontaminated by circulating levels of DA. Thus, the present study, along with our earlier work, suggests that D2 receptor densities are decreased by cocaine self-administration, but the receptor levels appear to recover during abstinence. In a similarly conducted PET study (Nader et al, 2006), recovery was noted in three of five monkeys. The present findings suggest that these monkeys were probably not different in D2 receptor densities, but perhaps the responsiveness of the DA system (ie levels of circulating DA during abstinence) differentiated between ‘recovered’ and ‘nonrecovered’ subjects.

Limitations

One important limitation of the current studies is that our studies cannot address the functionality of the D1 and D2 receptors or of the DAT. Rather we examined only the changes in the density of receptor proteins. Although the results have implications for the potential roles of these systems, further studies will be required to shed light on the behavioral consequences of the changes shown here. Another limitation of the present study is that autoradiographic ligands often fail to dissociate between intracellular and cytoplasmic locations of their targets, as radiolabeled antagonists are often membrane permeable. Little et al (2002) demonstrated that chronic exposure to cocaine leads to a significant upregulation of DAT at the membrane surface, concurrent with a decrease in the intracellular DAT concentration, in transfected cells. Recently, Samuvel et al (2008) reported a similar finding in rat striatal synaptosomal preparations. These results suggest that the alterations in the DAT distribution observed in the present study may represent changes at the membrane surface, rather than intracellular sites.

Finally, some caution should be given to the interpretation of the studies of prolonged (90 days) abstinence, as these findings were based on a relatively small group of animals (N=3). Despite the small number of subjects, the data obtained from this group were rather consistent, as can be seen in a scatter plot shown in Figure 2. The concentration of D1 receptor binding sites across the striatum showed little variability within groups, suggesting the reliability of these findings. Similar consistency was also evident in data from D2 receptor and DAT binding assays. Although caution should be exercised, these data strongly suggest that restoration of concentrations of DAT and DA receptors within the striatum can occur with prolonged abstinence.

Figure 2.

Figure 2 - Unfortunately we are unable to provide accessible alternative text for this. If you require assistance to access this image, please contact help@nature.com or the authorBinding densities of D1 receptors for individual animals averaged across the entire striatum following either food reinforcement (controls), or 30 or 90 days abstinence from chronic cocaine self-administration. Means for groups are depicted with black bars, ***p<0.001 compared to food-reinforced controls.

Full figure and legend (9K)

Top 

CONCLUSIONS

In conclusion, exposure to cocaine self-administration produced significant alterations in the regulation of DA systems that persisted during the early phases (first 30 days) of abstinence. This was most evident in the regulation of the concentration of D1 receptors and the DAT, both in terms of their magnitude of alterations and their topographical extent. In contrast, there was evidence for normalization with longer durations of abstinence from cocaine exposure, in that the concentrations of DAT, D1, and D2 receptors after 90 days of abstinence did not differ from those of non-drug-exposed controls. These systems, however, do not necessarily follow the same temporal course of recovery, suggesting that there is likely to be some instability in the regulation of DA levels particularly early in abstinence. This dopaminergic dysregulation may impact the effectiveness of any potential pharmacotherapy administered to abstinent cocaine addicts, particularly if the medication relies on the DA system for its mechanism of action.

Top 

Notes

DISCLOSURE/CONFLICT OF INTEREST

The authors have no conflict of interest to disclose.

Top 

References

  1. Alleweireldt AT, Weber SM, Kirschner KF, Bullock BL, Neisewander JL (2002). Blockade or stimulation of D1 dopamine receptors attenuates cue reinstatement of extinguished cocaine-seeking behavior in rats. Psychopharmacology (Berl) 159: 284–293. | Article | PubMed | ChemPort |
  2. Beveridge TJ, Smith HR, Daunais JB, Nader MA, Porrino LJ (2006). Chronic cocaine self-administration is associated with altered functional activity in the temporal lobes of non human primates. Eur J Neurosci 23: 3109–3118. | Article | PubMed |
  3. Canfield DR, Spealman RD, Kaufman MJ, Madras BK (1990). Autoradiographic localization of cocaine binding sites by [3H]CFT ([3H]WIN 35428) in the monkey brain. Synapse 6: 189–195. | Article | PubMed | ChemPort |
  4. De Vries TJ, Schoffelmeer AN, Binnekade R, Vanderschuren LJ (1999). Dopaminergic mechanisms mediating the incentive to seek cocaine and heroin following long-term withdrawal of IV drug self-administration. Psychopharmacology (Berl) 143: 254–260. | Article | PubMed | ChemPort |
  5. Farfel GM, Kleven MS, Woolverton WL, Seiden LS, Perry BD (1992). Effects of repeated injections of cocaine on catecholamine receptor binding sites, dopamine transporter binding sites and behavior in rhesus monkey. Brain Res 578: 235–243. | Article | PubMed | ChemPort |
  6. Graham J, Porrino LJ (1995). Neuroanatomical Substrates of Cocaine Self-Administration. CRC: Boca Raton, FL.
  7. Hemby SE, Co C, Koves TR, Smith JE, Dworkin SI (1997). Differences in extracellular dopamine concentrations in the nucleus accumbens during response-dependent and response-independent cocaine administration in the rat. Psychopharmacology (Berl) 133: 7–16. | Article | PubMed | ChemPort |
  8. Henry DJ, White FJ (1991). Repeated cocaine administration causes persistent enhancement of D1 dopamine receptor sensitivity within the rat nucleus accumbens. J Pharmacol Exp Ther 258: 882–890. | PubMed | ChemPort |
  9. Jacobsen LK, Staley JK, Malison RT, Zoghbi SS, Seibyl JP, Kosten TR et al (2000). Elevated central serotonin transporter binding availability in acutely abstinent cocaine-dependent patients. Am J Psychiatry 157: 1134–1140. | Article | PubMed | ISI | ChemPort |
  10. Khroyan TV, Barrett-Larimore RL, Rowlett JK, Spealman RD (2000). Dopamine D1- and D2-like receptor mechanisms in relapse to cocaine-seeking behavior: effects of selective antagonists and agonists. J Pharmacol Exp Ther 294: 680–687. | PubMed | ISI | ChemPort |
  11. Khroyan TV, Platt DM, Rowlett JK, Spealman RD (2003). Attenuation of relapse to cocaine seeking by dopamine D1 receptor agonists and antagonists in non-human primates. Psychopharmacology (Berl) 168: 124–131. | Article | PubMed | ChemPort |
  12. Laruelle M (2000). Imaging synaptic neurotransmission with in vivo binding competition techniques: a critical review. J Cereb Blood Flow Metab 20: 423–451. | Article | PubMed | ISI | ChemPort |
  13. Letchworth SR, Nader MA, Smith HR, Friedman DP, Porrino LJ (2001). Progression of changes in dopamine transporter binding site density as a result of cocaine self-administration in rhesus monkeys. J Neurosci 21: 2799–2807. | PubMed | ISI | ChemPort |
  14. Lidow MS, Goldman-Rakic PS, Gallager DW, Rakic P (1991). Distribution of dopaminergic receptors in the primate cerebral cortex: quantitative autoradiographic analysis using [3H]raclopride, [3H]spiperone and [3H]SCH 23390. Neuroscience 40: 657–671. | Article | PubMed | ChemPort |
  15. Little KY, Elmer LW, Zhong H, Scheys JO, Zhang L (2002). Cocaine induction of dopamine transporter trafficking to the plasma membrane. Mol Pharmacol 61: 436–445. | Article | PubMed | ISI | ChemPort |
  16. Little KY, Krolewski DM, Zhang L, Cassin BJ (2003). Loss of striatal vesicular monoamine transporter protein (VMAT2) in human cocaine users. Am J Psychiatry 160: 47–55. | Article | PubMed |
  17. Little KY, Zhang L, Desmond T, Frey KA, Dalack GW, Cassin BJ (1999). Striatal dopaminergic abnormalities in human cocaine users. Am J Psychiatry 156: 238–245. | PubMed | ChemPort |
  18. Malison RT, Best SE, van Dyck CH, McCance EF, Wallace EA, Laruelle M et al (1998). Elevated striatal dopamine transporters during acute cocaine abstinence as measured by [123I] beta-CIT SPECT. Am J Psychiatry 155: 832–834. | PubMed | ChemPort |
  19. Martinez D, Broft A, Foltin RW, Slifstein M, Hwang DR, Huang Y et al (2004). Cocaine dependence and d2 receptor availability in the functional subdivisions of the striatum: relationship with cocaine-seeking behavior. Neuropsychopharmacology 29: 1190–1202. | Article | PubMed | ISI | ChemPort |
  20. Martinez D, Narendran R, Foltin RW, Slifstein M, Hwang DR, Broft A et al (2007). Amphetamine-induced dopamine release: markedly blunted in cocaine dependence and predictive of the choice to self-administer cocaine. Am J Psychiatry 164: 622–629. | Article | PubMed | ISI |
  21. Mash DC, Pablo J, Ouyang Q, Hearn WL, Izenwasser S (2002). Dopamine transport function is elevated in cocaine users. J Neurochem 81: 292–300. | Article | PubMed | ChemPort |
  22. Mateo Y, Lack CM, Morgan D, Roberts DC, Jones SR (2005). Reduced dopamine terminal function and insensitivity to cocaine following cocaine binge self-administration and deprivation. Neuropsychopharmacology 30: 1455–1463. | Article | PubMed | ISI | ChemPort |
  23. Melega WP, Jorgensen MJ, Lacan G, Way BM, Pham J, Morton G et al (2008). Long-term methamphetamine administration in the vervet monkey models aspects of a human exposure: brain neurotoxicity and behavioral profiles. Neuropsychopharmacology 33: 1441–1452. | Article | PubMed | ChemPort |
  24. Moore RJ, Vinsant SL, Nader MA, Porrino LJ, Friedman DP (1998a). Effect of cocaine self-administration on striatal dopamine D1 receptors in rhesus monkeys. Synapse 28: 1–9. | Article | PubMed | ChemPort |
  25. Moore RJ, Vinsant SL, Nader MA, Porrino LJ, Friedman DP (1998b). Effect of cocaine self-administration on dopamine D2 receptors in rhesus monkeys. Synapse 30: 88–96. | Article | PubMed | ChemPort |
  26. Morgan D, Grant KA, Gage HD, Mach RH, Kaplan JR, Prioleau O et al (2002). Social dominance in monkeys: dopamine D2 receptors and cocaine self-administration. Nat Neurosci 5: 169–174. | Article | PubMed | ISI | ChemPort |
  27. Nader MA, Czoty PW (2008). Brain imaging in nonhuman primates: insights into drug addiction. ILAR J 49: 89–102. | PubMed | ChemPort |
  28. Nader MA, Daunais JB, Moore T, Nader SH, Moore RJ, Smith HR et al (2002). Effects of cocaine self-administration on striatal dopamine systems in rhesus monkeys: initial and chronic exposure. Neuropsychopharmacology 27: 35–46. | Article | PubMed | ISI | ChemPort |
  29. Nader MA, Morgan D, Gage HD, Nader SH, Calhoun TL, Buchheimer N et al (2006). PET imaging of dopamine D2 receptors during chronic cocaine self-administration in monkeys. Nat Neurosci 9: 1050–1056. | Article | PubMed | ChemPort |
  30. Nolan EB, Harrison LM, Lahoste GJ, Ruskin DN (2007). Behavioral synergism between D(1) and D(2) dopamine receptors in mice does not depend on gap junctions. Synapse 61: 279–287. | Article | PubMed | ChemPort |
  31. Porrino LJ, Lyons D, Miller MD, Smith HR, Friedman DP, Daunais JB et al (2002). Metabolic mapping of the effects of cocaine during the initial phases of self-administration in the nonhuman primate. J Neurosci 22: 7687–7694. | PubMed | ChemPort |
  32. Porrino LJ, Lyons D, Smith HR, Daunais JB, Nader MA (2004). Cocaine self-administration produces a progressive involvement of limbic, association, and sensorimotor striatal domains. J Neurosci 24: 3554–3562. | Article | PubMed | ISI | ChemPort |
  33. Ruskin DN, Bergstrom DA, Walters JR (1999). Multisecond oscillations in firing rate in the globus pallidus: synergistic modulation by D1 and D2 dopamine receptors. J Pharmacol Exp Ther 290: 1493–1501. | PubMed | ISI | ChemPort |
  34. Samuvel DJ, Jayanthi LD, Manohar S, Kaliyaperumal K, See RE, Ramamoorthy S (2008). Dysregulation of dopamine transporter trafficking and function after abstinence from cocaine self-administration in rats: evidence for differential regulation in caudate putamen and nucleus accumbens. J Pharmacol Exp Ther 325: 293–301. | Article | PubMed | ChemPort |
  35. Schmidt HD, Anderson SM, Pierce RC (2006). Stimulation of D1-like or D2 dopamine receptors in the shell, but not the core, of the nucleus accumbens reinstates cocaine-seeking behaviour in the rat. Eur J Neurosci 23: 219–228. | Article | PubMed |
  36. Self DW, Barnhart WJ, Lehman DA, Nestler EJ (1996). Opposite modulation of cocaine-seeking behavior by D1- and D2-like dopamine receptor agonists. Science 271: 1586–1589. | Article | PubMed | ISI | ChemPort |
  37. Staley JK, Hearn WL, Ruttenber AJ, Wetli CV, Mash DC (1994). High affinity cocaine recognition sites on the dopamine transporter are elevated in fatal cocaine overdose victims. J Pharmacol Exp Ther 271: 1678–1685. | PubMed | ChemPort |
  38. Volkow ND, Fowler JS, Wang GJ, Hitzemann R, Logan J, Schlyer DJ et al (1993). Decreased dopamine D2 receptor availability is associated with reduced frontal metabolism in cocaine abusers. Synapse 14: 169–177. | Article | PubMed | ISI | ChemPort |
  39. Volkow ND, Wang GJ, Fowler JS, Logan J, Gatley SJ, Gifford A et al (1999). Prediction of reinforcing responses to psychostimulants in humans by brain dopamine D2 receptor levels. Am J Psychiatry 156: 1440–1443. | PubMed | ISI | ChemPort |
  40. Volkow ND, Wang GJ, Fowler JS, Logan J, Gatley SJ, Hitzemann R et al (1997). Decreased striatal dopaminergic responsiveness in detoxified cocaine-dependent subjects. Nature 386: 830–833. | Article | PubMed | ISI | ChemPort |
  41. Walters JR, Bergstrom DA, Carlson JH, Chase TN, Braun AR (1987). D1 dopamine receptor activation required for postsynaptic expression of D2 agonist effects. Science 236: 719–722. | Article | PubMed | ChemPort |
  42. Weiss F, Martin-Fardon R, Ciccocioppo R, Kerr TM, Smith DL, Ben-Shahar O (2001). Enduring resistance to extinction of cocaine-seeking behavior induced by drug-related cues. Neuropsychopharmacology 25: 361–372. | Article | PubMed | ISI | ChemPort |
  43. Wong DF, Kuwabara H, Schretlen DJ, Bonson KR, Zhou Y, Nandi A et al (2006). Increased occupancy of dopamine receptors in human striatum during cue-elicited cocaine craving. Neuropsychopharmacology 31: 2716–2727. | Article | PubMed | ChemPort |

 

Caffeine increases striatal dopamine D2/D3 receptor availability in the human brain (2015)

Citation: Translational Psychiatry (2015) 5, e549; doi:10.1038/tp.2015.46

Published online 14 April 2015

N D Volkow1, G-J Wang1, J Logan2, D Alexoff2, J S Fowler2, P K Thanos2, C Wong1, V Casado3, S Ferre4 and D Tomasi1

  1. 1Intramural Research Program, National Institute on Alcohol Abuse and Alcoholism, Bethesda, MD, USA
  2. 2Brookhaven National Laboratory, Upton, NY, USA
  3. 3Department of Biochemistry and Molecular Biology, University of Barcelona, Barcelona, Spain
  4. 4Intramural Research Program, National Institute on Drug Abuse, Baltimore, MD, USA

Correspondence: Dr ND Volkow, Intramural Research Program, National Institute on Drug Abuse, 6001 Executive Boulevard, Room 5274, Bethesda, MD 20892, USA. E-mail: nvolkow@nida.nih.gov

Received 29 December 2014; Accepted 10 February 2015

Top of page

Abstract

Caffeine, the most widely consumed psychoactive substance in the world, is used to promote wakefulness and enhance alertness. Like other wake-promoting drugs (stimulants and modafinil), caffeine enhances dopamine (DA) signaling in the brain, which it does predominantly by antagonizing adenosine A2A receptors (A2AR). However, it is unclear if caffeine, at the doses consumed by humans, increases DA release or whether it modulates the functions of postsynaptic DA receptors through its interaction with adenosine receptors, which modulate them. We used positron emission tomography and [11C]raclopride (DA D2/D3 receptor radioligand sensitive to endogenous DA) to assess if caffeine increased DA release in striatum in 20 healthy controls. Caffeine (300 mg p.o.) significantly increased the availability of D2/D3 receptors in putamen and ventral striatum, but not in caudate, when compared with placebo. In addition, caffeine-induced increases in D2/D3 receptor availability in the ventral striatum were associated with caffeine-induced increases in alertness. Our findings indicate that in the human brain, caffeine, at doses typically consumed, increases the availability of DA D2/D3 receptors, which indicates that caffeine does not increase DA in the striatum for this would have decreased D2/D3 receptor availability. Instead, we interpret our findings to reflect an increase in D2/D3 receptor levels in striatum with caffeine (or changes in affinity). The association between increases in D2/D3 receptor availability in ventral striatum and alertness suggests that caffeine might enhance arousal, in part, by upregulating D2/D3 receptors.

Top of page

Introduction

Caffeine is the most widely consumed psychoactive substance.1 Its behavioral arousing pharmacological effects are similar to those of stimulant drugs (amphetamine and methylphenidate) and modafinil, which are drugs that increase dopamine (DA) signaling by blocking DA transporters and/or enhancing DA release from the terminals.2, 3, 4 The DA-enhancing effects of these drugs underlie their arousing5, 6 and reinforcing effects.7, 8, 9, 10 In contrast, preclinical studies indicate that caffeine’s pharmacological effects are mediated by its antagonism of adenosine receptors (A1 and A2A subtypes).11 In particular, its antagonism of A2A receptors (A2AR) in striatum has been implicated in its dopaminergic effects.12 Similarly, caffeine-induced increases in locomotor activity13 and arousal14 appear to be mediated by A2AR as they are absent in A2AR knockout mice, and silencing the expression of A2AR with short-hairpin RNA in the nucleus accumbens interferes with caffeine’s effects on wakefulness.15

The striatum expresses high levels of A2AR where they are co-expressed with postsynaptic D2 receptors (D2R) forming A2AR-D2R heteromers.16, 17, 18 Through allosteric and second-messenger interactions adenosine inhibits D2R signaling. Thus, in striatal neurons, A2AR agonists decrease D2R agonist binding.19 Caffeine, by blocking A2AR, could enhance DA signaling through the unopposed D2R.20 Though it was initially postulated that caffeine antagonism of adenosine A1 receptors resulted in DA increases in the nucleus accumbens,21 this finding was only obtained after very high doses of caffeine and was not corroborated by others.22, 23 Furthermore, a brain imaging study with [11C]raclopride, which is a radioligand that competes with endogenous DA for binding to D2 and D3 receptors (D2/D3R), showed that oral caffeine (200 mg) increased its binding in striatum,24 which is inconsistent with DA increases. However, the small sample size from the study (n=8) precludes its generalizability. Thus, the question of whether caffeine increases striatal DA and the mechanism(s) of action for caffeine’s alerting effects in the human brain remain unclear.

To assess whether caffeine increases DA in the human brain, we used positron emission tomography (PET) and [11C]raclopride25 and tested 20 healthy controls once with placebo and once with oral caffeine. A 300-mg dose of caffeine was selected to reflect the average amount of caffeine in 2–3 cups of coffee. We hypothesized that caffeine would not increase DA in striatum but instead would enhance striatal DA signaling by increasing D2R.

Top of page

Materials and methods

Subjects

This study included 20 healthy male controls (38±8 years of age, body mass index 26±3; years of education 14±2) recruited through advertisements in local newspapers. Exclusion criteria included consumption of more than two caffeine beverages per day, current or past psychiatric disease as per DSM IV including any substance use disorder (smokers were excluded); past or present history of neurological, cardiovascular or endocrinological disease; history of head trauma with loss of consciousness greater than 30 min; and current medical illness. Seventeen of the participants reported that they did not drink coffee (or caffeinated beverages), one reported one cup a day and two reported two cups a day. Written informed consent was obtained from all the subjects and the studies were reviewed and approved by the Institutional Review Board at Stony Brook University Medical Center.

Self-reports and scales and cardiovascular measures

To study the behavioral effects of caffeine, we assessed self-reports for subjective perception of ‘alertness’, ‘tiredness’, ‘sleepiness’ and ‘mood’ using analog scales (rated from 1 to 10) that were obtained before and at 30 and 120 min after placebo or caffeine administration, as previously described.26 The use of analog scales to assess self-reports of drug effects have been shown to be reproducible and to predict drug responses.27 For the correlation analysis, we used the measures obtained 120 min after caffeine administration (at the end of the [11C]raclopride scan), which is within the time for peak caffeine effects (60–120 min).28

Heart rate and blood pressure were recorded three times at five-minute intervals before the administration of placebo or caffeine and periodically thereafter until 120 min post placebo or post caffeine. The measures taken before placebo or caffeine were averaged (pre-drug measures) and those taken 60–120 min post administration were averaged as post-drug measures. Effects of the drug were evaluated as paired t-test comparisons between the pre- and the post-drug measures.

Measures of caffeine in plasma

Venous blood was drawn before and at 30, 60 and 120 min after caffeine administration. Caffeine in plasma was quantified using high-performance liquid chromatography.29

PET scan

We used an HR+ tomography (resolution 4.5 × 4.5 × 4.5 mm full width at half maximum, 63 slices) with [11C]raclopride 4–8 mCi (specific activity 0.5–1.5 Ci μM−1 at the end of bombardment). The procedures for imaging were as previously described.30 Briefly, 20 dynamic emission scans were obtained immediately after injection for a total of 54 min. The participants were scanned with [11C]raclopride twice, once with placebo and once with caffeine; the placebo scans were done 2 h before the caffeine scan. Caffeine (300 mg) and placebo (sugar tablet) were administered orally 60 min before the [11C]raclopride injection. We chose 60 min as peak effects from oral caffeine occur at ~60 min when it is administered as a tablet.28 The half life of caffeine in plasma is ~3–5 h,31 so this time point ensured high plasma caffeine levels during the PET measurements (60–120 min post caffeine).

PET image analysis

We analyzed the nondisplaceable binding potential (BPND) images using Statistical Parametric Mapping (SPM8; Wellcome Trust Centre for Neuroimaging, London, UK), which enabled us to make comparisons on a pixel-by-pixel basis.32 Specifically, we estimated for each voxel the distribution volume ratio, which corresponds to the equilibrium measurement of the ratio of the radiotracer’s tissue concentration in the striatum to that in the cerebellum, which is used as a reference region.33 These images were then spatially normalized to the stereotactic space of the Montreal Neurological Institute using a 12-parameter affine transformation and 2-mm isotropic voxels. A custom Montreal Neurological Institute template, which was previously developed using images from 34 healthy subjects acquired with [11C]raclopride and the same PET scanning sequence,34 was used for the spatial normalization of the distribution volume ratio images. The voxels of the distribution volume ratio images correspond to BPND +1.

An independent region-of-interest (ROI) analysis was performed using preselected ROIs in caudate, putamen and ventral striatum (VS) as previously described25 to corroborate the SPM findings. The ROI measures were used for the correlation analysis with the behavioral measures that were significantly affected by caffeine and to assess the correlations with the levels of caffeine in plasma.

Statistical analyses

The brain maps (BPND) were spatially smoothed in SPM8 using an 8-mm isotropic Gaussian kernel to minimize the effects associated with the variability of the brain anatomy across subjects. A striatal mask (dorsal striatum and VS) was created using the digital anatomical brain atlases provided with the MRIcro software (www.cabiatl.com/mricro/). Specifically, the voxels corresponding to striatum (caudate, putamen and VS) were defined in the Montreal Neurological Institute stereotactic space using the Automated Anatomical Labeling atlas.35 One-way (within-subjects) analysis of variance was used to assess drug effects (placebo vs caffeine) on BPND with SPM8. Statistical significance was set by the stringent threshold PFWE<0.05, corrected for multiple comparisons at the voxel level (within a striatal mask) using the random field theory with a family-wise error correction. For visualization purposes regarding the MRI location of the regions that differed significantly between placebo and caffeine, we used an uncorrected threshold of P<0.01.

For the independent ROI analysis, statistical significance was set at P<0.05, if it corroborated the SPM findings.

For the behavioral and cardiovascular measures, we compared each time point between the placebo and caffeine scores using repeated analysis of variance. Correlation analyses were done to assess the relationship between the regions where caffeine changed BPND and the behavioral measures that were significantly affected by caffeine. Significance was set at P <0.05.

Top of page

Results

Effects of caffeine on self-reports and on cardiovascular measures

Comparisons between caffeine and placebo for the corresponding time measures showed significantly higher self-reports of ‘alertness’ both at 30’ (P=0.05) and at 120’ (P=0.01) and lower scores in ‘sleepiness’ at 120’ (P=0.04) than placebo. Differences between caffeine and placebo for scores on mood and tiredness only reached trend effects (P>0.06<0.09; Figure 1).

Figure 1.

Figure 1 - Unfortunately we are unable to provide accessible alternative text for this. If you require assistance to access this image, please contact help@nature.com or the author

Behavioral effects of placebo and caffeine before and 30 and 120 min after their administration. Significance corresponds to comparison between placebo (gray symbols) and caffeine (black symbols) and values correspond to means and standard errors.

Full figure and legend (54K)

 

The average cardiovascular measures were not significantly affected by caffeine (pre vs post). Specifically, for heart rate, pre vs post placebo (70±10 vs 64±9) or pre vs post caffeine (66±9 vs 65±11); for systolic pressure, pre vs post placebo (124±6 vs 122±7) or pre vs post caffeine (128±11 vs 129±9); or for diastolic pressure, pre vs post placebo (67±10 vs 65±9) or pre vs post caffeine measures (71±12 vs 69±11); none of which differ significantly from one another.

Measures of caffeine in plasma

There were no detectable levels of caffeine on the plasma samples taken before caffeine administration. Measures of caffeine concentration in plasma were 4.7±2 μg ml−1 at 30 min, 5.2±1 μg ml−1 at 60 min and 4.8±0.6 μg ml−1 at 120 min. This corroborated that we had peak levels of caffeine in plasma at the time of [11C]raclopride injection (60 min post caffeine) and high levels at the time of the behavioral measures (30 and 120 min post caffeine).

Effects of caffeine on D2/D3R availability

SPM revealed that caffeine increased D2/D3R availability (observed as increases in BPND) in right and left striatum (including dorsal putamen and VS) as shown both by the averaged statistical maps as well as the individual values extracted from the center of the significant clusters (Figure 2, Table 1).

Figure 2.

Figure 2 - Unfortunately we are unable to provide accessible alternative text for this. If you require assistance to access this image, please contact help@nature.com or the author

(a) Brain maps obtained with Statistical Parametric Mapping (SPM) showing significant differences in D2/D3R availability, which was quantified as nondisplaceable binding potential (BPND), between placebo and caffeine for the contrast caffeine >placebo. Threshold for significance corresponds to Pu<0.01, clusters >100 voxels. (b) Individual values for BPND from measures extracted in dorsal putamen and in ventral striatum after placebo and after caffeine.

Full figure and legend (133K)

 

Table 1 - Statistical significance for changes in BPND for the contrast caffeine greater than placebo.

Table 1 - Statistical significance for changes in BPND for the contrast caffeine greater than placebo - Unfortunately we are unable to provide accessible alternative text for this. If you require assistance to access this image, please contact help@nature.com or the authorFull table

 

The independent ROI analyses, corroborated that caffeine when compared with placebo induced small but significant increases in BPND, in putamen (placebo: 2.84±0.37 vs caffeine: 2.97±0.35; P=0.05) and in VS (placebo: 2.69±0.31 vs caffeine: 2.84±0.39, P=0.05) but not in caudate.

Correlations between caffeine-induced changes in D2/D3R availability and behavior and plasma levels

The correlation analysis with the striatal ROI and the behavioral measures showed a significant positive correlation between VS and alertness (r=0.56, P=0.01) such that increases in D2/D3R availability with caffeine were associated with increases in alertness.

The correlation analysis between caffeine-induced changes in D2/D3R availability in striatum and levels of caffeine in plasma were not significant.

Top of page

Discussion

Here we show that caffeine increases D2/D3R availability in striatum (evidenced as increases in BPND in dorsal putamen and VS) in a group of healthy controls with low levels of daily caffeine intake. These findings are consistent with findings from a prior PET [11C]raclopride study done in a small group of subjects (eight habitual coffee drinkers) that also reported increases in D2/D3R availability in striatum with caffeine (200 mg).24 The findings from these two studies thus suggest that caffeine at doses typically consumed by humans might enhance DA signaling by increasing D2/D3R levels or their affinity rather than by increasing DA release in the striatum.

Here we interpret our results of increases in BPND (in BPND availability) with caffeine to suggest that they reflect increases in D2/D3R levels rather than reflecting decreases in endogenous DA, which is the way that typically increases in BPND are interpreted (reduced competition from DA to bind to D2/D3R). The reasons for this interpretation follow. First, it is recognized that alerting drugs (amphetamine, methylphenidate and modafinil) increase DA release in the striatum.3, 25, 36 Second, clinical studies have shown that the DA increases in striatum induced by stimulant drugs are associated with increases in alertness.5 Finally, preclinical studies have shown that the increases in striatal DA induced by stimulants and modafinil is necessary for their wake-promoting actions.6 Thus, if caffeine had reduced DA in the striatum, this would have resulted in an increase in tiredness and sleepiness instead of the increases in alertness observed after caffeine administration. Our interpretation that the increases in striatal D2/D3R availability in VS with caffeine reflect an increase in D2/D3R levels is also consistent with our findings that downregulation of D2/D3R in VS after sleep deprivation is associated with reduced alertness.5

Striato-pallidal neurons adjust their excitability by changing D2R levels in the membrane.37 Thus, D2R downregulate with DA stimulation38 and upregulate with reduced DA signaling.39, 40 DA stimulation of D2R triggers their internalization,38 which can then be recycled or degraded.38, 41 Internalization of D2R is regulated by A2AR,42 agonists facilitate its internalization through the binding of β-arrestin 2 to A2AR-D2R receptor heteromers43 whereas A2AR antagonists interfere with D2R internalization in striatal neurons.44 Thus, caffeine might interfere with a tonic A2AR-dependent internalization of D2R mediated by endogenous adenosine, which could contribute to its psychostimulant effects.14, 19, 45, 46 Indeed, our findings along with those previously reported showing that caffeine increased D2R availability in striatum,24 support this interpretation. As caffeine modulates DA signaling, in part, by its antagonism of A2AR,47 caffeine-induced D2R increases in striatum would be consistent with caffeine's antagonism of A2A-mediated D2R internalization. Indeed, A2A receptor knockout mice show increased D2R levels in striatum;48 though we cannot necessarily equate the chronic state of a knockout with the effects from acute caffeine exposure.

However, regardless of the mechanism responsible for the increases in striatal D2/D3R availability, our results indicate that in humans, caffeine at the doses typically consumed, does not increase DA in the striatum. This is consistent with findings from microdialysis studies in rodent showing that caffeine (0.25–5 mg kg−1 intravenously or 1.5 to 30 mg kg−1 intraperitoneally) did not increase DA in the nucleus accumbens,22, 23 though a study reported increases with a large (10 mg kg−1 intraperitoneally) but not a lower caffeine dose (3 mg kg−1 intraperitoneally).21 Thus, on the basis of the current and prior findings24 and the preclinical results, caffeine at doses that are relevant to human consumption does not appear to increase DA in the nucleus accumbens. As the ability of drugs of abuse to increase DA is necessary for their rewarding effects and for the neuroadaptations associated with the addiction phenotype,49 this could explain why caffeine does not produce the compulsive administration and the loss of control that characterizes addiction.50

Caffeine-induced increases in D2/D3R in VS were associated with increases in alertness. This association between alertness and D2/D3R replicates our previous findings with sleep deprivation but in the opposite direction, in which we showed that the decreases in D2/D3R availability in VS with sleep deprivation were associated with reductions in alertness.5 In the prior PET study, caffeine-induced increases in striatal D2/D3R availability were associated with reduced tiredness.24 Thus this provides evidence that enhanced signaling through D2/D3R in striatal regions might enhance alertness or decrease tiredness, whereas reduced signaling might decrease alertness or increase fatigue.

Study limitations

Traditionally, increases in D2/D3R availability with [11C]raclopride, as observed here, have been interpreted to reflect decreases in DA release. Instead, our model leads us to interpret them as increases in D2/D3R levels and/or increases in affinity. However, our model cannot rule out the potential confound that more than one factor could be affecting the binding of [11C]raclopride. In this respect, preclinical experiments that use more selective compounds should be performed to investigate whether caffeine’s effects on [11C]raclopride binding reflect changes in the expression or in the affinity of D2/D3R and whether these effects reflect caffeine’s antagonism at A2AR. Also because [11C]raclopride binds to both D2R and D3R,51 we cannot distinguish whether caffeine-induced increases in striatal BPND reflects only increases in D2R or also in D3R. However, in putamen where the relative density of D3R is much lower than that of D2R,52 the effects of caffeine are likely to reflect D2R. Another potential confound in our study is that caffeine significantly reduces cerebral blood flow,53 which could interfere with the BPND measures as cerebral blood flow effects differ between cerebellum and striatum.54 However, because caffeine decreases cerebral blood flow in striatum to a greater extent than in cerebellum,54 this would lead to decreases in striatal BPND, whereas we showed the opposite; that is increases in striatal BPND with caffeine, indicating that our findings are not due to caffeine-induced changes in cerebral blood flow. Though the raclopride PET method cannot distinguish between presynaptic and postsynaptic D2/D3R, the fact that caffeine is an antagonist at A2A receptors, which are expressed in medium spiny neurons expressing D2R but not in DA neurons lead us to presume that the effects are postsynaptic. Another confound in our studies is the order effect as placebo was always given 2 h before caffeine. However, studies that have evaluated test–retest reproducibility for raclopride binding (including ours)55, 56 have reported no significant differences between measures even when the repeated measures were performed on the same day57 as per the current study, indicating that the order effect is unlikely to account for our findings. We are unable to assess if the participants were able to determine if they received caffeine or placebo as we did not query them at the end of the study. Finally, we did not collect blood samples for epinephrine and norepinephrine, which are increased by caffeine.58 Thus, we cannot rule out the contribution of caffeine’s effects in the autonomic system on the behavioral effects of caffeine. Nonetheless, the significant association between increases in D2R availability in VS and alertness indicates that caffeine’s effects on D2R signaling contribute to its alerting effects.

Top of page

Conclusion

We show a significant increase in D2/D3R availability in striatum with caffeine administration, which indicates that caffeine at doses consumed by humans does not increase DA in striatum. Instead we interpret our findings to indicate that caffeine’s DA-enhancing effects in the human brain are indirect and mediated by an increase in D2/D3R levels and/or changes in D2/D3R affinity.

Top of page

Conflict of interest

The authors declare no conflict of interest.

Top of page

References

  1. Mitchell DC, Knight CA, Hockenberry J, Teplansky R, Hartman TJ. Beverage caffeine intakes in the U.S. Food Chem Toxicol 2014; 63: 136–142. | Article | PubMed | ISI |
  2. Cardenas L, Houle S, Kapur S, Busto UE. Oral D-amphetamine causes prolonged displacement of [11C]raclopride as measured by PET. Synapse 2004; 51: 27–31. | Article | PubMed | ISI | CAS |
  3. Volkow ND, Fowler JS, Logan J, Alexoff D, Zhu W, Telang F et al. Effects of modafinil on dopamine and dopamine transporters in the male human brain: clinical implications. JAMA 2009; 301: 1148–1154. | Article | PubMed | ISI | CAS |
  4. Volkow ND, Wang G, Fowler JS, Logan J, Gerasimov M, Maynard L et al. Therapeutic doses of oral methylphenidate significantly increase extracellular dopamine in the human brain. J Neurosci 2001; 21: RC121. | PubMed | CAS |
  5. Volkow ND, Tomasi D, Wang GJ, Telang F, Fowler JS, Logan J et al. Evidence that sleep deprivation downregulates dopamine D2R in ventral striatum in the human brain. J Neurosci 2012; 32: 6711–6717. | Article | PubMed | ISI |
  6. Wisor JP, Nishino S, Sora I, Uhl GH, Mignot E, Edgar DM. Dopaminergic role in stimulant-induced wakefulness. J Neurosci 2001; 21: 1787–1794. | PubMed | ISI | CAS |
  7. Abi-Dargham A, Kegeles LS, Martinez D, Innis RB, Laruelle M. Dopamine mediation of positive reinforcing effects of amphetamine in stimulant naive healthy volunteers: results from a large cohort. Eur Neuropsychopharmacol 2003; 13: 459–468. | Article | PubMed | ISI |
  8. Nguyen TL, Tian YH, You IJ, Lee SY, Jang CG. Modafinil-induced conditioned place preference via dopaminergic system in mice. Synapse 2011; 65: 733–741. | Article | PubMed | ISI |
  9. Volkow ND, Wang GJ, Fowler JS, Logan J, Gatley SJ, Wong C et al. Reinforcing effects of psychostimulants in humans are associated with increases in brain dopamine and occupancy of D(2) receptors. J Pharmacol Exp Ther 1999; 291: 409–415. | PubMed | ISI | CAS |
  10. Wuo-Silva R, Fukushiro DF, Borcoi AR, Fernandes HA, Procopio-Souza R, Hollais AW et al. Addictive potential of modafinil and cross-sensitization with cocaine: a pre-clinical study. Addict Biol 2011; 16: 565–579. | Article | PubMed | ISI |
  11. Banerjee D, Vitiello MV, Grunstein RR. Pharmacotherapy for excessive daytime sleepiness. Sleep Med Rev 2004; 8: 339–354. | Article | PubMed | ISI |
  12. Chen JF, Xu K, Petzer JP, Staal R, Xu YH, Beilstein M et al. Neuroprotection by caffeine and A(2 A) adenosine receptor inactivation in a model of Parkinson's disease. J Neurosci 2001; 21: RC143. | PubMed | CAS |
  13. El Yacoubi M, Ledent C, Menard JF, Parmentier M, Costentin J, Vaugeois JM. The stimulant effects of caffeine on locomotor behaviour in mice are mediated through its blockade of adenosine A(2A) receptors. Br J Pharmacol 2000; 129: 1465–1473. | Article | PubMed | ISI | CAS |
  14. Huang ZL, Qu WM, Eguchi N, Chen JF, Schwarzschild MA, Fredholm BB et al. Adenosine A2A, but not A1, receptors mediate the arousal effect of caffeine. Nat Neurosci 2005; 8: 858–859. | Article | PubMed | ISI | CAS |
  15. Lazarus M, Shen HY, Cherasse Y, Qu WM, Huang ZL, Bass CE et al. Arousal effect of caffeine depends on adenosine A2A receptors in the shell of the nucleus accumbens. J Neurosci 2011; 31: 10067–10075. | Article | PubMed | ISI | CAS |
  16. Ferre S, Ciruela F, Woods AS, Lluis C, Franco R. Functional relevance of neurotransmitter receptor heteromers in the central nervous system. Trends Neurosci 2007; 30: 440–446. | Article | PubMed | ISI | CAS |
  17. Azdad K, Gall D, Woods AS, Ledent C, Ferre S, Schiffmann SN. Dopamine D2 and adenosine A2A receptors regulate NMDA-mediated excitation in accumbens neurons through A2A-D2 receptor heteromerization. Neuropsychopharmacology 2009; 34: 972–986. | Article | PubMed | ISI |
  18. Trifilieff P, Rives ML, Urizar E, Piskorowski RA, Vishwasrao HD, Castrillon J et al. Detection of antigen interactions ex vivo by proximity ligation assay: endogenous dopamine D2-adenosine A2A receptor complexes in the striatum. Biotechniques 2011; 51: 111–118. | PubMed | ISI |
  19. Ferre S. Role of the central ascending neurotransmitter systems in the psychostimulant effects of caffeine. J Alzheimers Dis 2010; 20(Suppl 1): S35–S49. | PubMed | ISI |
  20. Fredholm BB, Battig K, Holmen J, Nehlig A, Zvartau EE. Actions of caffeine in the brain with special reference to factors that contribute to its widespread use. Pharmacol Rev 1999; 51: 83–133. | PubMed | ISI | CAS |
  21. Solinas M, Ferre S, You ZB, Karcz-Kubicha M, Popoli P, Goldberg SR. Caffeine induces dopamine and glutamate release in the shell of the nucleus accumbens. J Neurosci 2002; 22: 6321–6324. | PubMed | ISI |
  22. Acquas E, Tanda G, Di Chiara G. Differential effects of caffeine on dopamine and acetylcholine transmission in brain areas of drug-naive and caffeine-pretreated rats. Neuropsychopharmacology 2002; 27: 182–193. | Article | PubMed | ISI |
  23. De Luca MA, Bassareo V, Bauer A, Di Chiara G. Caffeine and accumbens shell dopamine. J Neurochem 2007; 103: 157–163. | PubMed | ISI |
  24. Kaasinen V, Aalto S, Nagren K, Rinne JO. Dopaminergic effects of caffeine in the human striatum and thalamus. Neuroreport 2004; 15: 281–285. | Article | PubMed | ISI |
  25. Volkow ND, Wang GJ, Fowler JS, Logan J, Schlyer D, Hitzemann R et al. Imaging endogenous dopamine competition with [11C]raclopride in the human brain. Synapse 1994; 16: 255–262. | Article | PubMed | ISI | CAS |
  26. Wang G-J, Volkow ND, Hitzemann RJ, Wong C, Angrist B, Burr G et al. Behavioral and cardiovascular effects of intravenous methylphenidate in normal subjects and cocaine abusers. Eur Addict Res 1997; 3: 49–54. | Article |
  27. Fischman MW, Foltin RW. Utility of subjective-effects measurements in assessing abuse liability of drugs in humans. Br J Addict 1991; 86: 1563–1570. | Article | PubMed |
  28. Liguori A, Hughes JR, Grass JA. Absorption and subjective effects of caffeine from coffee, cola and capsules. Pharmacol Biochem Behav 1997; 58: 721–726. | Article | PubMed | ISI |
  29. Tanaka E. Simultaneous determination of caffeine and its primary demethylated metabolites in human plasma by high-performance liquid chromatography. J Chromatogr 1992; 575: 311–314. | Article | PubMed |
  30. Volkow ND, Fowler JS, Wang GJ, Hitzemann R, Logan J, Schlyer DJ et al. Decreased dopamine D2 receptor availability is associated with reduced frontal metabolism in cocaine abusers. Synapse 1993; 14: 169–177. | Article | PubMed | ISI | CAS |
  31. Lelo A, Birkett DJ, Robson RA, Miners JO. Comparative pharmacokinetics of caffeine and its primary demethylated metabolites paraxanthine, theobromine and theophylline in man. Br J Clin Pharmacol 1986; 22: 177–182. | Article | PubMed | ISI | CAS |
  32. Friston KJ, Holmes AP, Poline JB, Grasby PJ, Williams SC, Frackowiak RS et al. Analysis of fMRI time-series revisited. Neuroimage 1995; 2: 45–53. | Article | PubMed | ISI | CAS |
  33. Logan J, Fowler JS, Volkow ND, Wang GJ, Ding YS, Alexoff DL. Distribution volume ratios without blood sampling from graphical analysis of PET data. J Cereb Blood Flow Metab 1996; 16: 834–840. | Article | PubMed | ISI | CAS |
  34. Volkow ND, Wang GJ, Fowler JS, Tomasi D, Telang F. Addiction: beyond dopamine reward circuitry. Proc Natl Acad Sci USA 2011; 108: 15037–15042. | Article | PubMed |
  35. Tzourio-Mazoyer N, Landeau B, Papathanassiou D, Crivello F, Etard O, Delcroix N et al. Automated anatomical labeling of activations in SPM using a macroscopic anatomical parcellation of the MNI MRI single-subject brain. Neuroimage 2002; 15: 273–289. | Article | PubMed | ISI | CAS |
  36. Martinez D, Slifstein M, Broft A, Mawlawi O, Hwang DR, Huang Y et al. Imaging human mesolimbic dopamine transmission with positron emission tomography. Part II: amphetamine-induced dopamine release in the functional subdivisions of the striatum. J Cereb Blood Flow Metab 2003; 23: 285–300. | Article | PubMed | ISI | CAS |
  37. Iizuka Y, Sei Y, Weinberger DR, Straub RE. Evidence that the BLOC-1 protein dysbindin modulates dopamine D2 receptor internalization and signaling but not D1 internalization. J Neurosci 2007; 27: 12390–12395. | Article | PubMed | ISI | CAS |
  38. Bartlett SE, Enquist J, Hopf FW, Lee JH, Gladher F, Kharazia V et al. Dopamine responsiveness is regulated by targeted sorting of D2 receptors. Proc Natl Acad Sci USA 2005; 102: 11521–11526. | Article | PubMed | CAS |
  39. Ginovart N, Wilson AA, Hussey D, Houle S, Kapur S. D2-receptor upregulation is dependent upon temporal course of D2-occupancy: a longitudinal [11C]-raclopride PET study in cats. Neuropsychopharmacology 2009; 34: 662–671. | Article | PubMed | ISI |
  40. Xu ZC, Ling G, Sahr RN, Neal-Beliveau BS. Asymmetrical changes of dopamine receptors in the striatum after unilateral dopamine depletion. Brain Res 2005; 1038: 163–170. | Article | PubMed | ISI |
  41. Li Y, Roy BD, Wang W, Zhang L, Zhang L, Sampson SB et al. Identification of two functionally distinct endosomal recycling pathways for dopamine D(2) receptor. J Neurosci 2012; 32: 7178–7190. | Article | PubMed | ISI |
  42. Hillion J, Canals M, Torvinen M, Casado V, Scott R, Terasmaa A et al. Coaggregation, cointernalization, and codesensitization of adenosine A2A receptors and dopamine D2 receptors. J Biol Chem 2002; 277: 18091–18097. | Article | PubMed | ISI | CAS |
  43. Borroto-Escuela DO, Romero-Fernandez W, Tarakanov AO, Ciruela F, Agnati LF, Fuxe K. On the existence of a possible A2A-D2-beta-Arrestin2 complex: A2A agonist modulation of D2 agonist-induced beta-arrestin2 recruitment. J Mol Biol 2011; 406: 687–699. | Article | PubMed | ISI | CAS |
  44. Huang L, Wu DD, Zhang L, Feng LY. Modulation of A(2)a receptor antagonist on D(2) receptor internalization and ERK phosphorylation. Acta Pharmacol Sin 2013; 34: 1292–1300. | Article | PubMed | ISI |
  45. Biaggioni I, Paul S, Puckett A, Arzubiaga C. Caffeine and theophylline as adenosine receptor antagonists in humans. J Pharmacol Exp Ther 1991; 258: 588–593. | PubMed | ISI | CAS |
  46. Schwierin B, Borbely AA, Tobler I. Effects of N6-cyclopentyladenosine and caffeine on sleep regulation in the rat. Eur J Pharmacol 1996; 300: 163–171. | Article | PubMed | ISI | CAS |
  47. Ferre S, Ciruela F, Borycz J, Solinas M, Quarta D, Antoniou K et al. Adenosine A1-A2A receptor heteromers: new targets for caffeine in the brain. Front Biosci 2008; 13: 2391–2399. | Article | PubMed | ISI |
  48. Dassesse D, Massie A, Ferrari R, Ledent C, Parmentier M, Arckens L et al. Functional striatal hypodopaminergic activity in mice lacking adenosine A(2A) receptors. J Neurochem 2001; 78: 183–198. | Article | PubMed | ISI | CAS |
  49. Volkow ND, Wang GJ, Fowler JS, Tomasi D. Addiction circuitry in the human brain. Annu Rev Pharmacol Toxicol 2012; 52: 321–336. | Article | PubMed | ISI |
  50. Dews PB, O'Brien CP, Bergman J. Caffeine: behavioral effects of withdrawal and related issues. Food Chem Toxicol 2002; 40: 1257–1261. | Article | PubMed | ISI |
  51. Levant B, Grigoriadis DE, De Souza EB. Relative affinities of dopaminergic drugs at dopamine D2 and D3 receptors. Eur J Pharmacol 1995; 278: 243–247. | Article | PubMed | ISI |
  52. Searle G, Beaver JD, Comley RA, Bani M, Tziortzi A, Slifstein M et al. Imaging dopamine D3 receptors in the human brain with positron emission tomography, [11C]PHNO, and a selective D3 receptor antagonist. Biol Psychiatry 2010; 68: 392–399. | Article | PubMed | ISI |
  53. Cameron OG, Modell JG, Hariharan M. Caffeine and human cerebral blood flow: a positron emission tomography study. Life Sci 1990; 47: 1141–1146. | Article | PubMed | ISI | CAS |
  54. Vidyasagar R, Greyling A, Draijer R, Corfield DR, Parkes LM. The effect of black tea and caffeine on regional cerebral blood flow measured with arterial spin labeling. J Cereb Blood Flow Metab 2013; 33: 963–968. | Article | PubMed | ISI |
  55. Kodaka F, Ito H, Kimura Y, Fujie S, Takano H, Fujiwara H et al. Test-retest reproducibility of dopamine D2/3 receptor binding in human brain measured by PET with [11C]MNPA and [11C]raclopride. Eur J Nucl Med Mol Imaging 2013; 40: 574–579. | Article | PubMed | ISI |
  56. Volkow ND, Fowler JS, Wang GJ, Dewey SL, Schlyer D, MacGregor R et al. Reproducibility of repeated measures of carbon-11-raclopride binding in the human brain. J Nucl Med 1993; 34: 609–613. | PubMed | ISI | CAS |
  57. Alakurtti K, Aalto S, Johansson JJ, Nagren K, Tuokkola T, Oikonen V et al. Reproducibility of striatal and thalamic dopamine D2 receptor binding using [11C]raclopride with high-resolution positron emission tomography. J Cereb Blood Flow Metab 2011; 31: 155–165. | Article | PubMed | ISI |
  58. Riksen NP, Rongen GA, Smits P. Acute and long-term cardiovascular effects of coffee: implications for coronary heart disease. Pharmacol Ther 2009; 121: 185–191. | Article | PubMed | ISI | CAS |

Top of page

Acknowledgements

We thank Colleen Shea, Pauline Carter, Karen Apelskog and Ruben Baler for their contributions. This research was supported by NIH’s Intramural Research Program (NIAAA).

 

Characterization of dopamine D1 and D2 receptor function in socially housed cynomolgus monkeys self-administering cocaine (2004)

Psychopharmacology (Berl). 2004 Jul;174(3):381-8. Epub 2004 Feb 7.

Czoty PW1, Morgan D, Shannon EE, Gage HD, Nader MA.

Abstract

RATIONALE:

Social rank has been shown to influence dopamine (DA) D(2) receptor function and vulnerability to cocaine self-administration in cynomolgus monkeys. The present studies were designed to extend these findings to maintenance of cocaine reinforcement and to DA D(1) receptors.

OBJECTIVE:

Examine the effects of a high-efficacy D(1) agonist on an unconditioned behavior (eyeblinking) and a low-efficacy D(1) agonist on cocaine self-administration, as well as the effects of cocaine exposure on D(2) receptor function across social ranks, as determined by positron emission tomography (PET).

METHODS:

Effects of the high-efficacy D(1) agonist SKF 81297 and cocaine (0.3-3.0 mg/kg) on spontaneous blinking were characterized in eight monkeys during 15-min observation periods. Next, the ability of the low-efficacy D(1) agonist SKF 38393 (0.1-17 mg/kg) to decrease cocaine self-administration (0.003-0.1 mg/kg per injection, IV) was assessed in 11 monkeys responding under a fixed-ratio 50 schedule. Finally, D(2) receptor levels in the caudate and putamen were assessed in nineteen monkeys using PET.

RESULTS:

SKF 81297, but not cocaine, significantly increased blinking in all monkeys, with slightly greater potency in dominant monkeys. SKF 38393 dose-dependently decreased cocaine-maintained response rates with similar behavioral potency and efficacy across social rank. After an extensive cocaine self-administration history, D(2) receptor levels did not differ across social ranks.

CONCLUSIONS:

These results suggest that D(1) receptor function is not substantially influenced by social rank in monkeys from well-established social groups. While an earlier study showed that dominant monkeys had higher D(2) receptor levels and were less sensitive to the reinforcing effects of cocaine during initial exposure, the present findings indicate that long-term cocaine use changed D(2) receptor levels such that D(2) receptor function and cocaine reinforcement were not different between social ranks. These findings suggest that cocaine exposure attenuated the impact of social housing on DA receptor function.

 

Correlation between dopamine D2 receptors in the ventral striatum and central processing of alcohol cues and craving (2004)

Am J Psychiatry. 2004 Oct;161(10):1783-9.

Heinz A1, Siessmeier T, Wrase J, Hermann D, Klein S, Grüsser SM, Flor H, Braus DF, Buchholz HG, Gründer G, Schreckenberger M, Smolka MN, Rösch F, Mann K, Bartenstein P.

Erratum in

  • Am J Psychiatry. 2004 Dec;161(12):2344. Grüsser-Sinopoli, Sabine M [corrected to Grüsser, Sabine M].

Abstract

OBJECTIVE:

Alcohol and other drugs of abuse stimulate dopamine release in the ventral striatum, which includes the nucleus accumbens, a core region of the brain reward system, and reinforce substance intake. Chronic alcohol intake is associated with down-regulation of central dopamine D(2) receptors, and delayed recovery of D(2) receptor sensitivity after detoxification is positively correlated with high risk for relapse. Prolonged D(2) receptor dysfunction in the ventral striatum may interfere with a dopamine-dependent error detection signal and bias the brain reward system toward excessive attribution of incentive salience to alcohol-associated stimuli.

METHOD:

Multimodal imaging, with the radioligand [(18)F]desmethoxyfallypride and positron emission tomography as well as functional magnetic resonance imaging (fMRI), was used to compare 11 detoxified male alcoholics with 13 healthy men. The authors measured the association of D(2)-like dopamine receptors in the ventral striatum with alcohol craving and central processing of alcohol cues.

RESULTS:

Activation of the medial prefrontal cortex and striatum by alcohol-associated stimuli, relative to activation by neutral visual stimuli, was greater in the detoxified alcoholics than in the healthy men. The alcoholics displayed less availability of D(2)-like receptors in the ventral striatum, which was associated with alcohol craving severity and with greater cue-induced activation of the medial prefrontal cortex and anterior cingulate as assessed with fMRI.

DISCUSSION:

In alcoholics, dopaminergic dysfunction in the ventral striatum may attribute incentive salience to alcohol-associated stimuli, so that alcohol cues elicit craving and excessive activation of neural networks associated with attention and behavior control.

 

D1 and D2 dopamine-receptor modulation of striatal glutamatergic signaling in striatal medium spiny neurons (2007)

Trends Neurosci. 2007 May;30(5):228-35. Epub 2007 Apr 3.

Surmeier DJ1, Ding J, Day M, Wang Z, Shen W.

Abstract

Dopamine shapes a wide variety of psychomotor functions. This is mainly accomplished by modulating cortical and thalamic glutamatergic signals impinging upon principal medium spiny neurons (MSNs) of the striatum.

Several lines of evidence suggest that dopamine D1 receptor signaling enhances dendritic excitability and glutamatergic signaling in striatonigral MSNs, whereas D2 receptor signaling exerts the opposite effect in striatopallidal MSNs. The functional antagonism between these two major striatal dopamine receptors extends to the regulation of synaptic plasticity.

Recent studies, using transgenic mice in which cells express D1 and D2 receptors, have uncovered unappreciated differences between MSNs that shape glutamatergic signaling and the influence of DA on synaptic plasticity. These studies have also shown that long-term alterations in dopamine signaling produce profound and cell-type-specific reshaping of corticostriatal connectivity and function.

 

Differences in D2 dopamine receptor availability and reaction to novelty in socially housed male monkeys during abstinence from cocaine (2010)

COMMENTS: Demonstrates that animals who are dominant have higher levels of D2 receptors, and take longer before investigating a novel item placed in their cage. In humans, dominance translates to feeling good about yourself and your life. Less attracted to novelty means less likely to become addicted and feeling satisfied with what you have.


Psychopharmacology (Berl). 2010 Mar;208(4):585-92. doi: 10.1007/s00213-009-1756-4.

Czoty PW1, Gage HD, Nader MA.

Abstract

Rationale

Studies in socially housed monkeys have demonstrated an influence of position in the social dominance hierarchy on brain dopamine D2 receptors and the reinforcing effects of cocaine that dissipates after long-term cocaine self-administration.

Objective

The aims of the study were to examine the effects of abstinence from cocaine on D2 receptors in socially housed monkeys and to extend behavioral characterizations to measures of reactivity to a novel object.

Materials and methods

Twelve socially housed male cynomolgus monkeys with extensive cocaine self-administration experience were used (average lifetime intakes ~270 and 215 mg/kg for dominant and subordinate monkeys, respectively). Abstinence lasted for approximately 8 months, after which D2 receptor availability was assessed using positron emission tomography and the D2 ligand [18F]fluoroclebopride. Reaction to novelty was also assessed in these subjects as well as nine individually housed monkeys.

Results

During abstinence, D2 receptor availability in the caudate nucleus was significantly higher in dominant versus subordinate monkeys. Average latency to touch a novel object was also significantly higher in dominant monkeys compared to subordinates or individually housed monkeys. In socially experienced monkeys, a significant positive correlation was observed between caudate nucleus D2 receptor availability and latencies to touch the novel object.

Conclusions

Although chronic cocaine self-administration blunts the ability of social dominance to alter D2 receptor availability and sensitivity to the reinforcing effects of cocaine, this influence reemerges during abstinence. In addition, the data suggest that prior experience with social dominance can lead to longer latencies in reaction to novelty—a personality trait associated with low vulnerability to cocaine abuse.

Keywords: Social rank, Reaction to novelty, PET imaging, Vulnerability, Nonhuman primates

Earlier work in socially housed nonhuman primates found that dopamine (DA) D2 receptor availability, as assessed with positron emission tomography (PET), was higher in dominant monkeys compared to subordinate animals (Grant et al. 1998; Morgan et al. 2002). In one of these studies, D2 receptor availability increased by approximately 20% in monkeys that attained dominance but was unchanged in subordinates (Morgan et al. 2002). These changes in D2 receptor availability had behavioral consequences such that dominant monkeys self-administered significantly less cocaine compared to subordinate animals. Thus, it appears that the high D2 receptor levels “protected” the dominant monkeys from the reinforcing effects of cocaine which is consistent with data in humans and laboratory animals (Volkow et al. 1999; Thanos et al. 2001; Nader et al. 2006; Dalley et al. 2007).

These studies indicated that the position in the social hierarchy could influence vulnerability to the reinforcing effects of cocaine during early exposure; however, less is known about the influence of social rank in monkeys with extensive cocaine self-administration histories. In the group-housed monkeys described above, social rank-related differences in D2 receptor availability and cocaine self-administration were not observed once monkeys had self-administered cocaine for several years (Czoty et al. 2004). Thus, the influence of the social environment dissipated over time, ostensibly due to the indirect pharmacological effects of cocaine on D2 receptors. The primary goal of the present study was to examine whether social rank-related differences in D2 receptor availability would reemerge during abstinence from cocaine or, alternately, whether long-term cocaine exposure permanently changed the brain such that neuroplasticity related to social rank was no longer possible.

Another aim of this study was to examine the relationship between D2 receptor availability and measures of personality traits in cocaine-experienced monkeys. Preclinical studies have established a connection between aspects of personality and vulnerability to substance abuse (Dawe and Loxton 2004; Verdejo-Garcia et al. 2008). In laboratory animals, measures of various aspects of impulsivity, such as reaction to novelty, can predict sensitivity to abuse-related behavioral effects of psychostimulants (e.g., Piazza et al. 1989, 2000; Bardo et al. 1996; Perry et al. 2005; Dalley et al. 2007). High novelty seeking has generally been associated with lower subcortical D2 receptor availability, higher extracellular DA levels, and increased vulnerability to drug self-administration (Piazza et al. 1991; Hooks et al. 1991; Rouge-Pont et al. 1993; Dalley et al. 2007). In the present study, we assessed the relationship of reaction to novelty and D2 receptor availability in the caudate nucleus and putamen of cocaine-experienced socially housed monkeys; the latency to touch a novel object was compared with data from individually housed cocaine-naïve control monkeys. Based on the relationship between D2 receptor availability and measures of novelty seeking in rats, we hypothesized that dominant monkeys would be less reactive than subordinates (i.e., longer latencies to touch a novel object) and that social rank-related differences in reaction to novelty would parallel differences in D2 receptor availability.

Materials and methods

Subjects

Twenty-one adult male cynomolgus monkeys (Macaca fascicularis) served as subjects. Twelve of these monkeys had a history of being housed in groups of three or four for over 2 years (Czoty et al. 2004, 2005b). At the start of the present experiments, six monkeys lived in two social groups of three monkeys per group, and six monkeys were pair-housed with each other. All 12 had self-administered cocaine several days per week for more than 2 years under either a fixed-ratio (FR) schedule of cocaine presentation (Czoty et al. 2004) or a concurrent FR schedule of food and cocaine presentation (Czoty et al. 2005b). There were no differences in average lifetime or past-year cocaine intakes between dominant and subordinate monkeys, although the former was somewhat higher in dominant monkeys (Table 1). The remaining nine monkeys were individually housed and had no previous cocaine exposure. These animals were included in order to better assess the impact of social housing on our primary behavioral endpoint (reactivity to a novel object). Each monkey was fitted with a nylon collar (Primate Products, Redwood City, CA, USA) and trained to sit calmly in a standard primate restraint chair (Primate Products) using a specially designed stainless steel pole that attached to the collar (Primate Products). Monkeys were weighed weekly and fed enough food daily (Purina Monkey Chow and fresh fruit and vegetables) to maintain body weights at approximately 95% of free-feeding levels. Body weights, which averaged 5.3 kg (SEM, 0.7 kg), did not change significantly during abstinence and were not different between dominant and subordinate monkeys. Water was available ad libitum in the home cage.

Table 1  
Description of monkeys’ cocaine histories (milligrams per kilogram), abstinence duration (days), and operant behavior during abstinence, according to social rank

Monkeys lived in stainless steel cages (0.71×1.73× 1.83 m; Allentown Caging Equipment, Co., Allentown, NJ, USA) with removable wire mesh partitions that separated monkeys into quadrants (0.71×0.84×0.84 m). Socially housed monkeys were separated daily for several hours during operant behavioral sessions and feeding; partitions remained in place for individually housed monkeys. Social status had previously been determined for each monkey according to the outcomes of agonistic encounters using procedures similar to those described previously (see Kaplan et al. 1982; Czoty et al. 2005b, 2009). Briefly, two observers separately conducted several 15-min observation sessions per pen. Aggressive, submissive, and affiliative behaviors were recorded according to an ethogram described previously (see Table 1 in Morgan et al. 2000) utilizing Noldus Observer software (Noldus Information Technology; Wageningen, The Netherlands). In these focal group sessions, both initiators and recipients of behaviors were recorded. The monkey in each pen aggressing toward all others and submitting to none was ranked #1 (most dominant). The monkey designated most subordinate displayed a low frequency of aggressive behaviors and submitted to all other monkeys in the pen. In each pen of three monkeys, the #2-ranked monkey submitted to the most dominant monkey and aggressed toward the most subordinate monkey; thus, the hierarchies in pens that consisted of three monkeys were linear and transitive. For the present studies, #1-ranked monkeys were considered dominant (n=5), and all other monkeys were considered to be subordinate (n=7). Animal housing and handling and all experimental procedures were performed in accordance with the 2003 National Research Council Guidelines for the Care and Use of Mammals in Neuroscience and Behavioral Research and were approved by the Animal Care and Use Committee of Wake Forest University. Environmental enrichment was provided as outlined in the Animal Care and Use Committee of Wake Forest University Non-Human Primate Environmental Enrichment Plan.

MR and PET imaging

An anatomical representation of the brain was acquired for each socially housed monkey using magnetic resonance imaging (MRI). Approximately 20 min prior to a scan, subjects were anesthetized with ketamine (15 mg/kg, i.m.) and transported to the MRI facility. Anesthesia was maintained during the scanning procedure with ketamine supplements when necessary. 3D spoiled gradient-recalled acquisition in steady state brain images were acquired (echo time 5, repetition time 45, flip angle 45, receiver bandwidth 15.6 kHz, field of view (FOV) 18 cm, 256×192 matrix, slice thickness 2 mm, number of excitations 3) with a 1.5-T GE Signa NR scanner (GE Medical Systems). T1-weighted whole brain images were used to anatomically define spherical regions of interest (ROIs), including the right and left caudate nucleus, putamen (0.5 mm radius), and cerebellum (0.8 mm radius), for later coregistration with PET images. Individually housed animals were not studied with PET.

During abstinence, PET scans were conducted in each monkey to measure D2 receptor availability using the D2 receptor radioligand [18F]fluoroclebopride (FCP), which does not differentiate among subtypes of the D2-like superfamily (i.e., D2, D3, and D4 receptors; Mach et al. 1996). The duration of abstinence from cocaine did not differ significantly between dominant and subordinate monkeys (Table 1). Prior to each study, monkeys were anesthetized with 10 mg/kg ketamine and transported to the PET Center. Details regarding [18F]FCP synthesis, the PET data acquisition protocol, blood sampling procedure, and metabolite analysis have been fully described previously (Mach et al. 1993a, b, 1996, 1997; Nader et al. 1999). Briefly, an arterial and a venous catheter were inserted by percutaneous stick for blood sampling and tracer injection, respectively. A paralytic agent (0.07 mg/kg vecuronium Br, i.v.) was administered and ventilation was maintained by a respirator throughout the 3-h PET scan. Supplemental doses of vecuronium (0.1 mg/h) were administered throughout the study. Body temperature was maintained at 40°C, and vital signs (heart rate, blood pressure, respiration rate, and temperature) were monitored throughout the scanning procedure.

Images were acquired on a General Electric Advance NXi PET scanner. In a single scan, the Advance NXi provided 35 transverse slices with a 4.25-mm center-to-center spacing over a 15.2-cm axial field of view. The transaxial resolution of the scanner ranges from 3.8 mm at the center of the FOV to 7.3 mm radial and 5.0 mm tangential at a radius of 20 cm when reconstructed with a ramp filter. Its axial resolution ranges from 4.0 mm at the center to 6.6 mm at a radius of 20 cm when reconstructed with a ramp filter. For more information on the performance of this scanner see DeGrado et al. (1994). At the start of the scan, approximately 5 mCi of [18F]FCP was injected, followed by 3 ml of heparinized saline. Scans were conducted and images were registered to each subject’s MRI (see Czoty et al. 2005a). Tissue–time–activity curves were generated for radiotracer concentrations in ROIs defined on each subject’s co-registered MRI. Distribution volume ratios (DVR) for the caudate nucleus and putamen were calculated using the cerebellum as the reference region and the graphical method of Logan et al. (1996). Thus, the DVR served as an index of specific [18F]FCP binding in each ROI.

Food-maintained responding

During abstinence from cocaine, eight monkeys received no other drugs. Three monkeys (C-6528, C-6628, and C-6629) received injections of the serotonin 1A receptor agonist 8-OH-DPAT (<0.4 mg/kg total over several weeks) prior to behavioral sessions in which they responded under a concurrent FR schedule of food and saline availability (Czoty et al. 2005b). Over several months, C-6526 had exposure to 4.7 mg/kg of the benzodiazepine midazolam under the concurrent schedule of food and midazolam availability (unpublished studies). At least 4.5 months passed after this drug exposure before the PET scan. During that time and for the duration of abstinence in all animals, monkeys participated in behavioral studies approximately once per week for the purpose of maintaining operant behavior after discontinuation of self-administration sessions. Each day, monkeys were separated by partitioning the cage into quadrants. Next, each monkey was seated in a restraint chair and placed into a ventilated, sound-attenuating chamber (1.5×0.74× 0.76 m; Med Associates, East Fairfield, VT, USA). During the session, 50 responses on the operant lever (FR50) resulted in delivery of a 1-g food pellet. Sessions lasted until 30 reinforcers had been obtained or 60 min had elapsed, whichever came first.

Response to novelty

During abstinence from cocaine in the socially housed monkeys and in all individually housed animals, latency to touch a novel object was determined. First, the monkey in the cage adjacent to the subject’s home cage was removed, the partition was removed from between the cages, and the subject was moved to the adjacent cage. Next, the partition was replaced and the novel object, a box measuring 30.5×20.3×20.3 cm made of black Plexiglas, was placed in the monkey’s empty home cage. Finally, the partition was again removed and the latency of the monkey to touch the object was recorded. If the monkey did not touch the object within 15 min, a score of 900 s was assigned. All sessions were videotaped and scored by an observer blind to the monkey’s social rank. While somewhat arbitrary, the 900-s maximum duration was based on preliminary data (A Bennett and P Pierre, unpublished) and was established prior to the start of this experiment.

Data analysis

DVRs in the caudate nucleus and putamen were compared between dominant and subordinate monkeys using t tests. Regarding novel object reactivity, because some dominant monkeys did not touch the object within 900 s and were thus assigned a score of 900, a (nonparametric) Kruskal–Wallis one-way analysis of variance (ANOVA) was used, followed by post hoc Mann–Whitney U tests. Finally, in the socially housed monkeys, correlations between latencies to touch the novel object and [18F]FCP DVRs in the caudate nucleus and putamen were calculated using a (nonparametric) Spearman’s rank correlation coefficient. In all cases, differences were considered statistically significant when p<0.05.

Results

PET imaging during abstinence

The average DVR in the caudate nucleus was significantly higher in dominant monkeys compared to subordinate monkeys (t10=2.96, p< 0.05; Fig. 1). Dominant monkeys also had a higher average DVR in the putamen, but this difference did not reach statistical significance (p=0.121).

Fig. 1  
D2 receptor availability ([18F]FCP DVR) in the caudate nucleus and putamen in five dominant (D) and seven subordinate (S) monkeys. Letters indicate individual monkeys (see Table 1). Horizontal line indicates the mean [18F]FCP DVR. *p<0.05

Food-maintained responding during abstinence

Mean (± SEM) numbers of reinforcers and mean (± SEM) response rates (responses per second) over the final five behavioral sessions before the monkeys’ PET scans are shown in Table 1. Neither of these variables differed across ranks as determined with t tests.

Response to novelty

The Kruskal–Wallis ANOVA indicated a main effect of group on latency to touch the novel object (K=8.73, p<0.05). As shown in Fig. 2, the latencies of dominant monkeys to touch the novel object were significantly longer than those of subordinate (Mann–Whitney U=3.00, p<0.05) and individually housed monkeys (Mann–Whitney U=2.00, p<0.01). The latter two groups were not significantly different from each other. Moreover, in socially experienced monkeys, a significant positive correlation was observed between latency to touch the novel object and D2 receptor availability in the caudate nucleus (Fig. 3; Spearman rho=0.663, p<0.05) but not in the putamen (Spearman rho=0.4718, p=0.122).

Fig. 2  
Latency in seconds to touch a novel object in five dominant (DOM), seven subordinate (SUB), and nine individually housed (IND) monkeys. Letters indicate individual monkeys (see Table 1), *p<0.05
Fig. 3  
Relationship between D2 receptor availability ([18F]FCP DVR) in the caudate nucleus or putamen and reaction to novelty (latency in seconds to touch a novel object) in socially housed monkeys

Discussion

Previous research in monkeys has demonstrated that attainment of social dominance is associated with increases in D2 receptor availability in the basal ganglia and a lower sensitivity to the reinforcing effects of cocaine compared to subordinate monkeys (Morgan et al. 2002). The data further demonstrated an inverse relationship between D2 receptor availability and sensitivity to the reinforcing effects of cocaine, as seen in other studies in laboratory animals and humans (Volkow et al. 1999; Thanos et al. 2001; Nader et al. 2006; Dalley et al. 2007). After monkeys had self-administered cocaine for several years, D2 receptor availability in the caudate nucleus and putamen no longer differed between dominant and subordinate monkeys, despite continued social housing (Czoty et al. 2004). In the present study, rank-related differences in D2 receptor availability reemerged while monkeys remained socially housed during abstinence from cocaine self-administration. After approximately 8 months of abstinence from cocaine, the average D2 receptor availability in the caudate nucleus of dominant monkeys was 26% higher than that of subordinates—a statistically significant effect. D2 availability in the putamen was 15% higher in dominant monkeys compared to subordinates, but variability across individuals was large enough to preclude statistical significance. These data provide evidence of neuroplasticity such that, despite several years of exposure to self-administered cocaine 5 days/week, brain D2 receptors remained responsive to environmental factors when cocaine exposure was discontinued. In addition, dominant monkeys were less reactive to novelty than subordinates, and this measure was positively correlated with D2 receptor availability in the caudate nucleus.

Our original study indicated that D2 receptor availability increased in monkeys that became dominant but was unchanged in subordinates (Morgan et al. 2002). We have conceptualized the dominance hierarchy as a continuum of social experience ranging from the unequivocal stress experienced by subordinate monkeys to environmental enrichment experienced by dominant animals (Nader and Czoty 2005). Thus, one interpretation of the present results is that the rank-related difference in D2 receptor availability observed after 8 months of abstinence was a result of exposure to environmental enrichment in dominant monkeys. At the outset of these experiments, we intended to assess this hypothesis more directly by determining the percentage change in individual monkeys’ [18F]FCP DVRs just before (i.e., Czoty et al. 2005b) and during abstinence. Unfortunately, this comparison was complicated by changes in social rank that occurred during abstinence for some monkeys. It is possible that the present results may be affected by individual differences in rates or extent of recovery from the decreases in D2 receptor availability that resulted from long-term cocaine self-administration, a phenomenon we previously demonstrated in individually housed rhesus monkeys (Nader et al. 2006). It is worth noting, however, that the average past-year cocaine intake of monkeys in the Nader et al. (2006) study was almost ten times higher than that of the monkeys in the present study (787.8±128.0 mg/kg versus 84.4±29.7 mg/kg). Although these issues complicate an understanding of the mechanisms through which dominant and subordinate monkeys came to differ in D2 receptor availability, after approximately 8 months of abstinence, dominant monkeys’ DVRs were significantly higher than those of subordinates. The clinical relevance of this finding lies in the demonstration of plasticity of brain DA receptor systems driven by the environment, suggesting that the brain of a cocaine-dependent individual can remain responsive to positive changes in the environment.

An additional aim of these studies was to examine the relationship between social experience, D2 receptor availability, and reaction to novelty—a characteristic that has been associated with increased vulnerability to the reinforcing effects of abused drugs (e.g., Piazza et al. 1989, 2000; Bardo et al. 1996). In the present study, the average latency of dominant monkeys to touch a novel object placed in the home cage was significantly longer than that of subordinate and individually housed monkeys, suggesting that the experience of being dominant (i.e., environmental enrichment) decreased this measure of reaction to novelty. It is important to note that previous studies examined subjects’ initial experiences with cocaine, whereas monkeys in the present studies had extensive experience self-administering cocaine. Thus, one important implication of these results is that the influence of social dominance on reaction to novelty was not eliminated due to the monkeys’ history of cocaine intake. One alternative explanation is that individual differences may have predated social housing and influenced the establishment of eventual rank. That is, it is possible that monkeys who tend to display higher reactivity to novelty are more likely to become subordinate. Supporting this possibility, female cynomolgus monkeys’ latencies to touch a novel object assessed prior to social housing were predictive of eventual social rank, and the direction of effects was similar to those observed in the present study (Riddick et al. 2009). In the present study, however, latencies of individually housed male monkeys were low with little between-subject variability to suggest they could predict future social rank. In fact, when these monkeys were eventually placed into social groups, eventual rank was not predicted by latencies to touch the novel object (not shown). It should be noted, however, that in the present study, a direct comparison of monkeys with and without social experience may be confounded by experience self-administering cocaine. Factors underlying the difference between results in male and female monkeys remain to be explored but may be due to the relatively small sample size in the present study.

Considering that dominant monkeys had significantly higher caudate nucleus D2 receptor availability and higher latencies to touch the novel object, it is not surprising that the latter two measures were positively correlated. These data are consistent with PET data in humans that suggest an inverse relationship between novelty seeking and D2 receptor availability (Zald et al. 2008) and further support the link between D2 dopamine receptors and the temperamental variables reflected in laboratory assessments of various dimensions of impulsivity including novelty seeking. The radiotracer used in the present study, FCP, binds to the D2, D3, and D4 subtypes of the D2 family of receptors; genetic studies have implicated these subtypes in mediating reaction to novelty and other measures related to impulsivity (e.g., Retz et al. 2003; Mufano et al. 2008). Moreover, Dalley and colleagues (2007) reported relatively lower D2 receptor availability in the nucleus accumbens of rats who were found to be more impulsive and subsequently self-administered greater amounts of cocaine. Although the cognitive processes measured by various laboratory tests of “impulsivity” and the overlap between these aspects of temperament as assessed in humans and animals is unclear (Dellu et al. 1996; Stoffel and Cunningham 2007), the predictive capacity of these measures suggests that they represent a reliable behavioral phenotype reflecting enhanced vulnerability to the abuse-related effects of psychostimulants. Moreover, the present and previous studies in socially housed monkeys (Morgan et al. 2002; Czoty et al. 2004, 2005b) demonstrate that these three characteristics can be influenced by environmental variables. Specifically, they support the intriguing hypothesis that social dominance is a form of environmental enrichment that can result in increases in D2 receptor availability, decreases in reaction to novelty (i.e., longer latencies to approach and touch a novel object), and decreases in sensitivity to the abuse-related effects of cocaine. To the clinician, these studies suggest that positive changes in a recovering drug abuser’s environment can be an effective component of substance abuse treatment.

Acknowledgments

This research was supported by National Institute on Drug Abuse grant R37 DA10584. The authors report no conflict of interest and would like to acknowledge the assistance with novel object reactivity assessments by Drs. Allyson Bennett and Peter Pierre and the technical assistance of Kimberly Black, Robert W. Gould and Michelle Icenhower.

References

  1. Bardo MT, Donohew RL, Harrington NG. Psychobiology of novelty seeking and drug seeking behavior. Behav Brain Res. 1996;77:23–43. [PubMed]
  2. Czoty PW, Morgan D, Shannon EE, Gage HD, Nader MA. Characterization of dopamine D1 and D2 receptor function in socially housed cynomolgus monkeys self-administering cocaine. Psychopharmacology. 2004;174:381–388. [PubMed]
  3. Czoty PW, Gage HD, Nader MA. PET imaging of striatal dopamine D2 receptors in nonhuman primates: increases in availability produced by chronic raclopride treatment. Synapse. 2005a;58:215–219. [PubMed]
  4. Czoty PW, McCabe C, Nader MA. Assessment of the reinforcing strength of cocaine in socially housed monkeys using a choice procedure. J Pharmacol Exp Ther. 2005b;312:96–102. [PubMed]
  5. Czoty PW, Gould RW, Nader MA. Relationship between social rank and cortisol and testosterone concentrations in male cynomolgus monkeys (Macaca fascicularis) J Neuroendocrinol. 2009;21:68–76. [PMC free article] [PubMed]
  6. Dalley JW, Fryer TD, Brichard L, Robinsin ES, Theobald DE, Laane K, Pena Y, Murphy ER, Shah Y, Probst K, Abakumova I, Aigbirhio FI, Richards HK, Hong Y, Baron JC, Everitt BJ, Robbins TW. Nucleus accumbens D2/3 receptors predict trait impulsivity and cocaine reinforcement. Science. 2007;315:1267–1270. [PMC free article] [PubMed]
  7. Dawe S, Loxton NJ. The role of impulsivity in the development of substance abuse and eating disorders. Neurosci Biobehav Rev. 2004;28:343–351. [PubMed]
  8. DeGrado TR, Turkington TG, Williams JJ, Stearns CW, Hoffman JM, Coleman RE. Performance characteristics of a whole-body PET scanner. J Nucl Med. 1994;35:1398–1406. [PubMed]
  9. Dellu F, Piazza PV, Mayo W, Le Moal M, Simon H. Novelty-seeking in rats—behavioral characteristics and possible relationship with the sensation-seeking trait in man. Neuropsychobiology. 1996;34:136–145. [PubMed]
  10. Grant KA, Shively CA, Nader MA, Ehrenkaufer RL, Line SW, Morton TE, Gage HD, Mach RH. The effect of social status on striatal dopamine D2 receptor binding characteristics in cynomolgus monkeys assessed with positron emission tomography. Synapse. 1998;29:80–83. [PubMed]
  11. Hooks MS, Jones GH, Smith AD, Neill DB, Justice JB., Jr Response to novelty predicts the locomotor and nucleus accumbens response to cocaine. Synapse. 1991;9:121–128. [PubMed]
  12. Kaplan JR, Manuck SB, Clarkson TB, Lusso FM, Taub DM. Social status, environment, and atherosclerosis in cynomolgus monkeys. Arteriosclerosis. 1982;2:359–368. [PubMed]
  13. Logan J, Fowler JS, Volkow ND, Wang GJ, Ding YS, Alexoff DL. Distribution volume ratios without blood sampling from graphical analysis of PET data. J Cereb Blood Flow Metab. 1996;16:834–840. [PubMed]
  14. Mach RH, Elder ST, Morton TE, Nowak PA, Evora PH, Scripko JG, Luedtke RR, Unsworth CD, Filtz T, Rao AV, et al. The use of [18F]4-fluorobenzyl iodide (FBI) in PET radiotracer synthesis: model alkylation studies and its application in the design of dopamine D1 and D2 receptor-based imaging agents. Nucl Med Biol. 1993a;20:777–794. [PubMed]
  15. Mach RH, Luedtke RR, Unsworth CD, Boundy VA, Nowak PA, Scripko JG, Elder ST, Jackson JR, Hoffman PL, Evora PH, et al. 18F-labeled benzamides for studying the dopamine D2 receptor with positron emission tomography. J Med Chem. 1993b;36:3707–3720. [PubMed]
  16. Mach RH, Nader MA, Ehrenkaufer RL, Line SW, Smith CR, Luedtke RR, Kung MP, Kung HF, Lyons D, Morton TE. Comparison of two fluorine-18 labeled benzamide derivatives that bind reversibly to dopamine D2 receptors: in vitro binding studies and positron emission tomography. Synapse. 1996;24:322–333. [PubMed]
  17. Mach RH, Nader MA, Ehrenkaufer RL, Line SW, Smith CR, Gage HD, Morton TE. Use of positron emission tomography to study the dynamics of psychostimulant-induced dopamine release. Pharmacol Biochem Behav. 1997;57:477–486. [PubMed]
  18. Morgan D, Grant KA, Prioleau OA, Nader SH, Kaplan JR, Nader MA. Predictors of social status in cynomolgus monkeys (Macaca fascicularis) after group formation. Am J Primatol. 2000;52:115–131. [PubMed]
  19. Morgan D, Grant KA, Gage HD, Mach RH, Kaplan JR, Prioleau O, Nader SH, Buchheimer N, Ehrenkaufer RL, Nader MA. Social dominance in monkeys: dopamine D2 receptors and cocaine self-administration. Nat Neurosci. 2002;5:169–174. [PubMed]
  20. Mufano MR, Yalcon B, Wills-Owen SA, Flint J. Association of the dopamine D4 receptor (DRD4) gene and approach-related personality traits: meta-analysis and new data. Biol Psychiatry. 2008;63:197–206. [PubMed]
  21. Nader MA, Czoty PW. PET imaging studies of dopamine D2 receptors in monkey models of cocaine abuse: genetic predisposition versus environmental modulation. Am J Psychiatry. 2005;162:1473–1482. [PubMed]
  22. Nader MA, Grant KA, Gage HD, Ehrenkaufer RL, Kaplan JR, Mach RH. PET imaging of dopamine D2 receptors with [18F] fluoroclebopride in monkeys: effects of isoflurane- and ketamine-induced anesthesia. Neuropsychopharmacology. 1999;21:589–596. [PubMed]
  23. Nader MA, Morgan D, Gage HD, Nader SH, Calhoun T, Buchheimer N, Ehrenkaufer R, Mach RH. PET imaging of dopamine D2 receptors during chronic cocaine self-administration in monkeys. Nature Neurosci. 2006;9:1050–1056. [PubMed]
  24. Perry JL, Larson EB, German JP, Madden GJ, Carroll ME. Impulsivity (delay discounting) as a predictor of acquisition of IV cocaine self-administration in female rats. Psychopharmacology. 2005;178:193–201. [PubMed]
  25. Piazza PV, Deminiere JM, Le Moal M, Simon H. Factors that predict individual vulnerability to amphetamine self-administration. Science. 1989;245:1511–1513. [PubMed]
  26. Piazza PF, Rouge-Pont F, Deminiere JM, Kharoubi M, Le Moal M, Siman H. Dopamine activity is reduced in the prefrontal cortex and increased in the nucleus accumbens of rats predisposed to develop amphetamine self-administration. Brain Res. 1991;567:169–174. [PubMed]
  27. Piazza PV, Deroche-Gamonet V, Rouge-Pont F, Le Moal M. Vertical shifts in self-administration dose–response functions predict a drug-vulnerable phenotype predisposed to addiction. J Neurosci. 2000;20:4226–4232. [PubMed]
  28. Retz W, Rosler M, Supprian T, Retz-Junginger P, Thome J. Dopamine D3 receptor gene polymorphism and violent behavior: relation to impulsiveness and ADHD-related psychopathology. J Neural Transm. 2003;110:561–572. [PubMed]
  29. Riddick NV, Czoty PW, Gage HD, Kaplan JR, Nader SH, Icenhower M, Pierre PJ, Bennett A, Garg PK, Nader MA. Behavioral and neurobiological characteristics influencing social hierarchy formation in female cynomolgus monkeys. Neuroscience. 2009;158:1257–1265. [PMC free article] [PubMed]
  30. Rouge-Pont F, Piazza PV, Kharouby M, Le Moal M, Simon H. Higher and longer stress-induced increase in dopamine concentrations in the nucleus accumbens of animals predisposed to amphetamine self-administration. A microdialysis study Brain Res. 1993;602:169–174. [PubMed]
  31. Stoffel EC, Cunningham KA. The relationship between the locomotor response to a novel environment and behavioral disinhibition in rats. Drug Alcohol Depend. 2007;92:69–78. [PubMed]
  32. Thanos PK, Volkow ND, Freimuth P, Umrgaki H, Ikari H, Roth G, Ingram DK, Hitzemann R. Overexpression of dopamine D2 receptors reduces alcohol self-administration. J Neurochem. 2001;78:1094–1103. [PubMed]
  33. Verdejo-Garcia A, Laerence AJ, Clark L. Impulsivity as a vulnerability marker for substance-use disorders: Review of findings form high-risk research, problem gamblers and genetic association studies. Neurosci Biobehav Rev. 2008;32:777–810. [PubMed]
  34. Volkow ND, Wang GJ, Fowler JS, Logan J, Gatley SJ, Gifford A, Hitzemann R, Ding YS, Pappas N. Prediction of reinforcing responses to psychostimulants in humans by brain D2 dopamine receptors. Amer J Psychiatry. 1999;156:1440–1443. [PubMed]
  35. Zald DH, Cowan RL, Riccardi P, Baldwin RM, Ansari MS, Li R, Shelby ES, Smith CE, McHugo M, Kessler RM. Midbrain dopamine receptor availability is inversely associated with novelty seeking traits in humans. J Neurosci. 2008;28:14372–14378. [PMC free article] [PubMed]

 

Dissociable Contributions by Prefrontal D1 and D2 Receptors to Risk Based Decision Making (2011)

 J Neurosci. 2011 Jun 8;31(23):8625-33.

St Onge JR, Abhari H, Floresco SB.

Source

Department of Psychology and Brain Research Center, University of British Columbia, Vancouver, British Columbia V6T 1Z4, Canada

Abstract

Choices between certain and uncertain rewards of different magnitudes have been proposed to be mediated by both the frontal lobes and the mesocorticolimbic dopamine (DA) system. In rats, systemic manipulations of DA activity or inactivation of the medial prefrontal cortex (PFC) disrupt decision making about risks and rewards. However, it is unclear how PFC DA transmission contributes to these processes. We addressed this issue by examining the effects of pharmacological manipulations of D1 and D2 receptors in the medial (prelimbic) PFC on choice between small, certain and large, yet probabilistic rewards. Rats were trained on a probabilistic discounting task where one lever delivered one pellet with 100% probability, and the other delivered four pellets, but the probability of receiving reward decreased across blocks of trials (100, 50, 25, 12.5%). D1 blockade (SCH23390) in the medial PFC decreased preference for the large/risky option. In contrast, D2 blockade (eticlopride) reduced probabilistic discounting and increased risky choice. The D1 agonist SKF81297 caused a slight, nonsignificant increase in preference for the large/risky lever. However, D2 receptor stimulation (quinpirole) induced a true impairment in decision making, flattening the discounting curve and biasing choice away from or toward the risky option when it was more or less advantageous, respectively. These findings suggest that PFC D1 and D2 receptors make dissociable, yet complementary, contributions to risk/reward judgments. By striking a fine balance between D1/D2 receptor activity, DA may help refine these judgments, promoting either exploitation of current favorable circumstances or exploration of more profitable ones when conditions change.

Introduction

Aberrations of the mesocorticolimbic dopamine (DA) system have been linked to profound deficits in decision making associated with certain psychiatric diseases. These include individuals with schizophrenia (Hutton et al., 2002), Parkinson's disease (Pagonabarraga et al., 2007), and stimulant addiction (Rogers et al., 1999). Animal models of decision making have revealed that manipulations of DA transmission can profoundly alter choices between small, easy to obtain rewards and large, yet more costly rewards. Systemic blockade of D1 or D2 receptors reduces the preference to wait longer or work harder to obtain a larger reward, whereas increasing DA transmission exerts differential effects on effort- or delay-based decision making, increasing or decreasing preference for larger rewards that come with a greater cost (Cousins et al., 1994; Cardinal et al., 2000; Denk et al., 2005; van Gaalen et al., 2006; Floresco et al., 2008a; Bardgett et al., 2009). Similarly, when rats choose between small, certain and large, yet risky rewards on a probabilistic discounting task, systemic administration of D1 or D2 antagonists reduces preference for large, risky options (St. Onge and Floresco, 2009). Conversely, D1 or D2 agonists bias choice toward large, risky options. However, given that numerous brain regions have been implicated in risk/reward judgments (e.g., frontal lobes, ventral striatum, amygdala) (Floresco et al., 2008b), the terminal regions on which DA may be acting to influence these processes remains unclear.

DA modulates multiple cognitive functions mediated by different regions of the prefrontal cortex (PFC), such as behavioral flexibility, working memory, and attentional processes (Williams and Goldman-Rakic, 1995; Granon et al., 2000; Chudasama and Robbins, 2004; Floresco et al., 2006), often in an “inverted U”-shaped curve, where too little or too much DA activity impairs certain executive functions. However, there have been comparatively few studies investigating the contribution of PFC DA transmission to different forms of cost/benefit decision making. Reducing DA activity in the anterior cingulate alters effort-based decisions (Schweimer et al., 2005; Schweimer and Hauber, 2006), whereas blockade or stimulation of medial PFC D1 receptors reduces preference for larger, delayed rewards (Loos et al., 2010). Notably, there have been no studies investigating the contribution of different PFC DA receptors to risk-based decision making.

Recent work has identified the prelimbic medial PFC as a critical region in the mediation of probabilistic discounting, whereas activity in other subregions (anterior cingulate, orbitofrontal, insular) do not appear to contribute to this behavior (St. Onge and Floresco, 2010). Inactivation of the medial PFC increased preference for larger, probabilistic rewards when the odds of obtaining them decreased over a session, but decreased choice when reward probabilities increased over a session. The results of this study led us to conclude that the medial PFC serves to integrate information about changing reward probabilities to update value representations that facilitate more efficient decision making. Given the critical role that mesocortical DA plays in other forms of cognition (Floresco and Magyar, 2006), the present study investigated the contribution of prefrontal D1/D2 receptor activity to risk-based decision making using a probabilistic discounting task.

Materials and Methods

Animals.

Male Long–Evans rats (Charles River Laboratories) weighing 275–300 g at the beginning of behavioral training were used for the experiment. Upon arrival, rats were given 1 week to acclimatize to the colony and food was restricted to 85–90% of their free-feeding weight for an additional week before behavioral training. Rats were given ad libitum access to water for the duration of the experiment. Feeding occurred in the rats' home cages at the end of the experimental day, and body weights were monitored daily to ensure a steady weight loss during food restriction and maintenance or weight gain for the rest of the experiment. All testing was in accordance with the Canadian Council of Animal Care and the Animal Care Committee of the University of British Columbia.

Apparatus.

Behavioral testing was conducted in 12 operant chambers (30.5 × 24 × 21 cm; Med Associates) enclosed in sound-attenuating boxes, each equipped with a fan to provide ventilation and to mask extraneous noise. Each chamber was fitted with two retractable levers, one located on each side of a central food receptacle where food reinforcement (45 mg; Bio-Serv) was delivered via a pellet dispenser. The chambers were illuminated by a single 100 mA house light located in the top-center of the wall opposite the levers. Four infrared photobeams were mounted on the sides of each chamber. Locomotor activity was indexed by the number of photobeam breaks that occurred during a session. All experimental data were recorded by an IBM personal computer connected to the chambers via an interface.

Lever-pressing training.

Our initial training protocols were identical to those of St. Onge and Floresco (2009), as adapted from Cardinal et al. (2000). On the day before their first exposure to the chambers, rats were given ∼25 sugar reward pellets in their home cage. On the first day of training, 2–3 pellets were delivered into the food cup and crushed pellets were placed on a lever before the animal was placed in the chamber. Rats were first trained under a fixed-ratio 1 schedule to a criterion of 60 presses in 30 min, first for one lever, and then repeated for the other lever (counterbalanced left/right between subjects). Rats were then trained on a simplified version of the full task. These 90 trial sessions began with the levers retracted and the operant chamber in darkness. Every 40 s, a trial was initiated with the illumination of the house light and the insertion of one of the two levers into the chamber. If the rat failed to respond on the lever within 10 s, the lever was retracted, the chamber darkened, and the trial was scored as an omission. If the rat responded within 10 s, the lever retracted and a single pellet was delivered with 50% probability. This procedure was used to familiarize the rats with the probabilistic nature of the full task. In every pair of trials, the left or right lever was presented once, and the order within the pair of trials was random. Rats were trained for ∼5–6 d to a criterion of 80 or more successful trials (i.e.; ≤10 omissions).

Probabilistic discounting task.

The primary task used in these studies has been described previously (Floresco and Whelan, 2009; Ghods-Sharifi et al., 2009; St. Onge and Floresco, 2009, 2010; St. Onge et al., 2010), and was originally modified from that described by Cardinal and Howes (2005) (Fig. 1). Briefly, rats received daily sessions consisting of 72 trials, separated into 4 blocks of 18 trials. The entire session took 48 min to complete, and animals were trained 6–7 d per week. A session began in darkness with both levers retracted (the intertrial state). A trial began every 40 s with the illumination of the house light and, 3 s later, insertion of one or both levers into the chamber (the format of a single trial is shown in Fig. 1). One lever was designated the large/risky lever, the other the small/certain lever, which remained consistent throughout training (counterbalanced left/right). If the rat did not respond by pressing a lever within 10 s of lever presentation, the chamber was reset to the intertrial state until the next trial (omission). When a lever was chosen, both levers retracted. Choice of the small/certain lever always delivered one pellet with 100% probability; choice of the large/risky lever delivered 4 pellets but with a particular probability. When food was delivered, the house light remained on for another 4 s after a response was made, after which the chamber reverted back to the intertrial state. Multiple pellets were delivered 0.5 s apart. The 4 blocks were comprised of 8 forced-choice trials in which only one lever was presented (4 trials for each lever, randomized in pairs), permitting animals to learn about the relative likelihood of receiving the larger or smaller reward in each block. This was followed by 10 free-choice trials, in which both levers were presented and the animal chose either the small/certain or the large/risky lever. The probability of obtaining 4 pellets after pressing the large/risky lever varied across blocks: it was initially 100%, then 50%, 25%, and 12.5%, respectively, for each successive block. The probability of receiving the large reward on each trial was drawn from a set probability distribution. Using these probabilities, selection of the large/risky lever would be advantageous in the first two blocks, and disadvantageous in the last block, whereas rats could obtain an equivalent number of food pellets after responding on either lever during the 25% block. Therefore, in the last three trial blocks of this task, selection of the larger reward option carries with it an inherent “risk” of not obtaining any reward on a given trial. Latencies to initiate a choice and overall locomotor activity (photobeam breaks) were also recorded. Rats were trained on the task until, as a group, they (1) chose the large/risky lever during the first trial block (100% probability) on at least 80% of successful trials, and (2) demonstrated stable baseline levels of choice, assessed using a procedure similar to that described by Winstanley et al. (2005) and St. Onge and Floresco (2009). In brief, data from three consecutive sessions were analyzed with repeated-measures ANOVA with two within-subject factors (day and trial block). If the effect of block was significant at the p < 0.05 level but there was no main effect of day or day × trial block interaction (at p > 0.1 level), animals were judged to have achieved stable baseline levels of choice behavior.

Figure 1.

Task design. Cost/benefit contingencies associated with responding on either lever (A) and format of a single free-choice trial (B) on the probabilistic discounting task.

Reward magnitude discrimination task.

As we have done previously (Ghods-Sharifi et al., 2009; Stopper and Floresco, 2011), we determined a priori that if a particular treatment specifically decreased preference for the large/risky lever on the probabilistic discounting task, separate groups of animals would be trained and tested on a reward magnitude discrimination task to determine whether this effect was due to an impairment in discriminating between reward magnitudes associated with the two levers. In these experiments, rats were trained to press retractable levers as in the probabilistic discounting task, after which they were trained on the discrimination task. Here, rats chose between one lever that delivered one pellet and another that delivered four pellets. Both the small and large rewards were delivered immediately after a single response with 100% probability. A session consisted of four blocks of trials, with each block consisting of 2 forced-choice followed by 10 free-choice trials.

Surgery.

Rats were subjected to surgery once the group displayed stable patterns of choice for 3 consecutive days. After the stability criterion was achieved, rats were provided food ad libitum and, 2 d later, underwent stereotaxic surgery. Rats were anesthetized with 100 mg/kg ketamine hydrochloride and 7 mg/kg xylazine and subsequently implanted with bilateral 23 gauge stainless steel guide cannulae into the prelimbic region of the medial PFC (flat skull; anteroposterior, +3.4 mm; medial-lateral, ±0.7 mm from bregma; and dorsoventral, −2.8 mm from dura). Thirty gauge obdurators, flush with the end of guide cannulae, remained in place until the infusions were made. Rats were given at least 7 d to recover from surgery before testing. During this recovery period, animals were handled for at least 5 min each day and food was restricted to 85% of their free-feeding weight. Body weights were continuously monitored on a daily basis to ensure a steady weight loss during this recovery period.

Microinfusion protocol.

Following recovery from surgery, rats were subsequently retrained on either the probabilistic discounting or reward magnitude discrimination task for at least 5 d and until, as a group, they displayed stable levels of choice behavior. For 3 d before the first microinfusion test day, obdurators were removed and a mock infusion procedure was administered. Stainless steel injectors were placed in the guide cannulae for 2 min, but no infusion took place. This procedure habituated rats to the routine of infusions to reduce stress on subsequent test days. The day after displaying stable discounting, the group received its first microinfusion test day.

A within-subjects design was used for all experiments. The following drugs were used: the D1 antagonist R-(+)-SCH23390 hydrochloride (1.0 μg, 0.1 μg; Sigma-Aldrich), the D2 antagonist eticlopride hydrochloride (1.0 μg, 0.1 μg; Sigma-Aldrich), the D1 receptor agonist SKF81297 (0.4 μg, 0.1 μg; Tocris Bioscience), and the D2 agonist quinpirole (10 μg, 1 μg; Sigma-Aldrich). All drugs were dissolved in physiological 0.9% saline, sonicated until dissolved, and protected from light. The selected doses have all been well documented by both our group and others to be behaviorally active when given intracerebrally (Seamans et al., 1998; Ragozzino, 2002; Chudasama and Robbins, 2004; Floresco and Magyar, 2006; Floresco et al., 2006; Haluk and Floresco, 2009; Loos et al., 2010).

Infusions of the D1 and D2 antagonists, agonists, and saline were administered bilaterally into the medial PFC via a microsyringe pump connected to PE tubing and 30 gauge cannulae that protruded 0.8 mm past the end of the guide, at a rate of 0.5 μl/75 s. Injection cannulae were left in place for an additional 1 min to allow for diffusion. Each rat remained in its home cage for another 10 min period before behavioral testing.

Four separate groups of rats were used to test the effects of each of the four compounds (D1 antagonist, D2 antagonist, D1 agonist, D2 agonist). The order of treatments (saline, low dose, high dose) was counterbalanced across rats within a particular treatment group. Following the first infusion test day, rats received a baseline training day (no infusion). If, for any individual rat, choice of the large/risky lever on this day deviated by >15% from its preinfusion baseline, the rat received an additional day of training before the second infusion test. On the next day, rats received a second counterbalanced infusion, followed by another baseline day, and finally the last infusion.

Histology.

After completion of all behavioral testing, rats were killed in a carbon dioxide chamber. Brains were removed and fixed in a 4% formalin solution. The brains were frozen and sliced in 50 μm sections before being mounted and stained with cresyl violet. Placements were verified with reference to the neuroanatomical atlas of Paxinos and Watson (1998). The locations of acceptable infusions in the medial PFC are presented in the right panels of Figure 2.

Figure 2.

Histology. Schematic of coronal sections of the rat brain showing the range of acceptable locations of infusions through the rostral-caudal extent of the medial PFC for all rats.

Data analysis.

The primary dependent measure of interest was the percentage of choices directed toward the large/risky lever for each block of free-choice trials, factoring in trial omissions. For each block, this was calculated by dividing the number of choices of the large/risky lever by the total number of successful trials. The choice data for each drug group were analyzed using two-way within-subject ANOVAs, with treatment (saline, low dose, high dose) and trial block (100, 50, 25, 12.5%) as the within-subject factors. The main effect of block for the choice data was significant in all discounting experiments (p < 0.05), indicating that rats discounted choice of the large/risky lever as the probability of the large reward changed across the four blocks. This effect will not be mentioned further. Response latencies, locomotor activity (photobeam breaks), and the number of trial omissions were analyzed with one-way ANOVAs.

Previous SectionNext Section

Results

Four groups of animals were initially trained in separate experiments and allocated to one of the four drug groups. The first two groups of 16 each, designated for D1 and D2 antagonist experiments, required an average of 28 d of training before reaching stable choice performance and receiving counterbalanced microinfusion tests. The second two groups of 14 and 14 rats for the D1 and D2 agonists required an average of 34 d of training before reaching stable choice performance. Response latency, locomotor, and trial omission data obtained on test days for all four groups are presented in Table 1.

Table 1.

Locomotion, trial omission, and response latency data obtained following saline or drug infusions into the medial PFC

D1 and D2 receptor antagonism and probabilistic discounting

D1 blockade

Initially, 16 rats were trained for this experiment. One animal died during surgery and the data from three others were eliminated due to inaccurate placements, resulting in a final n = 12. Analysis of the choice data revealed that intra-PFC infusions of the D1 antagonist SCH23390 resulted in a significant main effect of treatment (F(2,22) = 3.26, p = 0.05) but no treatment × block interaction (F(6,66) = 0.92, n.s.). The high dose of SCH23390 (1 μg) significantly decreased preference for the large/risky lever in the latter three blocks (p < 0.05; Fig. 3A), whereas the low dose (0.1 μg) produced no reliable change in choice behavior. D1 blockade had no effect on response latencies (F(2,22) = 0.18, n.s.), trial omissions (F(2,22) = 0.54, n.s.), or locomotor counts (F(2,22) = 1.66, n.s.).

Figure 3.

Effects of DA receptor manipulations in the medial PFC on probabilistic discounting. Data are plotted in terms of percentage choice of the large/risky lever during free-choice trials by probability block (x-axis). Symbols represent mean + SEM. Gray stars denote a significant main effect (saline vs high dose, p < 0.05). Black stars denote a significant difference (p < 0.05) between treatment conditions during a particular probability block main effect. A, Infusions of the 1.0 μg dose of D1 antagonist SCH23390 accelerated probabilistic discounting, reducing risky choice. B, In contrast, infusions of the 1.0 μg dose of the D2 antagonist eticlopride retarded discounting and increased risky choice. C, The D1 agonist SKF81297 induced a slight, nonsignificant increase in risky choice. D, Infusions of the 10 μg dose of the D2 agonist quinpirole abolished discounting, decreasing risky choice during the initial block and increasing choice during the final block.

D2 blockade

Initially, 16 rats were trained for this experiment. One animal died during surgery and the data from three others were eliminated due to inaccurate placements, resulting in a final n = 12. Analysis of the choice data also revealed a significant main effect of treatment (F(2,22) = 3.76, p < 0.05) but no treatment × block interaction (F(6,66) = 0.84, n.s.). However, in contrast to the effects of D1 receptor blockade, the high dose of eticlopride (1 μg) significantly increased preference for the large/risky lever across all blocks (p < 0.05; Fig. 3B), with the low dose (0.1 μg) producing a slight, but nonsignificant increase in choice. Eticlopride had no effect on response latencies (F(2,22) = 0.63, n.s.), trial omissions (F(2,22) = 1.45, n.s.), or locomotor counts (F(2,22) = 0.99, n.s.). Thus, blockade of D1 or D2 receptors in the medial PFC had qualitatively opposite effects on probabilistic discounting. Reducing D1 receptor activity increased discounting of larger, uncertain rewards, whereas D2 receptor antagonism reduced discounting, reflected as apparent decreases and increases in risky choice, respectively.

D1 and D2 receptor stimulation and probabilistic discounting

D1 stimulation

Initially, 14 rats were trained for this experiment. One animal died during surgery and the data from one rat were excluded because his baseline choice data were 2 SDs below the mean of the rest of the group, resulting in a final n = 12. Following administration of the D1 agonist SKF81297 into the medial PFC, rats tended to show an effect opposite to that induced by the D1 antagonist, displaying a moderate increase in preference for the large/risky lever, with this effect being numerically greater after treatment with the lower, 0.1 μg dose. Despite this tendency, analysis of the choice data did not reveal a significant effect of treatment (F(2,22) = 2.05, n.s.) or treatment × block interaction (F(6,66) = 0.10, n.s.; Fig. 3C), although a direct comparison between the low-dose and saline treatment conditions did show a trend toward statistical significance (p = 0.086). The D1 agonist also had no effect on response latencies (F(2,22) = 0.67, n.s.), trial omissions (F(2,22) = 0.06, n.s.), or locomotor counts (F(2,22) = 0.36, n.s.).

D2 stimulation

Again, 14 rats were trained for this experiment. The data from one rat were excluded because his baseline choice data showed no prominent discounting after the 34 d of training, while the data pertaining to another rat were eliminated due to an inaccurate placement, resulting in a final n = 12 in this group. Treatment with the D2 agonist quinpirole induced an effect on choice that was unique when compared with that induced by either DA receptor antagonist or the D1 agonist. Analysis of the choice data revealed no significant main effect of treatment (F(2,22) = 0.05, n.s.), but there was a significant treatment × block interaction (F(6,66) = 2.33, p < 0.05, Dunnett's p < 0.05). Simple main effects analyses further showed that, whereas the low dose (1 μg) of quinpirole had no effect on choice, the high dose (10 μg) produced a pronounced “flattening” of the discounting curve. Specifically, this dose significantly (p < 0.05) decreased choice of the large/risky lever in the initial 100% block, but significantly increased risky choice during the last block (12.5%) relative to saline infusions (Fig. 3D). Moreover, following infusions of either saline or the 1.0 μg dose of quinpirole, rats showed significant discounting of the large/risky option as the odds of obtaining the larger reward decreased over a session (p < 0.005). In contrast, the proportion of choice of this option did not significantly change across the four blocks after treatment with 10 μg of quinpirole (p > 0.25). Quinpirole had no effect on trial omissions (F(2,22) = 0.84, n.s.) or locomotor counts (F(2,22) = 1.72, n.s.), although the high dose significantly increased choice latencies across the four blocks (F(2,22) = 3.54, p < 0.05 and Dunnett's, p < 0.05; Table 1).

Win-stay/lose-shift analysis

Infusions of selective D1 or D2 receptor agonists or antagonist into the medial PFC each induced distinct effects on decision making. To obtain further insight into how these treatments affected patterns of choice and resulting alterations in discounting, we conducted a supplementary analysis of the choice data. Specifically, we conducted a choice-by-choice analysis to identify whether changes in behavior were due to alterations in the likelihood of choosing the risky lever after obtaining the larger reward (win-stay performance) or alterations in negative feedback sensitivity (lose-shift performance) (Bari et al., 2009; Stopper and Floresco, 2011). Animals' choices during the task were analyzed according to the outcome of each preceding free-choice trial (reward or non-reward) and expressed as a ratio. The proportion of win-stay trials was calculated from the number of times the rat chose the large/risky lever after choosing the risky option on the preceding trial and obtaining the large reward (a win), divided by the total number of free-choice trials in which the rat obtained the larger reward. Conversely, lose-shift performance was calculated from the number of times rats shifted choice to the small/certain lever after choosing the risky option on the preceding trial and were not rewarded (a loss), divided by the total number of free-choice trials resulting in a loss.

Because of the probabilistic nature of the task, across the four experiments there were at least 4–5 instances where an individual animal either did not select the large/risky lever (and therefore, could not “stay” or “shift” after a win or loss) or did not obtain the large reward at all during a certain probability block (particularly the latter two blocks). Thus, in either of these cases, the denominator in the equation used to compute these ratios would be zero for at least one of the blocks, which precluded us from conducting a block-by block analysis of these data. To overcome this, an analysis was conducted for all trials across the four blocks, as we have done previously (Stopper and Floresco, 2011). Changes in win-stay performance were used as a general index of the impact that obtaining the large, risky reward had on subsequent choice behavior, whereas changes in lose-shift performance served as an index of negative feedback sensitivity over the entire duration of the test session.

Given that each of the four compounds induced distinct effects on choice behavior, we were particularly interested in directly comparing the effects of each compound relative to saline treatment. For this analysis, we used data obtained following treatment with the most effective doses of each drug and corresponding vehicle injections (for SKF81297, we used data obtained after treatment with the lower, 0.1 μg dose). Analysis of win-stay and lose-shift trials revealed a significant four-way interaction of trial type (win-stay vs lose-shift) × treatment (saline vs drug) × receptor (D1 vs D2) × drug type (antagonist vs agonist) (F(1,44) = 11.92, p < 0.05; Fig. 4, Table 2). As was observed with analysis of overall choice behavior, this four-way interaction was driven by the fact that each drug induced a distinct effect on win-stay/lose-shift tendencies. With respect to win-stay performance, under control conditions, rats displayed a strong tendency (between 80 and 90%) to select the risky lever after selecting this lever on the preceding trial and receiving reward, as we have observed previously (Stopper and Floresco, 2011). Conversely, animals tended to shift to the small/certain lever following a “loss” after choosing the large/risky lever on ∼25–30% of these trials under control conditions.

Figure 4.

Effects of PFC DA receptor manipulations on win-stay (gray bars) and lose-shift (white bars) tendencies. For clarity and comparative purposes, the data are presented here in terms of a difference score between the ratios obtained on drug versus saline treatments (positive values indicate an increased ratio, negative values a decrease after drug treatment relative to control infusions). Raw data used in the overall analysis from which these values were obtained are presented in Table 2. Win-stay ratios index the proportion of trials for which rats chose the large/risky lever after receiving the larger reward on the previous trial. Lose-shift ratios index the proportion of trials for which rats shifted choice to the small/certain lever following unrewarded choice of the large/risky lever. Stars denote a significant difference from saline at the 0.05 level. n.s., not significant.

Table 2.

Win-stay/lose-shift ratios for rats performing the probabilistic discounting task following infusion of saline and the highest or most effective dose of D1 and D2 antagonist or agonists

Simple main effects analysis of the four-way interaction revealed that the D1 antagonist SCH23390 did not affect win-stay performance but did significantly increase lose-shift tendencies (Dunnett's, p < 0.05), suggesting that the decrease in risky choice induced by these treatments may be attributable in part to increased sensitivity to negative feedback (i.e; reward omission). In contrast, D2 blockade with eticlopride (1 μg) significantly increased the probability of choosing the risky option following a “win” (p < 0.05), while causing a nonsignificant decrease in lose-shift tendencies. Thus, the increase in risky choice induced by D2 blockade appears to be attributable primarily to an enhanced impact of obtaining a large reward on subsequent choice.

The D1 agonist SKF81297 (0.1 μg) significantly increased win-stay performance versus saline (p < 0.05), but also had the opposite effect of SCH23390, reducing the tendency to shift after a loss from the large/risky lever (p < 0.05). In contrast, quinpirole (10 μg) had the opposite effect of the D1 agonist on win-stay tendencies, significantly decreasing the probability of choosing the large/risky lever after a “win” (p < 0.05), suggesting a reduced sensitivity to receipt of larger, yet uncertain rewards. This treatment had no significant effect on lose-stay ratios. These findings indicate that D1 vs D2 receptor modulation induces differential changes in choice performance that appear to be characterized by distinct changes in the impact of either obtaining the larger reward or negative feedback sensitivity.

Reward magnitude discrimination

Blockade of D1 receptors or stimulation of D2 receptors reduced preference for the larger, uncertain reward during certain trial blocks of the discounting task. To assess whether these effects were attributable to a general disruption in discriminating between rewards of different magnitudes, we conducted another experiment, wherein two separate groups of rats were trained on a simpler task. Rats chose between two levers that delivered either one or four pellets, both with 100% probability. Fifteen rats were trained for 11 d on this task before receiving counterbalanced microinfusions of the high dose of SCH23390 (1 μg) or quinpirole (10 μg) and saline. The data for one animal were removed due to an inaccurate placement, leaving a final n of 6 in the SCH23390 group and 8 in the quinpirole group.

D1 blockade

Following saline infusions, rats displayed a very strong bias toward the larger reward, selecting this option on nearly 100% of the trials (Fig. 5A). Following infusions of SCH23390 (1 μg), there was no change in preference toward the four-pellet option (F(1,5) = 1.72, n.s.). In contrast to choice, we did see a slight increase in response latencies following D1 blockade (saline = 0.81 ± 0.1 s, SCH23390 = 0.98 ± 0.1 s; F(1,5) = 7.18, p < 0.05). Locomotor activity (F(1,5) = 4.86, n.s.) and trial omissions (F(1,5) = 1.0, n.s.) were unaffected by SCH23390. Thus, even though infusions of this dose of SCH23390 reduced choice of the larger reward option during the probabilistic discounting task, this effect does not appear to be attributable to a general reduction in the subjective value of larger rewards.

Figure 5.

Effects of DA receptor modulation in the medial PFC on reward magnitude discrimination. Rats were trained to choose between two levers that delivered either a four- or one-pellet reward immediately after a single press with 100% probability. A, D1 blockade (SCH23390, 1 μg) did not significantly disrupt the preference for the larger four-pellet reward during free-choice trials relative to saline treatment. B, D2 receptor stimulation (quinpirole, 10 μg) also did not alter preference for the large reward.

D2 receptor stimulation

A similar profile of choice was observed for the rats receiving the high dose (10 μg) of quinpirole into the medial PFC. Again, rats selected the four-pellet option on almost all of the free-choice trials after saline infusions. This preference was not altered by stimulation of D2 receptors (F(1,6) = 0.53, n.s.; Fig. 5B). Quinpirole also had no significant effect on latencies, locomotion, or omissions (all F values <1.76, n.s.). Note that similar treatments did reduce choice of the larger reward on the probabilistic discounting task during the first, 100% probability block (Fig. 3B). A possible explanation for this difference is that, unlike rats trained on the reward magnitude discrimination, those trained on the discounting task had learned that the relative utility of the large/risky option decreases over a session. Thus, their representation of the relative value of the large reward option would be expected to be more labile than that of rats trained on the simpler task and, therefore, more susceptible to disruption. Collectively, the results of this experiment show that even though blockade of D1 receptors and stimulation of D2 receptors substantially alters choices between small, certain and large, probabilistic rewards, these effects do not appear to be attributable to more fundamental impairments in the ability to discriminate between larger and smaller rewards.

Discussion

Here we report that D1 and D2 receptors in the medial PFC exert a critical influence over choices between probabilistic versus certain rewards. Furthermore, decreasing or increasing activity of each of these receptors produced differing, and sometimes opposite, changes in choice, suggesting that they each exert distinct, yet complementary modulatory control over these decision-making processes.

Effects of D1/D2 receptor blockade

To our knowledge, this is the first demonstration that blockade of D1 or D2 receptor in the medial PFC induces opposing effects on behavior. Previous studies of this kind have revealed either that D1, but not D2, antagonism disrupts functions such as attention or working memory (Williams and Goldman-Rakic, 1995; Seamans et al., 1998; Granon et al., 2000) or that both receptors act cooperatively to facilitate set-shifting or bias behavior away from conditioned punishers (Ragozzino, 2002; Floresco and Magyar, 2006). Our findings that SCH23390 and eticlopride induced opposite effects on choice suggest that normal decision making is dependent on a critical balance of frontal lobe D1 and D2 receptor activity, and that altering this balance induces dissociable changes in choice of certain/uncertain rewards.

PFC D1 blockade decreased preference for the large/risky option in a dose-dependent manner, most prominently during the last three probability blocks. SCH23390 increased probabilistic discounting, resembling the effects of this compound when administered systemically (St. Onge and Floresco, 2009). Interestingly, reducing DA transmission in human subjects via tyrosine depletion also leads to more conservative and poorer quality decision making on the Cambridge Gambling Task (McLean et al., 2004). Our results suggest that these effects may be mediated in part by reduced prefrontal D1 activation. Choice-by-choice analysis further revealed that this reduced preference for the risky option was linked to an increased tendency to choose the small/certain option following a non-rewarded risky choice, suggesting that the effects on decision making may be the result of increased sensitivity to negative feedback. In a similar vein, blockade of D1 receptors in the prelimbic or anterior cingulate reduces preference for larger rewards when they are either delayed (Loos et al., 2010) or associated with a greater effort cost (Schweimer and Hauber, 2006). Collectively, these findings suggest that PFC D1 signaling exerts a profound influence on cost/benefit evaluations, facilitating the ability to overcome costs that may be associated with larger rewards in an effort to maximize long-term gains.

In stark contrast, PFC D2 receptor blockade increased preference for the large/risky option, slowing the shift in choice bias as reward probabilities decreased over a session. Notably, this effect resembles that induced by PFC inactivation under similar task conditions (St. Onge and Floresco, 2010). However, we do not believe this reflects a general increase in “risky” behavior per se. Rather, our previous findings led us to conclude that the medial PFC plays a critical role in monitoring changes in reward probabilities to adjust behavior accordingly. The present results expand on this, revealing that D2 receptors make an essential contribution to PFC regulation of this aspect of decision making. This apparent increase in risky choice was driven more prominently by an increased tendency to select the risky option after obtaining a large reward on the preceding trial. Thus, rather than integrating information about the likelihood of obtaining the larger reward across multiple trials, D2 blockade caused receipt of the larger reward to exert a greater and more immediate impact on the direction of subsequent choice. This is in keeping with a recent study in humans, in which D2 antagonism increased both choice of options associated with higher reward probabilities and corresponding changes in ventromedial PFC activity (Jocham et al., 2011). Collectively, these findings show that PFC D1 and D2 receptors form distinct, yet complementary contributions to decision making. D1 receptor activity promotes choice of larger, yet uncertain or more costly rewards, whereas D2 receptors mitigate the immediate impact that larger, probabilistic rewards exert over choice bias, facilitating the ability to adjust behavior over the long-term when the likelihood of obtaining these rewards changes.

Effects of D1/D2 receptor stimulation

Intra-PFC infusions of D1 receptor agonist SKF81297, within dose ranges that have been shown to exert differential effects on other forms of cognition (attention, working memory), did not significantly alter risky choice, although these treatments slightly increased preference for the large/risky lever, most prominently with the low dose. Interpretation of this null effect should be approached with caution, as these non-monotonic dose/response effects suggest that SKF81297 may have an effective dose range that is narrower than it may be for other cognitive functions. Moreover, the 0.1 μg dose did significantly alter choice patterns, increasing win-stay performance and decreasing lose-shift tendencies, where rats were more likely to choose the large/risky lever following both rewards and reward omissions. Nevertheless, the fact that increasing doses of SKF81297 did not significantly alter choice indicates that supranormal stimulation of PFC D1 receptors does not substantially interfere with decision making about risks and rewards. In contrast, similar treatments decrease choice of larger, delayed rewards (Loos et al., 2010), providing further support that different types of cost/benefit decision making can be dissociated pharmacologically.

The D2 agonist quinpirole induced a true “impairment” in decision making, markedly flattening the discounting curve, with rats displaying no discernable discounting upon changes in reward probabilities. Choice of the four-pellet option was reduced in the 100% block (when it was most advantageous), but increased in the 12.5% block (when it is least advantageous). Following D2 stimulation, the overall proportion of large/risky choices did not change relative to saline (∼73%), but animals were completely insensitive to changes in these probabilities. Thus, excessive D2 receptor activation severely interfered with the ability to adjust choice, apparently causing rats to use a simpler alternation strategy across blocks while maintaining a bias toward the large/risky lever. This finding, in combination with the effects of eticlopride, suggests that the relative levels of D2 (rather than D1) receptor tone in the medial PFC has a critical impact on this aspect of decision making, and either increasing or decreasing this activity can interfere with performance.

The disadvantageous choice pattern produced by quinpirole bears a striking resemblance to that induced by reducing motivation for food through long-term free-feeding (St. Onge and Floresco, 2009). These complementary findings make it tempting to speculate that they may be related phenomena. Indeed, changes in medial PFC DA efflux have been proposed to reflect a generalized food reward or incentive motivational signal (Ahn and Phillips, 1999; Winstanley et al., 2006). Thus, changes in the amount of reward obtained over time may be signaled to the PFC by corresponding fluctuations in mesocortical DA levels that, via actions on D2 receptors, may be used to detect changes in the amount of reward obtained over time and facilitate alterations in choice bias. It follows that flooding D2 receptors may disrupt this dynamic signal, which could ultimately produce more static patterns of choice.

Dissociable contributions of PFC D1 and D2 receptors to risk-based decision making

The question remains as to why blockade of D1 or D2 receptors should exert opposing effects on risky choice, given that endogenous DA activates both receptors. Contemporary theory on how these receptors differentially affect PFC neural network activity may provide insight into this issue (Durstewitz et al., 2000; Seamans and Yang, 2004). D1 receptors have been proposed to decrease the influence of weak inputs, stabilizing network activity so that a single representation dominates PFC output. Conversely, D2 activity attenuates inhibitory influences, allowing PFC neural ensembles to process multiple stimuli/representations, placing theses networks in a more labile state that may permit changes in representations.

During different phases of the probabilistic discounting task used here, animals at some points must either maintain (within a probability block) or modify (across blocks) their representation of the relative value of the large/risky option. Thus, the opposing effects of D1/D2 antagonism described here may reflect differential contributions of these receptors during distinct phases of the task. D1 activity may stabilize the representation of the relative long-term value of the risky option within a particular block, maintaining choice bias even when a risky choice leads to reward omission (keeping the “eye on the prize”). Blocking these receptors would make animals more sensitive to reward omissions (i.e., increasing lose-shift tendencies), and reduce risky choice. Conversely, as the large/risky option yields fewer rewards across blocks, D2 receptors (possibly on a different neuronal population) may facilitate modifications in value representations. As such, reducing their activity would disrupt the updating of these representations and corresponding changes in choice bias. This model may also partially account for the effects of increasing D1 and D2 receptor activity, which would be expected to lead to either more persistent choice of the large/risky option or induce a “hyperflexible” state, respectively. Thus, our findings suggest that PFC DA tone makes a critical and complex contribution to risk/reward judgments. By striking a fine balance between D1/D2 receptor activity, mesocortical DA may help refine cost/benefit decisions between options of varying magnitude and uncertainty, promoting either exploitation of current favorable circumstances or exploration of more profitable ones when conditions change.

Footnotes

This work was supported by a grant from the Canadian Institutes of Health Research (MOP 89861) to S.B.F. S.B.F. is a Michael Smith Foundation for Health Research Senior Scholar and J.R.S.O. is the recipient of scholarships from the Natural Sciences and Engineering Research Council of Canada and the Michael Smith Foundation for Health Research.

Correspondence should be addressed to Dr. Stan B. Floresco, Department of Psychology and Brain Research Center, University of British Columbia, 2136 West Mall, Vancouver, BC V6T 1Z4, Canada.floresco@psych.ubc.ca

Copyright © 2011 the authors 0270-6474/11/318625-09$15.00/0

References

1. ↵

1. Ahn S,

2. Phillips AG

(1999) Dopaminergic correlates of sensory-specific satiety in the medial prefrontal cortex and nucleus accumbens of the rat. J Neurosci 19:RC29, (1–6).

Abstract/FREE Full Text

2. ↵

1. Bardgett ME,

2. Depenbrock M,

3. Downs N,

4. Points M,

5. Green L

(2009) Dopamine modulates effort-based decision-making in rats. Behav Neurosci 123:242–251.

CrossRefMedline

3. ↵

1. Bari A,

2. Eagle DM,

3. Mar AC,

4. Robinson ES,

5. Robbins TW

(2009) Dissociable effects of noradrenaline, dopamine, and serotonin uptake blockade on stop task performance in rats. Psychopharmacology 205:273–283.

CrossRefMedline

4. ↵

1. Cardinal RN,

2. Howes NJ

(2005) Effects of lesions of the nucleus accumbens core on choice between small certain rewards and large uncertain rewards in rats. BMC Neurosci 6:37.

CrossRefMedline

5. ↵

1. Cardinal RN,

2. Robbins TW,

3. Everitt BJ

(2000) The effects of d-amphetamine, chlordiazepoxide, alpha-flupenthixol and behavioural manipulations on choice of signalled and unsignalled delayed reinforcement in rats. Psychopharmacology 152:362–375.

CrossRefMedline

6. ↵

1. Chudasama Y,

2. Robbins TW

(2004) Dopaminergic modulation of visual attention and working memory in the rodent prefrontal cortex. Neuropsychopharmacology 29:1628–1636.

CrossRefMedline

7. ↵

1. Cousins MS,

2. Wei W,

3. Salamone JD

(1994) Pharmacological characterization of performance on a concurrent lever pressing/feeding choice procedure: effects of dopamine antagonist, cholinomimetic, sedative and stimulant drugs. Psychopharmacology 116:529–537.

CrossRefMedline

8. ↵

1. Denk F,

2. Walton ME,

3. Jennings KA,

4. Sharp T,

5. Rushworth MF,

6. Bannerman DM

(2005) Differential involvement of serotonin and dopamine systems in cost-benefit decisions about delay or effort. Psychopharmacology 179:587–596.

CrossRefMedline

9. ↵

1. Durstewitz D,

2. Seamans JK,

3. Sejnowski TJ

(2000) Neurocomputational models of working memory. Nat Neurosci 3(Suppl):1184–1191.

CrossRefMedline

10. ↵

1. Floresco SB,

2. Magyar O

(2006) Mesocortical dopamine modulation of executive functions: beyond working memory. Psychopharmacology 188:567–585.

CrossRefMedline

11. ↵

1. Floresco SB,

2. Whelan JM

(2009) Perturbations in different forms of cost/benefit decision making induced by repeated amphetamine exposure. Psychopharmacology 205:189–201.

CrossRefMedline

12. ↵

1. Floresco SB,

2. Magyar O,

3. Ghods-Sharifi S,

4. Vexelman C,

5. Tse MT

(2006) Multiple dopamine receptor subtypes in the medial prefrontal cortex of the rat regulate set-shifting. Neuropsychopharmacology 31:297–309.

CrossRefMedline

13. ↵

1. Floresco SB,

2. Tse MT,

3. Ghods-Sharifi S

(2008a) Dopaminergic and glutamatergic regulation of effort and delay-based decision making. Neuropsychopharmacology 33:1966–1979.

CrossRefMedline

14. ↵

1. Floresco SB,

2. St Onge JR,

3. Ghods-Sharifi S,

4. Winstanley CA

(2008b) Cortico-limbic-striatal circuits subserving different forms of cost-benefit decision making. Cogn Affect Behav Neurosci 8:375–389.

CrossRefMedline

15. ↵

1. Ghods-Sharifi S,

2. St Onge JR,

3. Floresco SB

(2009) Fundamental contribution by the basolateral amygdala to different forms of decision making. J Neurosci 29:5251–5259.

Abstract/FREE Full Text

16. ↵

1. Granon S,

2. Passetti F,

3. Thomas KL,

4. Dalley JW,

5. Everitt BJ,

6. Robbins TW

(2000) Enhanced and impaired attentional performance after infusion of D1 dopaminergic receptor agents into rat prefrontal cortex. J Neurosci 20:1208–1215.

Abstract/FREE Full Text

17. ↵

1. Haluk DM,

2. Floresco SB

(2009) Ventral striatal dopamine modulation of different forms of behavioral flexibility. Neuropsychopharmacology 34:2041–2052.

CrossRefMedline

18. ↵

1. Hutton SB,

2. Murphy FC,

3. Joyce EM,

4. Rogers RD,

5. Cuthbert I,

6. Barnes TR,

7. McKenna PJ,

8. Sahakian BJ,

9. Robbins TW

(2002) Decision making deficits in patients with first-episode and chronic schizophrenia. Schizophr Res 55:249–257.

CrossRefMedline

19. ↵

1. Jocham G,

2. Klein TA,

3. Ullsperger M

(2011) Dopamine-mediated reinforcement learning signals in the striatum and ventromedial prefrontal cortex underlie value-based choices. J Neurosci 31:1606–1613.

Abstract/FREE Full Text

20. ↵

1. Loos M,

2. Pattij T,

3. Janssen MC,

4. Counotte DS,

5. Schoffelmeer AN,

6. Smit AB,

7. Spijker S,

8. van Gaalen MM

(2010) Dopamine receptor D1/D5 gene expression in the medial prefrontal cortex predicts impulsive choice in rats. Cereb Cortex 20:1064–1070.

Abstract/FREE Full Text

21. ↵

1. McLean A,

2. Rubinsztein JS,

3. Robbins TW,

4. Sahakian BJ

(2004) The effects of tyrosine depletion in normal healthy volunteers: implications for unipolar depression. Psychopharmacology 171:286–297.

CrossRefMedline

22. ↵

1. Pagonabarraga J,

2. García-Sánchez C,

3. Llebaria G,

4. Pascual-Sedano B,

5. Gironell A,

6. Kulisevsky J

(2007) Controlled study of decision-making and cognitive impairment in Parkinson's disease. Mov Disord 22:1430–1435.

CrossRefMedline

23. ↵

1. Paxinos G,

2. Watson C

(1998) The rat brain in stereotaxic coordinates (Academic, San Diego), Ed 4.

24. ↵

1. Ragozzino ME

(2002) The effects of dopamine D(1) receptor blockade in the prelimbic-infralimbic areas on behavioral flexibility. Learn Mem 9:18–28.

Abstract/FREE Full Text

25. ↵

1. Rogers RD,

2. Everitt BJ,

3. Baldacchino A,

4. Blackshaw AJ,

5. Swainson R,

6. Wynne K,

7. Baker NB,

8. Hunter J,

9. Carthy T,

10. Booker E,

11. London M,

12. Deakin JF,

13. Sahakian BJ,

14. Robbins TW

(1999) Dissociable deficits in the decision-making cognition of chronic amphetamine abusers, opiate abusers, patients with focal damage to prefrontal cortex, and tryptophan-depleted normal volunteers: evidence for monoaminergic mechanisms. Neuropsychopharmacology 20:322–339.

CrossRefMedline

26. ↵

1. Schweimer J,

2. Hauber W

(2006) Dopamine D1 receptors in the anterior cingulate cortex regulate effort-based decision making. Learn Mem 13:777–782.

Abstract/FREE Full Text

27. ↵

1. Schweimer J,

2. Saft S,

3. Hauber W

(2005) Involvement of catecholamine neurotransmission in the rat anterior cingulate in effort-related decision making. Behav Neurosci 119:1687–1692.

CrossRefMedline

28. ↵

1. Seamans JK,

2. Yang CR

(2004) The principal features and mechanisms of dopamine modulation in the prefrontal cortex. Prog Neurobiol 74:1–58.

CrossRefMedline

29. ↵

1. Seamans JK,

2. Floresco SB,

3. Phillips AG

(1998) D1 receptor modulation of hippocampal-prefrontal cortical circuits integrating spatial memory with executive functions in the rat. J Neurosci 18:1613–1621.

Abstract/FREE Full Text

30. ↵

1. St Onge JR,

2. Floresco SB

(2009) Dopaminergic modulation of risk-based decision making. Neuropsychopharmacology 34:681–697.

CrossRefMedline

31. ↵

1. St Onge JR,

2. Chiu YC,

3. Floresco SB

(2010) Differential effects of dopaminergic manipulations on risky choice. Psychopharmacology 211:209–221.

CrossRefMedline

32. ↵

1. St Onge JR,

2. Floresco SB

(2010) Prefrontal cortical contribution to risk-based decision making. Cereb Cortex 20:1816–1828.

Abstract/FREE Full Text

33. ↵

1. Stopper CM,

2. Floresco SB

(2011) Contributions of the nucleus accumbens and its subregions to different aspects of risk-based decision making. Cogn Affect Behav Neurosci 11:97–112.

CrossRefMedline

34. ↵

1. van Gaalen MM,

2. van Koten R,

3. Schoffelmeer AN,

4. Vanderschuren LJ

(2006) Critical involvement of dopaminergic neurotransmission in impulsive decision making. Biol Psychiatry 60:66–73.

CrossRefMedline

35. ↵

1. Williams GV,

2. Goldman-Rakic PS

(1995) Modulation of memory fields by dopamine D1 receptors in prefrontal cortex. Nature 376:572–575.

CrossRefMedline

36. ↵

1. Winstanley CA,

2. Theobald DE,

3. Dalley JW,

4. Robbins TW

(2005) Interactions between serotonin and dopamine in the control of impulsive choice in rats: therapeutic implications for impulse control disorders. Neuropsychopharmacology 30:669–682.

Medline

37. ↵

1. Winstanley CA,

2. Theobald DE,

3. Dalley JW,

4. Cardinal RN,

5. Robbins TW

(2006) Double dissociation between serotonergic and dopaminergic modulation of medial prefrontal and orbitofrontal cortex of impulsive choice. Cereb Cortex 16:106–114.

Abstract/FREE Full Text

Distinct roles of the direct and indirect pathways in the basal ganglia circuit mechanism (2016)

Nihon Shinkei Seishin Yakurigaku Zasshi. 2015 Nov;35(5-6):107-11.

 [Article in Japanese]

Morita M, Hikida T.

Abstract

The basal ganglia are key neural substrates that control not only motor balance but also emotion, motivation, cognition, learning, and decision-making. Dysfunction of the basal ganglia leads to neurodegenerative diseases (e.g. Parkinson's disease and Huntington's disease) and psychiatric disorders (e.g. drug addiction, schizophrenia, and depression). In the basal ganglia circuit, there are two important pathways: the direct and indirect striatal pathways. Recently, new molecular techniques that activate or inactive selectively the direct or indirect pathway neurons have revealed the function of each pathway. Here we review the distinct roles of the direct and indirect striatal pathways in brain function and drug addiction.

We have developed a reversible neurotransmission blocking technique, in which transmission of each pathway is selectively blocked by specific expression of transmission-blocking tetanus toxin, and revealed that the activation of D1 receptors in the direct pathway is critical for reward learning/cocaine addiction, and that the inactivation of D2 receptors is critical for aversive learning/learning flexibility. We propose a new circuit mechanism by which the dopaminergic input from the ventral tegmental area can switch the direct and indirect pathways in the nucleus accumbens. These basal ganglia circuit mechanisms will give us insights into the pathophysiology of mental diseases.

 

Dopamine D2 receptors and striatopallidal transmission in addiction and obesity (2013)

Curr Opin Neurobiol. 2013 May 28. pii: S0959-4388(13)00101-3. doi: 10.1016/j.conb.2013.04.012.

Kenny PJ, Voren G, Johnson PM.

Source

Laboratory of Behavioral and Molecular Neuroscience, Department of Molecular Therapeutics, The Scripps Research Institute, Jupiter, FL 33458, USA; Department of Neuroscience, The Scripps Research Institute, Jupiter, FL 33458, USA; Kellogg School of Science and Technology, The Scripps Research Institute, FL, USA. Electronic address: pjkenny@scripps.edu.

Abstract

Drug addiction and obesity share the core feature that those afflicted by the disorders express a desire to limit drug or food consumption yet persist despite negative consequences. Emerging evidence suggests that the compulsivity that defines these disorders may arise, to some degree at least, from common underlying neurobiological mechanisms. In particular, both disorders are associated with diminished striatal dopamine D2 receptor (D2R) availability, likely reflecting their decreased maturation and surface expression. In striatum, D2Rs are expressed by approximately half of the principal medium spiny projection neurons (MSNs), the striatopallidal neurons of the so-called 'indirect' pathway. D2Rs are also expressed presynaptically on dopamine terminals and on cholinergic interneurons. This heterogeneity of D2R expression has hindered attempts, largely using traditional pharmacological approaches, to understand their contribution to compulsive drug or food intake.

The emergence of genetic technologies to target discrete populations of neurons, coupled to optogenetic and chemicogenetic tools to manipulate their activity, have provided a means to dissect striatopallidal and cholinergic contributions to compulsivity. Here, we review recent evidence supporting an important role for striatal D2R signaling in compulsive drug use and food intake. We pay particular attention to striatopallidal projection neurons and their role in compulsive responding for food and drugs. Finally, we identify opportunities for future obesity research using known mechanisms of addiction as a heuristic, and leveraging new tools to manipulate activity of specific populations of striatal neurons to understand their contributions to addiction and obesity.

The loss of control over food consumption in obese individuals who struggle and fail to control their body weight is similar in many respects to the compulsive drug taking observed in drug addicts [1,2]. Based on these similarities, it has been hypothesized that analogous or even homologous mechanisms may contribute to these compulsive behaviors [1,36]. Interestingly, human imaging studies have established that dopamine D2 receptor (D2R) availability is generally lower in the striatum of obese relative to lean individuals [7••, 8••, 9]. Similar deficits in D2R availability are also detected in those suffering from substance abuse disorders [1012]. Individuals harboring the TaqIA A1 allele, which results in ~30–40 % reduction in striatal D2Rs compared with those not carrying the allele [1315], are over-represented in obese and drug-dependent populations [7••, 8••, 9, 1618]. Hence, alterations in striatal D2Rs could potentially contribute to the emergence compulsive eating or drug use in obesity and addiction, respectively.

Dopamine D2 receptors in addiction and obesity

Recently, we investigated whether compulsive-like feeding behavior, as measured by palatable food consumption that is resistant to the suppressant effects punishment (or cues predicting punishment) emerges in rats with extended access to palatable diet that triggers hyperphagia and excessive weight gain. We provided rats with almost unlimited daily access to a “cafeteria diet” consisting of a selection of highly palatable energy-dense food products commercially available at most cafeterias and vending machines for human consumption, such as cheesecake and bacon, which induce obesity in rodents much like their human equivalents rats [19,20]. As these rats gained weight, they demonstrated eating behavior that was resistant to the suppressant effects of cues predicting the onset of aversive footshock [21••]. Similar compulsive-like intake is observed in rats responding for cocaine infusion after a period of extended access to the drug [22,23••].

In addition to their excessive adiposity and compulsive-like eating, cafeteria diet rats also had decreased D2Rs expression in striatum [21••]. We therefore assessed whether knockdown of striatal D2Rs could accelerate the emergence of compulsive-like intake in cafeteria diet rats. Considering that lentivirus undergoes very low rates of retrograde transport, this approach ensured that postsynaptic D2Rs on neurons in the striatum, and not those located presynaptically on dopamine inputs, we impacted by this manipulation [21••]. Striatal D2R knockdown indeed accelerated the emergence of compulsive-like consumption of calorically dense palatable food. However, striatal D2R knockdown did not trigger compulsive responding for standard chow, suggesting that animals had to experience a combination of D2R knockdown and even very limited exposure to the palatable food before compulsivity emerged [21••]. Surprisingly, the effects of disrupting striatal D2R signaling on compulsive-like patterns of drug intake have not yet been assessed.

Striatopallidal transmission and drug reward

The principal MSN projection neurons account for between 90–95 % of the neurons in the striatum. The MSNs are generally segregated into two discrete populations, termed the direct and indirect pathway neurons, although this characterization is almost certainly an over-simplification of the connectivity of striatal MSNs; for example, see Refs. [2426]. The direct pathway MSNs, also known as striatonigral neurons, express dopamine D1 receptors (D1Rs) and project directly from the striatum to the substantia nigra pars reticulata (SNr) and internal segment of the globus pallidus (GPi). The indirect pathway MSNs, also known as striatopallidal neurons, express D2Rs and project indirectly from the striatum to the SNr/GPi via the external segment of the globus pallidus (GPe) and subthalamic nucleus (STN).

Activation of striatonigral neurons generally facilitates forward locomotor behaviors, whereas the striatopallidal neurons exert an opposite inhibitory influence. In addition to the striatopallidal neurons, cholinergic interneurons in striatum also express D2Rs [27, 28••, 29]. This heterogeneity of D2R expression in striatum has complicated attempts to understand the mechanisms by which D2Rs may contribute to the development of compulsive drug and food intake. However, the development of mice that express Cre recombinase within defined populations of neurons, coupled with the emergence of Cre-dependent techniques to control the activity of Cre-expressing neurons, such as optogenetics [30•] and Designer Receptors Exclusively Activated by Designer Drugs (DREADDs) [31,32•], is beginning to define the contribution of specific populations of striatal cells to drug and food intake. As summarized below, these novel approaches are revealing key contributions of D2-expressing neurons in striatum to opposing the stimulant and rewarding properties of addictive drugs, and also opposing the emergence of inflexible, compulsive-like patterns of food or drug consumption.

Striatopallidal neurons but not cholinergic interneurons express adenosine 2A receptors (A2AR). Based on this fact, Durieux and colleagues used A2AR-Cre mice to drive expression of diphtheria toxin receptor in (DTR) in striatopallidal neurons, then injected the animals with diphtheria toxin to induce highly specific lesions of these neurons [33••]. This manipulation triggered profound hyperlocomotion and a marked increase in sensitivity to the rewarding effects of amphetamine [33••]. Lobo and colleagues subsequently reported that targeted deletion of Tropomyosin-related kinase B (TrkB), the receptor for brain-derived neurotropic factor (BDNF), in striatonigral diminished the rewarding properties of cocaine, whereas TrkB knockout in D2-expressing MSNs enhanced cocaine reward [34••]. Moreover, TrkB knockout in D2-expressing MSNs increased their excitability, with optogenetic stimulation of this these neurons similarly decreasing cocaine reward [34••]. More recently, Neumeier and colleagues used DREADDs to show that inhibition of striatonigral neurons blocked the emergence of sensitized locomotor responses to amphetamine, whereas inhibition of striatopallidal neurons enhanced sensitization [35•]. These findings suggest that striatopallidal signaling opposes reward-related processes and may protect against addiction-relevant neuroplasticity.

Striatopallidal transmission and compulsive drug use

More recent findings have implicated striatopallidal signaling in “flexible” responding – the ability to cease responding when persisting in the behavior may result in negative consequences – disruption in which likely drives the emergence of compulsivity. Kravitz and colleagues found that optogenetic stimulation of striatopallidal neurons resulted in punishment-like responses in animals, reflected in avoidance of the optical stimulation [36•]. Using cell-specific expression of tetanus toxin to block neurotransmitter release, Nakanishi and colleagues found that disruption of striatopallidal signaling abolished the ability of animals to learn an inhibitory avoidance behavior (avoidance of an environment in which electric footshocks were delivered) [37••]. Using this same tetanus toxin-based approach, Nakanishi and colleagues also found that disruption of striatopallidal transmission induced inflexible-like behaviors in mice in which they were unable to alter their behavior in response to alerted task contingencies [38]. These findings are consistent with a role for striatopallidal neurons in regulating behavioral flexibility, a key role that facilities the switching between different behavioral strategies in order to maximize reward opportunities [38]. Hence, drug-induced plasticity in striatopallidal neurons that results in their diminished activity could potentially precipitate inflexible, compulsive-like, patterns of drug-taking behavior. Consistent with this possibility, Alvarez and co-workers have recently shown that synaptic strengthening onto D2-expressing MSNs in nucleus accumbens occurs in mice with a history of intravenous cocaine self-administration [39••]. This synaptic strengthening was inversely correlated with the emergence of compulsive-like cocaine responding [39••]. Moreover, DREADD-mediated inhibition, or optical stimulation, of striatopallidal neurons increased or decreased, respectively, compulsive-like responding for cocaine in mice [39••].

Striatopallidal transmission and compulsive eating

These above findings provide direct evidence in support of a key role for D2- expressing MSNs in compulsive cocaine responding. This raises the important question of whether striatopallidal neurons are also involved in compulsive consumption of palatable food in obesity. Surprisingly, this possibility has not yet been investigated and this represents a major gap in knowledge. Nevertheless, there are intriguing hints that this may in fact be the case. As noted above, A2ARs are densely expressed by striatopallidal neurons [40]. As such, pharmacological agents that modulate A2AR activity are expected to preferentially influence striatopallidal transmission A2AR agonists, which increase striatopallidal transmission, reduced consumption of both highly palatable and standard chow in rats [41], and reduced lever-pressing for food rewards [42]. Conversely, pharmacological blockade of A2A receptors increased palatable food consumption when administered alone, and enhanced palatable food intake triggered by intra-accumbens administration of a µ-opioid receptor agonist (DAMGO) [43]. These findings are reminiscent of the inhibitory effects of indirect pathway stimulation on drug reward described above, and suggest that D2-expressing indirect pathway MSNs may regulate food intake in much the same way that they regulate drug rewards.

Conclusions and future directions

The above findings support a contextual framework in which prolonged drug use or weight gain drives adaptive responses in striatopallidal neurons, resulting in inflexible patterns of intake that become progressively more compulsive in nature. Hence, a major area of future activity in obesity research is likely to be defining the precise role for striatopallidal neurons in regulating the emergence of compulsive eating. It will also be important to determine if ameliorating this type of inflexible eating may form the basis of effective strategies to achieve long-term weight loss. Another area of research likely to be of considerable interest in both the addiction and obesity fields will be better defining the role for D2 receptors located on cholinergic interneurons. Optical inhibition of cholinergic interneurons in striatum abolishes the rewarding effects of cocaine [44]. D2 receptors on cholinergic interneurons regulate the characteristic pause-burst patterns of firing of these cells in response to salient stimuli through interactions with nicotinic acetylcholine receptors (nAChRs) located presynaptically on dopamine terminals [28]. Interestingly, antagonism of nAChRs blocks compulsive-like escalation of cocaine intake in rats with extended access to the drug [45]. Hence, it will be important to determine if D2 receptor signaling in striatal cholinergic interneurons also contributes to compulsive drug use and feeding behavior.

Highlights

  • Obesity and addiction result in diminished D2 receptor availability in striatum.
  • D2 receptors control compulsive eating.
  • DREADDs and optogenetics have revealed a key role for striatopallidal neurons in compulsive drug use.

Acknowledgements

This work was supported by a grant from the National Institute on Drug Abuse (DA020686 to P.J.K.). This is manuscript number 23035 from The Scripps Research Institute.

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References and recommended reading

Papers of particular interest, published within the period of review, have been highlighted as:

• of special interest

•• of outstanding interest

1. Baicy K. Can food be addictive? Insights on obesity from neuroimaging and substance abuse treatment and research. Nutrition Noteworthy. 2005;7:4.
2. Wise RA. Drug self-administration viewed as ingestive behaviour. Appetite. 1997;28:1–5. [PubMed]
3. Volkow ND, Wise RA. How can drug addiction help us understand obesity? Nat Neurosci. 2005;8:555–560. [PubMed]
4. Kelley AE, Berridge KC. The neuroscience of natural rewards: relevance to addictive drugs. J Neurosci. 2002;22:3306–3311. [PubMed]
5. Kenny PJ. Common cellular and molecular mechanisms in obesity and drug addiction. Nat Rev Neurosci. 2011;12:638–651. [PubMed]
6. Kenny PJ. Reward mechanisms in obesity: new insights and future directions. Neuron. 2011;69:664–679. [PMC free article] [PubMed]
7. Stice E, Spoor S, Bohon C, Small DM. Relation between obesity and blunted striatal response to food is moderated by TaqIA A1 allele. Science. 2008;322:449–452. [PubMed] ••This important paper provides strong evidence that striatal D2 receptor signaling regulates hedonic responses to palatable food and vulnerability to long term weight gain.
8. Wang GJ, Volkow ND, Logan J, Pappas NR, Wong CT, Zhu W, Netusil N, Fowler JS. Brain dopamine and obesity. Lancet. 2001;357:354–357. [PubMed] ••A seminal paper demonstrating that striatal dopamine D2 receptor availability was lower in obese individuals compared with lean controls.
9. Barnard ND, Noble EP, Ritchie T, Cohen J, Jenkins DJ, Turner-McGrievy G, Gloede L, Green AA, Ferdowsian H. D2 dopamine receptor Taq1A polymorphism, body weight, and dietary intake in type 2 diabetes. Nutrition. 2009;25:58–65. [PMC free article] [PubMed]
10. Asensio S, Romero MJ, Romero FJ, Wong C, Alia-Klein N, Tomasi D, Wang GJ, Telang F, Volkow ND, Goldstein RZ. Striatal dopamine D2 receptor availability predicts the thalamic and medial prefrontal responses to reward in cocaine abusers three years later. Synapse. 2010;64:397–402. [PMC free article] [PubMed]
11. Volkow ND, Chang L, Wang GJ, Fowler JS, Ding YS, Sedler M, Logan J, Franceschi D, Gatley J, Hitzemann R, et al. Low level of brain dopamine D2 receptors in methamphetamine abusers: association with metabolism in the orbitofrontal cortex. Am J Psychiatry. 2001;158:2015–2021. [PubMed]
12. Volkow ND, Fowler JS, Wang GJ, Hitzemann R, Logan J, Schlyer DJ, Dewey SL, Wolf AP. Decreased dopamine D2 receptor availability is associated with reduced frontal metabolism in cocaine abusers. Synapse. 1993;14:169–177. [PubMed]
13. Stice E, Yokum S, Bohon C, Marti N, Smolen A. Reward circuitry responsivity to food predicts future increases in body mass: moderating effects of DRD2 and DRD4. Neuroimage. 2010;50:1618–1625. [PMC free article] [PubMed]
14. Ritchie T, Noble EP. Association of seven polymorphisms of the D2 dopamine receptor gene with brain receptor-binding characteristics. Neurochem Res. 2003;28:73–82. [PubMed]
15. Jonsson EG, Nothen MM, Grunhage F, Farde L, Nakashima Y, Propping P, Sedvall GC. Polymorphisms in the dopamine D2 receptor gene and their relationships to striatal dopamine receptor density of healthy volunteers. Mol Psychiatry. 1999;4:290–296. [PubMed]
16. Noble EP, Zhang X, Ritchie TL, Sparkes RS. Haplotypes at the DRD2 locus and severe alcoholism. Am J Med Genet. 2000;96:622–631. [PubMed]
17. Noble EP, Blum K, Khalsa ME, Ritchie T, Montgomery A, Wood RC, Fitch RJ, Ozkaragoz T, Sheridan PJ, Anglin MD, et al. Allelic association of the D2 dopamine receptor gene with cocaine dependence. Drug Alcohol Depend. 1993;33:271–285. [PubMed]
18. Lawford BR, Young RM, Noble EP, Sargent J, Rowell J, Shadforth S, Zhang X, Ritchie T. The D(2) dopamine receptor A(1) allele and opioid dependence: association with heroin use and response to methadone treatment. Am J Med Genet. 2000;96:592–598. [PubMed]
19. Sclafani A, Springer D. Dietary obesity in adult rats: similarities to hypothalamic and human obesity syndromes. Physiol Behav. 1976;17:461–471. [PubMed]
20. Rothwell NJ, Stock MJ. Effects of continuous and discontinuous periods of cafeteria feeding on body weight, resting oxygen consumption and noradrenaline sensitivity in the rat [proceedings] J Physiol. 1979;291:59P. [PubMed]
21. Johnson PM, Kenny PJ. Dopamine D2 receptors in addiction-like reward dysfunction and compulsive eating in obese rats. Nat Neurosci. 2010;13:635–641. [PubMed] ••This paper provided some of the first evidence that palatable food can induce compulsive-like patterns of eating.
22. Pelloux Y, Everitt BJ, Dickinson A. Compulsive drug seeking by rats under punishment: effects of drug taking history. Psychopharmacology (Berl) 2007;194:127–137. [PubMed]
23. Vanderschuren LJ, Everitt BJ. Drug seeking becomes compulsive after prolonged cocaine self-administration. Science. 2004;305:1017–1019. [PubMed] ••This paper established that addiction-like responding for cocaine, which is resistant to punishment or cues predicting punishment, can be detected in laboratory animals. Served to operationalize measures of compulsive responding for cocaine in rats, which can now be used to assess compulsive eating.
24. Smith RJ, Lobo MK, Spencer S, Kalivas PW. Cocaine-induced adaptations in D1 and D2 accumbens projection neurons (a dichotomy not necessarily synonymous with direct and indirect pathways) Curr Opin Neurobiol. 2013 [PMC free article] [PubMed]
25. Perreault ML, Hasbi A, O'Dowd BF, George SR. The dopamine d1-d2 receptor heteromer in striatal medium spiny neurons: evidence for a third distinct neuronal pathway in Basal Ganglia. Front Neuroanat. 2011;5:31. [PMC free article] [PubMed]
26. Thompson RH, Swanson LW. Hypothesis-driven structural connectivity analysis supports network over hierarchical model of brain architecture. Proc Natl Acad Sci U S A. 2010;107:15235–15239. [PMC free article] [PubMed]
27. Goldberg JA, Ding JB, Surmeier DJ. Muscarinic modulation of striatal function and circuitry. Handb Exp Pharmacol. 2012:223–241. [PubMed]
28. Ding JB, Guzman JN, Peterson JD, Goldberg JA, Surmeier DJ. Thalamic gating of corticostriatal signaling by cholinergic interneurons. Neuron. 2010;67:294–307. [PubMed] •Defines the role for dopamine D2 receptors, and their interactions with nicotinic receptors, in controlling activity of cholinergic interneurons in striatum.
29. Dawson VL, Dawson TM, Filloux FM, Wamsley JK. Evidence for dopamine D-2 receptors on cholinergic interneurons in the rat caudate-putamen. Life Sci. 1988;42:1933–1939. [PubMed]
30. Boyden ES, Zhang F, Bamberg E, Nagel G, Deisseroth K. Millisecond-timescale, genetically targeted optical control of neural activity. Nat Neurosci. 2005;8:1263–1268. [PubMed] •A now classic paper that help established the feasibility of optogenetically controlling neuronal activity.
31. Armbruster BN, Li X, Pausch MH, Herlitze S, Roth BL. Evolving the lock to fit the key to create a family of G protein-coupled receptors potently activated by an inert ligand. Proc Natl Acad Sci U S A. 2007;104:5163–5168. [PMC free article] [PubMed]
32. Alexander GM, Rogan SC, Abbas AI, Armbruster BN, Pei Y, Allen JA, Nonneman RJ, Hartmann J, Moy SS, Nicolelis MA, et al. Remote control of neuronal activity in transgenic mice expressing evolved G protein-coupled receptors. Neuron. 2009;63:27–39. [PubMed] •A key paper establishing the effectiveness of DREADD technologies for controlling neuronal activity.
33. Durieux PF, Bearzatto B, Guiducci S, Buch T, Waisman A, Zoli M, Schiffmann SN, de Kerchove d'Exaerde A. D2R striatopallidal neurons inhibit both locomotor and drug reward processes. Nat Neurosci. 2009;12:393–395. [PubMed] ••One of the first demonstrations that striatopallidal neurons could be efficiently lesioned and revealing that they exerted an inhibitory effect on drug reward.
34. Lobo MK, Covington HE, 3rd, Chaudhury D, Friedman AK, Sun H, Damez-Werno D, Dietz DM, Zaman S, Koo JW, Kennedy PJ, et al. Cell type-specific loss of BDNF signaling mimics optogenetic control of cocaine reward. Science. 2010;330:385–390. [PubMed] ••One of the first demonstrations that activity striatonigral and striatopallidal neurons could be discretely controlled using optogenetics. Also verified the opposing role for these two types of neurons in drug reward.
35. Ferguson SM, DE, MI, Wanat MJ, Phillips PEM, Dong Y, Roth BL, Neumaier JF. Transient neuronal inhibition reveals opposing roles of indirect and direct pathways in sensitization. Nature Neuroscience. 2011;14:22–24. [PMC free article] [PubMed] •Using DREADDS, showed that direct and indirect pathway neurons have opposite roles in the induction of addiction-relevant neuroplasticity associated with repeated drug exposure.
36. Kravitz AV, Tye LD, Kreitzer AC. Distinct roles for direct and indirect pathway striatal neurons in reinforcement. Nature Neuroscience. 2012;15:816–819. [PMC free article] [PubMed] •This paper provides strong evidence that indirect pathway neurons encode information related to punishment and facilitate avoidance behaviors.
37. Hikida T, Kimura K, Wada N, Funabiki K, Nakanishi S. Distinct roles of synaptic transmission in direct and indirect striatal pathways to reward and aversive behavior. Neuron. 2010;66:896–907. [PubMed] ••An important paper that provided some of the first evidence that indirect pathway neurons regulate avoidance behaviors and that their activity is important for maintaining behavioral "flexibility".
38. Yawata S, Yamaguchi T, Danjo T, Hikida T, Nakanishi S. Pathway-specific control of reward learning and its flexibility via selective dopamine receptors in the nucleus accumbens. Proc Natl Acad Sci U S A. 2012;109:12764–12769. [PMC free article] [PubMed]
39. Bock R, Shin HJ, Kaplan AR, Dobi A, Market E, Kramer PF, Gremel CM, Christensen CH, Adrover MF, Alvarez VA. Strenghtening the accumbal indirect pathway promotes resilience to compulsive cocaine use. Nature Neuroscience. 2013 Advanced Online Publication. [PMC free article] [PubMed] ••Likely to be a key publication in the field showing that striatopallidal neurons regulate vulnerability to developing compulsive-like responding for cocaine.
40. Schiffmann SN, Fisone G, Moresco R, Cunha RA, Ferre S. Adenosine A2A receptors and basal ganglia physiology. Prog Neurobiol. 2007;83:277–292. [PMC free article] [PubMed]
41. Micioni Di Bonaventura MV, Cifani C, Lambertucci C, Volpini R, Cristalli G, Massi M. A(2A) adenosine receptor agonists reduce both high-palatability and low-palatability food intake in female rats. Behav Pharmacol. 2012;23:567–574. [PubMed]
42. Jones-Cage C, Stratford TR, Wirtshafter D. Differential effects of the adenosine A(2)A agonist CGS-21680 and haloperidol on food-reinforced fixed ratio responding in the rat. Psychopharmacology (Berl) 2012;220:205–213. [PMC free article] [PubMed]
43. Pritchett CE, Pardee AL, McGuirk SR, Will MJ. The role of nucleus accumbens adenosine-opioid interaction in mediating palatable food intake. Brain Res. 2010;1306:85–92. [PubMed]
44. Witten IB, Lin SC, Brodsky M, Prakash R, Diester I, Anikeeva P, Gradinaru V, Ramakrishnan C, Deisseroth K. Cholinergic interneurons control local circuit activity and cocaine conditioning. Science. 2010;330:1677–1681. [PMC free article] [PubMed]
45. Hansen ST, Mark GP. The nicotinic acetylcholine receptor antagonist mecamylamine prevents escalation of cocaine self-administration in rats with extended daily access. Psychopharmacology (Berl) 2007;194:53–61. [PubMed]

 

Dopamine signaling in food addiction: role of dopamine D2 receptors (2013)

FULL STUDY - PDF

BMB Rep. 2013 Nov;46(11):519-26.

Baik JH.

Abstract

Dopamine (DA) regulates emotional and motivational behavior through the mesolimbic dopaminergic pathway. Changes in DA signaling in mesolimbic neurotransmission are widely believed to modify reward-related behaviors and are therefore closely associated with drug addiction. Recent evidence now suggests that as with drug addiction, obesity with compulsive eating behaviors involves reward circuitry of the brain, particularly the circuitry involving dopaminergic neural substrates. Increasing amounts of data from human imaging studies, together with genetic analysis, have demonstrated that obese people and drug addicts tend to show altered expression of DA D2 receptors in specific brain areas, and that similar brain areas are activated by food-related and drug-related cues. This review focuses on the functions of the DA system, with specific focus on the physiological interpretation and the role of DA D2 receptor signaling in food addiction. [BMB Reports 2013; 46(11): 519-526].

 

Dual Control of Dopamine Synthesis and Release by Presynaptic and Postsynaptic Dopamine D2 Receptors.(2012)

J Neurosci. 2012 Jun 27;32(26):9023-9034.

Anzalone A, Lizardi-Ortiz JE, Ramos M, De Mei C, Hopf FW, Iaccarino C, Halbout B, Jacobsen J, Kinoshita C, Welter M, Caron MG, Bonci A, Sulzer D, Borrelli E.

Source

Department of Microbiology and Molecular Genetics, INSERM U904, University of California Irvine, Irvine, California 92697, Department of Psychiatry, Columbia University, New York, New York 10032, Ernest Gallo Clinic and Research Center, University of California, San Francisco, Emeryville, California 94608, Department of Cell Biology, Duke University Medical Center, Durham, North Carolina 27710, Intramural Research Program, National Institute on Drug Abuse, Baltimore, Maryland 21224, and Departments of Neurology and Pharmacology, Columbia University, New York, New York 10032.

Abstract

Dysfunctions of dopaminergic homeostasis leading to either low or high dopamine (DA) levels are causally linked to Parkinson's disease, schizophrenia, and addiction. Major sites of DA synthesis are the mesencephalic neurons originating in the substantia nigra and ventral tegmental area; these structures send major projections to the dorsal striatum (DSt) and nucleus accumbens (NAcc), respectively. DA finely tunes its own synthesis and release by activating DA D2 receptors (D2R). To date, this critical D2R-dependent function was thought to be solely due to activation of D2Rs on dopaminergic neurons (D2 autoreceptors); instead, using site-specific D2R knock-out mice, we uncover that D2 heteroreceptors located on non-DAergic medium spiny neurons participate in the control of DA levels. This D2 heteroreceptor-mediated mechanism is more efficient in the DSt than in NAcc, indicating that D2R signaling differentially regulates mesolimbic- versus nigrostriatal-mediated functions. This study reveals previously unappreciated control of DA signaling, shedding new light on region-specific regulation of DA-mediated effects

Effect of Exercise Training on Striatal Dopamine D2/D3 Receptors in Methamphetamine Users during Behavioral Treatment (2015)

COMMENTS: 8 weeks of exercise significantly increased D2 receptors in meth addicts undergoing treatment. This supports the following:

  1. Exercise can help reverse desensitization even in meth addicts.
  2. D2 receptor levels are not set in stone: environment matters.
  3. Meth use seems to cause a drop in D2 receptors. As with #2 this refutes the "you born to be an addict" meme.

Neuropsychopharmacology. 2015 Oct 27. doi: 10.1038/npp.2015.331.

Robertson CL1,2, Ishibashi K2,3, Chudzynski J3, Mooney LJ3, Rawson RA3, Dolezal BA4, Cooper CB4, Brown AK1,2, Mandelkern MA2, London ED1,2,3.

Abstract

Methamphetamine Use Disorder is associated with striatal dopaminergic deficits, which have been linked to poor treatment outcomes, identifying these deficits as an important therapeutic target. Exercise attenuates methamphetamine-induced neurochemical damage in the rat brain, and a preliminary observation suggests that exercise increases striatal D2/D3 receptor availability (measured as non-displaceable binding potential, BPND) in patients with Parkinson's disease.

The goal of this study was to evaluate whether adding an exercise-training program to an inpatient behavioral intervention for methamphetamine use disorder reverses deficits in striatal D2/D3 receptors. Participants were adult men and women who met DSM-IV criteria for methamphetamine dependence and were enrolled in a residential facility, where they maintained abstinence from illicit drugs of abuse and received behavioral therapy for their addiction.

They were randomized to a group that received 1-hr supervised exercise training (n=10) or one that received equal-time health-education training (n=9), 3 days/week for 8 weeks.

They came to an academic research center for positron emission tomography (PET) using 18F-fallypride to determine the effects of the 8-week interventions on striatal D2/D3 receptor BPND.

At baseline, striatal D2/D3 BPND did not differ between groups. However, after 8-weeks, participants in the exercise group displayed a significant increase in striatal D2/D3 BPND, while those in the education group did not. There were no changes in D2/D3 BPND in extrastriatal regions in either group.

These findings suggest that structured exercise training can ameliorate striatal D2/D3 receptor deficits in methamphetamine users, and warrants further evaluation as an adjunctive treatment for stimulant dependence.Neuropsychopharmacology accepted article preview online, 27 October 2015. doi:10.1038/npp.2015.331.

Emotion dysregulation and amygdala dopamine D2-type receptor availability in methamphetamine users (2016)

Drug Alcohol Depend. 2016 Feb 12. pii: S0376-8716(16)00059-4. doi: 10.1016/j.drugalcdep.2016.01.029.

Okita K1, Ghahremani DG2, Payer DE3, Robertson CL4, Dean AC2, Mandelkern MA5, London ED6.

Abstract

BACKGROUND:

Individuals who use methamphetamine chronically exhibit emotional and dopaminergic neurochemical deficits. Although the amygdala has an important role in emotion processing and receives dopaminergic innervation, little is known about how dopamine transmission in this region contributes to emotion regulation. This investigation aimed to evaluate emotion regulation in subjects who met DSM-IV criteria for methamphetamine dependence, and to test for a relationship between self-reports of difficulty in emotion regulation and D2-type dopamine receptor availability in the amygdala.

METHOD:

Ninety-four methamphetamine-using and 102 healthy-control subjects completed the Difficulties in Emotion Regulation Scale (DERS); 33 of those who used methamphetamine completed the Addiction Severity Index (ASI). A subset of 27 methamphetamine-group and 20 control-group subjects completed positron emission tomography with [18F]fallypride to assay amygdala D2-type dopamine receptor availability, measured as binding potential (BPND).

RESULTS:

The methamphetamine group scored higher than the control group on the DERS total score (p<0.001), with DERS total score positively correlated with the Drug Composite Score on the ASI (p=0.02) in the methamphetamine group. The DERS total score was positively correlated with amygdala BPND in both groups and the combined group of participants (combined: r=0.331, p=0.02), and the groups did not differ in this relationship.

CONCLUSION:

These findings highlight problems with emotion regulation linked to methamphetamine use, possibly contributing to personal and interpersonal behavioral problems. They also suggest that D2-type dopamine receptors in the amygdala contribute to emotion regulation in both healthy and methamphetamine-using subjects.

KEYWORDS:

Amygdala; Dopamine; Emotion dysregulation; Methamphetamine; PET; [(18)F]Fallypride

 

Getting specialized: presynaptic and postsynaptic dopamine D2 receptors (2009)

FULL STUDY

Curr Opin Pharmacol. 2009 Feb;9(1):53-8. Epub 2009 Jan 8.

De Mei C, Ramos M, Iitaka C, Borrelli E.

Source

University of California Irvine, Department of Microbiology and Molecular Genetics, 3113 Gillespie NRF, Irvine, CA 92617 USA.

Abstract

Dopamine (DA) signaling controls many physiological functions ranging from locomotion to hormone secretion, and plays a critical role in addiction. DA elevation, for instance in response to drugs of abuse, simultaneously activates neurons expressing different DA receptors; how responses from diverse neurons/receptors are orchestrated in the generation of behavioral and cellular outcomes, is still not completely defined. Signaling from D2 receptors (D2Rs) is a good example to illustrate this complexity. D2Rs have presynaptic and postsynaptic localization and functions, which are shared by two isoforms in vivo. Recent results from knockout mice are clarifying the role of site and D2 isoform-specific effects thereby increasing our understanding of how DA modulates neuronal physiology.

Introduction

Responses to natural rewards (i.e. food) and addictive drugs share hedonic properties and elevate dopamine (DA) levels in the mesolimbic system, in areas such as the NAcc, which has been shown to be a preferential anatomical substrate for reward [1–3]. Drugs of abuse exploit the dopaminergic system to elicit their behavioral and cellular effects and by enhancing DA responses facilitate the study of the system.

DA effects are elicited through the interaction with membrane receptors that belong to the G-protein coupled receptor family [4]. Thus, upon drug intake DA signaling, controlled by any of the five DA receptors, is strongly activated leading to stimulation or inhibition of pathways regulated by the D1-like (D1 and D5) and D2-like receptor family (D2, D3 and D4), which translates into activation/inhibition of specific neurons and circuitries. In this article we will focus on the pre- and postsynaptic DA D2 receptor (D2R) mediated signaling and functions in vivo.

D2Rs, widely expressed in the brain, are localized both on presynaptic dopaminergic neurons, but also on neurons targeted by dopaminergic afferences (Fig.1). In addition of having a dual localization, D2 receptors are a heterogeneous population formed by two molecularly distinct isoforms, named D2S (S=short) and D2L (L=long) generated by alternative splicing of the same gene [4]. Genetically engineered mice deleted or altered [5–9] in D2Rs expression have been critical in identifying D2R-mediated functions in vivo [10]. We will discuss the relative contribution of pre- versus post-synaptic D2R-mediated mechanisms in response to DA elevation generated by drugs of abuse or by DA agonists by comparing results from wild-type (WT) and knock-out mice.

Figure 1

Pre- and postsynaptic signaling mediated by D2L and D2S

Signal transduction by D2L and D2S differently affects pre- versus postsynaptic responses

The best-characterized intracellular effect of DA is activation of the cAMP pathway [4]. This pathway is activated through D1-like receptors and inhibited by D2-like receptors. In striatal medium spiny neurons (MSNs), elevation of cAMP level leads to the activation of the protein Kinase A (PKA) [11] and consequently to phosphorylation of a large series of cellular targets and importantly of the DA- and cAMP-regulated phosphoprotein of 32 kDa (DARPP-32), [12] (Fig.1). Blockade of D2R stimulates the PKA-dependent phosphorylation of DARPP-32. This effect is most likely mediated via suppression of the inhibition exerted by D2R on the adenylyl cyclase. Phosphorylation catalysed by PKA on Thr34 converts DARPP-32 into a potent inhibitor of PP-1, thereby amplifying the responses produced by activation of the cAMP/PKA pathway. Importantly, blockade of D2R-mediated signaling produces a motor depressant effect, which is attenuated in DARPP-32 null-mice [13]. Activation of D1Rs increases Thr34 phosphorylation via Golf-mediated stimulation [14]. Conversely, activation of D2Rs decreases DARPP-32 phosphorylation at Thr34 via Gi-mediated inhibition of cAMP production [11]. In addition, D2Rs agonists stimulate protein phosphatase-2B activity, thereby increasing dephosphorylation of DARPP-32 at Thr34 [11].

Interestingly, SKF81297, a D1R agonist, produces a ten-fold increase in the state of phosphorylation of DARPP-32 at Thr34, in WT mice, D2R −/− and D2L −/− mice [15]. Quinpirole, a D2-specific agonist, counteracts the increase in phosphorylation of DARPP-32 at Thr34 produced by the dopamine D1 agonist, in WT, but not in D2R−/− or D2L −/− tissues [15]. This suggests that the D2L isoform is responsible for D2-like receptor-mediated regulation of DARPP-32 phosphorylation in MSNs, thereby demonstrating the specific involvement of this receptor isoform in postsynaptic D2R-mediated signaling.

Conversely in dopaminergic neurons of the substantia nigra (SN) and ventral tegmental area (VTA), the reduction of phosphorylation of tyrosine hydroxylase (TH) on Ser40, induced by dopamine D2 specific agonists, is lost in D2R−/− mice, but preserved in D2L−/− as in WT tissues [15]. Indicating a major D2S-specific presynaptic effect.

The specificity in isoform-mediated presynaptic and postsynaptic functions most likely arises from D2L and D2S ability to interact with different G-proteins and signaling pathways [16,17] or through isoform-specific and yet to unravel protein-protein interactions.

More recently, the implication of the serine/threonine kinase AKT in the signaling mediated by DA through D2-like receptors has been reported [18]. Activation of this pathway is cAMP-independent and mediated through the formation of a macromolecular complex containing at least three proteins, the scaffolding protein β-arrestin 2, AKT and the phosphatase PP-2A [18]. Interestingly, the activity of psychostimulants in the striatum induces a rapid down-regulation of AKT phosphorylation and activity, through a D2-like receptor activity [18]. Importantly, AKT phosphorylation is not down-regulated after psychostimulants treatment in D2R−/− and D2L−/− striata [19], illustrating a specific D2R-mediated effect very likely dependent from activation of D2L.

Future analyses should assess whether the reported effects of D2R-mediated signaling on the AKT and PKA pathways are parallel, and whether they are activated in the same neurons.

D2R-mediated pre-synaptic functions in postsynaptic neurons

Nigrostriatal and mesolimbic afferences, respectively from the SN and VTA, gate sensory, motor and reward information to the striatum. In response to salient events glutamate reward signals originated in the orbitofrontal cortex and basolateral amygdala reach the ventral striatum where DA is a gatekeeper of these inputs. Similarly, DA modulates glutamate inputs to the dorsal striatum from sensory and motor cortical areas [1], where it filters the noise amplifying the impact of salient stimuli through a D2R-mediated mechanism [20].

In addition to MSNs, D2Rs are also expressed by striatal interneurons [21] with important physiological implications [22,23]. These cells represent only 5% of striatal neurons, however their role is essential in the physiological processing of information relayed from cortical, thalamic and mesencephalic afferences. The participation of cholinergic interneurons on the modulation of MSNs activity, through D2R-dependent signaling has been clearly shown [22,23]. Presynaptic D2R-mediated mechanisms have also been implicated in the release of GABA and glutamate [20,24,25] from striatal and cortical neurons. Thus, in addition to the DA release modulating function on dopaminergic neurons, D2Rs acting as heteroreceptors, modulate neurotransmitter release from postsynaptic neurons. Thereby the presynaptic release-modulating role of D2Rs influences not only the response of dopaminergic neurons, but also profoundly modify that of target cells.

Presynaptic D2R-mediated function on dopaminergic neurons

Studies on D2R−/− mice have determined that D2 receptors are the “bona fide” autoreceptors regulating DA synthesis and release [26–29]. Interestingly, while the mean baseline concentration of DA in striatal dialysates is similar in WT and D2R−/− siblings, the release of DA evoked by cocaine injection is dramatically higher in D2R−/− mutants as compared to WT animals and well above the range of DA increase normally observed in WT animals [27]. Similar results were also obtained in response to morphine [27].

The observation that D2R-mediated auto-inhibition plays a major role in controlling DA release in conditions of high extracellular DA levels might explain the large influence of D2R on changes induced by drugs of abuse and in particular by cocaine through blockade of the DA transporter (DAT). Thus, in normal conditions D2R autoreceptors, which inhibit firing and DA release, are the only remaining factor able to counteract cocaine effect.

Importantly, selective ablation of the D2L isoform in D2L−/− mice, which still express D2S receptors, does not impair D2R-mediated autoreceptor functions, in support of a specific presynaptic role of the D2S isoform in vivo [8].

Therefore, a deregulation of D2R autoreceptor function, mediated by D2S, might play an important role in the pathophysiology of drug abuse as well as in mediating vulnerability to drugs. This hypothesis is indirectly supported by observations in animals spontaneously vulnerable to drug abuse. These animals are characterized by an enhanced release of DA in response to addictive drugs [30] as well as by a lower number of D2R binding sites [31] and lower inhibition of DA discharge activity resulting from reduced somatodendritic autoreceptor sensitivity [32].

Also, activation of D2Rs has been reported to regulate the trafficking of DAT to the plasma membrane, through activation of the MAPK pathway [33], and that D2Rs physically interact with DAT modulating its activity [34]. Thus, D2Rs, and very likely the D2S isoform, in addition to regulate DA synthesis, strongly participate in the control of its release by different mechanisms among which the interaction with DAT is surely very significant.

The motor stimulating effect of cocaine is impaired by absence of D2S

Largely abused by humans, cocaine elicits its psychomotor and cellular effects by blocking DAT activity on dopaminergic neurons [35]. Glutamate and dopaminergic antagonists abolish the transcriptional activation of immediate early genes (IEGs) induced by cocaine [36,37]. In this respect, activation of D1Rs is an absolute requirement for the induction of the cellular and behavioral response to cocaine, as demonstrated by studies performed in D1R−/− mice [38]. Recent studies, using transgenic mice in which D1R and D2R containing cells are visualized by the expression of fluorescent proteins, have further refined and supported these findings by showing that the acute cellular response to cocaine mostly engage D1R-, but not D2R-expressing neurons [39].

In this scenario it would be expected that genetic ablation of D2Rs should, if anything, amplify cocaine effects in vivo, due to the reported D2R-dependent inhibitory role on DA signaling. However, this is not what it has been observed.

Cocaine effect on D2R−/− mice has now been evaluated after acute and chronic treatments as well as in self-administration studies with the results that D2R−/− mice have impaired responses to the drug. Importantly, this does not arise from a defective D1R-mediated signaling as the cellular and behavioral responses of D2R−/− mice to direct stimulation of D1Rs is present [40,41]. In line with an unopposed D1R-mediated signaling in D2R−/− mice, activation of the IEG c-fos by D1R-specific agonists at concentrations of D1R ligands that are ineffective to induce the gene in WT mice, resulted into activation of this gene in the striatum of D2R−/− mice [40].

Nonetheless, stimulation of motor activity by cocaine is greatly attenuated in D2R−/− mice with respect to WT controls and it does not increase in a dose-dependent manner [40,42]. Surprisingly, administration of cocaine in D2R−/− mice fails to induce c-fos (Fig.2). This leads to hypothesize that in the absence of D2Rs an inhibitory circuit, normally controlled by D2R, becomes unveiled leading to the reported suppression of c-fos induction in MSNs. GABA and acetylcholine represent good candidates in this context where loss of D2R-mediated control of their release could result into overflows of one or both neurotransmitters [25] on MSNs blocking c-fos induction (Fig.2). Alternatively, loss of D2Rs impairs the formation of macromolecular complexes between the D2R and other proteins, which normally control the cellular and behavioral responsiveness to cocaine [43].

Figure 2

Cellular effects of cocaine on striatal neurons.

Rewarding and reinforcing properties of addictive drugs in the absence of D2Rs

The rewarding properties of cocaine in D2R−/− mice, as assessed by conditioned place preference (CPP), are attenuated [40]. However, self-administration studies showed that D2R−/− mice self-administer more cocaine than WT mice [44]. The contribution of other neuromodulators (i.e. noradrenalin, serotonin) [45] in expression of CPP and self-administration to cocaine in D2R−/− cannot be excluded and awaits further analyses. This point is of particular relevance in light of the numerous data showing absence of the rewarding effects of several other drugs of abuse in D2R−/− mice. Specifically, D2R−/− mutants are unresponsive to the rewarding and reinforcing properties of morphine [46–48] and alcohol [49,50]. Thus indicating that an intact D2R-mediated signaling is required to elicit the rewarding and reinforcing effects of most drugs.

Importantly, D2L−/− mice, which still express D2S and maintain D2R-mediated autoreceptor functions [8,9,27], have locomotor and rewarding responses to cocaine similar to that of WT animals [40]. Thus implicating a prevalent role of D2S in the behavioral and cellular response to drugs of abuse.

This suggests that presynaptic D2R-mediated effects acting not only on DA release, but also on GABA [25,51,52], glutamate [20] and acetylcholine [22] might play a role in the response to drugs of abuse.

Finally, the specific involvement of D2S and D2L respectively in pre- and postsynaptic activities leaves open the question on the role of the other isoform in either location, since both isoforms are co expressed in D2R expressing neurons. One challenging hypothesis is that trafficking of both isoforms to the membrane might not be equally regulated [53]. The development of the mouse technology and the generation of new animal models and tools should help clarifying this point.

Conclusions

Results obtained from the analysis of D2R mutants have provided evidence of the different involvement of D2L and D2S in D2R-mediated signaling evoked by drugs of abuse and direct agonists. Absence of D2L-mediated signaling impairs the regulation of PKA and AKT pathways by D2Rs, but it does not affect the motor and rewarding response to cocaine. Conversely, D2S-mediated signaling appears to be an absolute requirement for the motor and rewarding effects of cocaine and very likely of other drugs. Future analyses and models are required to further dissect which presynaptic component is involved in these responses, whether that present on dopaminergic or on postsynaptic neurons.

Acknowledgements

Work in the laboratory of E Borrelli related to this review was supported by funds from NIDA (DA024689) and European Community (EC LSHM-CT-2004-005166).

References

1. Wise RA. Forebrain substrates of reward and motivation. J Comp Neurol. 2005;493:115–121. [PMC free article][PubMed]

2. Di Chiara G, Bassareo V. Reward system and addiction: what dopamine does and doesn't do. Curr Opin Pharmacol. 2007;7:69–76.[PubMed]

3. Koob GF. The neurobiology of addiction: a neuroadaptational view relevant for diagnosis. Addiction. 2006;101 Suppl 1:23–30.[PubMed]

4. Tan S, Hermann B, Borrelli E. Dopaminergic mouse mutants: investigating the roles of the different dopamine receptor subtypes and the dopamine transporter. Int Rev Neurobiol. 2003;54:145–197.[PubMed]

5. Baik JH, Picetti R, Saiardi A, Thiriet G, Dierich A, Depaulis A, Le Meur M, Borrelli E. Parkinsonian-like locomotor impairment in mice lacking dopamine D2 receptors. Nature. 1995;377:424–428.[PubMed]

6. Kelly MA, RM, Asa SL, Zhang G, Saez C, Bunzow JR, Allen RG, Hnasko R, Ben-Jonathan N, Grandy DK, Low MJ. Pituitary lactotroph hyperplasia and chronic hyperprolactinemia in dopamine D2 receptor-deficient mice. Neuron. 1997;19:103–113.[PubMed]

7. Jung MY, Skryabin BV, Arai M, Abbondanzo S, Fu D, Brosius J, Robakis NK, Polites HG, Pintar JE, Schmauss C. Potentiation of the D2 mutant motor phenotype in mice lacking dopamine D2 and D3 receptors. Neuroscience. 1999;91:911–924.[PubMed]

8. Usiello A, Baik JH, Rouge-Pont F, Picetti R, Dierich A, LeMeur M, Piazza PV, Borrelli E. Distinct functions of the two isoforms of dopamine D2 receptors. Nature. 2000;408:199–203.[PubMed]

9. Wang Y, Xu R, Sasaoka T, Tonegawa S, Kung MP, Sankoorikal EB. Dopamine D2 long receptor-deficient mice display alterations in striatum-dependent functions. J Neurosci. 2000;20:8305–8314.[PubMed]

10. Bozzi Y, Borrelli E. Dopamine in neurotoxicity and neuroprotection: what do D2 receptors have to do with it? Trends Neurosci. 2006;29:167–174.[PubMed]

11. Nishi A, Snyder GL, Greengard P. Bidirectional regulation of DARPP-32 phosphorylation by dopamine. J Neurosci. 1997;17:8147–8155.[PubMed]

12. Bateup HS, Svenningsson P, Kuroiwa M, Gong S, Nishi A, Heintz N, Greengard P. Cell type-specific regulation of DARPP-32 phosphorylation by psychostimulant and antipsychotic drugs. Nat Neurosci. 2008;11:932–939. [PMC free article][PubMed]

13. Fienberg AA, Hiroi N, Mermelstein PG, Song W, Snyder GL, Nishi A, Cheramy A, O'Callaghan JP, Miller DB, Cole DG, et al. DARPP-32: regulator of the efficacy of dopaminergic neurotransmission. Science. 1998;281:838–842.[PubMed]

14. Herve D, Le Moine C, Corvol JC, Belluscio L, Ledent C, Fienberg AA, Jaber M, Studler JM, Girault JA. Galpha(olf) levels are regulated by receptor usage and control dopamine and adenosine action in the striatum. J Neurosci. 2001;21:4390–4399.[PubMed]

15. Lindgren N, Usiello A, Goiny M, Haycock J, Erbs E, Greengard P, Hokfelt T, Borrelli E, Fisone G. Distinct roles of dopamine D2L and D2S receptor isoforms in the regulation of protein phosphorylation at presynaptic and postsynaptic sites. Proc Natl Acad Sci U S A. 2003;100:4305–4309. [PMC free article][PubMed]

16. Senogles SE. The D2 dopamine receptor isoforms signal through distinct Gi alpha proteins to inhibit adenylyl cyclase. A study with site-directed mutant Gi alpha proteins. J Biol Chem. 1994;269:23120–23127.[PubMed]

17. Guiramand J, Montmayeur JP, Ceraline J, Bhatia M, Borrelli E. Alternative splicing of the dopamine D2 receptor directs specificity of coupling to G-proteins. J Biol Chem. 1995;270:7354–7358.[PubMed]

18. Beaulieu JM, Sotnikova TD, Marion S, Lefkowitz RJ, Gainetdinov RR, Caron MG An Akt/beta-arrestin 2/PP2A signaling complex mediates dopaminergic neurotransmission and behavior. Cell. 2005;122:261–273.[PubMed] This article identifies a novel G-protein independent dopamine transduction pathway regulating AKT activity and mediated by D2-like receptors. Signaling to the AKT pathway are induced by the formation of a macromolecular complex containing AKT, β-arrestin2 and the protein phosphatase PP2A. This is the first study showing a connection between dopamine and AKT mediated signaling.

19. Beaulieu JM, Tirotta E, Sotnikova TD, Masri B, Salahpour A, Gainetdinov RR, Borrelli E, Caron MG Regulation of Akt signaling by D2 and D3 dopamine receptors in vivo. J Neurosci. 2007;27:881–885.[PubMed] Using dopamine receptor mutants these authors identify D2Rs as major actors in the regulation of the AKT pathway.

20. Bamford NS, Zhang H, Schmitz Y, Wu NP, Cepeda C, Levine MS, Schmauss C, Zakharenko SS, Zablow L, Sulzer D Heterosynaptic dopamine neurotransmission selects sets of corticostriatal terminals. Neuron. 2004;42:653–663.[PubMed] Using optical, electrochemical and electrophysiological approaches, these authors demonstrate that dopamine through a presynaptic D2R-mediated mechanism regulate glutamate release from corticostriatal terminals. This mechanism is proposed to act as a filter to reduce the noise caused by less active terminals.

21. Delle Donne KT, Sesack SR, Pickel VM. Ultrastructural immunocytochemical localization of the dopamine D2 receptor within GABAergic neurons of the rat striatum. Brain Res. 1997;746:239–255.[PubMed]

22. Wang Z, Kai L, Day M, Ronesi J, Yin HH, Ding J, Tkatch T, Lovinger DM, Surmeier DJ. Dopaminergic control of corticostriatal long-term synaptic depression in medium spiny neurons is mediated by cholinergic interneurons. Neuron. 2006;50:443–452.[PubMed]

23. Surmeier DJ, Ding J, Day M, Wang Z, Shen W. D1 and D2 dopamine-receptor modulation of striatal glutamatergic signaling in striatal medium spiny neurons. Trends Neurosci. 2007;30:228–235.[PubMed]

24. Centonze D, Gubellini P, Usiello A, Rossi S, Tscherter A, Bracci E, Erbs E, Tognazzi N, Bernardi G, Pisani A, et al. Differential contribution of dopamine D2S and D2L receptors in the modulation of glutamate and GABA transmission in the striatum. Neuroscience. 2004;129:157–166.[PubMed]

25. Centonze D, Picconi B, Baunez C, Borrelli E, Pisani A, Bernardi G, Calabresi P. Cocaine and amphetamine depress striatal GABAergic synaptic transmission through D2 dopamine receptors. Neuropsychopharmacology. 2002;26:164–175.[PubMed]

26. Dickinson SD, Sabeti J, Larson GA, Giardina K, Rubinstein M, Kelly MA, Grandy DK, Low MJ, Gerhardt GA, Zahniser NR. Dopamine D2 receptor-deficient mice exhibit decreased dopamine transporter function but no changes in dopamine release in dorsal striatum. J Neurochem. 1999;72:148–156.[PubMed]

27. Rouge-Pont F, Usiello A, Benoit-Marand M, Gonon F, Piazza PV, Borrelli E. Changes in extracellular dopamine induced by morphine and cocaine: crucial control by D2 receptors. J Neurosci. 2002;22:3293–3301.[PubMed]

28. Benoit-Marand M, Borrelli E, Gonon F. Inhibition of dopamine release via presynaptic D2 receptors: time course and functional characteristics in vivo. J Neurosci. 2001;21:9134–9141.[PubMed]

29. Schmitz Y, Schmauss C, Sulzer D. Altered dopamine release and uptake kinetics in mice lacking D2 receptors. J Neurosci. 2002;22:8002–8009.[PubMed]

30. Rouge-Pont F, Piazza PV, Kharouby M, Le Moal M, Simon H. Higher and longer stress-induced increase in dopamine concentrations in the nucleus accumbens of animals predisposed to amphetamine self-administration. A microdialysis study. Brain Res. 1993;602:169–174.[PubMed]

31. Hooks MS, Jones GH, Juncos JL, Neill DB, Justice JB. Individual differences in schedule-induced and conditioned behaviors. Behav Brain Res. 1994;60:199–209.[PubMed]

32. Marinelli M, White FJ. Enhanced vulnerability to cocaine self-administration is associated with elevated impulse activity of midbrain dopamine neurons. J. Neurosci. 2000;20:8876–8885.[PubMed]

33. Bolan EA, Kivell B, Jaligam V, Oz M, Jayanthi LD, Han Y, Sen N, Urizar E, Gomes I, Devi LA, et al. D2 receptors regulate dopamine transporter function via an extracellular signal-regulated kinases 1 and 2-dependent and phosphoinositide 3 kinase-independent mechanism. Mol Pharmacol. 2007;71:1222–1232.[PubMed]

34. Lee FJ, Pei L, Moszczynska A, Vukusic B, Fletcher PJ, Liu F Dopamine transporter cell surface localization facilitated by a direct interaction with the dopamine D2 receptor. Embo J. 2007;26:2127–2136.[PubMed] This article reports for the first time an association between D2Rs and DAT, which modulates DAT activity and dopamine concentration at the synapse.

35. Gainetdinov RR, Caron MG. Monoamine transporters: from genes to behavior. Annu Rev Pharmacol Toxicol. 2003;43:261–284.[PubMed]

36. Konradi C. The molecular basis of dopamine and glutamate interactions in the striatum. Adv Pharmacol. 1998;42:729–733.[PubMed]

37. Valjent E, Pascoli V, Svenningsson P, Paul S, Enslen H, Corvol JC, Stipanovich A, Caboche J, Lombroso PJ, Nairn AC, et al. Regulation of a protein phosphatase cascade allows convergent dopamine and glutamate signals to activate ERK in the striatum. Proc Natl Acad Sci U S A. 2005;102:491–496. [PMC free article][PubMed]

38. Xu M, Hu XT, Cooper DC, Moratalla R, Graybiel AM, White FJ, Tonegawa S. Elimination of cocaine-induced hyperactivity and dopamine-mediated neurophysiological effects in dopamine D1 receptor mutant mice. Cell. 1994;79:945–955.[PubMed]

39. Bertran-Gonzalez J, Bosch C, Maroteaux M, Matamales M, Herve D, Valjent E, Girault JA Opposing patterns of signaling activation in dopamine D1 and D2 receptor-expressing striatal neurons in response to cocaine and haloperidol. J Neurosci. 2008;28:5671–5685.[PubMed] Using newly generated mice expressing fluorescent proteins under the control of the dopamine D1R or D2R promoters, these authors perform an elegant analysis of the molecular response to cocaine and haloperidol in vivo. The results show that acute cocaine activates mostly D1R expressing MSNs sparing D2R expressing cells.

40. Welter M, Vallone D, Samad TA, Meziane H, Usiello A, Borrelli E Absence of dopamine D2 receptors unmasks an inhibitory control over the brain circuitries activated by cocaine. Proc Natl Acad Sci U S A. 2007;104:6840–6845.[PubMed] Using D2R−/− and D2L−/− mice, these authors show that the motor and cellular responses to cocaine are severely impaired in the absence of both isoforms of the D2R. This unexpected results suggest that D2R-mediated signaling exert an inhibitory effect on yet to determine brain circuitries. Importantly, the presence of only D2S, as in D2L−/− mice, is able to restore a normal response very likely through preserved presynaptic functions.

41. Kelly MA, Rubinstein M, Phillips TJ, Lessov CN, Burkhart-Kasch S, Zhang G, Bunzow JR, Fang Y, Gerhardt GA, Grandy DK, et al. Locomotor activity in D2 dopamine receptor-deficient mice is determined by gene dosage, genetic background, and developmental adaptations. J Neurosci. 1998;18:3470–3479.[PubMed]

42. Chausmer AL, Elmer GI, Rubinstein M, Low MJ, Grandy DK, Katz JL. Cocaine-induced locomotor activity and cocaine discrimination in dopamine D2 receptor mutant mice. Psychopharmacology (Berl) 2002;163:54–61.[PubMed]

43. Liu XY, Chu XP, Mao LM, Wang M, Lan HX, Li MH, Zhang GC, Parelkar NK, Fibuch EE, Haines M, et al. Modulation of D2R-NR2B interactions in response to cocaine. Neuron. 2006;52:897–909.[PubMed]

44. Caine SB, Negus SS, Mello NK, Patel S, Bristow L, Kulagowski J, Vallone D, Saiardi A, Borrelli E. Role of dopamine D2-like receptors in cocaine self-administration: studies with D2 receptor mutant mice and novel D2 receptor antagonists. J Neurosci. 2002;22:2977–2988.[PubMed]

45. Rocha BA, Fumagalli F, Gainetdinov RR, Jones SR, Ator R, Giros B, Miller GW, Caron MG. Cocaine self-administration in dopamine-transporter knockout mice. Nat Neurosci. 1998;1:132–137.[PubMed]

46. Maldonado R, Saiardi A, Valverde O, Samad TA, Roques BP, Borrelli E. Absence of opiate rewarding effects in mice lacking dopamine D2 receptors. Nature. 1997;388:586–589.[PubMed]

47. Elmer GI, Pieper JO, Rubinstein M, Low MJ, Grandy DK, Wise RA. Failure of intravenous morphine to serve as an effective instrumental reinforcer in dopamine D2 receptor knock-out mice. J Neurosci. 2002;22:RC224.[PubMed]

48. Elmer GI, Pieper JO, Levy J, Rubinstein M, Low MJ, Grandy DK, Wise RA. Brain stimulation and morphine reward deficits in dopamine D2 receptor-deficient mice. Psychopharmacology (Berl) 2005;182:33–44.[PubMed]

49. Phillips TJ, Brown KJ, Burkhart-Kasch S, Wenger CD, Kelly MA, Rubinstein M, Grandy DK, Low MJ. Alcohol preference and sensitivity are markedly reduced in mice lacking dopamine D2 receptors. Nat Neurosci. 1998;1:610–615.[PubMed]

50. Risinger FO, Freeman PA, Rubinstein M, Low MJ, Grandy DK. Lack of operant ethanol self-administration in dopamine D2 receptor knockout mice. Psychopharmacology (Berl) 2000;152:343–350.[PubMed]

51. Cepeda C, Hurst RS, Altemus KL, Flores-Hernandez J, Calvert CR, Jokel ES, Grandy DK, Low MJ, Rubinstein M, Ariano MA, et al. Facilitated glutamatergic transmission in the striatum of D2 dopamine receptor-deficient mice. J Neurophysiol. 2001;85:659–670.[PubMed]

52. Chesselet MF, Plotkin JL, Wu N, Levine MS. Development of striatal fast-spiking GABAergic interneurons. Prog Brain Res. 2007;160:261–272.[PubMed]

53. Tirotta E, Fontaine V, Picetti R, Lombardi M, Samad TA, Oulad-Abdelghani M, Edwards R, Borrelli E. Signaling by dopamine regulates D2 receptors trafficking at the membrane. Cell Cycle. 2008;7:2241–2248.[PubMed]

In vivo evidence for the involvement of dopamine D2 receptors in striatum and anterior cingulate gyrus in major depression. (1997)

 

Neuroimage. 1997 May;5(4 Pt 1):251-60.

Larisch R, Klimke A, Vosberg H, Löffler S, Gaebel W, Müller-Gärtner HW.

Source

Clinic of Nuclear Medicine, University of Düsseldorf, Germany.

Abstract

The dopaminergic system is a candidate neurotransmitter system thought to be involved in the pathogenesis of depression. This study addresses the issue whether the antidepressant efficacy of serotonin reuptake inhibition is related to changes in the cerebral dopaminergic system. Cerebral dopamine-D2 receptors were characterized in 13 patients with major depression using the dopamine-D2 receptor antagonist iodobenzamide and single photon emission tomography. Dopamine receptor binding was assessed twice, before and during serotonin reuptake inhibition. An increase in dopamine-D2 receptor binding during serotonin reuptake inhibition was found in striatum and anterior cingulate gyrus in treatment responders, but not in nonresponders. The increase in dopamine-D2 receptor binding correlated significantly with clinical recovery from depression as assessed with the Hamilton depression scale (r = 0.59 for right and left striatum respectively, P < 0.05; r = 0.79 for the anterior cingulate gyrus, P < 0.05 after Bonferroni correction). Qualitatively similar correlations were observed in the precentral gyrus, the medial frontal gyrus, the inferior frontal gyrus, and the frontal part of the opercular gyrus, but these correlations failed to reach statistical significance after correction for the effects of multiple testing. No such correlations were found in the superior frontal gyrus, the orbitofrontal gyrus, the gyrus rectus, the superior parietal gyrus, or the superior temporal gyrus. The data strengthen the concept that the striatum and the anterior cingulate gyrus are involved in mood regulation. Dopamine-D2 receptors may constitute a central role in this domain.

 

Increased Impulsivity Retards the Transition to Dorsolateral Striatal Dopamine Control of Cocaine Seeking (2014)

Biological Psychiatry Volume 76, Issue 1, Pages 15–22, July 1, 2014

Received: May 21, 2013; Received in revised form: September 18, 2013; Accepted: September 18, 2013; Published Online: October 23, 2013
 

 

Background

Development of maladaptive drug-seeking habits occurs in conjunction with a ventral-to-dorsal striatal shift in dopaminergic control over behavior. Although these habits readily develop as drug use continues, high impulsivity predicts loss of control over drug seeking and taking. However, whether impulsivity facilitates the transition to dorsolateral striatum (DLS) dopamine-dependent cocaine-seeking habits or whether impulsivity and cocaine-induced intrastriatal shifts are additive processes is unknown.

Methods

High- and low-impulsive rats identified in the five-choice serial reaction-time task were trained to self-administer cocaine (.25 mg/infusion) with infusions occurring in the presence of a cue-light conditioned stimulus. Dopamine transmission was blocked in the DLS after three stages of training: early, transition, and late-stage, by bilateral intracranial infusions of α-flupenthixol (0, 5, 10, or 15 μg/side) during 15-min cocaine-seeking test sessions in which each response was reinforced by a cocaine-associated conditioned stimulus presentation.

Results

In early-stage tests, neither group was affected by DLS dopamine receptor blockade. In transition-stage tests, low-impulsive rats showed a significant dose-dependent reduction in cocaine seeking, whereas high-impulsive rats were still unaffected by α-flupenthixol infusions. In the final, late-stage seeking test, both groups showed dose-dependent sensitivity to dopamine receptor blockade.

Conclusions

The results demonstrate that high impulsivity is associated with a delayed transition to DLS-dopamine-dependent control over cocaine seeking. This suggests that, if impulsivity confers an increased propensity to addiction, it is not simply through a more rapid development of habits but instead through interacting corticostriatal and striato-striatal processes that result ultimately in maladaptive drug-seeking habits.

Increasing evidence suggests that addiction results from the convergence of various neurobiological adaptations in vulnerable subjects, eventually resulting in the loss of control over maladaptive drug seeking (1, 2, 3). Exposure to addictive drugs, such as cocaine, not only impairs executive processes, resulting in impulse control deficits and behavioral inflexibility (4), but it also facilitates the development of drug-seeking habits (3, 5, 6), thereby rendering instrumental actions that are resistant to their immediate consequences and motivational significance (6, 7). Addictive drugs trigger adaptations within corticostriatal circuitry, including reductions in metabolic activity and D2 dopamine receptors, that are initially restricted to the ventral limbic areas of the striatum and prefrontal cortex but eventually encompass the more dorsolateral, associative and cognitive, territories of these structures (8, 9, 10). This progressive shift from limbic to cognitive corticostriatal networks that occurs over the course of addiction (11) takes place alongside a transition from the nucleus accumbens to the dorsolateral striatum (DLS) in the locus of control over drug seeking and taking (12) and the associated imbalance in fronto-striatal and striato-striatal functional coupling (13) displayed by former and current addicted individuals.

Studies in animals have further demonstrated that this ventral to DLS shift in the control over drug seeking (14, 15) is not only associated with the development of habitual responding for the drug as assessed by devaluation procedures (3, 6) but also reflects the emergence of compulsive cocaine seeking (16). The latter, a hallmark feature of addiction (17), is predicted by the behavioral trait of high impulsivity (18), which is associated with low D2/3 dopamine receptor availability in the ventral striatum (19). This has led to hypotheses suggesting that impulsivity and habits, with their striatal dopaminergic substrates, interact during the development of cocaine addiction, but the neurobiological basis of this interaction is unknown. Neurocomputational learning theory-based, actor-critic models of basal ganglia function (20) suggest that high impulsivity and its associated low D2 dopamine receptor availability in the ventral striatum facilitate the transition to DLS control over drug self-administration. However, we and others have suggested that compulsive drug seeking in addiction might instead result from weak inhibitory control over a rather independently established, drug-influenced, maladaptive incentive habit (4, 21).

We therefore directly investigated whether high impulsivity interacts with the recruitment of dopamine-dependent DLS control over cocaine-seeking behavior over an extended period of cocaine self-administration. To do this, we investigated the effects of bilateral infusions of the dopamine receptor antagonist α-flupenthixol into the DLS of rats identified as high (HI) and low impulsive (LI) in the 5-choice serial reaction-time task (5-CSRTT), on cue-controlled cocaine-seeking behavior at early, transitional, and late stages of training under a second-order schedule of reinforcement for cocaine (22). Under these conditions we have previously shown that cocaine seeking becomes dependent upon dopamine transmission in the DLS (14, 18, 23), and the functional recruitment of this dopaminergic mechanism is a neurobiological marker of the emergence of drug-seeking habits (3, 6).

Methods and Materials

Subjects

Forty male Lister Hooded rats (Charles River Laboratories, Kent, United Kingdom) weighing approximately 300 g on arrival were housed as described previously (23). Experiments were conducted in accordance with the United Kingdom 1986 Animals (Scientific Procedures) Act.


5-CSRTT

Apparatus and Procedure. The 5-CSRTT apparatus has been described in detail elsewhere (24, 25) (Supplement 1). The training procedure was identical to that previously described (18). Each training session began with illumination of the operant chamber by a house light and the delivery of a food pellet in the magazine. Pushing open the magazine panel and collecting this pellet initiated the first trial. After a fixed intertrial interval (ITI), a light at the rear of one of the response apertures was briefly illuminated. Responses in this aperture within a limited-hold period (5 sec) were reinforced by the delivery of a food pellet in the magazine (correct responses). Responses in a nonilluminated aperture were recorded as incorrect responses and were punished by a 5-sec time-out period. Failure to respond within the limited-hold period counted as an omission and was likewise punished. Additional responses in any aperture before food collection (perseverative responses) were recorded but not punished. Responses made in any aperture before the onset of the target stimulus, or premature responses, were punished by a 5-sec time-out period. Across training sessions, the ITI was gradually increased, and the stimulus duration was gradually decreased (25). Subjects were considered to have acquired the task when accuracy was > 75% and omissions were fewer than 20% while the stimulus duration was .5 sec with a 5-sec ITI.

After 2 weeks of stable responding, rats underwent three 60-min challenge 7-sec ITI (long intertrial interval [LITI]) sessions, separated by baseline 5-sec ITI sessions (18, 26). The LITIs markedly increase premature responding, thereby facilitating the identification of interindividual differences in impulsivity. The number of premature responses during LITI sessions provides an index of impulse control (18, 19, 24, 25, 26), which is used to identify HI or LI rats. Subjects were ranked according to the mean number of premature responses during the last two LITI sessions (10, 18). Those with <20 or >50 premature responses were selected as LI and HI rats, respectively (n = 8/group) (Figure S1 in Supplement 1).

In addition, premature responses, magazine panel pushes, correct and incorrect responses, omitted trials, and collection latency (milliseconds to collect the food pellet) were averaged across the baseline sessions preceding each of the last two LITI sessions to compare baseline behavioral performance in LI and HI rats


Surgery

Rats then underwent standard intravenous and intrastriatal surgeries under general anesthesia (Supplement 1). Cannulae were implanted bilaterally 2 mm above the dorsolateral striatum (anterior/posterior+1.2, medial/lateral±3, dorsal/ventral-3 [15]; AP and ML coordinates measured from bregma, DV coordinates from the skull surface, incisor bar at −3.3 mm [27]).


Drugs

Cocaine hydrochloride (Macfarlan-Smith, Edinburgh, United Kingdom) was dissolved in sterile .9% saline. α-Flupenthixol (Sigma Aldrich, Poole, United Kingdom) was dissolved in double-distilled water. Drug doses are reported in the salt form.


Cocaine Self-Administration

Apparatus. Twelve standard operant conditioning chambers described in detail elsewhere (15) were used (Methods in Supplement 1).

Procedure. The timeline of self-administration procedures is shown in Figure 1. Briefly, cocaine self-administration training sessions began 7 days after surgery. Cocaine (.25 mg/infusion; .1 mL/5 sec) was available under a fixed-ratio 1 (FR1) (continuous reinforcement) schedule of reinforcement in which one active lever press resulted in an infusion and initiated a 20-sec timeout. During that 20 sec, the cue-light (conditioned stimulus [CS]) above the active lever was illuminated, the house light was extinguished, and both levers were retracted. Pressing on the inactive lever was recorded to provide an index of general activity but had no programmed consequence. A maximum of 30 cocaine infusions was available at this stage. Active and inactive lever assignment was counterbalanced.

Thumbnail image of Figure 1. Opens large image

Figure 1

The timeline of self-administration experimentation. Subjects underwent intravenous catheter and central cannulae surgery a week before beginning behavioral training. There were five sessions of fixed-ratio 1 (FR1) training followed by early-acquisition testing. From Days 13 to 17, the response requirement was increased across sessions to the mid-stage training schedule of FR10(FR4:S). Rats remained on that schedule for five sessions before entering mid-stage testing. The response requirement was again increased on Days 30 and 31 to the final second-order training schedule, FI15(FR10:S). Rats were again tested after 15 training sessions from Days 32 to 46 on the final schedule of reinforcement. Late-stage testing began on Day 37. d, day; FI, fixed-interval.

After five training sessions under the FR1 schedule of reinforcement, the dose-dependent effects of striatal dopamine receptor blockade on early-stage cocaine seeking were tested. Bilateral infusions of α-flupenthixol were made into the DLS. These 15-min test sessions [FI15(FR10:S)] instituted a change in contingency in that every active lever press resulted in a 1-sec light CS presentation, and cocaine was only delivered on the first lever press after the 15-min interval (23). Thus, the early performance tests were conducted before and were thus unaffected by self-administered cocaine on these sessions, because they were explicitly assessed for cocaine seeking within the fixed interval rather than a fixed ratio. Each test session was immediately followed by a FR1 cocaine self-administration training session (30 reinforcers over 2 hours), and rats were given a training session between test days so as to confirm and maintain a stable cocaine-taking baseline.

After the tests evaluating the early performance of cocaine seeking, the response requirement was increased across the daily training sessions through the following schedules of reinforcement: FR1; FR3; FR5(FR2:S); FR10(FR2:S); then to FR10(FR4:S). Under each intermediate second-order schedule, completion of the unit schedule (given within parentheses) resulted in a 1-sec CS light presentation; cocaine infusions and the 20-sec timeout were given only upon completion of the overall schedule. Therefore, for the transition-stage assessments, rats had been trained under conditions that promote the association between instrumental responding and conditioned reinforcers: contingent presentations of the cocaine-associated CS occurred after 4 responses (FR4:S); and cocaine was delivered on completion of the 10th set of four lever presses. Rats remained on this schedule for five training sessions before beginning the transition-stage cocaine-seeking tests. During each 15-min test session with α-flupenthixol infusions in the DLS, every four active lever presses continued to result in a 1-sec light CS presentation, and cocaine was only delivered on the fourth lever press after the 15-min interval [i.e., FI15(FR4:S)]. Thus, the transition-stage performance tests were again conducted before and were unaffected by daily self-administered cocaine. Each test session was immediately followed by an FR10(FR4:S) cocaine self-administration training session (30 reinforcers over 2 hours), and rats were given a training session between test days so as to confirm and maintain a stable cocaine-taking baseline.

After completing the tests evaluating cocaine seeking at the transition stage, the response requirements were again increased through daily training sessions across the following schedules of reinforcement: FR10(FR6:S); FR10(FR10:S); and finally to an overall fixed interval (fixed ratio) schedule of FI15(FR10:S) used in previous studies (23, 28). During the final FI15(FR10:S) schedule, responding was maintained by contingent presentation of the cocaine-associated CS after 10 responses (FR10:S); cocaine was delivered on completion of the first 10 lever presses after the expiration of each 15-min fixed interval. At this final stage, there was a limit of five available cocaine infusions. Rats were trained under this FI15(FR10:S) schedule of reinforcement for 15 sessions before the well-established, or late-stage, tests were conducted, in which the effects of α-flupenthixol infusions in the DLS were again assessed. The first interval (FI15) of the second-order schedule provides a time period in which no cocaine has been administered, yet rats are actively seeking the drug. Two rats were removed before the final tests, due to faulty catheters. Rats were given at least one session of training under FI15(FR10:S) conditions between each α-flupenthixol infusion test to ensure baseline stable baseline levels of responding.


Intrastriatal Infusions

For all three testing stages, intrastriatal infusions (.5 μL/side) of α-flupenthixol (0, 5, 10, and 15 μg/infusion in a counterbalanced, Latin-square order of treatment) were made with 28-gauge steel hypodermic injectors (Plastics One, Roanoke, Virginia) lowered to the injection sites 2 mm ventral to the end of the guide cannulae (i.e., DV-5 mm). Bilateral infusions were made over 90 sec with a syringe pump (Harvard Apparatus, Holliston, Massachusetts) and were followed by a 60-sec diffusion period before injectors were removed and obturators were replaced. Test sessions began 5 min later.


Histology

At the end of the experiment, histology was conducted as described previously (23) (Supplement 1).


Statistical Analyses

Premature responses in the 5-CSRTT were analyzed with 2-way analyses of variance (ANOVAs) with Session as the within-subject factor, and Group (HI or LI) as the between-subjects factor. Premature responses were then correlated with selected training measures from the 5-CSRTT, and significant correlations were confirmed with between-subject t tests.

Recruitment of DLS dopaminergic involvement in cocaine seeking was confirmed with a three-way ANOVA with Stage (early, transition, and well-established), Dose (0, 5, 10, and 15 μg), and Lever (active and inactive) as within-subject factors. The differential recruitment of DLS dopaminergic involvement in cocaine seeking between HI and LI rats was investigated with a three-way ANOVA with planned contrasts (29) with Session (weights on session 2 vs. session 1) and Dose (weights on doses of 10 and 15 µg/side vs. vehicle) as the within-subject factors and Group (HI or LI) as the between-subjects factor. Differences between HI and LI rats for each stage were then investigated with ANOVA with Dose and Lever as within-subject factors. Significant interactions were analyzed further with Tukey’s honestly significant difference (HSD) tests. Significance was set at α = .05.


Results

5-CSRTT

Rats selected as HI (n = 8) in the 5-CSRTT displayed greater sensitivity to increased ITI duration than the LI (n = 8) rats as supported by increases in premature responses for the three LITI trials for the HI compared with the LI rats (Figure 2) (main effects of Group: F1,14 = 65.20, p < .001, Session: F14,196 = 59.34, p < .001, and Group × Session interaction: F14,196 = 25.44, p < .001). Post hoc analysis revealed that group differences emerged as a result of lengthening the ITI (HSD = 14.477).

Thumbnail image of Figure 2. Opens large image 

Figure 2

High-impulsive rats are characterized by a high number of premature responses made before the onset of the target stimulus during the long inter-trial intervals (LITIs) but not during baseline (BL) sessions. *Significant difference from low-impulsive rats during the same LITI.

Higher impulsivity (measured as the level of premature responses during the last two LITI sessions) was related to greater amounts of goal tracking (measured as panel pushes into the magazine) and latency to collect earned pellets as revealed by a positive relationship between premature responses and panel pushing during training (τ = .481, p = .010) (Figure 3A); this was further confirmed by a follow-up t test comparing the number of panel pushes in HI and LI rats (t14 = 2.36, p = .033). Impulsivity was not, however, related to motivation for the reinforce, as revealed by both the lack of relationship between the number of premature responses and the latency to collect pellets after a correct trial (τ = −.211, p = .259) (Figure 3B) and the absence of a difference in this latter measure between HI and LI rats (t14 = 1.14, p = .273). Baseline behavioral measures recorded during the training sessions immediately preceding LITI 2 and 3 are shown in Table S1 in Supplement 1.

Thumbnail image of Figure 3. Opens large image 

Figure 3

Premature responses during the long inter-trial interval (LITI) sessions were correlated with magazine panel pushes (goal-tracking) (A) and latency to collect reinforcers (motivation) (B) during training sessions. High-impulsive rats showed higher levels of interaction with the magazine, but not more motivated to obtain the reward, than low-impulsive rats.


Histological Assessments

All rats had cannulae located bilaterally within the DLS (Figure 4) (27).

Thumbnail image of Figure 4. Opens large image 

Figure 4

Schematic representations of the localization of injection sites in high-impulsive (A) and low-impulsive (B) rats with guide cannulae placed in the anterior dorsolateral striatum. Reprinted from Paxinos and Watson (27) with permission from Elsevier, copyright 1998.


Recruitment of DLS Dopamine Control over Cocaine Seeking

Progressive recruitment of dopamine-dependent DLS processes in the control over well-established, habitual, cue-controlled cocaine-seeking behavior was observed from early to late stage tests as illustrated by the progressive increase in the effect of bilateral intra-DLS α-flupenthixol infusions on active lever presses during the 15-min drug-free cocaine-seeking interval (Stage × Dose × Lever interaction: F6,78 = 3.50, p = .004), confirming our earlier results (15, 23). Thus, although dopamine receptor blockade in the DLS was ineffective during the early stage of cocaine seeking (Figure 5A) (effect of Dose: F3,45 = 1.03, p = .389 and Lever × Dose interaction: F3,45 = 1.06, p = .375), it dose-dependently reduced cocaine seeking when performed at the transition stage (Figure 5B) (main effect of Dose, F3,45 = 3.41, p = .025; and a Lever × Dose interaction, F3,45 = 3.45, p = .024). Post hoc analyses revealed that this effect was attributable to the 10- and 15-μg/side doses of α-flupenthixol (HSD = 26.59). When cue-controlled cocaine seeking was well-established, bilateral DLS α-flupenthixol infusions resulted in an even more pronounced decrease in cocaine-seeking responses measured during the 15-min drug-free interval (Figure 5C) (main effect of Dose: F3,39 = 9.69, p < .001 and Lever × Dose interaction: F3,39 = 9.01, p < .001). At this stage, all doses of α-flupenthixol significantly reduced cocaine seeking relative to vehicle (HSD = 40.30).

Thumbnail image of Figure 5. Opens large image 

Figure 5

Progressive recruitment of dopamine-dependent dorsolateral striatum control over cue-controlled cocaine seeking. Active and inactive lever presses (±1 SEM) during (cocaine-free) tests of drug seeking with α-flupenthixol injections into the dorsolateral striatum of high- and low-impulsive rats combined at the early (A), transition (B), and well-established (C) stages of training. *Significant difference in active lever responding from the 0 μg test. +Significant difference between active and inactive lever responses for each dose tested. FI, fixed-interval; FR, fixed-ratio.


Impulsivity Is Associated with a Delayed Transition to DLS Dopamine Control over Cocaine Seeking

The progressive recruitment of DLS dopamine control over cocaine seeking observed in the entire population was modulated by impulsivity status. Thus, HI and LI rats displayed different time-courses in their sensitivity to DLS dopamine receptor blockade over the transition from early to well-established, habitual, cue-controlled cocaine seeking (Session × Dose × Group contrasts: F1,12 = 8.07, p < .05). Thus, whereas DLS α-flupenthixol infusions had no significant effect on active lever presses in HI (Figure 6A) and LI rats (Figure 6B) during the early seeking tests (main effects of Dose or Dose × Lever interaction: Fs ≤ 2.83, p ≥ .063), they dose-dependently decreased cocaine seeking in LI rats (Figure 6C) (main effect of Dose: F3,21 = 3.89, p = .023, and a Dose × Lever interaction: F3,21 = 3.86, p = .024) but not in HI rats (Figure 6D) (Fs < 1) during the transition seeking tests. Post hoc analyses revealed that cocaine seeking in LI rats behavior was decreased after infusions of 10- and 15-μg/side doses of α-flupenthixol relative to vehicle and inactive lever presses (HSD = 40.62).

Thumbnail image of Figure 6. Opens large image 

Figure 6

Delayed transition to dorsolateral striatum control over cocaine-seeking behavior in high impulsive rats. Active and inactive lever presses (±1 SEM) during (cocaine-free) tests of drug seeking with α-flupenthixol injections into the dorsolateral striatum of low- and high-impulsive rats at the early (A, B, respectively), transition (C, D, respectively), and well-established (E, F, respectively) stages of training. *Significant difference in active lever responding from the 0 μg test. +Significant difference between active and inactive lever responses for each dose tested. FI, fixed-interval; FR, fixed-ratio.

In the well-established seeking tests, after rats had been trained to seek cocaine under the control of contingent presentations of the drug associated CSs, during the FI15(FR10:S) stage of the second-order schedule, responding was dose-dependently decreased by bilateral infusions of α-flupenthixol into the DLS in both HI and LI rats. LI rats continued to display dose-dependent effects of α-flupenthixol infusions into the DLS (Figure 6E), while this sensitivity to DLS dopamine receptor blockade now emerged in HI rats (Figure 6F) (main effect of Dose: F3,15 = 5.23, p = .011 and F3,21 = 4.11, p = .019, respectively, Dose × Lever interaction: F3,15 = 5.20, p = .012 and F3,21 = 3.59, p = .031, respectively). Thus, the 10 and 15 μg/side doses of α-flupenthixol markedly reduced active-lever presses relative to vehicle such that significant differences between active and inactive lever pressing were no longer observed (HSD = 69.58 and HSD = 55.62 for LI and HI rats, respectively).

Although a shift in the time course of the recruitment of dopamine-dependent DLS control over cue-controlled cocaine seeking was observed between HI and LI rats, the two groups differed neither in the propensity to initiate cocaine self-administration over the five FR1 acquisition sessions (main effect of Session: F4,56 = 3.124, p = .022 but no effect of Group: F1,14 = 1.606, p = .226, or Group × Session interaction: F < 1) nor in their performance to the increasing behavioral demands associated with each stage of the establishment of a second-order schedule of reinforcement for the drug. Indeed, no differences were observed in cocaine-seeking responses between HI and LI rats either during the five FR10(FR4:S) sessions that preceded the intermediate stage assessment (all Fs < 1) or during the FI15(FR10:S) sessions that preceded the late stage assessment (main effect of Group: F1,12 = 1.367, p = .265, and Group × Session interaction: F14,168 = 1.167, p = .305), despite an overall increase in active lever presses over the sessions, indicative of the progressive increase in the influence of contingent presentations on CS on instrumental cocaine-seeking responses over time (main effect of Session: F14,168 = 1.872, p = .033).


Discussion

Cocaine-induced intrastriatal processes eventually resulting in DLS dopamine-dependent drug-seeking habits (3, 14, 15, 23, 30, 31) are increasingly considered to be a pivotal mechanism during the development of addiction (16). Although impulsivity characterized by low ventral striatal D2/3 dopamine receptor availability (19) has been identified as a key marker of the individual propensity to switch from controlled to compulsive drug use (18), the ways in which impulsivity and its underlying neural substrates interact with drug-induced intrastriatal adaptations are unknown. According to our earlier speculation (28) and a computational model of addiction based on striatal function (20), the trait of high impulsivity and associated low dopamine D2/3 ventral striatal dopamine receptors (19) has been suggested to facilitate drug-induced recruitment of DLS-dependent habitual control over cocaine-seeking behavior. By contrast, integrative hypotheses suggest that addiction develops when the neurobiological underpinnings of impaired executive, corticostriatal-dependent, inhibitory control, lying at the core of impulsivity, add to and converge with those associated with drug-induced intrastriatal shifts subserving the development of cue-controlled drug-seeking habits (6, 7, 21, 32, 33).

The findings in the present study support the latter view by providing evidence that increased impulsivity does not facilitate or accelerate the progressive recruitment of dopamine-dependent DLS control over behavior that has been shown to underlie both drug-seeking habits and compulsive cocaine seeking (3, 6, 15, 16, 23). Instead, high impulsivity was associated with a delay in striato-striatal neuroadaptations leading to the progressive devolution of control over cocaine seeking to DLS dopamine-dependent processes. This thereby indicates that the interaction between impulsivity and cocaine-induced recruitment of dopamine-dependent dorsolateral striatal control over behavior underlying the eventual transition to compulsive drug seeking (16) might depend upon interactive, co-occurring corticostriatal and striato-striatal processes. It might therefore be speculated that compulsive drug seeking arises from the development of qualitatively aberrant, rigid, maladaptive habits in vulnerable individuals that are characterized by premorbid alterations in corticostriatal-dependent inhibitory control processes.

Thus, in HI rats, there was a shift in the time-course of the effects of bilateral intra-DLS infusions of the dopamine receptor antagonist α-flupenthixol to reduce active lever presses during the 15-min drug-seeking challenge tests. Although DLS dopamine receptor blockade had no effect on cue-controlled cocaine-seeking responses at the early performance test stage, it significantly decreased active lever presses at the later, habitual test stage, the two test stages when there were no significant differences between HI and LI rats. These data, in agreement with our previous work (23), thereby demonstrate that—regardless of differences in impulse control—all subjects eventually develop DLS dopamine-dependent cocaine-seeking habits after protracted drug-seeking performance (3, 8, 15, 23). However, at the intermediate stage of training, cocaine-seeking responses were decreased by DLS dopamine receptor blockade specifically in LI but not HI rats.

This delayed recruitment of the DLS in the control over cocaine seeking suggests that low availability of ventral striatum dopamine D2 receptors might influence drug-induced adaptations underlying the progressive ventral to dorsal striatal shift that occurs in the course of addiction in humans (12, 34) and during extended periods of cocaine self-administration in nonhuman primates (8, 9, 11, 35) and rats (10). We and others have suggested that this ventral to dorsal striatal shift depends upon the dopamine-dependent ascending spiraling circuitry (36, 37) functionally linking the ventral with the dorsolateral striatum (13, 15, 31, 38), even though the mechanisms whereby this circuitry is recruited remain to be established. Added to the recent demonstration that the progressive cocaine-induced ventral to the dorsal striatum decrease in dopamine D2 receptors and messenger RNA (mRNA) levels demonstrated in primates (39, 40, 41) and rats (10) is also delayed in HI as compared with LI rats (10), despite lower baseline levels of D2 mRNA in the nucleus accumbens shell and dopaminergic neurons of the former (10), the present results suggest that low D2 receptor availability in the ventral striatum retards intra-striatal cocaine-induced plasticity processes. This is consistent with the demonstration that individual vulnerability to develop addiction-like behavior for cocaine, that we have demonstrated to be highly predicted by high impulsivity (18), is associated with impaired cocaine-induced plasticity in the ventral striatum (42).

Although protracted cocaine exposure results in marked decreases in striatal D2 dopamine receptor and mRNA levels, an adaptation suggested to contribute to the development of addiction (39, 43, 44, 45), cocaine self-administration in HI rats that display spontaneous low D2 mRNA and receptor levels in the ventral striatum results in a normalization of D2 receptor levels (46) that parallels a reduction in impulsivity. This observation therefore suggests that the potential delay in dorsal striatal recruitment after cocaine exposure observed in HI rats might be attributed to cocaine-induced remediation of low D2 dopamine receptors in the ventral striatum and the associated impulsivity that occurs early on after cocaine self-administration. Indeed, this hypothesis is supported by a recent micro positron emission topography study in LI and HI rats (46). This has important implications at the psychological level in that it suggests that, for HI rats, instrumental actions for cocaine might remain goal-directed for longer than in LI rats, a consequence partly determined by a dopamine deficiency state in the ventral striatum. This is consistent with the observation that HI rats are more focused on a food goal than LI rats, spending more time at the food delivery magazine when trained in the 5-CSRTT. Moreover goal-trackers in a Pavlovian conditioned approach task motivated by food were more impulsive in a delay discounting task than sign-trackers (47), a dimension of impulsivity that is also expressed by HI rats selected in the 5-CSRTT (48). These observations indicate that impulsivity is associated with a dominance of goal-directed behavior during early experience in instrumental and Pavlovian tasks.

The present results show that the psychological mechanisms whereby impulsivity and habits contribute to addiction do not depend upon a facilitation of the development of the latter by the former. However, it is pivotal to dissociate the propensity to develop habits, which in itself is not an aberrant process, from the inability to regain control over maladaptive habits that have become inflexible, such as those that are seen in addicted individuals who compulsively seek and take drugs. This further suggests that vulnerability to addiction does not lie in the propensity of an individual to develop habits but instead in the rigid nature of drug-seeking habits and the inability of an individual to regain control over these maladaptive habits. This inflexibility of drug-seeking habits might stem from either cortical (49) or striatal components of weak inhibitory control or in the persistence of aberrant neurobiological adaptations that have accumulated during the recruitment of dorsolateral striatal control over behavior to overcome the apparent lack of striatal neuroplasticity that characterizes HI rats (10).

This work was supported by Medical Research Council (MRC) grants to BJE and JWD (G1002231, G0701500) and by a joint core award from the MRC and Wellcome Trust (MRC G1000183; WT 093875/Z/10/Z) in support of the Behavioral and Clinical Neuroscience Institute at Cambridge University.

We acknowledge funding support within the MRC Imperial College-Cambridge University-Manchester University (ICCAM) strategic addiction cluster (G1000018). DB is a member of the Groupe de Recheche (GDR) 3557 and is supported by an INSERM AVENIR grant, the ANR “heraddictstress,” the IREB and the University of Poitiers. We thank Emily Jordan, David Theobald, and Alan Lyon for their technical assistance.

The authors reported no biomedical financial interests or potential conflicts of interest.


Appendix A. Supporting Information

References

  1. Chen, B.T., Yau, H.J., Hatch, C., Kusumoto-Yoshida, I., Cho, S.L., Hopf, F.W., and Bonci, A. Rescuing cocaine-induced prefrontal cortex hypoactivity prevents compulsive cocaine seeking. Nature. 2013; 496: 359–362
  2. Pelloux, Y., Dilleen, R., Economidou, D., Theobald, D., and Everitt, B.J. Reduced forebrain serotonin transmission is causally involved in the development of compulsive cocaine seeking in rats. Neuropsychopharmacology. 2012; 37: 2505–2514
  3. View in Article
  4. View in Article
  5. View in Article
  6. View in Article
  7. View in Article
  8. View in Article
  9. View in Article
  10. View in Article
  11. View in Article
  12. View in Article
  13. View in Article
  14. View in Article
  15. View in Article
  16. View in Article
  17. View in Article
  18. View in Article
  19. View in Article
  20. View in Article
  21. View in Article
  22. View in Article
  23. View in Article
  24. View in Article
  25. View in Article
  26. View in Article
  27. View in Article
  28. View in Article
  29. View in Article
  30. View in Article
  31. View in Article
  32. View in Article
  33. View in Article
  34. View in Article
  35. View in Article
  36. View in Article
  37. View in Article
  38. View in Article
  39. View in Article
  40. View in Article
  41. View in Article
  42. View in Article
  43. View in Article
  44. View in Article
  45. View in Article
  46. View in Article
  47. View in Article
  48. View in Article
  49. View in Article
  50. View in Article
  51. Zapata, A., Minney, V.L., and Shippenberg, T.S. Shift from goal-directed to habitual cocaine seeking after prolonged experience in rats. J Neurosci. 2010; 30: 15457–15463
  52. Jentsch, J.D. and Taylor, J.R. Impulsivity resulting from frontostriatal dysfunction in drug abuse: implications for the control of behavior by reward-related stimuli. Psychopharmacology. 1999; 146: 373–390
  53. Dickinson, A., Wood, N., and Smith, J. Alcohol seeking by rats: Action or habit?. Q J Exp Psychol B. 2002; 55: 331–348
  54. Corbit, L.H., Nie, H., and Janak, P.H. Habitual alcohol seeking: time course and the contribution of subregions of the dorsal striatum. Biol Psychiatry. 2012; 72: 389–395
  55. Everitt, B. and Robbins, T. Neural systems of reinforcement for drug addiction: From actions to habits to compulsion. Nat Neurosci. 2005; 8: 1481–1489
  56. Porrino, L.J., Daunais, J.B., Smith, H.R., and Nader, M.A. The expanding effects of cocaine: Studies in a nonhuman primate model of cocaine self-administration. Neurosci Biobehav Rev. 2004; 27: 813–820
  57. Porrino, L. Cocaine self-administration produces a progressive involvement of limbic, association, and sensorimotor striatal domains. J Neurosci. 2004; 24: 3554–3562
  58. Besson, M., Pelloux, Y., Dilleen, R., Theobald, D., Belin-Rauscent, A., Robbins, T.W. et al. Cocaine modulation of fronto-striatal expression of zif268, D2 and 5-HT2c receptors in high and low impulsive rats. Neuropschopharmacology. 2013; 38: 1963–1973
  59. Porrino, L., Smith, H.R., Nader, M.A., and Beveridge, T.J. The effects of cocaine: A shifting target over the course of addiction. Prog Neuropsychopharmacol Biol Psychiatry. 2007; 31: 1593–1600
  60. Vollstadt-Klein, S., Wichert, S., Rabinstein, J., Buhler, M., Klein, O., Ende, G. et al. Initial, habitual and compulsive alcohol use is characterized by a shift of cue processing from ventral to dorsal striatum. Addiction. 2010; 105: 1741–1749
  61. Xie, C., Shao, Y., Ma, L., Zhai, T., Ye, E., Fu, L. et al. Imbalanced functional link between valuation networks in abstinent heroin-dependent subjects [published online ahead of print December 4]. Mol Psychiatry. 2012;
  62. Vanderschuren, L.J., Di Ciano, P., and Everitt, B.J. Involvement of the dorsal striatum in cue-controlled cocaine seeking. J Neurosci. 2005; 25: 8665–8670
  63. Belin, D. and Everitt, B.J. Cocaine-seeking habits depend upon dopamine-dependent serial connectivity linking the ventral with the dorsal striatum. Neuron. 2008; 57: 432–441
  64. Jonkman, S., Pelloux, Y., and Everitt, B.J. Differential roles of the dorsolateral and midlateral striatum in punished cocaine seeking. J Neurosci. 2012; 32: 4645–4650
  65. American Psychiatric Association. Diagnostic and Statistical Manual of Mental Disorders, 4th ed. American Psychiatric Press, Washington, DC; 1994
  66. Belin, D., Mar, A., Dalley, J., Robbins, T., and Everitt, B. High impulsivity predicts the switch to compulsive cocaine-taking. Science. 2008; 320: 1352–1355
  67. Dalley, J.W., Fryer, T., Brichard, L., Robinson, E., Theobald, D., Laane, K. et al. Nucleus accumbens D2/3 receptors predict trait impulsivity and cocaine reinforcement. Science. 2007; 315: 1267–1270
  68. Piray, P., Keramati, M.M., Dezfouli, A., Lucas, C., and Mokri, A. Individual differences in nucleus accumbens dopamine receptors predict development of addiction-like behavior: A computational approach. Neural Comput. 2010; 22: 2334–2368
  69. Belin, D., Belin-Rauscent, A., Murray, J.E., and Everitt, B.J. Addiction: Failure of control over maladaptive incentive habits. Curr Opin Neurobiol. 2013; 23: 564–572
  70. Everitt, B. and Robbins, T. Second-order schedules of drug reinforcement in rats and monkeys: Measurement of reinforcing efficacy and drug-seeking behaviour. Psychopharmacology. 2000; 153: 17–30
  71. Murray, J.E., Belin, D., and Everitt, B.J. Double dissociation of the dorsomedial and dorsolateral striatal control over the acquisition and performance of cocaine seeking. Neuropsychopharmacology. 2012; 37: 2456–2466
  72. Robbins, T. The 5-choice serial reaction time task: Behavioural pharmacology and functional neurochemistry. Psychopharmacology. 2002; 163: 362–380
  73. Bari, A., Dalley, J., and Robbins, T. The application of the 5-choice serial reaction time task for the assessment of visual attentional processes and impulse control in rats. Nature Protocol. 2008; 3: 759–767
  74. McNamara, R., Dalley, J.D., Robbins, T.W., Everitt, B.J., and Belin, D. Trait-like impulsivity does not predict escalation of heroin self-administration in the rat. Psychopharmacology. 2010; 212: 453–464
  75. Paxinos, G. and Watson, C. The Rat Brain in Stereotaxic Coordinates, 4th ed. Academic Press, San Diego; 1998
  76. Everitt, B.J., Belin, D., Economidou, D., Pelloux, Y., Dalley, J., and Robbins, T.W. Neural mechanisms underlying the vulnerability to develop compulsive drug-seeking habits and addiction. Philos Trans R Soc Lond B Biol Sci. 2008; 363: 3125–3135
  77. Hedges, L.V. Fixed effect models. in: H. Cooper, L.V. Hedges (Eds.) Handbook of Research Synthesis. Russell Sage Foundation, New York; 1994: 301–321
  78. Ito, R., Dalley, J., Robbins, T., and Everitt, B.J. Dopamine release in the dorsal striatum during cocaine-seeking behavior under the control of a drug-associated cue. J Neurosci. 2002; 22: 6247–6253
  79. Willuhn, I., Burgeno, L.M., Everitt, B.J., and Phillips, P.E. Hierarchical recruitment of phasic dopamine signaling in the striatum during the progression of cocaine use. Proc Natl Acad Sci U S A. 2012; 109: 20703–20708
  80. Belin-Rauscent, A., Everitt, B.J., and Belin, D. Intrastriatal shifts mediate the transition from drug-seeking actions to habits. Biol Psychiatry. 2012; 72: 343–345
  81. Everitt, B.J. and Robbins, T.W. From the ventral to the dorsal striatum: Devolving views of their roles in drug addiction [published online ahead of print February 21]. 2013; Neurosci Biobehav Rev. 2013;
  82. Volkow, N., Wang, G.J., Telang, F., Fowler, J.S., Logan, J., Childress, A.R. et al. Cocaine cues and dopamine in dorsal striatum: Mechanism of craving in cocaine addiction. J Neurosci. 2006; 26: 6583–6588
  83. Letchworth, S.R., Nader, M.A., Smith, H.R., Friedman, D.P., and Porrino, L. Progression of changes in dopamine transporter binding site density as a result of cocaine self-administration in rhesus monkeys. J Neurosci. 2001; 21: 2799–2807
  84. Haber, S., Fudge, J.L., and McFarland, N.R. Striatonigrostriatal pathways in primates form an ascending spiral from the shell to the dorsolateral striatum. J Neurosci. 2000; 20: 2369–2382
  85. Ikemoto, S. Dopamine reward circuitry: Two projection systems from the ventral midbrain to the nucleus accumbens–olfactory tubercle complex. Brain Res Rev. 2007; 56: 27–78
  86. Keramati, M. and Gutkin, B. Imbalanced decision hierarchy in addicts emerging from drug-hijacked dopamine spiraling circuit. PLoS One. 2013; 8: e61489
  87. Volkow, N., Fowler, J., Wang, G., and Hitzemann, R. Decreased dopamine D2 receptor availability is associated with reduced frontal metabolism in cocaine abusers. Synapse. 1993; 14: 169–177
  88. Moore, R.J., Vinsant, S.L., Nader, M.A., Porrino, L., and Friedman, D.P. Effect of cocaine self-administration on dopamine D2 receptors in rhesus monkeys. Synapse. 1998; 30: 88–96
  89. Nader, M., Morgan, D., Gage, H., Nader, S., Calhoun, T., Buchheimer, N. et al. PET imaging of dopamine D2 receptors during chronic cocaine self-administration in monkeys. Nat Neurosci. 2006; 9: 1050–1056
  90. Kasanetz, F., Deroche-Gamonet, V., Berson, N., Balado, E., Lafourcade, M., Manzoni, O., and Piazza, P.V. Transition to addiction is associated with a persistent impairment in synaptic plasticity. Science. 2010; 328: 1709–1712
  91. Volkow, N.D., Fowler, J.S., Wang, G.J., and Goldstein, R.Z. Role of dopamine, the frontal cortex and memory circuits in drug addiction: insight from imaging studies. Neurobiol Learn Mem. 2002; 78: 610–624
  92. Volkow, N.D., Fowler, J.S., Wang, G.J., Baler, R., and Telang, F. Imaging dopamine’s role in drug abuse and addiction. Neuropharmacology. 2009; 56: 3–8
  93. Asensio, S., Romero, M.J., Romero, F.J., Wong, C., Alia-Klein, N., Tomasi, D. et al. Striatal dopamine D2 receptor availability predicts the thalamic and medial prefrontal responses to reward in cocaine abusers three years later. Synapse. 2010; 64: 397–402
  94. Caprioli, D., Hong, Y.T., Sawiak, S.J., Ferrari, V., Williamson, D.J., Jupp, B. et al. Baseline-dependent effects of cocaine pre-exposure on impulsivity and D2/3 receptor availability in the rat striatum: Possible relevance to the attention-deficit hyperactivity syndrome. Neuropsychopharmacology. 2013; 38: 1460–1471
  95. Flagel, S.B., Robinson, T.E., Clark, J.J., Clinton, S.M., Watson, S.J., Seeman, P. et al. An animal model of genetic vulnerability to behavioral disinhibition and responsiveness to reward-related cues: Implications for addiction. Neuropsychopharmacology. 2010; 35: 388–400
  96. Robinson, E.S., Eagle, D.M., Economidou, D., Theobald, D.E., Mar, A.C., Murphy, E.R. et al. Behavioural characterisation of high impulsivity on the 5-choice serial reaction time task: Specific deficits in ‘waiting’ versus ‘stopping’. Behav Brain Res. 2009; 196: 310–316
  97. Jupp, B., Caprioli, D., Saigal, N., Reverte, I., Shrestha, S., Cumming, P. et al. Dopaminergic and GABA-ergic markers of impulsivity in rats: Evidence for anatomical localisation in ventral striatum and prefrontal cortex. Eur J Neurosci. 2013; 37: 1519–1528

 

Increasing dopamine D2 receptor expression in the adult nucleus accumbens enhances motivation (2013)

Mol Psychiatry. 2013 May 28. doi: 10.1038/mp.2013.57.

Trifilieff P, Feng B, Urizar E, Winiger V, Ward RD, Taylor KM, Martinez D, Moore H, Balsam PD, Simpson EH, Javitch JA.

Source

1] Department of Neuroscience, Columbia University, New York, NY, USA [2] New York State Psychiatric Institute, New York, NY, USA.

Abstract

A decrease in dopamine D2 receptor (D2R) binding in the striatum is one of the most common findings in disorders that involve a dysregulation of motivation, including obesity, addiction and attention deficit hyperactivity disorder. As disruption of D2R signaling in the ventral striatum-including the nucleus accumbens (NAc)-impairs motivation, we sought to determine whether potentiating postsynaptic D2R-dependent signaling in the NAc would improve motivation. In this study, we used a viral vector strategy to overexpress postsynaptic D2Rs in either the NAc or the dorsal striatum. We investigated the effects of D2R overexpression on instrumental learning, willingness to work, use of reward value representations and modulation of motivation by reward associated cues.

Overexpression of postsynaptic D2R in the NAc selectively increased motivation without altering consummatory behavior, the representation of the value of the reinforcer, or the capacity to use reward associated cues in flexible ways. In contrast, D2R overexpression in the dorsal striatum did not alter performance on any of the tasks.

Thus, consistent with numerous studies showing that reduced D2R signaling impairs motivated behavior, our data show that postsynaptic D2R overexpression in the NAc specifically increases an animal's willingness to expend effort to obtain a goal. Taken together, these results provide insight into the potential impact of future therapeutic strategies that enhance D2R signaling in the NAc.Molecular Psychiatry advance online publication, 28 May 2013; doi:10.1038/mp.2013.57.

Initial D2 Dopamine Receptor Sensitivity Predicts Cocaine Sensitivity and Reward in Rats (2015)

Kathryn E. Merritt,

Affiliation: Department of Psychology and Neuroscience, University of Colorado, Boulder, Colorado, United States of America

Ryan K. Bachtell

Ryan.Bachtell@Colorado.edu

Affiliations:Department of Psychology and Neuroscience, University of Colorado, Boulder, Colorado, United States of America,
Center for Neuroscience, University of Colorado, Boulder, Colorado, United States of America,
Institute for Behavioral Genetics, University of Colorado, Boulder, Colorado, United States of America

PLOS
  • Published: November 4, 2013
  • DOI: 10.1371/journal.pone.0078258

Abstract

The activation of dopamine receptors within the mesolimbic dopamine system is known to be involved in the initiation and maintenance of cocaine use. Expression of the D2 dopamine receptor subtype has been implicated as both a predisposing factor and consequence of chronic cocaine use. It is unclear whether there is a predictive relationship between D2 dopamine receptor function and cocaine sensitivity that would enable cocaine abuse. Therefore, we exploited individual differences in behavioral responses to D2 dopamine receptor stimulation to test its relationship with cocaine-mediated behaviors. Outbred, male Sprague-Dawley rats were initially characterized by their locomotor responsiveness to the D2 dopamine receptor agonist, quinpirole, in a within-session ascending dose-response regimen (0, 0.1, 0.3 & 1.0 mg/kg, sc). Rats were classified as high or low quinpirole responders (HD2 and LD2, respectively) by a median split of their quinpirole-induced locomotor activity. Rats were subsequently tested for differences in the psychostimulant effects of cocaine by measuring changes in cocaine-induced locomotor activity (5 and 15 mg/kg, ip). Rats were also tested for differences in the development of conditioned place preference to a low dose of cocaine (7.5 mg/kg, ip) that does not reliably produce a cocaine conditioned place preference. Finally, rats were tested for acquisition of cocaine self-administration and maintenance responding on fixed ratio 1 and 5 schedules of reinforcement, respectively. Results demonstrate that HD2 rats have enhanced sensitivity to the locomotor stimulating properties of cocaine, display greater cocaine conditioned place preference, and self-administer more cocaine compared to LD2 animals. These findings suggest that individual differences in D2 dopamine receptor sensitivity may be predictive of cocaine sensitivity and reward.

Figures

Figure 7

Figure 1

Figure 2

Figure 3

Figure 4

Figure 5

Figure 6

Figure 7

Figure 1

Figure 2

Figure 3

   

Citation:Merritt KE, Bachtell RK (2013) Initial D2 Dopamine Receptor Sensitivity Predicts Cocaine Sensitivity and Reward in Rats. PLoS ONE 8(11): e78258. doi:10.1371/journal.pone.0078258

Editor: Abraham A. Palmer, University of Chicago, United States of America

Received: May 28, 2013; Accepted: September 10, 2013; Published: November 4, 2013

Copyright: © 2013 Merritt, Bachtell. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Funding:This work was supported by R03 DA 029420; CU Innovative Seed Grant. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Competing interests: The authors have declared that no competing interests exist.

Introduction

Understanding why some individuals develop substance abuse or patterns of compulsive drug use while others do not is one of the most poorly understood aspects in the development of drug addiction. Epidemiological studies report that nearly 17% of people who use cocaine will become cocaine dependent within 10 years of initial cocaine use [1]. This suggests that some individuals are vulnerable, while others are resistant to developing drug dependence despite having a history of drug use. While there are many factors that may contribute to drug dependence (e.g. drug availability, social pressures, etc.), the discrepancy between vulnerable and resistant individuals may also be explained through individual differences in the functioning of the neurobiological systems underlying the responsiveness to drugs of abuse [2]. Understanding these differences may provide insight into one of the most sought after questions in the development of substance dependence.

The mesolimbic dopamine (DA) system consists of dopamine cells in the ventral tegmental area that project to medium spiny neurons in the nucleus accumbens among other limbic regions [3]. Cocaine rapidly elevates extracellular DA in the terminal regions of mesolimbic pathway by blocking the DA transporter, which contributes to cocaine reinforcement [4]. Activation of the mesolimbic pathway is widely known to be involved in the initiation and maintenance of cocaine use and use of other drugs of abuse [5]. Alterations within mesolimbic DA circuitry have been demonstrated as both a consequence of repeated psychostimulant use and as a predisposing factor. For example, chronic cocaine use is associated with decreased D2 DA receptor levels in the ventral striatum of cocaine abusers [6], suggesting that decreased D2 DA receptor expression is a consequence of chronic cocaine administration. There has been a long-standing debate about whether the decrease in D2 DA receptor expression observed in cocaine abusers is a result of chronic cocaine use or whether this alteration represents a pre-existing conditioning that may predispose an individual to develop cocaine dependence.

Recent work in humans and animals suggests that reduced D2 DA receptor expression may in fact be a vulnerability factor. Thus, non-addicted individuals with lower levels of D2 DA receptor report greater drug “liking” for the psychostimulant, methylphenidate [7]. Mutant mice lacking the D2 DA receptor self-administer more cocaine compared to wild-type animals [8], while over-expressing D2 DA receptors in the ventral striatum decrease cocaine self-administration [9]. Together these studies suggest that pre-existing alterations in D2 DA receptor expression may predict the reinforcing effects of cocaine, although there are still uncertainties concerning the specific role of D2 DA receptors as a vulnerability factor.

There is emerging interest in the dissociation between D2 DA receptor expression and D2 DA receptor function and sensitivity. While binge-like cocaine administration in rats recapitulates decreased D2 DA receptor expression, as observed in human cocaine abusers, there are somewhat paradoxical increases G protein activation in response to D2 DA receptor stimulation [10]. Likewise, cocaine self-administration increases the expression of high affinity D2 DA receptors [10], [11]. These changes suggest that while the expression of D2 DA receptors may decrease, the sensitivity of D2 DA receptors may increase following repeated cocaine. This notion is reflected in several behavioral paradigms where chronic cocaine produces cross-sensitization to the psychostimulant effects of D2 DA receptor agonists [12], [13], [14], [15], and stimulation of D2 DA receptors produces robust reinstatement to cocaine seeking in rodent self-administration models [16], [17], [18], [19], [20], [21]. It is unknown whether the pre-existing differences in the sensitivity of D2 DA receptors relate to the behavioral effects of cocaine.

In the present studies, we utilized a rodent model to identify how individual differences in the behavioral sensitivity of D2 DA receptors relate to cocaine-induced behaviors. Administration of the D2 DA receptor agonist, quinpirole, produces a high degree of variability in locomotor responses in drug naïve animals. Thus, we exploited these individual differences in the rat’s initial locomotor response to quinpirole as a model to test D2 DA receptor sensitivity as a vulnerability factor for subsequent cocaine-mediated behaviors. Those animals displaying robust increases in quinpirole-induced activity were characterized as having high D2 DA receptor sensitivity (HD2), while those rats having more modest activation were characterized as having low D2 DA receptor sensitivity (LD2). Following this initial characterization, rats from each group were compared in cocaine-induced locomotion, cocaine-induced place preference, and cocaine self-administration.

Materials and Methods

Animals

Male Sprague–Dawley rats (Charles River, Portage, MI) weighing 275–325 g were individually housed upon arrival. Rats were given ad libitum food and water, except where indicated. All experiments were conducted during the light period of a (12:12) light/dark cycle.

Ethics Statement

These studies were carried out in accordance with the guidelines established by the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health and were approved by the Institutional Animal Care and Use Committee at the University of Colorado at Boulder.

Habituation to a Novel Environment

Locomotor activity was recorded in plexiglass chambers (San Diego Instruments, San Diego, CA, USA) measuring 16×16×15 in with 16 pairs of photobeams spaced 1 in apart across both horizontal planes. All locomotor tests were performed in unlit activity chambers during the light phase of the (12:12) light/dark cycle. Animals were initially habituated to the novel locomotor testing chambers for 2 hrs prior to quinpirole-induced locomotor testing (see below).

Characterization of the Quinpirole-induced Locomotor Behavior

The initial locomotor response to the D2 DA receptor agonist, quinpirole was used to classify animals into groups prior to any further behavioral testing. Tests began at least 7 days after the animals arrived from the vendor and were conducted in darkened locomotor chambers during the light period of a (12:12) light/dark cycle. All animals were handled for approximately 5 min daily for 4 days prior to beginning these procedures to eliminate any potential interference. All animals were first habituated to the locomotor testing apparatus for 2 hrs the day prior to quinpirole testing (see above). Quinpirole-induced locomotion was assessed in a 5-hr within-session dose-response protocol as follows: 1-hr habituation followed by hourly ascending doses of the agonist (0, 0.1, 0.3 and 1.0 mg/kg, s.c.). A median split of total quinpirole-induced locomotor activity (calculated as Area Under the Curve, see below) was used to classify these rats as either high D2 responders (HD2) or low D2 responders (LD2). These procedures were conducted identically in several cohorts of animals (groups of rats arriving from the same vendor at identical age and weights) for each of the behavioral measures described (i.e. cocaine locomotion, place conditioning and self-administration). In each of the cohorts, the animal with the median score was tested, but eliminated from further data analyses. The distribution of scores within each cohort was qualitatively quite similar, but we did observe differences in the range and median scores for quinpirole-induced locomotor activity between cohorts of animals. Therefore, HD2 and LD2 classifications were made within each individual cohort.

Cocaine-induced Locomotor Behavior

In one cohort of animals (N = 39), locomotor responses were measured using a 3-hr within-session cocaine dose-response protocol. These assessments were performed in darkened locomotor chambers during the light period of a (12:12) light/dark cycle. Animals were tested 5–7 days following the initial characterization of their quinpirole sensitivity in the same activity chambers. On the test day, animals were habituated to the locomotor chamber for 1 hr and were then administered hourly ascending doses of cocaine (5 and 15 mg/kg, i.p.).

Cocaine Place Conditioning

In another cohort of animals (N = 37), place conditioning was measured in an unbiased 3-chamber apparatus using an unbiased 3-phase procedure. Testing began 7 days following the initial characterization of quinpirole sensitivity. The two conditioning chambers (15 cm×25 cm×35 cm) were distinct in wall patterns (gray vs. vertical white and black stripes) and floor textures (grid vs. hole). The center compartment (15 cm×10 cm) had white walls and a plexiglass floor. Chambers are equipped with infrared photocells to detect animal position and movement in the apparatus. From 1000–1500 hrs on the day before conditioning (pre-conditioning), rats were allowed access to all three compartments for 20 min to test for initial bias. One animal was excluded from the experiment because it displayed an initial bias of 92% time in one compartment. Rats received three 30-min saline conditioning sessions and three 30-min cocaine (7.5 mg/kg, i.p.) conditioning sessions. Saline conditioning occurred between 0800–1100 hrs, while cocaine conditioning occurred between 1500–1700 hrs. The 7.5 mg/kg cocaine dose was chosen because preliminary studies in our lab demonstrate that it does not reliably produce a place preference in all rats. Therefore, this cocaine dose was ideal to identify potential differences in the development of a place preference between the two groups. The final test session (post-conditioning) was conducted between 1000 hrs and 1500 hrs and rats were again allowed free access to the three compartments and preference was determined as time spent in the drug compartment minus time spent in the saline compartment (conditioned place preference (CPP) score).

Sucrose and Cocaine Self-administration

Another cohort of animals (N = 29) was tested for operant responding for sucrose pellets following the initial characterization of quinpirole sensitivity. Self-administration procedures were performed in operant conditioning chambers (Med-Associates, St Albans, VT) equipped with two response levers. Seven days following the initial quinpirole testing, these rats were food-restricted to prevent weight gain, and trained to lever-press for sucrose pellets on a fixed ratio 1 (FR1) reinforcement schedule until acquisition criteria had been achieved (50 sucrose pellets). The latency to reach this criterion was used as the dependent variable in these experiments. All rats reached criterion after approximately 8 days of training and were fed ad libitum thereafter.

Following the sucrose self-administration and at least one day of ad libitum feeding, animals were implanted with jugular catheters under halothane anesthesia (1–2.5%), as described elsewhere [22]. After 5–7 days of recovery from surgery, animals self-administered cocaine (0.5 mg/kg/100 µl, iv) under a FR1, timeout 20 s reinforcement schedule during 6 daily 2-h sessions. Animals were then transferred to a FR5, timeout 20 s schedule of reinforcement for an additional 5 daily 2-h sessions. Cocaine infusions were delivered over 5 s concurrent with the termination of the house light and illumination of a cue light above the drug-paired lever.

Drugs

Quinpirole [(-)-Quinpirole hydrochloride] and cocaine hydrochloride were purchased from Sigma (St. Louis, MO). All drugs were dissolved in sterile-filtered physiological (0.9%) saline.

Data Analysis

Cocaine-induced locomotor data (beam breaks) were analyzed by 2-factor mixed design ANOVA with quinpirole group (HD2 and LD2) and cocaine dose (5 & 15 mg/kg) as factors. Linear regressions were also performed on the locomotor data to identify the explanatory power of the quinpirole sensitivity in cocaine locomotion. Place conditioning data (CPP score = drug-paired minus saline-paired) was analyzed using a 2-factor mixed design ANOVA with quinpirole group (HD2 and LD2) and conditioning (Pre-conditioning and Post-conditioning) as factors. Cocaine self-administration data (cocaine infusions) were analyzed by both a 2-factor mixed design ANOVA with quinpirole group (HD2 and LD2) and days as factors, or an independent t-test between the quinpirole groups (HD2 and LD2) when cocaine infusions were collapsed across days. In all cases, significant main and interactive effects were followed by simple effects analyses and post hoc tests (Bonferroni’s test of significance). Statistical significance was preset at p<0.05.

Results

Characterization of High and Low Quinpirole Sensitivity Groups

There is a high degree of variation in responding across each quinpirole dose during the within-session dose response locomotor activity testing (Figure S1). Generally, the lowest dose of quinpirole (0.1 mg/kg, sc) suppresses locomotion compared to vehicle responding, while the higher doses (0.3 and 1.0 mg/kg, sc) activate locomotion. This is a prototypical quinpirole dose response, where low doses of quinpirole presumably stimulate D2 autoreceptors on dopamine terminals and higher quinpirole doses saturate D2 autoreceptors and stimulate postsynaptic D2 receptors [23], [24], [25]. In an attempt to capture the behavioral complexity of pre- and postsynaptic D2 receptor stimulation, we calculated the area under the curve (AUC) for each animal across all quinpirole doses (Figure S1). The quinpirole AUC score was then used to segregate each cohort into high quinpirole sensitivity (HD2) and low quinpirole sensitivity (LD2) groups based on a median split of the entire cohort. Figure 1A and 1B illustrate both the distribution of the quinpirole AUC scores and the group means following the median split into HD2 and LD2 groups. Figure 1C and 1D shows the distributions and group means of locomotion at each quinpirole dose. In developing the groups, the rat corresponding to the median score was eliminated from further analysis, but is shown on the graph to depict both the individual and mean range from the median score.

thumbnail

Download:

PowerPoint slide

larger image (314KB)

original image (1.66MB)

Figure 1. Distributions and averages of quinpirole-induced locomotor activity for LD2 and HD2 groups.

(A) Group distributions of the calculated quinpirole area under the curve (AUC) scores used to classify rats into the LD2 and HD2 groups. The dotted line represents the median score (M = 15460). (B) Group averages (± sem) of the quinpirole AUC score used to generate the LD2 and HD2 groups. The dotted line represents the median score (M = 15460). (C) Distribution of locomotor activity scores (beam breaks/hr) during the ascending within-session quinpirole dose response testing within the LD2 (gray circles) and HD2 (red circles) groups. (D) Group averages (± sem) of the quinpirole dose response curve for the LD2 and HD2 groups.

doi:10.1371/journal.pone.0078258.g001

Given that the group assignments are primarily influenced by locomotor activation produced by quinpirole activation of postsynaptic D2 receptors, we also wanted to identify whether the groups differed in their responsiveness to the low, locomotor suppressing dose of quinpirole (0.1 mg/kg). To fully capture the magnitude of the suppressive effects of the low quinpirole dose, we calculated the suppressive effects of quinpirole as a percent of baseline (saline-induced activity; Figure S2). There were no differences in the quinpirole-induced locomotor suppression produced by 0.1 mg/kg quinpirole (t36 = 1.01, p = 0.3183), suggesting that the differential sensitivity to quinpirole between the HD2 and LD2 animals largely reflects the sensitivity of postsynaptic D2 DA receptors.

High Quinpirole Sensitivity Predicts Increased Cocaine-induced Locomotion

Utilizing the median split group assignments for quinpirole responding, we tested whether quinpirole sensitivity was related to the locomotor activating properties of cocaine. Figure 2 illustrates that HD2 animals had greater cocaine-induced locomotor activity following the 15 mg/kg cocaine dose, but not following the 5 mg/kg cocaine dose. A two-way mixed design ANOVA of these data reveal a significant interaction between cocaine dose and quinpirole group (F1,36 = 7.17, p = 0.0111), and main effects of cocaine (F1,36 = 88.43, p<0.0001) and group (F1,36 = 6.86, p = 0.0128). Figure 2 also displays the results of linear regressions performed at each cocaine dose across the entire population of animals. There was a significant relationship between quinpirole sensitivity and 15 mg/kg cocaine-induced locomotor activity (F1,36 = 8.62, p = 0.0058), but not 5 mg/kg cocaine-induced locomotor activity (F1,36 = 1.91, p = 0.1761). Thus, initial quinpirole sensitivity appears to predict cocaine-induced locomotion to a high, locomotor activating dose of cocaine.

thumbnail

Download:

PowerPoint slide

larger image (279KB)

original image (1.67MB)

Figure 2. HD2 animals display greater sensitivity to cocaine-induced locomotor activity.

(A) Rats were tested across two cocaine doses (5 and 15 mg/kg, ip) in a within-session procedure. HD2 animals displayed significantly greater cocaine-induced locomotor activity to 15 mg/kg cocaine, but not 5 mg/kg cocaine. *HD2 significant from LD2, p<0.05 (B and C) Analyses of the entire cohort were conducted to determine the relationship between quinpirole AUC scores and cocaine-induced locomotion. A non-significant positive relationship was identified for cocaine-induced activity at the low dose (B, 5 mg/kg cocaine) and a significant positive relationship was identified for cocaine-induced activity at the high dose (C, 15 mg/kg cocaine).

doi:10.1371/journal.pone.0078258.g002

Previous work demonstrates that novelty-induced locomotion is predictive of future cocaine responding [26], [27]. Therefore, we wanted to assess if there were differences between LD2 and HD2 groups in novelty-induced locomotor activity. There was no difference between the HD2 and LD2 groups in novelty-induced locomotion across the entire session (Figure 3A: t36 = 0.44, p = 0.6601) or within the first 30–60 minutes (Figure 3B), when differences in novelty responsiveness are typically most robust. To identify whether novelty-induced locomotor activity was predictive of D2 DA receptor sensitivity, we re-characterized our rats as having either low or high novelty-induced locomotor activity. Thus, we created low responding rats (LR) and high responding rats (HR) based on a median split of their initial locomotor responsiveness to the locomotor testing apparatus during the habituation phase of testing. We then determined whether these groups differed in quinpirole-induced locomotor activity. As shown in Figure 3, LR and HR rats did not differ significantly at any of the quinpirole doses (Group: F1,108<1, NS; Quinpirole: F3,108 = 69.61, p<0.0001; Interaction: (F3,108<1, NS), although the groups did significantly differ in cocaine-induced locomotion (Group: F1,36 = 10.49, p = 0.0026; Cocaine: F1,36 = 84.86, p<0.0001; Interaction: (F1,36 = 5.02, p = 0.0313). Together, these data suggest that while novelty-induced locomotion is predictive of cocaine responsiveness, the mechanisms associated with this relationship may be distinct from those associated with D2 DA receptor sensitivity.

thumbnail

Download:

PowerPoint slide

larger image (313KB)

original image (1.61MB)

Figure 3. Quinpirole sensitivity is not associated with novelty-induced locomotor activity.

Assessing novelty-induced locomotion during the habituation phase of testing revealed no significant differences between the LD2 and HD2 groups. (A) Distribution of novelty-induced locomotor activity scores over the 2-hr testing period. (B) Time course depicting novelty-induced locomotor activity between the LD2 and HD2 groups. Animals from this cohort were re-classified into a low responder group (LR) and high responder group (HR) based on their novelty-induced locomotor activity. (C) LR and HR rats did not predict differences in locomotor activity across the quinpirole dose response testing. (D) HR rats displayed significantly greater cocaine-induced locomotor activity across both cocaine doses. *HR significant from LR, p<0.05.

doi:10.1371/journal.pone.0078258.g003

Since individual differences in the initial locomotor response to cocaine have also been shown to correspond with alterations in the development of cocaine sensitization, cocaine reward and cocaine self-administration, we re-characterized our rats as having either low or high cocaine-induced locomotor activity [28], [29], [30], [31]. This re-characterization was based on calculating the AUC for cocaine-induced locomotion across both cocaine doses during the within-session cocaine dose response testing. Rats having AUC values below the median were placed in the low cocaine responder (LCR) group while those having AUC values above the median were placed in the high cocaine responder (HCR) group. We then determined whether initial cocaine-induced locomotion was predictive of quinpirole-induced activity. HCR rats had greater overall quinpirole-induced activity compared to LCR rats using the quinpirole AUC score (t36 = 3.585, p<0.0010, data not shown). Analysis of the activity across the quinpirole dose response testing suggests that these differences were primary observed at the locomotor activating quinpirole doses (Figure 4). Thus, analysis of the quinpirole dose response between the groups revealed a significant main effects of group (F1,108 = 14.05, p = 0.0006), quinpirole dose (F3,108 = 85.93, p<0.0001) and the interaction (F3,108 = 7.64, p = 0.0001). We also assessed the relationship between the overall cocaine sensitivity and quinpirole sensitivity using the AUC scores for each drug where there was a significant correlation between the two activity scores (Figure 4). Together these findings suggest that there is significant overlap between the initial cocaine sensitivity and initial quinpirole sensitivity.

thumbnail

Download:

PowerPoint slide

larger image (191KB)

original image (850KB)

Figure 4. Initial cocaine sensitivity corresponds with differences in D2 DA receptor sensitivity.

The area under the curve (AUC) was calculated for each rat’s cocaine-induced locomotor activity across both 5 and 15 mg/kg doses. Using this calculated score for initial cocaine-induced locomotor activity, rats were re-classified into a low cocaine responder group (LCR) and a high cocaine responder group (HCR). (A) HCR rats displayed significantly greater quinpirole-induced locomotor activity at the 0.3 and 1.0 mg/kg doses. *HCR significant from LCR, p<0.05. (B) An analysis of the entire cohort was conducted to determine the relationship between quinpirole AUC scores and cocaine AUC scores. A significant positive relationship was identified between initial quinpirole sensitivity and initial cocaine sensitivity.

doi:10.1371/journal.pone.0078258.g004

High Quinpirole Sensitivity Predicts Increased Cocaine Reward

In a separate cohort of animals, median split group assignments for quinpirole responding was created (data not shown) and place conditioning for cocaine (7.5 mg/kg) was tested. This dose was used in this test because it does not reliably produce robust place conditioning in all animals. Figure 5 illustrates both the saline- and cocaine-induced locomotion during the 30 min conditioning sessions. There was no significant group difference in saline-induced locomotion (F1,66 = 0.51, p = 0.4784). There was a significant decrease in saline-induced locomotion across each conditioning session (F2,66 = 10.91, p<0.0001) although there was no significant interaction between groups and sessions (F2,66 = 0.59, p = 0.5567). HD2 rats had significantly higher cocaine-induced locomotion during the conditioning sessions compared to LD2 rats (F1,66 = 4.29, p = 0.0462). There was no main effect of session (F2,66 = 0.77, p = 0.4595) and no significant interactive effects (F2,66 = 0.60, p = 0.5535), although qualitatively there appeared to be enhanced cocaine-induced locomotion during the first two conditioning sessions (Figure 5). Heightened cocaine-induced locomotion in HD2 animals during the conditioning sessions recapitulates our previous findings (Figure 2) and indicates that HD2 animals are more sensitive to the locomotor stimulating properties of cocaine and that may be predictive of cocaine reward. When the entire cohort was analyzed for the development of a conditioned place preference for cocaine, there was a significant increase in time spent in the cocaine-paired compartment post-conditioning (t36 = 2.27, p = 0.0295). When group was included in the analysis, there was a significant main effect of conditioning (F1,34 = 6.31, p = 0.0169), again suggesting that overall, animals developed a preference for the cocaine-paired compartment. There was no group effect (F1,34 = 3.27, p = 0.0793), but there was a significant interaction between conditioning and group (F2,34 = 4.36, p = 0.0443). Subsequent analyses revealed that HD2 animals displayed greater conditioned place preference to 7.5 mg/kg cocaine compared to LD2 animals on the post-conditioning test (t34 = 2.33, p = 0.0258), but did not differ on pre-conditioning test (t34 = 0.31, p = 0.7619). These findings suggest that initial quinpirole sensitivity is associated with heighted cocaine reward.

thumbnail

Download:

PowerPoint slide

larger image (219KB)

original image (1.44MB)

Figure 5. HD2 animals display greater sensitivity to the rewarding effects of cocaine.

(A) There were no group differences in the saline-induced locomotor activity during the conditioning trials. (B) There was a significant group difference in the cocaine-induced activity during the conditioning trials where HD2 animals displayed significantly greater cocaine-induced locomotor activity across all session. *HD2 significant from LD2, p<0.05. (C) Analyses of all animals in the cohort demonstrated a significant, modest cocaine-induced place preference following conditioning. † Post-conditioning significant from pre-conditioning, t36 = 2.27, p = 0.0295. (D) Group analyses demonstrated that only animals in the HD2 group developed a significant preference for the cocaine-paired compartment compared to animals in the LD2 group that did not develop any significant conditioning to the cocaine-paired compartment. *HD2 significant from LD2, p<0.05.

doi:10.1371/journal.pone.0078258.g005

High Quinpirole Sensitivity Predicts Increased Cocaine Self-administration

In a separate cohort of animals, median split group assignments for quinpirole responding was created and self-administration of either sucrose or cocaine was tested. Figure 6 illustrates that there was no group difference in the acquisition of sucrose self-administration (F1,176 = 0.39, p = 0.5406) and both groups acquired equivalently (Sessions: F8,176 = 18.00, p<0.0001; Group×Session Interaction: F8,176 = 1.81, p = 0.0775), suggesting that these groups do not differ in reinforced learning of an operant response. These same animals were then implanted with a chronic indwelling catheter and allowed to self-administer cocaine. Animals initially acquired cocaine self-administration on an FR 1 schedule. There was a trend for HD2 to self-administer more cocaine than LD2 animals on an FR 1 schedule analyzed across all sessions (F1,95 = 3.31, p = 0.0846). When sessions were averaged across all FR 1 sessions, HD2 animals self-administered significantly more cocaine than LD2 animals (t19 = 2.63, p = 0.0164, data not shown). When the schedule was advanced to an FR 5 schedule of reinforcement HD2 animals self-administered more cocaine across sessions as revealed by a significant interaction (F4,76 = 3.465, p = 0.0118), although this effect was not observed when averaged across all FR 5 sessions (t19 = 1.51, p = 0.1484, data not shown). Thus, enhanced initial quinpirole sensitivity is associated with increased cocaine intake.

thumbnail

Download:

PowerPoint slide

larger image (141KB)

original image (882KB)

Figure 6. HD2 animals self-administer more cocaine than LD2 animals.

(A) There were no group differences in the acquisition of an operant response to acquire sucrose pellets. (B) There were significant group differences in the number of cocaine infusions delivered on both a fixed ratio 1 and fixed ratio 5 schedule of reinforcement. #significant trend between HD2 and LD2 groups, p = 0.08, *HD2 significant from LD2, p<0.05.

doi:10.1371/journal.pone.0078258.g006

Cocaine Increases Quinpirole Sensitivity in both HD2 and LD2 Animals

It is well established that chronic cocaine treatments increase the sensitivity of D2 DA receptors [12], [13], [14], [15]. Therefore, we tested quinpirole sensitivity in all animals following the cocaine self-administration procedure to identify whether the pre-existing differences in D2 DA receptor sensitivity persisted following chronic cocaine administration. This was performed in all but 3 animals that were lost due to catheter failure. Figure 7 illustrates that cocaine self-administration enhances quinpirole-induced locomotion compared with responding in the same animals prior to cocaine self-administration. A two-way mixed ANOVA reveals that there was a main effect of cocaine exposure (F1,104 = 17.46, p<0.0001) and quinpirole dose (F2,104 = 66.73, p<0.0001). There was also a significant interaction (F2,104 = 10.61, p<0.0001). Similar results were obtained using the quinpirole AUC scores generated before and after cocaine exposure (t24 = 5.56, p<0.0001). We also analyzed the differences between HD2 and LD2 groups on quinpirole sensitivity before and after cocaine self-administration (Figure 7). Interestingly, pre-existing group differences remained despite cocaine-induced enhancements in D2 receptor sensitivity in both groups. Thus, analyses reveal a main effect of group (F3,98 = 24.21, p<0.0001), quinpirole dose (F2,98 = 117.50, p<0.0001) and the interaction (F6,98 = 16.03, p<0.0001). Similarly, results were also obtained using the quinpirole AUC scores generated before and after cocaine exposure. Analyses reveal a main effect of group (F1,23 = 46.05, p<0.0001) and cocaine exposure (F1,23 = 36.26, p<0.0001), but not the interaction (F1,23 = 3.45, p = 0.0760). These findings suggest that even though quinpirole sensitivity prior to cocaine self-administration predicts future cocaine responding, both populations develop quinpirole cross-sensitization following cocaine self-administration.

thumbnail

Download:

PowerPoint slide

larger image (214KB)

original image (1.17MB)

Figure 7. Cocaine self-administration enhances D2 DA receptor sensitivity in both LD2 and HD2 rats.

(A) Quinpirole AUC scores were enhanced across the entire cohort of animals tested following cocaine self-administration. *After cocaine significant from Before cocaine, p<0.05 (B) Likewise, this enhancement was observed across all quinpirole doses. *After cocaine significant from Before cocaine, p<0.05. (C and D) Cocaine-induced enhancements in D2 DA receptor sensitivity were apparent in both the LD2 and HD2 groups using both the quinpirole AUC scores and raw locomotor scores across the quinpirole dose response curve. *After cocaine significant from Before cocaine, p<0.05. Interestingly, the group differences persisted even after cocaine exposure. † HD2 significant from LD2, p<0.05.

doi:10.1371/journal.pone.0078258.g007

Discussion

The findings reported here demonstrate that individual differences in the locomotor responsiveness to quinpirole are predictive of cocaine-induced behavioral regulation. This is the first demonstration that differences in the sensitivity of D2 DA receptors predict differential cocaine-induced locomotion, place preference and self-administration. The rats categorized as HD2, having high locomotor activation in response to quinpirole treatments, demonstrate increased cocaine-induced locomotor activity, increased cocaine reward, and self-administer cocaine in greater amounts compared to rats categorized as LD2 that have diminished locomotor activation in response to quinpirole. Importantly, categorizations of HD2 and LD2 did not parallel differences in the exploration of a novel environment, which has been show to be predictive of cocaine responding. Categorizing rats based on their initial cocaine sensitivity (HCR and LCR) did correspond with differences in quinpirole sensitivity suggesting that there may be common mechanisms underlying the individual differences between these two behavioral characteristics. It was determined that the categorization of HD2 and LD2 did not correspond with the quinpirole-induced suppression of locomotion that is presumably mediated by presynaptic D2 DA receptor stimulation [23], [24], [25]. Therefore, we suspect that the HD2 and LD2 group characterization in quinpirole locomotion likely reflects differences in the sensitivity of postsynaptic D2 DA receptors. However, quinpirole is also known to interact with some selectivity at D3 DA receptors [32]. In fact, it has been postulated that low doses of quinpirole induce increased oral behavior and yawning behavior in male rats through its interaction with D3 DA receptors [33], [34]. Thus, while we speculate that quinpirole-induced locomotion is reflective of postsynaptic D2 DA receptor stimulation, it is possible that D3 DA receptors may play a role in the behavioral responsiveness to quinpirole.

Alterations within the mesocorticolimbic DA circuitry have been long implicated as both a predisposing factor to psychostimulant use and a consequence of repeated psychostimulant use. The D2 DA receptor has received an extraordinary amount of attention due to observations that chronic administration of many drugs of abuse reduces D2 DA receptor binding in the striatum, suggesting that drug use produces these changes [6]. However, other lines of evidence suggest that D2 DA receptor expression may also correspond to a vulnerability factor. Thus, non-addicted individuals that reported higher drug “liking” scores for methylphenidate also had lower levels of D2 DA receptors within the striatum [7]. Using an animal model, it was observed that over-expressing the D2 DA receptor in the ventral striatum decreases cocaine self-administration [9]. These findings suggest that expression of D2 DA receptors may predict future cocaine use, although neither study address how the sensitivity of the D2 DA receptor may correspond with the responsiveness to psychostimulants.

There are several lines of evidence suggesting that the expression levels of metabotropic receptors can be dissociated from the sensitivity of the receptor to initiate intracellular signaling and influence cellular activity. For example, dissociation was observed in rats following a binge-like administration of cocaine. Thus, decreases in D2 DA receptor Bmax were observed suggesting a decrease in D2 DA receptor expression following binge cocaine administration, while concomitant increases in G protein activation were observed in response to D2 DA receptor stimulation in these same animals [10]. This corresponds with the notion that cocaine self-administration increases the expression of high affinity D2 DA receptors without necessarily influencing the overall expression of D2 DA receptors [11]. Our studies suggest that individual differences in the behavioral sensitivity to D2 DA receptor stimulation predict the responsiveness to cocaine-induced locomotion, reward and reinforcement. Specifically, animals with higher D2 DA receptor behavioral sensitivity, whether it is because of greater expression of high affinity D2 DA receptors, enhanced G protein activation or another cellular mechanism, predisposes animals to greater cocaine sensitivity, reward and reinforcement. It remains undetermined whether HD2 and LD2 rats differ in the expression of D2 DA receptors and/or G protein activation.

Investigating individual differences as a predictor of drug sensitivity, reward and development of addictive-like behavioral changes has been a long-standing approach to determine vulnerability factors. One of the most established animals models utilizes the habituation response to a novel environment to classify animals as either low or high responders (LR or HR, respectively; [26]). In this model, HR rats exhibit a greater locomotor response to acute cocaine and more readily self-administer low doses of psychostimulants compared to LR rats [26], [27], [35], [36]. Interestingly, HR and LR rats also display differences in D2 DA receptor expression where HR rats have decreased Bmax of 3H-raclopride binding and in D2 DA receptor mRNA in the nucleus accumbens [37]. These differences are not reflected in the behavioral sensitivity to D2 DA receptor stimulation since we did not observed differences between HR and LR rats in quinpirole-induced locomotion confirming previous results [38]. In contrast, an analogous study where rats were selectively bred for differences in responsiveness to novelty, high novelty responders displayed a greater proportion of high affinity D2 receptors [39], [40]. Rats bred for high novelty responsiveness also displayed greater quinpirole sensitivity, increased responsiveness to cocaine-related cues and enhanced behavioral disinhibition, findings that are akin to some of our observations. It is unclear whether the differences between HR and LR rats in D2 DA receptor expression reflect pre-synaptic or post-synaptic changes or changes in both populations of D2 DA receptors. One study reports that HR rats possess subsensitivity of D2 autoreceptors in the ventral tegmental area, however it is unknown whether the sensitivity of post-synaptic D2 DA receptors in the striatal terminal regions is different between the HR and LR rats [41]. Given some of the inconsistencies in our observations and previous observations we suspect that our D2 DA receptor group characterization likely corresponds with mechanisms distinct from generalized locomotor responses to novelty and exploratory behaviors.

Another, more recently developed animal model of individual differences utilizes the initial locomotor response to cocaine to determine HCR and LCR rats [28]. This model has established that LCR rats display greater development of cocaine sensitization [29], enhanced conditioned place preference to cocaine [30], and have higher progressive ratio breakpoints than HCR rats [31]. These findings suggest that animals with a low initial response to cocaine may be more vulnerable to cocaine addiction. We observed that HD2 rats have a greater initial response to cocaine, develop cocaine conditioned place preference more readily, and self-administer more cocaine on fixed ratio schedules compared to LD2 rats. In an attempt to relate our findings to those using the HCR/LCR characterization, we re-characterized our animals based on their initial cocaine locomotor response. Using this method, we observed that HCR rats had significantly higher D2 DA receptor sensitivity compared to LCR rats. While these findings are somewhat contradictory since we find that higher D2 DA receptor sensitivity corresponds with behaviors more reminiscent of LCR rats in previous studies (e.g. higher cocaine locomotion, cocaine CPP, increased cocaine self-administration), they are consistent with findings from the Roman high avoidance rat lines where rats that display greater acute locomotor responsiveness self-administer more cocaine [42], [43].

There may be undetermined neurobiological underpinnings that correspond with this discrepancy or it may be a reflection of several experimental differences. First, we did not precisely replicate the published procedures for HCR/LCR characterization. We used a broader characterization of the initial cocaine response. Thus, we collapsed across 2 cocaine doses (5 and 15 mg/kg) and the testing was performed over two hours. This is substantially different than the 30-minute assessment following 10 mg/kg cocaine that was used in previous HCR/LCR studies. Second, the cocaine locomotor testing was performed after the initial quinpirole sensitivity assessment in the same locomotor activity chambers. It is unclear how this experience may have confounded the subsequent cocaine locomotor testing. Finally, we used different procedures in assessing conditioned place preference (ip vs iv cocaine injections) and our self-administration studies were performed after substantial sucrose self-administration. In fact, another recent study utilizing food training prior to cocaine self-administration observed effects more reminiscent of our findings suggesting that this may be an important procedural consideration [44]. In all, these procedural differences may impair our ability to directly compare our studies with those using the HCR/LCR characterization.

Regardless, enhanced initial sensitivity to D2 DA receptor stimulation may reflect a vulnerability factor that contributes to increased psychostimulant use. Our observations exploit differences in D2 DA receptor sensitivities in an outbred, drug-naïve population of rats. It is possible that genetic or environmental factors could influence D2 DA receptor sensitivity rendering some individuals vulnerable or resistant to the behavioral effects of psychostimulants. For example, rearing conditions and social hierarchies have been shown to influence the expression of D2 DA receptors. Isolation housing is associated with decreased D2 DA receptor expression [45], although others report no change in receptor expression and no change in the behavioral sensitivity of D2 DA receptors [46]. In socially housed animals, social dominance can influence the expression of D2 DA receptors where dominant animals display increased D2 DA receptor expression and are resistant to cocaine self-administration [47], [48]. Given that our animals were individually housed, social hierarchies were likely not a contributing factor, although early life social and/or stressful experiences may have impacted D2 DA receptor sensitivities [49], [50], [51], [52], [53], [54], [55].

In summary, we demonstrate that rats with a high initial sensitivity to the locomotor effects of D2 DA receptor stimulation, HD2 rats, correspond with greater sensitivity to cocaine locomotor sensitivity, cocaine reward, and cocaine taking compared with LD2 rats having low initial sensitivity to the locomotor effects produced by D2 DA receptor stimulation. This is the first demonstration that D2 DA receptor sensitivity is a phenotype representing higher susceptibility to cocaine use, given the exacerbation of cocaine’s behavioral effects. Future studies will be aimed at identifying whether D2 DA receptor sensitivity is associated with greater development of behavioral sensitization and cocaine dependence phenotypes as well as associated alterations within the neurobiology of the mesocorticolimbic DA system.

Supporting Information

Figure_S1.tif

http://s3-eu-west-1.amazonaws.com/previews.figshare.com/1267025/preview_1267025.jpg

  • 1 / 2
  •  
  •  
  •  

figshare

download

Distribution of quinpirole-induced locomotion in one cohort of animals. (A) Distribution of locomotor activity scores (beam breaks/hr) during the ascending within-session quinpirole dose response testing. Dark gray horizontal lines within the data clusters depict the median score at each dose. (B) Distribution of the calculated area under the curve (AUC) score for each animal across the three quinpirole doses. The dark gray filled data point and the dotted line represent the median score (M = 15460).

Figure S1.

Distribution of quinpirole-induced locomotion in one cohort of animals. (A) Distribution of locomotor activity scores (beam breaks/hr) during the ascending within-session quinpirole dose response testing. Dark gray horizontal lines within the data clusters depict the median score at each dose. (B) Distribution of the calculated area under the curve (AUC) score for each animal across the three quinpirole doses. The dark gray filled data point and the dotted line represent the median score (M = 15460).

doi:10.1371/journal.pone.0078258.s001

(TIF)

Figure S2.

LD2 and HD2 groups did not differ in their D2 dopamine autoreceptor sensitivity. (A) Distribution of the calculated scores (% Baseline) for 0.1 mg/kg quinpirole within the LD2 and HD2 groups. Baseline activity corresponds with saline-induced locomotor activity the hour prior to 0.1 mg/kg quinpirole administration in the within session dose response testing procedure. (B) Group averages (± sem) for the D2 autoreceptor sensitivity scores revealed not significant group differences.

doi:10.1371/journal.pone.0078258.s002

(TIF)

Author Contributions

Conceived and designed the experiments: RKB KEM. Performed the experiments: KEM. Analyzed the data: RKB. Contributed reagents/materials/analysis tools: RKB KEM. Wrote the paper: RKB.

References

  1. 1. Wagner FA, Anthony JC (2002) From first drug use to drug dependence; developmental periods of risk for dependence upon marijuana, cocaine, and alcohol. Neuropsychopharmacology : official publication of the American College of Neuropsychopharmacology 26: 479–488. doi: 10.1016/s0893-133x(01)00367-0
  2. 2. Piazza PV, Le Moal ML (1996) Pathophysiological basis of vulnerability to drug abuse: role of an interaction between stress, glucocorticoids, and dopaminergic neurons. Annual review of pharmacology and toxicology 36: 359–378. doi: 10.1146/annurev.pa.36.040196.002043
  3. View Article
  4. PubMed/NCBI
  5. Google Scholar
  6. View Article
  7. PubMed/NCBI
  8. Google Scholar
  9. View Article
  10. PubMed/NCBI
  11. Google Scholar
  12. View Article
  13. PubMed/NCBI
  14. Google Scholar
  15. View Article
  16. PubMed/NCBI
  17. Google Scholar
  18. View Article
  19. PubMed/NCBI
  20. Google Scholar
  21. View Article
  22. PubMed/NCBI
  23. Google Scholar
  24. View Article
  25. PubMed/NCBI
  26. Google Scholar
  27. View Article
  28. PubMed/NCBI
  29. Google Scholar
  30. View Article
  31. PubMed/NCBI
  32. Google Scholar
  33. View Article
  34. PubMed/NCBI
  35. Google Scholar
  36. View Article
  37. PubMed/NCBI
  38. Google Scholar
  39. View Article
  40. PubMed/NCBI
  41. Google Scholar
  42. View Article
  43. PubMed/NCBI
  44. Google Scholar
  45. View Article
  46. PubMed/NCBI
  47. Google Scholar
  48. View Article
  49. PubMed/NCBI
  50. Google Scholar
  51. View Article
  52. PubMed/NCBI
  53. Google Scholar
  54. View Article
  55. PubMed/NCBI
  56. Google Scholar
  57. View Article
  58. PubMed/NCBI
  59. Google Scholar
  60. View Article
  61. PubMed/NCBI
  62. Google Scholar
  63. View Article
  64. PubMed/NCBI
  65. Google Scholar
  66. View Article
  67. PubMed/NCBI
  68. Google Scholar
  69. View Article
  70. PubMed/NCBI
  71. Google Scholar
  72. View Article
  73. PubMed/NCBI
  74. Google Scholar
  75. View Article
  76. PubMed/NCBI
  77. Google Scholar
  78. View Article
  79. PubMed/NCBI
  80. Google Scholar
  81. View Article
  82. PubMed/NCBI
  83. Google Scholar
  84. View Article
  85. PubMed/NCBI
  86. Google Scholar
  87. View Article
  88. PubMed/NCBI
  89. Google Scholar
  90. View Article
  91. PubMed/NCBI
  92. Google Scholar
  93. View Article
  94. PubMed/NCBI
  95. Google Scholar
  96. View Article
  97. PubMed/NCBI
  98. Google Scholar
  99. View Article
  100. PubMed/NCBI
  101. Google Scholar
  102. View Article
  103. PubMed/NCBI
  104. Google Scholar
  105. View Article
  106. PubMed/NCBI
  107. Google Scholar
  108. View Article
  109. PubMed/NCBI
  110. Google Scholar
  111. View Article
  112. PubMed/NCBI
  113. Google Scholar
  114. View Article
  115. PubMed/NCBI
  116. Google Scholar
  117. View Article
  118. PubMed/NCBI
  119. Google Scholar
  120. View Article
  121. PubMed/NCBI
  122. Google Scholar
  123. View Article
  124. PubMed/NCBI
  125. Google Scholar
  126. View Article
  127. PubMed/NCBI
  128. Google Scholar
  129. View Article
  130. PubMed/NCBI
  131. Google Scholar
  132. View Article
  133. PubMed/NCBI
  134. Google Scholar
  135. View Article
  136. PubMed/NCBI
  137. Google Scholar
  138. View Article
  139. PubMed/NCBI
  140. Google Scholar
  141. View Article
  142. PubMed/NCBI
  143. Google Scholar
  144. View Article
  145. PubMed/NCBI
  146. Google Scholar
  147. View Article
  148. PubMed/NCBI
  149. Google Scholar
  150. View Article
  151. PubMed/NCBI
  152. Google Scholar
  153. View Article
  154. PubMed/NCBI
  155. Google Scholar
  156. View Article
  157. PubMed/NCBI
  158. Google Scholar
  159. View Article
  160. PubMed/NCBI
  161. Google Scholar
  162. View Article
  163. PubMed/NCBI
  164. Google Scholar
  165. 3. Swanson LW (1982) The projections of the ventral tegmental area and adjacent regions: a combined fluorescent retrograde tracer and immunofluorescence study in the rat. Brain research bulletin 9: 321–353. doi: 10.1016/0361-9230(82)90145-9
  166. 4. Ritz MC, Lamb RJ, Goldberg SR, Kuhar MJ (1987) Cocaine receptors on dopamine transporters are related to self-administration of cocaine. Science 237: 1219–1223. doi: 10.1126/science.2820058
  167. 5. Anderson SM, Pierce RC (2005) Cocaine-induced alterations in dopamine receptor signaling: implications for reinforcement and reinstatement. Pharmacol Ther 106: 389–403. doi: 10.1016/j.pharmthera.2004.12.004
  168. 6. Volkow ND, Fowler JS, Wang GJ, Baler R, Telang F (2009) Imaging dopamine’s role in drug abuse and addiction. Neuropharmacology 56 Suppl 13–8. doi: 10.1016/j.neuropharm.2008.05.022
  169. 7. Volkow ND, Wang GJ, Fowler JS, Logan J, Gatley SJ, et al. (1999) Prediction of reinforcing responses to psychostimulants in humans by brain dopamine D2 receptor levels. The American journal of psychiatry 156: 1440–1443.
  170. 8. Caine SB, Negus SS, Mello NK, Patel S, Bristow L, et al. (2002) Role of dopamine D2-like receptors in cocaine self-administration: studies with D2 receptor mutant mice and novel D2 receptor antagonists. The Journal of neuroscience : the official journal of the Society for Neuroscience 22: 2977–2988.
  171. 9. Thanos PK, Michaelides M, Umegaki H, Volkow ND (2008) D2R DNA transfer into the nucleus accumbens attenuates cocaine self-administration in rats. Synapse 62: 481–486. doi: 10.1002/syn.20523
  172. 10. Bailey A, Metaxas A, Yoo JH, McGee T, Kitchen I (2008) Decrease of D2 receptor binding but increase in D2-stimulated G-protein activation, dopamine transporter binding and behavioural sensitization in brains of mice treated with a chronic escalating dose ‘binge’ cocaine administration paradigm. Eur J Neurosci 28: 759–770. doi: 10.1111/j.1460-9568.2008.06369.x
  173. 11. Briand LA, Flagel SB, Seeman P, Robinson TE (2008) Cocaine self-administration produces a persistent increase in dopamine D2 High receptors. European neuropsychopharmacology : the journal of the European College of Neuropsychopharmacology 18: 551–556. doi: 10.1016/j.euroneuro.2008.01.002
  174. 12. Bachtell RK, Choi KH, Simmons DL, Falcon E, Monteggia LM, et al. (2008) Role of GluR1 expression in nucleus accumbens neurons in cocaine sensitization and cocaine-seeking behavior. Eur J Neurosci 27: 2229–2240. doi: 10.1111/j.1460-9568.2008.06199.x
  175. 13. Collins GT, Truong YN, Levant B, Chen J, Wang S, et al. (2011) Behavioral sensitization to cocaine in rats: evidence for temporal differences in dopamine D3 and D2 receptor sensitivity. Psychopharmacology 215: 609–620. doi: 10.1007/s00213-010-2154-7
  176. 14. Edwards S, Whisler KN, Fuller DC, Orsulak PJ, Self DW (2007) Addiction-related alterations in D1 and D2 dopamine receptor behavioral responses following chronic cocaine self-administration. Neuropsychopharmacology 32: 354–366. doi: 10.1038/sj.npp.1301062
  177. 15. Ujike H, Akiyama K, Otsuki S (1990) D-2 but not D-1 dopamine agonists produce augmented behavioral response in rats after subchronic treatment with methamphetamine or cocaine. Psychopharmacology (Berl) 102: 459–464. doi: 10.1007/bf02247125
  178. 16. Bachtell RK, Whisler K, Karanian D, Self DW (2005) Effects of intra-nucleus accumbens shell administration of dopamine agonists and antagonists on cocaine-taking and cocaine-seeking behaviors in the rat. Psychopharmacology (Berl) 183: 41–53. doi: 10.1007/s00213-005-0133-1
  179. 17. De Vries TJ, Schoffelmeer AN, Binnekade R, Vanderschuren LJ (1999) Dopaminergic mechanisms mediating the incentive to seek cocaine and heroin following long-term withdrawal of IV drug self-administration. Psychopharmacology (Berl) 143: 254–260. doi: 10.1007/s002130050944
  180. 18. Dias C, Lachize S, Boilet V, Huitelec E, Cador M (2004) Differential effects of dopaminergic agents on locomotor sensitisation and on the reinstatement of cocaine-seeking and food-seeking behaviour. Psychopharmacology 175: 105–115. doi: 10.1007/s00213-004-1839-1
  181. 19. Khroyan TV, Barrett-Larimore RL, Rowlett JK, Spealman RD (2000) Dopamine D1- and D2-like receptor mechanisms in relapse to cocaine-seeking behavior: Effects of selective antagonists and agonists. J Pharmacol Exp Ther 294: 680–687.
  182. 20. Schmidt HD, Pierce RC (2006) Cooperative activation of D1-like and D2-like dopamine receptors in the nucleus accumbens shell is required for the reinstatement of cocaine-seeking behavior in the rat. Neuroscience 142: 451–461. doi: 10.1016/j.neuroscience.2006.06.004
  183. 21. Self DW, Barnhart WJ, Lehman DA, Nestler EJ (1996) Opposite modulation of cocaine-seeking behavior by D1- and D2-like dopamine receptor agonists. Science 271: 1586–1589. doi: 10.1126/science.271.5255.1586
  184. 22. O’Neill CE, LeTendre ML, Bachtell RK (2012) Adenosine A2A receptors in the nucleus accumbens bi-directionally alter cocaine seeking in rats. Neuropsychopharmacology : official publication of the American College of Neuropsychopharmacology 37: 1245–1256. doi: 10.1038/npp.2011.312
  185. 23. White FJ, Wang RY (1986) Electrophysiological evidence for the existence of both D-1 and D-2 dopamine receptors in the rat nucleus accumbens. The Journal of neuroscience : the official journal of the Society for Neuroscience 6: 274–280.
  186. 24. Hu XT, Wang RY (1988) Disinhibition of nucleus accumbens neurons by the dopamine D2 receptor agonist LY-141865: prevented by 6-OHDA pretreatment. Brain research 444: 389–393. doi: 10.1016/0006-8993(88)90953-5
  187. 25. Eilam D, Szechtman H (1989) Biphasic effect of D-2 agonist quinpirole on locomotion and movements. European journal of pharmacology 161: 151–157. doi: 10.1016/0014-2999(89)90837-6
  188. 26. Piazza PV, Deminiere JM, Le Moal M, Simon H (1989) Factors that predict individual vulnerability to amphetamine self-administration. Science 245: 1511–1513. doi: 10.1126/science.2781295
  189. 27. Piazza PV, Deroche-Gamonent V, Rouge-Pont F, Le Moal M (2000) Vertical shifts in self-administration dose-response functions predict a drug-vulnerable phenotype predisposed to addiction. J Neurosci 20: 4226–4232.
  190. 28. Gulley JM, Hoover BR, Larson GA, Zahniser NR (2003) Individual differences in cocaine-induced locomotor activity in rats: behavioral characteristics, cocaine pharmacokinetics, and the dopamine transporter. Neuropsychopharmacology : official publication of the American College of Neuropsychopharmacology 28: 2089–2101. doi: 10.1038/sj.npp.1300279
  191. 29. Sabeti J, Gerhardt GA, Zahniser NR (2003) Individual differences in cocaine-induced locomotor sensitization in low and high cocaine locomotor-responding rats are associated with differential inhibition of dopamine clearance in nucleus accumbens. The Journal of pharmacology and experimental therapeutics 305: 180–190. doi: 10.1124/jpet.102.047258
  192. 30. Allen RM, Everett CV, Nelson AM, Gulley JM, Zahniser NR (2007) Low and high locomotor responsiveness to cocaine predicts intravenous cocaine conditioned place preference in male Sprague-Dawley rats. Pharmacology, biochemistry, and behavior 86: 37–44. doi: 10.1016/j.pbb.2006.12.005
  193. 31. Mandt BH, Schenk S, Zahniser NR, Allen RM (2008) Individual differences in cocaine-induced locomotor activity in male Sprague-Dawley rats and their acquisition of and motivation to self-administer cocaine. Psychopharmacology 201: 195–202. doi: 10.1007/s00213-008-1265-x
  194. 32. Sokoloff P, Giros B, Martres MP, Bouthenet ML, Schwartz JC (1990) Molecular cloning and characterization of a novel dopamine receptor (D3) as a target for neuroleptics. Nature 347: 146–151. doi: 10.1038/347146a0
  195. 33. Kostrzewa RM, Brus R (1991) Is dopamine-agonist induced yawning behavior a D3 mediated event? Life sciences 48: PL129. doi: 10.1016/0024-3205(91)90619-m
  196. 34. Kurashima M, Yamada K, Nagashima M, Shirakawa K, Furukawa T (1995) Effects of putative dopamine D3 receptor agonists, 7-OH-DPAT, and quinpirole, on yawning, stereotypy, and body temperature in rats. Pharmacology, biochemistry, and behavior 52: 503–508. doi: 10.1016/0091-3057(95)00103-4
  197. 35. Deminiere JM, Piazza PV, Le Moal M, Simon H (1989) Experimental approach to individual vulnerability to psychostimulant addiction. Neuroscience and biobehavioral reviews 13: 141–147. doi: 10.1016/s0149-7634(89)80023-5
  198. 36. Hooks MS, Jones GH, Smith AD, Neill DB, Justice JB Jr (1991) Individual differences in locomotor activity and sensitization. Pharmacology, biochemistry, and behavior 38: 467–470. doi: 10.1016/0091-3057(91)90308-o
  199. 37. Hooks MS, Juncos JL, Justice JB Jr, Meiergerd SM, Povlock SL, et al. (1994) Individual locomotor response to novelty predicts selective alterations in D1 and D2 receptors and mRNAs. The Journal of neuroscience : the official journal of the Society for Neuroscience 14: 6144–6152.
  200. 38. Hooks MS, Jones DN, Holtzman SG, Juncos JL, Kalivas PW, et al. (1994) Individual differences in behavior following amphetamine, GBR-12909, or apomorphine but not SKF-38393 or quinpirole. Psychopharmacology 116: 217–225. doi: 10.1007/bf02245065
  201. 39. Flagel SB, Robinson TE, Clark JJ, Clinton SM, Watson SJ, et al. (2010) An animal model of genetic vulnerability to behavioral disinhibition and responsiveness to reward-related cues: implications for addiction. Neuropsychopharmacology : official publication of the American College of Neuropsychopharmacology 35: 388–400. doi: 10.1038/npp.2009.142
  202. 40. Seeman P, Weinshenker D, Quirion R, Srivastava LK, Bhardwaj SK, et al. (2005) Dopamine supersensitivity correlates with D2High states, implying many paths to psychosis. Proc Natl Acad Sci U S A 102: 3513–3518. doi: 10.1073/pnas.0409766102
  203. 41. Marinelli M, White FJ (2000) Enhanced vulnerability to cocaine self-administration is associated with elevated impulse activity of midbrain dopamine neurons. J Neurosci 20: 8876–8885.
  204. 42. Fattore L, Piras G, Corda MG, Giorgi O (2009) The Roman high- and low-avoidance rat lines differ in the acquisition, maintenance, extinction, and reinstatement of intravenous cocaine self-administration. Neuropsychopharmacology : official publication of the American College of Neuropsychopharmacology 34: 1091–1101. doi: 10.1038/npp.2008.43
  205. 43. Giorgi O, Piras G, Corda MG (2007) The psychogenetically selected Roman high- and low-avoidance rat lines: a model to study the individual vulnerability to drug addiction. Neuroscience and biobehavioral reviews 31: 148–163. doi: 10.1016/j.neubiorev.2006.07.008
  206. 44. Schramm-Sapyta NL, Cauley MC, Stangl DK, Glowacz S, Stepp KA, et al. (2011) Role of individual and developmental differences in voluntary cocaine intake in rats. Psychopharmacology 215: 493–504. doi: 10.1007/s00213-011-2216-5
  207. 45. Rilke O, May T, Oehler J, Wolffgramm J (1995) Influences of housing conditions and ethanol intake on binding characteristics of D2, 5-HT1A, and benzodiazepine receptors of rats. Pharmacology, biochemistry, and behavior 52: 23–28. doi: 10.1016/0091-3057(95)00093-c
  208. 46. Del Arco A, Zhu S, Terasmaa A, Mohammed AH, Fuxe K (2004) Hyperactivity to novelty induced by social isolation is not correlated with changes in D2 receptor function and binding in striatum. Psychopharmacology 171: 148–155. doi: 10.1007/s00213-003-1578-8
  209. 47. Grant KA, Shively CA, Nader MA, Ehrenkaufer RL, Line SW, et al. (1998) Effect of social status on striatal dopamine D2 receptor binding characteristics in cynomolgus monkeys assessed with positron emission tomography. Synapse 29: 80–83. doi: 10.1002/(sici)1098-2396(199805)29:1<80::aid-syn7>3.0.co;2-7
  210. 48. Morgan D, Grant KA, Gage HD, Mach RH, Kaplan JR, et al. (2002) Social dominance in monkeys: dopamine D2 receptors and cocaine self-administration. Nat Neurosci 5: 169–174. doi: 10.1038/nn798
  211. 49. Papp M, Muscat R, Willner P (1993) Subsensitivity to rewarding and locomotor stimulant effects of a dopamine agonist following chronic mild stress. Psychopharmacology 110: 152–158. doi: 10.1007/bf02246965
  212. 50. Papp M, Klimek V, Willner P (1994) Parallel changes in dopamine D2 receptor binding in limbic forebrain associated with chronic mild stress-induced anhedonia and its reversal by imipramine. Psychopharmacology 115: 441–446. doi: 10.1007/bf02245566
  213. 51. Puglisi-Allegra S, Kempf E, Schleef C, Cabib S (1991) Repeated stressful experiences differently affect brain dopamine receptor subtypes. Life sciences 48: 1263–1268. doi: 10.1016/0024-3205(91)90521-c
  214. 52. Henry C, Guegant G, Cador M, Arnauld E, Arsaut J, et al. (1995) Prenatal stress in rats facilitates amphetamine-induced sensitization and induces long-lasting changes in dopamine receptors in the nucleus accumbens. Brain research 685: 179–186. doi: 10.1016/0006-8993(95)00430-x
  215. 53. Cabib S, Giardino L, Calza L, Zanni M, Mele A, et al. (1998) Stress promotes major changes in dopamine receptor densities within the mesoaccumbens and nigrostriatal systems. Neuroscience 84: 193–200. doi: 10.1016/s0306-4522(97)00468-5
  216. 54. Dziedzicka-Wasylewska M, Willner P, Papp M (1997) Changes in dopamine receptor mRNA expression following chronic mild stress and chronic antidepressant treatment. Behavioural pharmacology 8: 607–618. doi: 10.1097/00008877-199711000-00017
  217. 55. Carr KD, Kim GY, Cabeza de Vaca S (2001) Rewarding and locomotor-activating effects of direct dopamine receptor agonists are augmented by chronic food restriction in rats. Psychopharmacology 154: 420–428. doi: 10.1007/s002130000674

 

Irrational Choice under Uncertainty Correlates with Lower Striatal D2/3 Receptor Binding in Rats (2012)

 

  1. Catharine A. Winstanley1

Author contributions: V.S. and C.A.W. designed research; P.J.C., K.D., and R.K. performed research; P.J.C., K.D., and C.A.W. analyzed data; P.J.C. and C.A.W. wrote the paper.

Abstract

Individual differences in dopamine (DA) signaling, including low striatal D2/3 receptors, may increase vulnerability to substance abuse, although whether this phenotype confers susceptibility to nonchemical addictions is unclear. The degree to which people use “irrational” cognitive heuristics when choosing under uncertainty can determine whether they find gambling addictive. Given that dopaminergic projections to the striatum signal reward expectancy and modulate decision-making, individual differences in DA signaling could influence the extent of such biases. To test this hypothesis, we used a novel task to model biased, risk-averse decision-making in rats. Animals chose between a “safe” lever, which guaranteed delivery of the wager, or an “uncertain” lever, which delivered either double the wager or nothing with 50:50 odds. The bet size varied from one to three sugar pellets. Although the amount at stake did not alter the options' utility, a subgroup of “wager-sensitive” rats increased their preference for the safe lever as the bet size increased, akin to risk aversion. In contrast, wager-insensitive rats slightly preferred the uncertain option consistently. Amphetamine increased choice of the uncertain option in wager-sensitive, but not in wager-insensitive rats, whereas a D2/3 receptor antagonist decreased uncertain lever choice in wager-insensitive rats alone. Micro-PET and autoradiography using [11C]raclopride confirmed a strong correlation between high wager sensitivity and low striatal D2/3 receptor density. These data suggest that the propensity for biased decision-making under uncertainty is influenced by striatal D2/3 receptor expression, and provide novel support for the hypothesis that susceptibility to chemical and behavioral addictions may share a common neurobiological basis.

Introduction

Most decisions involve elements of risk or uncertainty. Using Bayesian rationality, any option's expected value can be computed as the product of an outcome's value and its probability of occurring. Although we understand such principles, our decisions are instead primarily influenced by cognitive biases (Kahneman and Tversky, 1979). For example, we are excessively intolerant of uncertainty as the wager increases, a bias that can engender problematic risk-seeking to avoid guaranteed losses (Trepel et al., 2005). Such strategies are suboptimal when compared with mathematical norms. Furthermore, irrational decision-making under risk has been linked to the manifestation and severity of problem gambling (PG) (Ladouceur and Walker, 1996; Miller and Currie, 2008; Emond and Marmurek, 2010) and correcting such irrational cognitions is a key target of cognitive therapy for PG (Sylvain et al., 1997; Ladoucer et al., 2001). Understanding the biological basis of these decision-making biases could therefore provide valuable insight into gambling and its addictive nature.

Given that the dopamine (DA) system plays a critical role in drug addiction, it is perhaps unsurprising that differences in DA activity have been hypothesized to contribute to PG. The psychostimulant amphetamine, which potentiates the actions of DA, can increase the drive to gamble in problem gamblers but not in healthy controls (Zack and Poulos, 2004), indicating that problem gamblers may be hypersensitive to increases in DA release. DA may also be fundamentally important in representing risk at a neuronal level due to its role in signaling reward prediction errors within the striatum (Schultz et al., 1997; Cardinal et al., 2002; O'Doherty et al., 2004; Day et al., 2007). Given that dopaminergic drugs have been shown to modulate decision-making between probabilistic outcomes in rats and humans (Pessiglione et al., 2006; St. Onge and Floresco, 2009), DA signaling, particularly within the striatum, could theoretically contribute to biases in decision-making under risk.

Experiments using animal models of human cognitive functioning can provide vital insight into the mechanisms underlying complex brain functions. Although a multitude of cognitive distortions has been identified in gamblers, it is relatively unclear which, if any, contribute meaningfully toward the formation or maintenance of an “addicted” state. However, many of these biases, such as the illusion of control or preferences when picking numbers in a lottery, are inherently difficult to model in nonhuman subjects. It could be argued that, when considering biased or subjective preference, the critical comparison occurs when subjects choose between certain and uncertain options that yield equal payoffs on average. Although rational decision-makers should be indifferent under such circumstances, most human subjects are initially risk-averse and favor the guaranteed reward, particularly as the wager increases (Kahneman, 2003), although individuals vary as to the extent and resilience of this bias (Weber et al., 2004; Brown and Braver, 2007, 2008; Gianotti et al., 2009). Using a novel decision-making task, we therefore aimed to determine whether rats are likewise more prone to risk aversion when the reward at stake increases, and whether the size of such a bias is mediated by individual differences in DA signaling.

Materials and Methods

Subjects.

Subjects were 32 male Long–Evans rats (Charles River Laboratories) weighing between 275 and 300 g at the start of testing. Animals were maintained at 85% of their ad libitum feeding weight and food restricted to 14 g of rat chow daily, in addition to the sugar pellets earned during behavioral testing. Water was available ad libitum. Animals were pair-housed and kept in a temperature-controlled and climate-controlled colony room (21°C) on a reverse 12 h light/dark schedule (lights off, 8 A.M.). All testing and housing conditions were in accordance with the Canadian Council for Animal Care and all experiments were approved by the Animal Care Committee of the University of British Columbia.

Behavioral apparatus.

Testing took place in eight standard five-hole operant chambers, each enclosed within a ventilated sound-attenuating cabinet (Med Associates). An array of five evenly spaced nosepoke apertures, or response holes, was located 2 cm above a bar floor along one wall of the chamber. A recessed stimulus light was located in the back of each aperture and nosepoke responses could be detected by a horizontal infrared beam passing across the front of each response hole. A food tray, also equipped with an infrared beam and a tray light, was located on the opposite wall. Sucrose pellets (45 mg, Bio-Serv) were delivered to the food tray via an external pellet dispenser. Retractable levers were located on either side of the food tray. Chambers could be illuminated via a houselight and were controlled by software, written in MED-PC by C.A.W., running on an IBM-compatible computer.

Behavioral training.

Animals were initially habituated to the testing chambers with 2 daily 30 min sessions. During these sessions, the response apertures and the food tray were baited with sugar pellets. In subsequent sessions, animals were trained to respond in the apertures when the light inside was illuminated, similar to the procedure used for training rats to perform the five-choice serial reaction time task as has been described in detail previously (Winstanley et al., 2007, 2010). In essence, rats were trained to nosepoke into an illuminated aperture within 10 s to gain food reward. Sessions lasted 30 min, or 100 trials, and the spatial position of the stimulus light varied pseudorandomly between trials. Once rats were capable of responding in the correct aperture with an accuracy of 80% or higher, and omitted <20% of trials, animals were then trained to respond on the retractable levers for reward under a fixed ratio 1 schedule. Only one lever was presented per 30 min session. Once the animal had made >50 lever presses during a 30 min session, the other lever was presented in the subsequent session. The order in which the levers were presented (left/right) was counterbalanced across subjects.

Betting task.

A task schematic is provided in Figure 1. Before task commencement, levers were permanently designated as “safe” or “uncertain,” and these designations were counterbalanced across subjects. Animals initially performed 10 sessions of a forced-choice version of the task in which only one lever extended per trial. All trials were initiated via a nosepoke response into the illuminated food tray. Following such a response, the tray light was extinguished and one, two, or three lights within the five-hole array were illuminated in holes 2, 3, or 4. The number of lights presented equaled the bet size on each trial. Rats were required to make a nosepoke response at each illuminated aperture to turn off the light inside it. Once all the stimulus lights had been turned off in this manner, the levers were inserted into the chamber. A response on the “safe” lever led to the guaranteed delivery of the number of pellets wagered, whereas a response on the “uncertain” lever yielded a 50% chance of double the available safe reward or nothing. The expected utility of both options was therefore equal, and there was no net advantage in choosing one over the other. On rewarded trials, the designated number of pellets was dispensed into the food tray. Regardless of whether reward was delivered, the tray light was illuminated after a response had been made on one of the two levers, and a response at the food tray initiated the next trial. Failure to respond on either lever within 10 s led to the trial being scored as a choice omission. Similarly, failure to respond at all illuminated apertures within 10 s resulted in the trial being scored as a hole omission. Both errors of omission were immediately punished by a 5 s time-out period. During such time-outs, the house light illuminated the chamber and no reward could be earned or trials initiated. Following the time-out period, the tray light was illuminated, indicating the animal could commence another trial.

Figure 1. 

Schematic diagram showing the trial structure for the betting task. The rat initiated each trial by making a nosepoke response at the illuminated food tray. The tray light was then extinguished, and 1–3 response holes were illuminated, signaling the size of the bet or wager (1–3 sugar pellets). A nosepoke response at an illuminated aperture turned off the light inside it. Once all the aperture lights had been extinguished in this manner, two levers were presented to the rat. Selection of the uncertain lever resulted in a 50:50 chance of receiving either double the wager or nothing, whereas selection of the safe lever always lead to delivery of the wager. The trial was scored as a choice omission if the rat failed to choose one of the levers within 10 s. Likewise, if the rat failed to respond at each illuminated response hole within 10 s, the trial was scored as a hole omission.

Each session consisted of 12 blocks of 10 trials each. The bet size remained constant within each block but varied between blocks in a pseudorandom fashion that ensured four blocks of each bet size within a session, and not >2 consecutive blocks of the same bet size. The first four trials of each block were forced choice, such that only the safe (2 trials) or uncertain (2 trials) lever was presented in random order to ensure the animal sampled from both options throughout the session and was familiar with the current contingency in play. Sessions lasted until all 120 trials had been completed, up to a maximum of 30 min.

Animals received five daily sessions per week and were tested until a statistically stable pattern of responding was observed across all variables analyzed over five sessions (total sessions to behavioral stability, 46–54). All animals were able to complete the 120 trials within the 30 min time limit.

Pharmacological challenges.

Once a stable behavioral baseline had been established, the effects of the following compounds were investigated: the psychostimulant d-amphetamine (0, 0.3, 1.0 mg/kg), the DA D2/3 receptor antagonist eticlopride (0, 0.01, 0.03, 0.06 mg/kg), and the DA D1 receptor antagonist R(+)-7-chloro-8-hydroxy-3-methyl-1-phenyl-2,3,4,5-tetrahydro-1H-3-benzazepine hydrochloride (SCH 23390; 0, 0.001, 0.003, 0.01 mg/kg). Drugs were administered according to a series of digram-balanced Latin-square designs (for doses A–D: ABCD, BDAC, CABD, DCBA) (Cardinal and Aitken, 2006). Drug injections were given on a 3 d cycle starting with a baseline session. On the following day, drug or saline would be administered 10 min before testing. On the third day, animals remained in their home cages. Animals were tested drug free for at least 1 week between each series of injections to allow a stable behavioral baseline to be re-established, and to ensure that exposure to any of the compounds had not had lasting effects on behavior.

All drug doses were calculated as the salt and dissolved in 0.9% sterile saline. All drugs were prepared fresh daily and administered via the intraperitoneal route. d-Amphetamine sulfate was purchased under a Health Canada exception from Sigma-Aldrich. SCH 23390 and eticlopride hydrochloride were purchased from Tocris Bioscience.

PET analysis.

In a subgroup of rats (n = 9), D2/3 receptor availability and density were assessed via PET and autoradiography. All rats were tested for a week following the last drug challenge to ensure that drug administration had not led to any lasting changes in behavior. Animals then remained in their home cages and were fed 20 g of food per day until it was possible to perform the PET scan (46–212 d after the last behavioral test session).

PET studies were performed on a Siemens micro-PET Focus F120 scanner (Laforest, 2007), which has a resolution of ∼1.8 mm3. Rats were maintained under 2.5% isofluorane anesthesia throughout the scanning procedure. Six minutes of transmission data were collected with a 57Co source to allow the calculation of attenuation and scatter corrections. Following intravenous injection of [11C]raclopride (1.02 ± 0.02 μCi/g; specific activity, > 4000Ci/mmol), 1 h of emission data were collected. Data were histogrammed into 6 × 30 s, 2 × 60 s, 5 × 300 s, 2 × 450 s, and 2 × 480 s frames and reconstructed using Fourier rebinning and filtered backprojection. Corrections for normalization, scatter, and attenuation were applied during reconstruction.

Rectangular regions of interest (ROIs) were placed bilaterally on the dorsal striatum across three image slices (2.6 × 3.5 × 2.4 mm) and on the cerebellum across three image slices (6.9 × 2.6 × 2.4 mm). An average time activity curve for the left striatum, right striatum, and cerebellum were generated from these ROIs. Using the graphical Logan method (Logan, 1996), the binding potential (BPND) was calculated for the left and right striatum using the cerebellum as a reference region.

Autoradiography.

One to two hours after the PET scan had been completed, each animal was killed via decapitation and the brain removed, frozen in isopentane, and stored at −80°C. Brains were sliced into 16 μm coronal sections along the same axis as the collected PET data and mounted on glass slides. Sections from the dorsal striatum (anterior, medial, and posterior) were taken. To measure D2/3 receptor availability, slides were incubated in 3 nm [11C]raclopride to determine total binding, or a mixture of 3 nm [11C]raclopride and 10 μm (+)-butaclamol to determine nonspecific binding. Standard curves were prepared by serially diluting a known amount of [11C]raclopride and pipetting a drop from each dilution onto a small piece of paper (Strome, 2005). Following incubation, the slides and standard curves were dried and apposed to radiosensitive phosphor screens for 2 h. These screens were then read out using a Cyclone phosphor imaging system. The resulting optical densities were converted to pmol/ml via the standard curves. Rectangular ROIs with the same in-plane (or in-slice) area as those used in the PET analysis were placed on the striatum in each of the imaged slices. ROIs were also placed in the nucleus accumbens (area of bilateral ellipses, 2.5 mm2), medial prefrontal cortex (area of bilateral ellipses, 2.0 mm2), and ventrolateral orbitofrontal cortex (area of rectangle, 3.4 mm2). A single binding measurement for each region was reported by averaging the measured optical density across all relevant tissue slices in a given ROI and converting to pmol/ml using the standard curve data. A similar method was used to measure D1 receptor availability with [3H]SCH 23390 (PerkinElmer), with the exception that commercially available [3H] microscales (GE Healthcare) were used to convert the measured optical densities.

Behavioral data analysis.

All behavioral statistical analyses were conducted using SPSS (version 16, IBM). The percentage choice rather than the absolute number of choices of the uncertain lever was analyzed to prevent any drug-induced changes in the number of trials completed from confounding our analyses. The percentage of trials on which the uncertain lever was chosen for each bet size was therefore calculated according to the following formula: [(number of times uncertain lever chosen)/(total number of trials)] × 100. These data were arcsine transformed before analysis to minimize any artificial ceiling effects (i.e., 100%). Other measurements analyzed were the following: the number of hole omissions, the number of choice omissions, the latency to choose a lever, the latency to collect reward at the food tray, and the number of trials completed per session. Stable baseline behavior across five sessions was determined via repeated-measures ANOVA for all variables measured, with session (5 levels: sessions 1–5) and bet size (3 levels: 1–3 sugar pellets) as within-subjects factors. A third within-subjects factor, lever choice (2 levels: safe, uncertain) was also included for all variables except percentage choice of the uncertain lever. The number of trials completed was also analyzed via repeated-measures ANOVA for all variables measured, with session (5 levels: sessions 1–5) as a within-subjects factor. The order in which blocks of different bet size were presented was controlled for within-the-task design and was therefore not included as an additional factor; if the block sequence was influencing behavior, then it would be impossible to see consistent effects of bet size across sessions, nor to reach statistically stable behavior as the data would vary day to day.

It became clear during analysis of these baseline data that individual animals differed dramatically in their wager sensitivity. Rats were therefore divided into two groups based on a linear regression analysis. A singular measure of wager sensitivity was obtained for each rat as follows. The choice of the uncertain option at each bet size was averaged across the five previous baseline sessions and plotted in Microsoft Excel to generate an equation of the form y = mx + c, in which the factor m indicates the gradient of the line (i.e., the degree to which choice of the risky option changed as a function of increasing bet size). This distinction was used as a between-subjects factor (group, 2 levels) and henceforth incorporated into all ANOVAs. Data from pharmacological challenges were also analyzed using repeated-measures ANOVAs with drug dose [4 levels: vehicle plus 3 doses of compound (with the exception of amphetamine, which had 3 levels: vehicle plus 2 doses of compound)] and bet size as within-subjects factors, and group as a between-subjects factor. In all analyses, any significant (p < 0.05) main effects were followed up post hoc using one-way ANOVA or Student's t tests. When data values are given in the text, the mean ± SEM are provided.

D2/3 striatal binding and wager sensitivity.

It was not possible to perform PET scans on all the rats. Therefore nine were selected pseudorandomly, the behavior of which was representative of the variation inherent in the group as a whole. ANOVAs were conducted to ensure that, statistically, the behavior of this subgroup did not significantly differ from that of the remainder of the cohort across the course of the experiment. Choice data from five baseline sessions, occurring both before and following all pharmacological challenges, were analyzed by ANOVA as described above with session and bet size as within-subjects factors, plus an additional between-subjects variable: PET group (2 levels, scanned and not scanned). The degree to which the level of wager sensitivity exhibited during these baseline sessions predicted the availability of D2/3 receptors in the dorsal striatum, as measured through BPND, was then determined. The relationship between the density of D1 or D2/3 receptors in the dorsal striatum, as measured by autoradiography, was also analyzed as an estimate of wager sensitivity. The degree to which the PET and autoradiography data correlated was also determined.

Results

Baseline performance of the betting task

Lever choice

Objectively there was no optimum strategy to the betting task: exclusive choice of either option did not yield any greater or lesser reward. However, animals showed significant preferences for one option over the other, and these preferences were modulated by the bet size in play (Fig. 2a; bet size: F(2,60) = 32.498, p < 0.0001). Furthermore, there were marked individual differences in the expression of such preferences, and these differences were exemplified by the degree to which animals showed a linear shift away from the uncertain lever as the bet size increased. Hence, animals were separated into two groups on the basis of their wager sensitivity (m in the equation y = mx + b; mean, −5.06 ± 10.50; Fig. 2b). Animals that chose the safe lever more as the wager increased, demonstrated by an m value of ≥1 SD below a theoretical 0 were classified as wager sensitive (n = 10), whereas all other animals were classified as wager insensitive (n = 22) (bet size–group: F(2,60) = 37.783, p < 0.0001; wager-insensitive bet size: F(2,42) = 3.309, p = 0.06; wager-sensitive bet size: F(2,18) = 57.596, p < 0.0001; bet size 1 vs 2: F(1,9) = 13.298, p = 0.005; 2 vs 3: F(1,9) = 114.551, p < 0.0001). Although there was a trend for bet size to influence choice in the wager-insensitive group, this was predominantly mediated by a slight increase in choice of the uncertain option at bet size 2. This was unlikely to represent a meaningful pattern of responding and certainly did not compare with the linear decrease in uncertain choice demonstrated by wager-sensitive animals. Perhaps unsurprisingly, the degree of wager sensitivity correlated strongly with the total choice of the uncertain lever (r2 = 0.522, p = 0.002). However, the classification of rats as wager sensitive versus wager insensitive captured more than just general preference for one lever or the other, in that choice behavior of the two groups was indistinguishable at the smallest bet size but pulled apart as wager-sensitive rats decreased their preference for the uncertain option as the bet size increased (bet size 1 group: F(1,27) = 1.759, not significant; bet size 2 group: F(1,27) = 10.681, p = 0.003; bet size 3 group: F(1,27) = 23.406, p < 0.0001).

Figure 2. 

Rats exhibit individual differences in preference for the uncertain reward, and this determines the response to amphetamine and eticlopride. a, Wager-sensitive rats shifted their preference as the bet size increased, whereas the choice pattern of wager-insensitive rats did not change. b, The degree of wager sensitivity shown by each rat, as indicated by the gradient (m) of the line obtained by plotting choice of the uncertain lever against bet size. c, d, Amphetamine increased choice of the uncertain option in wager-sensitive (c) but not wager-insensitive rats (d). e, f, In contrast, eticlopride had no effect in wager-sensitive rats (e), but decreased uncertain choice in wager-insensitive animals (f). Data shown are mean ± SEM.

Other behavioral measurements

Both wager-sensitive and wager-insensitive animals were quicker to select the uncertain over the safe lever, regardless of bet size (choice: F(1,28) = 11.238, p = 0.002; group: F(1,28) = 0.863, not significant; mean choice latency ± SEM, safe: 1.58 ± 0.03; mean choice latency ± SEM, uncertain 1.40 ± 0.03). Statistically, all animals were also quicker to collect the reward as the bet size increased (bet size: F(2,56) = 16.445, p < 0.0001; bet size–group: F(2,56) = 0.015, not significant; bet size 1 vs 2: F(1,28) = 12.493 p < 0.001; bet size 2 vs 3: F(1,28) = 16.521, p < 0.0001), although the magnitude of such changes were minimal (bet size 1: 0.42 ± 0.006 s; bet size 2: 0.4 ± 0.005 s; bet size 3: 0.39 ± 0.005 s). All animals completed a similar number of trials per session (wager sensitive, 120.0 ± 0.0; wager insensitive, 119.55 ± 0.26; group: F(1,30) = 0.770, not significant). There were so few omissions made per session that meaningful analysis was compromised due to the large number of cells containing null values (all rats: hole omissions, 0.006 ± 0.0004; choice omissions, 0.44 ± 0.06).

Effects of amphetamine administration on performance of the betting task

Lever choice.

Amphetamine significantly increased choice of the uncertain option in the wager-sensitive group, yet did not affect choice behavior in the wager-insensitive animals (Fig. 2c,d; group: F(1,30) = 6.560, p = 0.0016; dose: F(2,60) = 5.056, p = 0.009; wager sensitive to dose: F(2,18) = 6.483, p = 0.008; wager insensitive to dose: F(2,42) = 0.806, not significant; wager sensitive: saline vs 0.3 mg/kg amphetamine; F(1,9) = 3.647, p = 0.088; saline vs 1.0 mg/kg amphetamine: F(1,9) = 13.307, p = 0.005).

Other behavioral measures.

Amphetamine increased choice latencies, although this effect was only evident at the highest dose (dose: F(2,56) = 13.363, p < 0.0001; saline vs 0.6 mg/kg amphetamine: F(1,28) = 0.019, not significant; saline vs 1.0 mg/kg amphetamine: F(1,28) = 13.719). Both sets of animals displayed the same pattern of responding seen at baseline whereby they were quicker to respond on the uncertain lever (choice: F(1,28) = 8.024, p = 0.008; safe, 1.93 ± 0.19; uncertain, 1.66 ± 0.04). The latency to collect reward was not affected by amphetamine administration (dose: F(2,42) = 1.106, not significant; dose–choice–group: F(2,42) = 0.623, not significant), but the highest dose increased the number of choice omissions made (wager sensitive, 0.40 ± 0.18; wager insensitive, 0.53 ± 0.16; dose: F(2,60) = 5.264, p = 0.029; saline vs 1.0 mg/kg amphetamine: F(1,30) = 5.263, p = 0.029). Hole omissions were not affected following amphetamine administration (dose: F(2,60) = 2.344, p = 0.105; group: F(1,30) = 0.623, not significant). Although the higher dose of amphetamine appeared to decrease the number of trials completed, this effect fell short of significance when compared with saline administration (1.0 mg/kg amphetamine: wager sensitive, 118.9 ± 1.1; wager insensitive, 112.5 ± 4.59; dose: F(2,60) = 2.616, not significant; saline vs 1.0 mg/kg amphetamine: F(1,30) = 2.066, not significant).

Effects of eticlopride administration on performance of the betting task

At the highest dose, eticlopride reduced the total number of trials completed to <50%. Hence, this dose was not included in the final analysis.

Lever choice.

Eticlopride reduced choice of the uncertain lever in wager-insensitive rats, yet did not alter choice behavior in wager-sensitive animals (Fig. 2e,f; dose–group: F(2,60) = 2.729, p = 0.073; dose–group–bet size: F(4,120) = 2.821, p = 0.028; wager sensitive to dose: F(2,18) = 0.405, not significant; wager insensitive to dose: F(2,42) = 5.250, p < 0.009; saline vs 0.01 mg/kg eticlopride: F(1,21) = 4.477, p = 0.046; saline vs 0.03 mg/kg eticlopride: F(1,21) = 8.601, p < 0.008).

Other behavioral measures.

Eticlopride caused a general increase in lever choice latency, regardless of group (dose: F(1,29) = 13.794, p = 0.001; group: F(1,29) = 0.32, not significant). However this effect was only significant at the highest dose and animals retained the tendency to choose the uncertain lever more quickly (saline vs 0.01 mg/kg eticlopride: F(1,29) = 0.008, not significant; saline vs 0.03 mg/kg eticlopride: F(1,29) = 5.23, p = 0.03; choice: F(1,29) = 13.794, p = 0.001). Contrary to the increases in lever choice latency, eticlopride did not affect the time taken to collect reward (dose: F(2,34) = 0.267, not significant; dose–choice–group: F(2,34) = 0.99, not significant). Although the drug did not affect the number of choice omissions made (dose: F(2,58) = 1.626, not significant; dose–group: F(2,58) = 0.132, not significant), the higher dose of eticlopride included in the analysis significantly increased the number of hole omissions in both groups, although these numbers remained low (wager sensitive, 3.57 ± 0.67; wager insensitive, 2.82 ± 0.45; dose: F(2,58) = 29.143, p < 0.0001; saline vs 0.03 mg/kg eticlopride: F(1,29) = 37.679, p < 0.0001). The higher dose also decreased the number of trials completed in both groups (wager sensitive, 101.18 ± 9.11; wager insensitive, 78.4 ± 2.99; dose: F(2,60) = 24.854, p < 0.0001; saline vs 0.03 mg/kg eticlopride: F(1,30) = 31.663, p < 0.0001).

Effects of SCH 23390 administration on performance of the betting task

Lever choice.

SCH 23390 did not affect lever choice behavior in either group (Fig. 3; dose–group: F(3,90) = 0.507, not significant).

Figure 3. 

Lack of effect of the D1 receptor antagonist SCH 23390 on choice behavior. SCH 23390 did not alter preference for the uncertain lever at any bet size in either wager-sensitive (a) or wager-insensitive (b) rats. Data shown are mean ± SEM.

Other behavioral measures.

In both groups, the highest dose of SCH 23390 significantly increased the time taken to choose either lever (wager sensitive, 1.48 ± 0.04; wager insensitive, 1.53 ± 0.03; dose: F(3,90) = 4.791, p = 0.004; dose–choice–group: F(3,90) = 1.925, not significant; saline vs 0.01 mg/kg SCH 23390: F(1,30) = 13.066, p = 0.001). SCH 23390 did not affect the latency to collect reward (dose: F(3,90) = 0.216, not significant; dose–choice–group: F(3,90) = 0.406, not significant). The highest dose administered significantly increased hole omissions (wager sensitive, 2.30 ± 0.50; wager insensitive, 1.65 ± 0.28; dose: F(3,90) = 32.869, p < 0.0001; saline vs 0.01 mg/kg SCH 23390: F(1,30) = 38.63, p < 0.0001) and decreased the number of trials completed (wager sensitive, 83.7 ± 14.88; wager insensitive, 100.91 ± 5.28; dose: F(3,90) = 25.709, p < 0.0001; saline vs 0.01 mg/kg SCH 23390: F(1,30) = 25.247, p < 0.0001).

Correlations between wager sensitivity and striatal D2/3 or D1 receptor density

Nine animals were selected randomly for PET scanning. The selected group showed no difference in lever choice behavior from the rest of the group at baseline (bet size–PET group: F(2,20) = 1.336, not significant). Higher wager sensitivity correlated with lower levels of D2/3 receptor availability in the dorsal striatum (Fig. 4a; r2 = 0.483, p = 0.04). Autoradiography analysis confirmed that this reduction was caused by a selective decrease in the density of dorsal striatal D2/3 receptors (Fig. 4b; r2 = 0.601, p = 0.01), rather than enhanced DA release. Both the PET and autoradiography binding measurements were likewise strongly correlated with each other (r2 = 0.60, p = 0.02). In contrast, no significant correlations were observed between wager sensitivity and D2/3 receptor density in the nucleus accumbens, medial lateral orbitofrontal cortex, or medial cortex (r2 = 0.17, not significant; r2 = 0.12, not significant; r2 = 0.12, not significant, data not shown). Similarly there was no significant correlation between wager sensitivity and D1 receptor binding in the striatum (Fig. 5; r2 = 0.03, not significant).

Figure 4. 

Wager sensitivity correlates with striatal D2/3 receptor density. a, b, Striatal D2/3 receptor availability, measured by (a) PET as a tissue input BPND and (b) autoradiography using [11C]raclopride, predicts wager sensitivity as estimated by coefficient m (high negative values indicate high wager sensitivity). c, d, D2/3 receptor availability in a wager-insensitive animal as measured by PET and autoradiography respectively. e, f, The same data from a wager-sensitive rat. Data are shown on the same scale. The binding measurements obtained from PET and autoradiography analyses were strongly correlated (r2 = 0.60, p = 0.02).

Figure 5. 

Null relationship between the degree of wager-sensitivity and [3H]SCH 23390 binding to D1 receptors in the striatum. Wager-sensitivity could not be predicted from striatal D1 receptor binding.

Discussion

Here, animals chose between a “safe” lever which guaranteed delivery of the wager, and an “uncertain” lever which delivered double the bet size or nothing with 50:50 odds. Some rats appeared largely insensitive to bet size, maintaining a moderate preference for the uncertain option. However, others drastically shifted their preference toward guaranteed rewards as the wager increased, despite extensive training. Such a choice pattern can be considered irrational in that switching from the uncertain option did not confer any benefit.

Amphetamine increased choice of the uncertain option in these wager-sensitive rats, whereas the D2/3 antagonist eticlopride had the opposite effect in wager-insensitive animals. Such group differences in the response to dopaminergic drugs suggest that individual variation in DA signaling, particularly through D2/3 receptors, may influence the degree of wager sensitivity. PET and autoradiography analyses confirmed that higher wager sensitivity correlated with lower dorsal striatal D2/3 receptor availability and density, a pattern thought to confer vulnerability to stimulant abuse. Hence, irrational choice under uncertainty, a putative risk factor for PG, was associated with a similar biomarker as chemical dependency, perhaps indicating that susceptibility to chemical and behavioral addictions is underpinned by a common biological phenotype. It is possible that behavioral training, or the pharmacological challenges, altered D2/3 receptor levels. However, as all animals were exposed to the same drugs and testing protocol, these factors are unlikely to account for the relationship between wager sensitivity and receptor expression.

The results may seem counterintuitive; one might expect a preference for uncertainty, rather than greater wager sensitivity, to be associated with addiction vulnerability (Lane and Cherek, 2001). Indeed, preferential choice of high-risk options in tests like the Iowa Gambling Task has been observed in substance abusers, pathological gamblers, and those at-risk for addiction (Bechara et al., 2001; Goudriaan et al., 2005; Garon et al., 2006). However, in such paradigms, the “tempting” uncertain options are ultimately disadvantageous and result in less reward. Furthermore, subjects are unaware of the reinforcement contingencies at the outset, whereas the degree of uncertainty was expected in our well trained rats (for discussion, see Yu and Dayan, 2005; Platt and Huettel, 2008). Exclusive choice of either option in the rodent task also led to identical net reward over time. Hence, we could examine biases in the response to uncertainty without confounds caused by variation in learning rates, or how subjects evaluated expected differences in net gain, both of which can influence the neural circuitry involved and the degree of risk aversion observed (Yu and Dayan, 2005; Schönberg et al., 2007; Platt and Huettel, 2008). Our data therefore match clinical observations that the degree of biased decision-making under uncertainty, rather than simple preference for high risk, differentiates problem gamblers from the general population (Coventry and Brown, 1993; Michalczuk et al., 2011).

Indeed, some of our findings suggest that wager sensitivity and the preference for uncertainty are dissociable. Amphetamine increased choice of the uncertain lever across all bet sizes in wager-sensitive rats without affecting the degree of wager sensitivity. As the bet sizes are presented in random order, it is difficult to argue that this resulted from amphetamine's ability to increase perseveration (Robbins, 1976). Given that amphetamine did not alter the consistent preference for the uncertain lever in wager-insensitive rats, it is doubtful that amphetamine increased switching tendencies (Evenden and Robbins, 1985; Weiner, 1990). Baseline choice of the uncertain lever was also at 70% in this group, leaving plenty of opportunity for drugs to increase preference (St. Onge and Floresco, 2009) and making a ceiling effect unlikely. The most parsimonious conclusion is that amphetamine increased wager-sensitive rats' preference for uncertain options, replicating previous findings using a probability discounting task (St. Onge and Floresco, 2009). These data also suggest that wager-insensitive rats were less susceptible to amphetamine's effects, potentially mirroring the finding that amphetamine primes the desire to gamble in gamblers but not in healthy controls (Zack and Poulos, 2004).

It may be adaptive for animals to preferentially explore options that have less predictable outcomes to develop a better model of the environment (Pearce and Hall, 1980; Hogarth et al., 2008). When there is no cost to choosing probabilistic options, many healthy animals and humans prefer uncertain outcomes (Adriani and Laviola, 2006; Hayden et al., 2008; Hayden and Platt, 2009). Social psychology experiments suggest that, contrary to our expectations, experiencing some degree of uncertainty engenders greater feelings of happiness, again indicating we may be predisposed to favor uncertain outcomes in the absence of negative consequences (Wilson et al., 2005).

The question remains as to what governs the shift in choice seen in wager-sensitive rats. Assuming behavioral choices signify cognitive processes, numerous experiments demonstrate that rats can integrate reward delivery over time (Balleine and Dickinson, 1998). It therefore seems unlikely that wager-sensitive rats were unaware of the reinforcement contingencies in play. Impaired temporal integration should also result in constant preference for the safe option, rather than a shift toward guaranteed rewards as bet size increases. As wager-sensitive and wager-insensitive rats completed comparable numbers of trials, and exhibited similar latencies to choose a lever and collect reward, it is hard to infer that wager-sensitive animals were less able or motivated to perform the task. Likewise, these latency data do not suggest that the two groups differed in their subjective appraisal of relative reward value, although it would be useful in future to demonstrate this explicitly given the assumption that animals evaluate increases in reward value linearly.

Data suggest that, as need increases, animals switch from preferring certain/reliable options associated with constant incremental gain to uncertain/probabilistic options that lead to intermittent but larger rewards (Bateson and Kacelnik, 1995; Caraco, 1981; Schuck-Paim et al., 2004). Such shifts can be explained: the bigger reward might guarantee survival when gradual accumulation of smaller rewards would not satisfy the need in time. However, such factors cannot explain the shift toward the uncertain option as bet size decreased here. Although satiety levels probably fluctuated throughout each session, the order in which animals experienced the different bet sizes was randomized within and between daily tests. Delaying reward delivery can also decrease preference for uncertain options, as can increasing the intertrial interval (Bateson and Kacelnik, 1997; Hayden and Platt, 2007). However, reward was always delivered immediately following selection of either lever in the current experiment. Nevertheless, the intermittent reward delivery on the uncertain lever inevitably led to longer gaps between rewards. It is therefore possible that the choice pattern exhibited by wager-sensitive animals reflected a myopia for immediate rewards. Wager sensitivity could therefore contribute to poor decision-making under risk due to a short-sighted focus on immediate gains over future returns. Indeed, pathological gamblers discount delayed rewards more steeply, which correlates with the degree of cognitive distortions observed (Dixon et al., 2003; Michalczuk et al., 2011).

Wager sensitivity is somewhat reminiscent of the risk-averse arm of the framing effect, in which subjects are less likely to gamble for a bigger reward if a smaller but guaranteed gain is available (Kahneman, 2003). Risk aversion increases with the size of the wager, even though the net gain remains constant. In seeking to explain this apparent irrationality, dual-process theorists posit two decision-making modes: judgments made in the deliberative mode are effortful and require thoughtful analyses, whereas choices made in the affective mode are effortless, intuitive, and often influenced by heuristics (Osman, 2004; Evans, 2008; Strough et al., 2011). Wager-sensitive and wager-insensitive animals could therefore be approaching the task in the affective and deliberative modes respectively. However, affective choices should be quicker to enact, yet decision-making speed was equivalent across the two groups and across bet size, suggesting that animals also did not find the decision more effortful as the wager increased. The fact that rats exhibit biased decision-making under uncertainty may, nevertheless, imply a limited role for complex reasoning. Furthermore, making decisions using the framing heuristic is associated with decreased frontocortical activation and increased recruitment of the amygdala, suggesting that this irrational behavior is primarily driven by subcortical, emotional processing (De Martino et al., 2006). Decreased striatal D2/3 receptor expression is linked to hypofunction within the orbitofrontal cortex of substance abusers (Volkow and Fowler, 2000), though whether such reduced cortical activity likewise contributes to wager sensitivity remains to be determined.

Neuroimaging data indicate that decreasing DA-modulated striatal activity, via a D2 receptor antagonist, alters the representation of reward prediction errors in this region, leading to impaired value-based decision-making (Pessiglione et al., 2006). Decreased striatal activation has also been observed in problem gamblers during risk-based decision-making (Reuter et al., 2005). It is therefore conceivable that individual differences in striatal D2/3 receptor expression would mediate the behavioral effects of eticlopride and influence the degree of wager sensitivity, as observed here. Rats that make significantly more premature, or impulsive, responses in an attentional task also express fewer striatal D2/3 receptors, and develop a pattern of drug-taking that resembles addiction (Dalley et al., 2007). Although disparate cognitive processes control motor impulsivity and decision-making biases, both phenomena have been linked to addictive disorders (Verdejo-García et al., 2008; Clark, 2010), and the current data suggest that the underlying neurobiology may overlap at least at the level of the striatum. Further work is needed to explore the interdependence of these behaviors, and whether similar brain mechanisms confer vulnerability to chemical and behavioral addictions. Such information could prove invaluable when considering whether treatments will be effective in multiple addiction disorders.

Footnotes

  • Received February 7, 2012.
  • Revision received September 5, 2012.
  • Accepted September 6, 2012.
  • This work was supported by an operating grant awarded to C.A.W. from the Canadian Institutes for Health Research (CIHR), and a National Sciences and Engineering Research Council of Canada grant awarded to V.S. C.A.W. and V.S. also receive salary support through the Michael Smith Foundation for Health Research and C.A.W. through the CIHR New Investigator Award program.

  • C.A.W. has previously consulted for Theravance, a biopharmaceutical company, on an unrelated matter. The other authors declare no competing financial interests.

  • Correspondence should be addressed to Catharine A. Winstanley, Department of Psychology, University of British Columbia, 2136 West Mall, Vancouver, BC V6T 1Z4, Canada. cwinstanley@psych.ubc.ca

References


    1. Adriani W,
    2. Laviola G

    (2006) Delay aversion but preference for large and rare rewards in two choice tasks: implications for the measurement of self-control parameters. BMC Neurosci 7:52.


    1. Balleine BW,
    2. Dickinson A

    (1998) Goal-directed instrumental action: contingency and incentive learning and their cortical substrates. Neuropharmacology 37:407–419.


    1. Bateson M,
    2. Kacelnik A

    (1995) Preferences for fixed and variable food sources: variability in amount and delay. J Exp Anal Behav 63:313–329.


    1. Bateson M,
    2. Kacelnik A

    (1997) Starlings' preferences for predictable and unpredictable delays to food. Anim Behav 53:1129–1142.


    1. Bechara A,
    2. Dolan S,
    3. Denburg N,
    4. Hindes A,
    5. Anderson SW,
    6. Nathan PE

    (2001) Decision-making deficits, linked to a dysfunctional ventromedial prefrontal cortex, revealed in alcohol and stimulant abusers. Neuropsychologia 39:376–389.


    1. Brown JW,
    2. Braver TS

    (2007) Risk prediction and aversion by anterior cingulate cortex. Cogn Affect Behav Neurosci 7:266–277.


    1. Brown JW,
    2. Braver TS

    (2008) A computational model of risk, conflict, and individual difference effects in the anterior cingulate cortex. Brain Res 1202:99–108.


    1. Caraco T

    (1981) Energy budgets, risk and foraging preferences in dark-eyed juncos (Junco hyemalis) Behav Ecol Sociobiol 8:213–217.


    1. Cardinal RN,
    2. Parkinson JA,
    3. Hall J,
    4. Everitt BJ

    (2002) Emotion and motivation: the role of the amygdala, ventral striatum, and prefrontal cortex. Neurosci Biobehav Rev 26:321–352.


    1. Cardinal RN,
    2. Aitken M

    (2006) ANOVA for the behavioural sciences researcher (Lawrence Erlbaum Associates, London).


    1. Clark L

    (2010) Decision-making during gambling: an integration of cognitive and psychobiological approaches. Philos Trans R Soc Lond B Biol Sci 365:319–330.


    1. Coventry KR,
    2. Brown RI

    (1993) Sensation seeking, gambling and gambling addictions. Addiction 88:541–554.


    1. Dalley JW,
    2. Fryer TD,
    3. Brichard L,
    4. Robinson ES,
    5. Theobald DE,
    6. Lääne K,
    7. Peña Y,
    8. Murphy ER,
    9. Shah Y,
    10. Probst K,
    11. Abakumova I,
    12. Aigbirhio FI,
    13. Richards HK,
    14. Hong Y,
    15. Baron JC,
    16. Everitt BJ,
    17. Robbins TW

    (2007) Nucleus accumbens D2/3 receptors predict trait impulsivity and cocaine reinforcement. Science 315:1267–1270.


    1. Day JJ,
    2. Roitman MF,
    3. Wightman RM,
    4. Carelli RM

    (2007) Associative learning mediates dynamic shifts in dopamine signaling in the nucleus accumbens. Nat Neurosci 10:1020–1028.


    1. De Martino B,
    2. Kumaran D,
    3. Seymour B,
    4. Dolan RJ

    (2006) Frames, biases, and rational decision-making in the human brain. Science 313:684–687.


    1. Dixon MR,
    2. Marley J,
    3. Jacobs EA

    (2003) Delay discounting by pathological gamblers. J Appl Behav Anal 36:449–458.


    1. Emond MS,
    2. Marmurek HH

    (2010) Gambling related cognitions mediate the association between thinking style and problem gambling severity. J Gambl Stud 26:257–267.


    1. Evans JS

    (2008) Dual-processing accounts of reasoning, judgment, and social cognition. Annu Rev Psychol 59:255–278.


    1. Evenden JL,
    2. Robbins TW

    (1985) The effects of d-amphetamine, chlordiazepoxide and alpha-flupenthixol on food-reinforced tracking of a visual stimulus by rats. Psychopharmacology (Berl) 85:361–366.


    1. Garon N,
    2. Moore C,
    3. Waschbusch DA

    (2006) Decision making in children with ADHD only, ADHD-anxious/depressed, and control children using a child version of the Iowa Gambling Task. J Atten Disord 9:607–619.


    1. Gianotti LR,
    2. Knoch D,
    3. Faber PL,
    4. Lehmann D,
    5. Pascual-Marqui RD,
    6. Diezi C,
    7. Schoch C,
    8. Eisenegger C,
    9. Fehr E

    (2009) Tonic activity level in the right prefrontal cortex predicts individuals' risk taking. Psychol Sci 20:33–38.


    1. Goudriaan AE,
    2. Oosterlaan J,
    3. de Beurs E,
    4. van den Brink W

    (2005) Decision making in pathological gambling: a comparison between pathological gamblers, alcohol dependents, persons with Tourette syndrome, and normal controls. Brain Res Cogn Brain Res 23:137–151.


    1. Hayden BY,
    2. Platt ML

    (2007) Temporal discounting predicts risk sensitivity in rhesus macaques. Curr Biol 17:49–53.


    1. Hayden BY,
    2. Platt ML

    (2009) Gambling for Gatorade: risk-sensitive decision making for fluid rewards in humans. Anim Cogn 12:201–207.


    1. Hayden BY,
    2. Heilbronner SR,
    3. Nair AC,
    4. Platt ML

    (2008) Cognitive influences on risk-seeking by rhesus macaques. Judgm Decis Mak 3:389–395.


    1. Hogarth L,
    2. Dickinson A,
    3. Austin A,
    4. Brown C,
    5. Duka T

    (2008) Attention and expectation in human predictive learning: the role of uncertainty. Q J Exp Pscychol (Hove) 61:1658–1668.


    1. Kahneman D

    (2003) A perspective on judgment and choice: mapping bounded rationality. Am Psychol 58:697–720.


    1. Kahneman D,
    2. Tversky A

    (1979) Prospect theory: an analysis of decision under risk. Econometrica 47:263–292.


    1. Ladouceur R,
    2. Sylvain C,
    3. Boutin C,
    4. Lachance S,
    5. Doucet C,
    6. Leblond J,
    7. Jacques C

    (2001) Cognitive treatment of pathological gambling. J Nerv Ment Dis 189:774–780.


    1. Ladouceur R,
    2. Walker M

    (1996) in Trends in cognitive therapy, A cognitive perspective on gambling, ed Salkovskis PM (Wiley, Oxford), pp 89–120.


    1. Laforest R,
    2. Longford D,
    3. Siegel S,
    4. Newport DF,
    5. Yap J

    (2007) Performance evaluation of the microPET-Focus-F120. Trans Nucl Sci 54:42–49.


    1. Lane SD,
    2. Cherek DR

    (2001) Risk taking by adolescents with maladaptive behavior histories. Exp Clin Psychopharmacol 9:74–82.


    1. Logan J,
    2. Fowler JS,
    3. Volkow ND,
    4. Wang GJ,
    5. Ding YS,
    6. Alexoff DL

    (1996) Distribution volume ratios without blood sampling from graphical analysis of PET data. J Cereb Blood Flow Metab 16:834–840.


    1. Michalczuk R,
    2. Bowden-Jones H,
    3. Verdejo-Garcia A,
    4. Clark L

    (2011) Impulsivity and cognitive distortions in pathological gamblers attending the UK National Problem Gambling Clinic: a preliminary report. Psychol Med, 1–11.


    1. Miller NV,
    2. Currie SR

    (2008) A Canadian population level analysis of the roles of irrational gambling cognitions and risky gambling practices as correlates of gambling intensity and pathological gambling. J Gambl Stud 24:257–274.


    1. O'Doherty J,
    2. Dayan P,
    3. Schultz J,
    4. Deichmann R,
    5. Friston K,
    6. Dolan RJ

    (2004) Dissociable role of ventral and dorsal striatum in instrumental conditioning. Science 304:452–454.


    1. Osman M

    (2004) An evaluation of dual-process theories of reasoning. Psychon Bull Rev 11:988–1010.


    1. Pearce JM,
    2. Hall G

    (1980) A model for Pavlovian learning: variations in the effectiveness of conditioned but not unconditioned stimuli. Psychol Rev 87:532–552.


    1. Pessiglione M,
    2. Seymour B,
    3. Flandin G,
    4. Dolan RJ,
    5. Frith CD

    (2006) Dopamine-dependent prediction errors underpin reward-seeking behaviour in humans. Nature 442:1042–1045.


    1. Platt ML,
    2. Huettel SA

    (2008) Risky business: the neuroeconomics of decision making under uncertainty. Nat Neurosci 11:398–403.


    1. Reuter J,
    2. Raedler T,
    3. Rose M,
    4. Hand I,
    5. Gläscher J,
    6. Büchel C

    (2005) Pathological gambling is linked to reduced activation of the mesolimbic reward system. Nat Neurosci 8:147–148.


    1. Robbins TW

    (1976) Relationship between reward-enhancing and stereotypical effects of psychomotor stimulant drugs. Nature 264:57–59.


    1. Schönberg T,
    2. Daw ND,
    3. Joel D,
    4. O'Doherty JP

    (2007) Reinforcement learning signals in the human striatum distinguish learners from nonlearners during reward-based decision making. J Neurosci 27:12860–12867.


    1. Schuck-Paim C,
    2. Pompilio L,
    3. Kacelnik A

    (2004) State-dependent decisions cause apparent violations of rationality in animal choice. PLoS Biol 2:e402.


    1. Schultz W,
    2. Dayan P,
    3. Montague PR

    (1997) A neural substrate of prediction and reward. Science 275:1593–1599.


    1. St Onge JR,
    2. Floresco SB

    (2009) Dopaminergic regulation of risk-based decision-making. Neuropsychopharmacology 34:681–697.


    1. Strome EM,
    2. Jivan S,
    3. Doudet DJ

    (2005) Quantitative in vitro phosphor imaging using [3H] and [18F] radioligands: effects of chronic desipramine treatment on serotonin 5HT2 receptors. J Neurosci Methods 141:143–154.


    1. Strough J,
    2. Karns TE,
    3. Schlosnagle L

    (2011) Decision-making heuristics and biases across the life span. Ann N Y Acad Sci 1235:57–74.


    1. Sylvain C,
    2. Ladouceur R,
    3. Boisvert JM

    (1997) Cognitive and behavioral treatment of pathological gambling: a controlled study. J Consult Clin Psychol 65:727–732.


    1. Trepel C,
    2. Fox CR,
    3. Poldrack RA

    (2005) Prospect theory on the brain? Toward a cognitive neuroscience of decision under risk. Brain Res Cogn Brain Res 23:34–50.


    1. Verdejo-García A,
    2. Lawrence AJ,
    3. Clark L

    (2008) Impulsivity as a vulnerability marker for substance-use disorders: review of findings from high-risk research, problem gamblers and genetic association studies. Neurosci Biobehav Rev 32:777–810.


    1. Volkow ND,
    2. Fowler JS

    (2000) Addiction, a disease of compulsion and drive: involvement of the orbitofrontal cortex. Cereb Cortex 10:318–325.


    1. Weber EU,
    2. Shafir S,
    3. Blais AR

    (2004) Predicting risk sensitivity in humans and lower animals: risk as variance or coefficient of variation. Psychol Rev 111:430–445.


    1. Weiner I

    (1990) Neural substrates of latent inhibition: the switching model. Psychol Bull 108:442–461.


    1. Wilson TD,
    2. Centerbar DB,
    3. Kermer DA,
    4. Gilbert DT

    (2005) The pleasures of uncertainty: prolonging positive moods in ways people do not anticipate. J Pers Soc Psychol 88:5–21.


    1. Winstanley CA,
    2. LaPlant Q,
    3. Theobald DE,
    4. Green TA,
    5. Bachtell RK,
    6. Perrotti LI,
    7. DiLeone RJ,
    8. Russo SJ,
    9. Garth WJ,
    10. Self DW,
    11. Nestler EJ

    (2007) DeltaFosB induction in orbitofrontal cortex mediates tolerance to cocaine-induced cognitive dysfunction. J Neurosci 27:10497–10507.


    1. Winstanley CA,
    2. Zeeb FD,
    3. Bedard A,
    4. Fu K,
    5. Lai B,
    6. Steele C,
    7. Wong AC

    (2010) Dopaminergic modulation of the orbitofrontal cortex affects attention, motivation and impulsive responding in rats performing the five-choice serial reaction time task. Behav Brain Res 210:263–272.


    1. Yu AJ,
    2. Dayan P

    (2005) Uncertainty, neuromodulation, and attention. Neuron 46:681–692.


    1. Zack M,
    2. Poulos CX

    (2004) Amphetamine primes motivation to gamble and gambling-related semantic networks in problem gamblers. Neuropsychopharmacology 29:195–207.

Related Article

  • Journal Club: Gambling Rats and Gambling Addiction: Reconciling the Role of Dopamine in Irrationality 
    • Guillaume Sescousse and
    • Hanneke E.M. den Ouden

    The Journal of Neuroscience, 20 February 2013, 33(8):3256-3258; doi:10.1523/JNEUROSCI.5828-12.2013

Articles citing this article

  • Pathological Choice: The Neuroscience of Gambling and Gambling Addiction Journal of Neuroscience, 6 November 2013, 33(45):17617-17623
  • The Impact of Dopamine on Aggression: An [18F]-FDOPA PET Study in Healthy Males Journal of Neuroscience, 23 October 2013, 33(43):16889-16896
  • Highly impulsive rats: modelling an endophenotype to determine the neurobiological, genetic and environmental mechanisms of addiction Disease Models & Mechanisms, 1 March 2013, 6(2):302-311
  • Gambling Rats and Gambling Addiction: Reconciling the Role of Dopamine in Irrationality Journal of Neuroscience, 20 February 2013, 33(8):3256-3258

 

Modulation of striatal projection systems by dopamine (2011)

FULL STUDY

Annu Rev Neurosci. 2011;34:441-66. doi: 10.1146/annurev-neuro-061010-113641.

Gerfen CR, Surmeier DJ.

Source

Laboratory of Systems Neuroscience, National Institute of Mental Health, Bethesda, Maryland 20892, USA. gerfenc@mail.nih.gov

Abstract

The basal ganglia are a chain of subcortical nuclei that facilitate action selection. Two striatal projection systems--so-called direct and indirect pathways--form the functional backbone of the basal ganglia circuit. Twenty years ago, investigators proposed that the striatum's ability to use dopamine (DA) rise and fall to control action selection was due to the segregation of D(1) and D(2) DA receptors in direct- and indirect-pathway spiny projection neurons. Although this hypothesis sparked a debate, the evidence that has accumulated since then clearly supports this model. Recent advances in the means of marking neural circuits with optical or molecular reporters have revealed a clear-cut dichotomy between these two cell types at the molecular, anatomical, and physiological levels. The contrast provided by these studies has provided new insights into how the striatum responds to fluctuations in DA signaling and how diseases that alter this signaling change striatal function.

Nucleus accumbens D2 and D1 receptor expressing medium spiny neurons are selectively activated by morphine withdrawal and acute morphine, respectively (2012)

Neuropharmacology. 2012 Jun;62(8):2463-71.

Enoksson T, Bertran-Gonzalez J, Christie MJ.

Source

Brain and Mind Research Institute, The University of Sydney, NSW 2006, Australia.

Abstract

Opioids are effective analgesic agents but serious adverse effects such as tolerance and withdrawal contribute to opioid dependence and limit their use. Opioid withdrawal involves numerous brain regions and includes suppression of dopamine release and activation of neurons in the ventral striatum.

By contrast, acute opioids increase dopamine release.

Like withdrawal, acute opioids also activate neurons in the ventral striatum, suggesting that different populations of ventral striatal neurons may be activated by withdrawal and acute opioid actions.

Here, immunofluorescence for the activity-related immediate-early gene, c-Fos, was examined in transgenic reporter mouse lines by confocal microscopy to study the specific populations of ventral striatal neurons activated by morphine withdrawal and acute morphine. After chronic morphine, naloxone-precipitated withdrawal strongly increased expression of c-Fos immunoreactivity, predominantly in D2-receptor (D2R) medium-sized spiny neurons (MSNs) of the nucleus accumbens (NAc) core and shell regions. By contrast, a single injection of morphine exclusively activated c-Fos immunoreactivity in D1-receptor expressing (D1R) MSNs of the core and shell of the NAc. These results reveal a striking segregation of neuronal responses occurring in the two populations of MSNs of the NAc in response to morphine withdrawal and acute morphine.

Nucleus accumbens dopamine/glutamate interaction switches mode to generate desire versus dread: D1 alone for appetitive eating but D1 and D2 together for fear (2011)

J Neurosci. Author manuscript; available in PMC Mar 7, 2012.

Published in final edited form as:

PMCID: PMC3174486

NIHMSID: NIHMS323168

The publisher's final edited version of this article is available free at J Neurosci

See other articles in PMC that cite the published article.

Go to:

Abstract

The medial shell of nucleus accumbens (NAc) and its mesolimbic dopamine inputs mediate forms of fearful as well as of incentive motivation. For example, either appetitive and/or actively fearful behaviors are generated in a keyboard pattern by localized glutamate disruptions in NAc (via microinjection of AMPA receptor antagonist DNQX) at different anatomical locations along a rostrocaudal gradient within medial shell of rats. Rostral glutamate disruptions produce intense increases in eating, but more caudally placed disruptions produce increasingly fearful behaviors: distress vocalizations and escape attempts to human touch, and a spontaneous and directed antipredator response called defensive treading/burying. Local endogenous dopamine is required for either intense motivation to be generated by AMPA disruptions. Here we report that only endogenous local signaling at D1 dopamine receptors is needed for rostral generation of excessive eating, potentially implicating a direct output pathway contribution. By contrast, fear generation at caudal sites requires both D1 and D2 signaling simultaneously, potentially implicating an indirect output pathway contribution. Finally, when motivation valence generated by AMPA disruptions at intermediate sites was flipped by manipulating environmental ambience, from mostly appetitive in a comfortable home environment to mostly fearful in a stressful environment, the roles of local D1 versus D2 signaling in dopamine/glutamate interaction at microinjection sites also switched dynamically to match the motivation valence generated at the moment. Thus, NAc D1 and D2 receptors, and their associated neuronal circuits, play different and dynamic roles in enabling desire and dread to be generated by localized NAc glutamate disruptions in medial shell.

Introduction

Intense aberrant motivation is an important feature of psychopathological disorders, ranging from intense appetitive motivation in addiction and binge eating to more fearful paranoia in schizophrenia and anxiety disorders (Barch, 2005; Kalivas and Volkow, 2005; Howes and Kapur, 2009; Woodward et al., 2011). Both appetitive and fearful motivations involve interactions between dopamine and glutamate in overlapping mesocorticolimbic circuits that converge on nucleus accumbens (NAc) (Kelley et al., 2005; Faure et al., 2008; Meredith et al., 2008; Carlezon and Thomas, 2009; Kalivas et al., 2009; Humphries and Prescott, 2010).

NAc and dopamine-related circuits are best known for roles in appetitive motivation (Schultz, 2007; Wise, 2008), but are also implicated in some forms of aversive motivation related to fear, stress, disgust and pain (Levita et al., 2002; Salamone et al., 2005; Ventura et al., 2007; Matsumoto and Hikosaka, 2009; Zubieta and Stohler, 2009; Cabib and Puglisi-Allegra, 2011). Within medial shell of NAc, neuroanatomical coding plays an important role in determining appetitive versus fearful valence of intense motivations generated by glutamate disruptions.

Local AMPA blockade (e.g., by DNQX microinjection) produces intense eating and/or fearful reactions in an anatomical keyboard pattern along a rostrocaudal gradient (Reynolds and Berridge, 2001, 2003; Faure et al., 2008; Reynolds and Berridge, 2008). At rostral sites in medial shell, purely positive/appetitive behavior, such as intense eating, is produced by local glutamate disruptions (Maldonado-Irizarry et al., 1995; Kelley and Swanson, 1997). By contrast, as locations move caudally, disruptions generate progressively more fearful behaviors, including reactive distress vocalizations and escape dashes in response to touch, and spontaneous actively fearful behaviors such as an anti-predator response of defensive treading/burying, in which rodents use rapid forepaw movements to toss sand or bedding at a threatening stimulus (e.g., rattlesnake) (Coss and Owings, 1978; Treit et al., 1981; Reynolds and Berridge, 2001, 2003; Faure et al., 2008; Reynolds and Berridge, 2008). At intermediate sites in NAc shell, glutamate disruptions generate a mixture of both behaviors, and the dominant valence can be flexibly flipped between positive and negative by changing environmental ambience between familiar and stressful (Reynolds and Berridge, 2008).

We previously reported that endogenous dopamine activity was required locally for glutamate disruptions in NAc shell to generate feeding or fear (Faure et al., 2008). What remains unknown are the relative roles of D1-like versus D2-like dopamine receptors and their associated direct versus indirect output circuits in DNQX-generated motivations. Here we addressed these roles, and found that only D1 receptor stimulation, potentially involving the direct pathway to ventral tegmentum, was needed for glutamatergic disruptions to generate appetitive eating at rostral sites. In contrast, endogenous activity at both D1 and D2 receptors, potentially recruiting a stronger role of the indirect pathway to ventral pallidum and lateral hypothalamus, was needed for DNQX to generate fearful behavior at caudal sites. Further, we found that motivational valence trumped rostrocaudal location at flexible intermediate sites, which switched reversibly between an appetitive mode that required only D1 neurotransmission and a fearful mode that required simultaneous D1 and D2 neurotransmission.

Methods

Subjects

Male Sprague-Dawley rats (total n = 87; feeding and fear test groups, n = 51; Fos plume groups, n = 36), weighing 300 – 400 grams at surgery, were housed at ~21°C on a reverse 12:12 light:dark cycle. All rats had ad libitum access to both food and water. All of the following experimental procedures were approved by the University Committee on the Use and Care of Animals at the University of Michigan.

Cranial cannulation surgery

Rats were anesthetized with intraperitoneal injections of ketamine hydrochloride (80 mg/kg) and xylazine (5 mg/kg), and treated with atropine (0.05 mg/kg) to prevent respiratory distress, and then placed in a stereotaxic apparatus (David Kopf Instruments). The incisor bar was set at 5.0 mm above intra-aural zero, angling cannula trajectory so as to avoid penetrating the lateral ventricles. Under surgical anesthesia, rats (n=87) received bilateral implantation of permanent cranial cannulae (14 mm, 23 gauge stainless-steel) aimed at staggered points throughout the rostrocaudal extent of medial shell of NAc. Cannulae were bilaterally inserted at coordinates between anteroposterior (AP) +2.4 to +3.1, mediolateral (ML) +/−.9 to 1.0 mm, and dorsoventral (DV) −5.6 to 5.7 mm from bregma. Cannulae were anchored to the skull using surgical screws and dental acrylic. Stainless steel obturators (28 gauge) were inserted in cannulae to avoid occlusion. After surgery, each rat received subcutaneous injection of chloramphenical sodium succinate (60 mg/kg) to prevent infection and carprofen (5 mg/kg) for pain relief. Rats received carprofen again 24 hrs later, and were allowed to recover for at least 7 days before testing began.

Drugs and intracerebral microinjections

Localized glutamate disruptions in medial shell were induced before behavioral tests by bilateral microinjections of DNQX, an AMPA/kainate receptor glutamate antagonist (6,7-dinotroquinoxaline-2,3(1H,4H)-dione; Sigma, St. Louis, MO) at a dose of 450 ng/0.5 μl per side. Either DNQX or vehicle (0.5 μl per side) was microinjected alone, or in combination with a) the selective D1 antagonist SCH23390 (R(+) – 7-chloro-8-hydroxy-3-methyl1-phenyl-2,3,4,5,-tetrahydro-1H-3-benzazepine, Sigma) at a dose of 3 μg/0.5 μl per side; or b) the selective D2 antagonist raclopride (3,5-dichloro-N-{[(2S)-1-ethylpyrrolidin-2-yl]methyl}-2-hydroxy-6-methoxybenzamide) at a dose of 5 μg/0.5 μl per side, or c) both SCH23390 and raclopride. Drug doses were chosen based on Faure et al. (2008) and Reynolds and Berridge (2003). All drugs were dissolved in a vehicle of 50% DMSO mixed with 50% 0.15 M saline, and microinjected at a volume of 0.5 μl per side. The pH was normalized to 7.0 to 7.4 using HCl for both drug and vehicle microinjections. On test days, solutions were brought to room temperature (~21°C), inspected to confirm the absence of precipitation, and bilaterally infused at a speed of 0.3 μl/minute by syringe pump via PE-20 tubing through stainless-steel injectors (16 mm, 29 gauge) extending 2 mm beyond the guide cannulae to reach NAc targets. Injectors were left in place for 1 minute following microinjection to allow drug diffusion, after which obturators were replaced and rats were immediately placed in the testing chamber.

Glutamate/dopamine interaction group

Each rat tested for motivated behavior (n=23) received the following 5 drug microinjections on different days, spaced 48 hours apart, in counter-balanced order: 1) vehicle alone, 2) DNQX alone (in order to elicit motivated behavior), 3) a mixture of DNQX plus SCH23390 (D1 blockade), 4) DNQX plus raclopride (D2 blockade), and 5) DNQX plus both SCH23390 and raclopride (combined dopamine blockade) (Faure et al., 2008).

Independent dopamine blockade group

A separate group of rats (n=18) was tested for motivated behavior after receiving microinjections of dopamine antagonists alone (without DNQX), or DNQX alone, or vehicle to ensure that dopamine antagonists in NAc shell did not prevent DNQX from generating motivations by simply eliminating motoric capacity or normal motivated behavior. Use of different groups ensured that the number of microinjections any rat received was limited to 5 or 6. This dopamine antagonist group received the following 5 drug conditions: 1) vehicle, 2) SCH23390 alone, 3) raclopride alone, 4) SCH23390 plus raclopride, and 5) DNQX alone (as a positive contrast to confirm that motivated behaviors could be generated at high intensities in these rats). All drug conditions were administered in counterbalanced order within each group and tests were spaced at least 48 hours apart.

Environmental shift group

A separate environment-shift group (n=10) was used to assess whether changing the environmental ambience flexibly altered the mode of dopamine-glutamate interactions at a particular site within the intermediate two-thirds of medial shell that is capable of generating both appetitive and fearful motivations (Reynolds and Berridge, 2008). Rats in this group had microinjection cannulae aimed at intermediate rostral-caudal sites. Each rat was tested on different days in two environments: comfortable and familiar “Home” versus overstimulating and “Stressful” (described below) in counterbalanced order. Rats were tested in each environment three times, also in counterbalanced in order, after microinjections of either: 1) vehicle, 2) DNQX, or 3) DNQX plus raclopride. Thus each rat received 6 test conditions; all separated at least 48 hrs apart in balanced order.

Behavioral tests of spontaneous motivated behaviors

Following 3 days of handling, all rats tested for motivated behavior (n = 51) were habituated to the testing procedure and apparatus on 4 days for 1 hour each. On the 4th day of habituation, rats received mock microinjections of vehicle prior to entering the test chamber, in order to habituate them to the microinjection procedure. On each test day, rats received one of the drug conditions described previously and were placed immediately in the transparent testing chamber (23 × 20 × 45 cm) which contained pre-weighed food (~20g rat chow) and ad libitum water, to allow the expression of appetitive behavior. The chamber also contained granular cob bedding spread on the floor ~3 cm deep to allow the expression of defensive treading behavior. Behavior in the chamber was videorecorded for 60 minutes, to be scored later offline for analysis. At the end of each session, rats were removed by the experimenter’s gloved hand using a standardized slow-approach hand motion in order to quantify any fearful distress calls, escape attempts or defensive bites elicited by human touch. Following a ~5 second approach towards the testing cage, the experimenter slowly reached towards the rat, taking ~2 seconds. Upon contact, the experimenter lightly brushed the side of the rat with gloved fingertips, taking ~1 sec, before lifting the rat from the chamber in a gentle movement that lasted ~2 sec. The observer recorded any attempts by the rat to escape when touched, as well as bites and audible distress vocalizations.

All behavioral tests for the above groups (n = 41) were conducted in a “Standard” lab environment (Reynolds and Berridge, 2008), following a brief transport from the Home room. The Standard environment was intended to be similar to most behavioral neuroscience laboratories in lighting, sounds, and odors, and to be of relatively neutral ambience (in between positive Home and negative Stressful of the next experiment). This Standard environment consisted of a conventional laboratory testing room (daylight illumination conditions of white fluorescent light intensity 550–650 lux, ambient noise sound intensity 65 – 70 decibels) as described previously (Reynolds and Berridge, 2008).

Rats in the environmental shift group were tested in 2 environments of opposite extreme valence: 1) the “Home” environment, which consisted of normal dim red lighting (5–10 lux) and quiet levels of ambient noise (65–70 decibels, primarily rat noise and static noise from ventilation systems), as well as familiar odors and sights of the rat’s own home-room; versus 2) the “Stressful” high-intensity sensory-stimulation environment, which was conducted in the standard laboratory except that additional incandescent lamps were directed at the test chamber (1000–1300 lux within the cage) and loud, unpredictable sound was presented continuously throughout the test (raucous rock music from the continuous full-album soundtrack of “Raw Power” by Iggy & The Stooges [1973; Iggy Pop reissue 1997]; 80–86 decibels). In preference tests, rats have been shown to prefer the Home environment over the Standard and to prefer the Standard lab environment over the Stressful (Reynolds and Berridge, 2008).

Behavioral coding

The incidence of elicited fearful distress vocalizations, escape dashes, and bite attempts directed at the experimenter’s hand were scored when the rat was gently picked up at end of the test session (Reynolds and Berridge, 2003), after which total grams of chow pellets consumed were recorded. Behaviors emitted spontaneously and videotaped during the 1-hr test were subsequently scored by experimenters blind to treatment for the total cumulative duration (seconds) for each of the following: eating behavior (involving both appetitive approach and voluntary initiation of ingestion plus consummatory chewing and swallowing of food), drinking behaviors (licking from water spout), and fearful defensive treading/burying behavior (defined as active spraying or pushing of bedding with rapid alternating thrusts of the forepaws, spatially directed generally towards the brightly lit front or corners of the cage). Additionally, the number of bouts of appetitive behaviors such as food carrying and food sniffs, as well as less-valenced behaviors such as rearing, cage crosses, and grooming behavior were also recorded.

Histology

Following behavioral testing, rats were deeply anesthetized with an overdose of sodium pentobarbital. Rats in which Fos plumes were measured were perfused and brains treated as described previously (Reynolds and Berridge, 2008). These included rats behaviorally tested in the environmental shift group (n=10; which therefore received a 7th final drug or vehicle microinjection and behavioral test 90 minutes prior to perfusion) and a separate dedicated Fos group (n = 36; which were histologically assessed after just a single drug or vehicle microinjection into locations staggered throughout medial shell, administered under conditions identical to the first day of testing for behavioral rats). The purpose of the dedicated Fos group was to assess maximal local impact radius, and avoid danger of under-estimating plume size due to progressive necrosis/gliosis over a series of microinjections that might shrink a final plume. If shrinkage occurred in the behaviorally tested group, that in turn could give rise to overly precise estimates of localization of function in brain maps. This potential distortion of impact estimates by plume shrinkage was prevented in the dedicated group that received only one microinjection.

All rats used for Fos analysis were anesthetized and transcardially perfused 90 minutes after their final or sole bilateral microinjection of vehicle (n=10), DNQX alone (n=13), DNQX plus SCH23390 (n=6), DNQX plus raclopride (n=10), DNQX plus raclopride and SCH23390 (n=3) or no solution (normal, n=3). Brain slices were processed for Fos-like immunoreactivity using NDS, goat anti-cfos (Santa Cruz Biotechnology, Santa Cruz, CA) and donkey anti-goat Alexa Fluor 488 (Invitrogen, Carlsbad, CA) (Faure et al., 2008; Reynolds and Berridge, 2008). Sections were mounted, air-dried and coverslipped with ProLong Gold antifade reagent (Invitrogen). Zones where the expression of fluorescent Fos was elevated in neurons surrounding microinjection sites (“Fos plumes”) were assessed via microscope as described previously (Reynolds and Berridge, 2008).

Other brains were removed and fixed in 10% paraformaldehyde for 1–2 days and in 25% sucrose solution (0.1 M NaPB) for 3 days. For assessment of microinjection site locations in behaviorally tested rats, brains were sliced at 60 microns on a freezing microtome, mounted, air-dried and stained with cresyl violet for verification of microinjection sites. Bilateral microinjection sites for each rats were placed on coronal slices from a rat brain atlas (Paxinos and Watson, 2007), which were used to extrapolate the position of each site on one sagittal slice. Mapping in the sagittal view allows for the presentation on the same map of the entire rostrocaudal and dorsoventral extents of NAc medial shell. Functional effects on appetitive and fearful behaviors were mapped using color-coding to express the intensity of changes in motivated behaviors for individual behaviorally-tested rats. Symbols were sized to match the maximal diameter of Fos plumes measured as described below. Sites were classified as rostral shell if their NAc placements were located +1.4 to +2.6 mm ahead of bregma, and as caudal shell if their placements were located +0.4 to +1.4 mm ahead of bregma.

Statistical analysis

The effects of DNQX on parametric behaviors were assessed using a three-factor mixed within- and between-subject ANOVA (drug × group [glutamate/dopamine interaction versus independent dopamine blockade] × anatomical level [rostral versus caudal]) to verify elicitation of eating and defensive behavior along a rostrocaudal gradient. The effects of antagonism at D1-and D2-like receptors on DNQX-induced behavior was assessed using an additional two-factor mixed within- and between subject ANOVA to compare with behavior on DNQX-alone (D1 antagonism × D2 antagonism). The effects of environmental modulation were assessed using a two-factor within-subject ANOVA (environment × drug). When significant effects were found, rats were split by anatomical location and additional analysis was done using a one-way ANOVA and pairwise comparisons using Sidak corrections for multiple comparisons. For nominal data, differences between drug conditions were assessed using McNemar’s repeated- measures test.

Results

Local AMPA receptor blockade in medial shell elicits eating and defensive treading behavior in a rostrocaudal gradient

Localized glutamate disruptions in medial shell induced by microinjections of DNQX, an AMPA/kainate receptor glutamate antagonist, stimulated intense appetitive and/or fearful behaviors depending on placement along a rostrocaudal gradient as expected (Figure 1a). At rostral sites in medial shell, NAc glutamate disruptions generated robust elevations nearly 5-times over vehicle levels in amounts of eating behavior and food consumed during the 1-hr test (cumulative duration of eating: drug × site interaction, F(1,32) = 10.0, p = .003; food intake measured in grams consumed: drug × site interaction, F(1,32) = 14.5, p = .001, Figures 2a–b, ​,3a).3a). Conversely, at caudal sites in medial shell, DNQX microinjections did not elevate food intake (and in some caudal rats actually suppressed eating and food intake below control vehicle levels; Figure 2a–b), but instead generated profound elevations in the incidence of fearful distress vocalizations (Figures 2d, ​,3c;3c; 73% of rats after DNQX microinjection vs 0% after vehicle, McNemar’s test, p = .001) and of fearful escape attempts to human touch (Figures 2e, ​,3c;3c; 40% of rats after DNQX vs 0% after vehicle, McNemar’s test, p = .031). Likewise, caudal DNQX microinjections generated nearly 10-fold increases in the spontaneous emission of defensive treading-burying behavior over vehicle control levels (Figures 2c, ​,3b;3b; drug × site interaction in cumulative duration of treading, F(1,32) = 6.9, p = .013, Figure 1a). Defensive treading typically was not diffuse or random, but rather was directionally focused on a particular target: usually towards the transparent front of the cage (beyond which objects and people in the room could be seen) and towards light-reflecting front corners of the transparent plastic chamber.

Figure 1 
Summary maps of behavior and Fos plume analysis
Figure 2 
Motivated behavior summary graphs
Figure 3 
Effects of D1 and D2 antagonism on DNQX-induced eating and defensive fearful behaviors

D1 dopamine receptor transmission alone needed for DNQX to generate appetitive behaviors at rostral sites

A novel finding here was that endogenous local dopamine stimulation was needed only at D1-like (D1, D5) receptors around the microinjection site in rostral shell for the generation of intense appetitive behavior by DNQX microinjections. Rostral D2-like receptors (D2, D3, D4) appeared essentially irrelevant to glutamate-related amplification of eating behavior and food intake (Figures 13). That is, when the dopamine D1-antagonist, SCH23390, was added to the rostral DNQX microinjection, the D1 blockade abolished the ability of DNQX to increase time spent eating or food intake, leaving eating behavior and intake at control levels seen after vehicle microinjections (Figures 2a–b and ​and3a,3a, eating: SCH23390, F(1,7) = 13.3, p = .008; Figure 2b, grams intake: SCH23390, F(1,7) = 11.1, p = .010).

By contrast, combining the D2-like antagonist raclopride with DNQX microinjection for rostral sites failed to prevent or even impair the DNQX-enhancement of eating (cumulative duration; Figures 2a–b and ​and3a,3a, raclopride, F(1,8) < 1, p = .743) or food intake (grams consumed; Figure 2b, raclopride, F(1,8) < 1, p = .517). Quite the opposite, at least at caudal shell sites, adding the D2 antagonist allowed caudal DNQX to further increase time spent eating to even higher levels that were 245% above vehicle, or 156% above eating levels produced by DNQX alone (Figures 2a, ​,3a;3a; DNQX stimulation of eating at caudal sites was usually low due to the rostrocaudal gradient: average of 566 sec +/− 101 sec on DNQX plus raclopride versus 362 sec on DNQX alone and 230 sec on vehicle; raclopride × DNQX, F(1,10) = 6.0, p = 0.035). A slight caveat to this additional enhancement is that adding the D2 antagonist did not actually boost the physical amount of food consumed for this group, even though it nearly doubled the proportion of time during the trial in which rats ate (Figure 2b, raclopride, F(1,11) < 1, p = .930; however, we note that raclopride did boost stimulation of food consumption as well as of eating behavior for caudal DNQX microinjections in a separate experiment tested below (in tests conducted in a more stressful environment).

As expected, combining both the D1 antagonist and the D2 antagonist together with DNQX completely prevented DNQX from enhancing eating (similar to D1 antagonist above), and kept levels of intake equivalent to vehicle baseline levels (Figure 2a–b; versus vehicle: grams intake, F(1,7) < 1, p = .973; eating, F(1,7) = 1.1, p = .322). However, the D1–D2 mixture of antagonists was no more effective than adding just the D1 antagonist alone to DNQX, which also completely prevented appetitive increases (Figure 2a; eating, SCH23390 plus raclopride versus SCH23390 alone, F<1, p = 1.000). In short, we conclude that only local endogenous D1 receptor neurotransmission is needed to enable glutamate disruptions in rostral sites of medial shell to stimulate appetitive behavior and food intake. By contrast, local D2 receptor neurotransmission is essentially irrelevant to rostral eating stimulation, being neither necessary nor even contributing additively in any detectable way (and possibly even inhibiting the stimulation of eating at caudal sites, perhaps via generation of fearful reactions as described below that could compete with or suppress appetitive eating).

Ruling out general suppression of appetitive/fearful behavior by dopamine antagonists

Finally, the prevention of DNQX-induced increases in food intake or eating by D1 receptor blockade appeared to reflect a specific interaction of dopamine receptors with glutamate disruptions rather than a general independent suppression of eating motivation or capacity induced by dopamine blockade. Neither microinjections of the D1 antagonist by itself (without DNQX) nor of the D2 antagonist by itself (without DNQX) suppressed baseline levels of eating below control vehicle levels of about 1 gram of chow per session (eating: SCH23390, F(1,14) = 1.9, p = .194, 149 sec +/− 52 SEM on SCH23390 versus 166 sec +/− 54 SEM on vehicle; raclopride: F(1,14) < 1, p = .389, 227 sec +/− 56 SEM; grams intake: SCH23390, F(1,14) < 1, p = .514, 1.15 grams +/− .36 SEM on SCH23390 versus .94 grams +/− .23 SEM on vehicle; raclopride, F(1,14) = 3.9, p = .068, 1.82 grams +/− .42 SEM). Thus local dopamine blockade in NAc at these doses did not impair either normal levels of motivation to eat or the motor capacity for ingestive movements. Instead our results seem to reflect a specific role of D1 receptor dopamine signals in enabling local AMPA receptor glutamate disruptions in rostral shell to stimulate eating behavior to high levels.

Fearful behaviors elicited by local glutamate disruption depend on concurrent local D1 and D2 receptor stimulation from endogenous dopamine

By contrast, simultaneous endogenous signaling at both D1 and D2 receptors in caudal sites of medial shell appeared necessary for DNQX microinjection to generate intense fearful behaviors (Figures 13). Mixing either the D1 antagonist or the D2 antagonist with DNQX effectively prevented the production of any defensive treading at caudal sites, as well as the generation of any distress calls or escape reactions to human touch that otherwise were potentiated by DNQX microinjections (Figures 2c–e, 3b–c; defensive treading: SCH23390, F(1,10) = 7.1, p = 0.024, raclopride, F(1,10) = 5.4, p = 0.043; escape attempts & jumps: DNQX alone: 40% of rats, DNQX plus SCH23390: 0%, p = 0.031 [compared to DNQX, McNemar’s test], DNQX plus raclopride: 13%, p = .219; distress calls: DNQX alone: 73% of rats, DNQX plus SCH23390: 13% of rats, p = .012, DNQX plus raclopride: 20% of rats, p = .008). In short, all fearful behaviors remained at near-zero control levels when either dopamine antagonist was mixed with DNQX.

Ruling out general suppression by dopamine antagonist microinjections

Again, D1 and D2 receptor contributions to DNQX fear induction appeared to reflect a specific interaction of these dopamine receptors with the glutamate disruption in caudal shell, because giving microinjections of either or both dopamine antagonists in the absence of DNQX did not change defensive treading from vehicle baseline levels (treading: SCH23390, F(1,14) < 1, p = .913; raclopride, F(1,14) < 1, p = .476). However, it must be noted that vehicle levels of fearful behaviors were near zero already, raising the possibility that a floor effect could have obscured a general suppression of fearful behavior by dopamine blockade. Therefore we turn to other evidence, which also suggests that dopamine antagonist microinjections, either with DNQX or by themselves, did not generally prevent most behaviors. For example, grooming, a nonvalenced behavior that was emitted at substantial rates after vehicle, remained unsuppressed by local blockade of D1 or D2 receptors. Dopamine antagonists alone did not suppress spontaneous grooming (average of 9.33 +/− 1.35 bouts on vehicle versus 8.09 +/− 1.13 on SCH23390 and 8.40 +/− 1.22 on raclopride; F<1). Likewise, adding dopamine antagonists to DNQX did not suppress grooming behavior (F<1). Microinjections of the dopamine antagonists alone did moderately suppress locomotion expressed as rears and cage crosses by about 50% from vehicle levels, though this suppression was nowhere near as strong as the abolition of DNQX-induced elevations of eating or fearful defensive treading described above (rears: SCH23390, F(1,13) = 17.6, p = .001, raclopride, F(1,13) = 9.8, p = .008; cage crosses: SCH23390, F(1,13) = 19.3, p < .001, raclopride, F(1,13) = 13.1, p = .002). Further, DNQX microinjections stimulated locomotion to double or triple vehicle levels, and adding SCH23390 or raclopride to the DNQX microinjection did not prevent that rise in cage crosses and rears (main effect of DNQX: cage crosses, F(1,33) = 12.0, p = .002; rears, F(1,33) = 6.8, p = .014; SCH23390: F<1 for rears and cage crosses; raclopride: cage crosses, F(1,19) = 2.2, p = .154; rears, F(1,19) = 3.2, p = .091). Thus general suppression effects of dopamine antagonists were either missing or minimal, and did not appear sufficient to account for the abolition of DNQX-stimulated motivated behaviors described above.

Local mode of dopamine-glutamate interaction switches flexibly as ambience reverses motivation valence

Environmental ambience flips motivational valence

As expected, for most sites in the intermediate two-thirds of medial shell (i.e., all sites between far rostral 20% and far caudal 20%), changing environmental ambience from dark, quiet and familiar (similar to rats’ home-room) to stressfully bright and noisy (extra light and raucous music) reversed the valence of motivated behavior generated by DNQX microinjections (Reynolds and Berridge, 2008) (Figure 4). Rats emitted almost exclusively appetitive behavior in the Home environment after DNQX microinjections, but emitted substantial amounts of fearful behaviors as well when tested in the Stressful environment after DNQX at the same NAc sites. The familiar, low-stimulation and presumably comfortable conditions of the Home environment (which rats have been shown to prefer to standard lab illumination condition; Reynolds and Berridge, 2008) caused the appetitive-stimulating zone within NAc to expand from rostral sites and invade caudal sites of medial shell as well, so that 90% of all medial shell locations generated intense eating behavior and food intake (greater than 200% of vehicle; Figure 4a). Concomitantly, the Home environment virtually eliminated DNQX-induction of fearful behaviors, such as distress vocalizations, escape attempts or defensive treading (Figure 4a–b; treading, DNQX, F(1,7) = 3.5, p = .102; drug × site interaction, F(1,7) < 1, p = .476). Consequently, the size of the fear-inducing zone severely shrank in the Home environment, leaving most mid-caudal sites unable to generate fearful reactions. Thus only one rat (which had the farthest caudal shell site) displayed more than 20 seconds of defensive treading in the Home environment, or emitted a distress vocalization when touched after the test (Figure 4b).

Figure 4 
Environmental ambience shifts glutamate-dopamine interaction mode

In contrast, the loud and bright Stressful environment (which rats avoid over lab conditions and quickly learn to turn off when given the opportunity; Reynolds and Berridge, 2008) expanded the caudal fear-inducing zone to include substantial mid-rostral areas of medial shell, and increased the levels of defensive treading stimulated by DNQX to over 600% the corresponding levels induced in the Home environment (Figure 4b; DNQX, F(1,7) = 23.8, p = .002; site × drug interaction, F(1,7) < 1, p = .429). Similarly, the Stressful environment increased the incidence of distress vocalizations generated after DNQX when the rats were touched by the experimenter at the end of the session by five-fold compared to the Home environment (Figure 4d; 50% of rats versus 10% at Home; McNemar’s test, p = .063). Conversely, the Stressful environment eliminated pure appetitive sites in the mid rostrocaudal zone, converting them into either mixed valence or purely fearful sites (Figure 4c). The Stressful environment also reduced the intensity of appetitive behaviors induced by DNQX at midrostral sites to approximately 50% of Home levels, even for sites that still generated any eating (average of 507 sec +/− 142 SEM in the Stressful Environment versus 879 sec +/− 87 SEM in the Home Environment; drug × environment interaction, eating, F(1,7) = 6.0, p = .044; food intake, F(1,7) = 2.9, p = .013).

Fearful mode requires D2 receptor involvement, but appetitive mode does not

The most important novel finding here was that D1/D2 receptor requirements for endogenous dopamine stimulation at a given site dynamically changed with environmental ambience shifts in a manner tied to motivational valence generated by DNQX at the moment rather than to rostrocaudal location per se. Each DNQX site had two modes: appetitive and fearful, depending on external ambience of the moment. The appetitive mode (i.e. DNQX-stimulation of eating induced by the dark, quiet and familiar Home environment) did not require D2 receptor activation to enhance eating, whereas the fearful mode (i.e. DNQX-stimulation of defensive treading behavior and distress vocalizations induced by the loud and bright Stressful environment) always required D2 receptor activation for every site to stimulate fear, regardless of rostrocaudal location (just as caudal sites had required D2 for DNQX generation of fear in the previous experiment) (Figure 4). Flips in valence mode, between appetitive and defensive, occurred for 90% of sites tested, which comprised nearly all possible intermediate rostrocaudal locations in medial shell. For the remaining 10% of sites (n = 1), DNQX microinjected into far caudal shell always generated fearful behaviors in both environments (and fearful behaviors were always eliminated by D2 blockade).

More specifically, adding the D2 antagonist to DNQX microinjection completely blocked distress calls and defensive treading behavior at all sites that otherwise generated fear after DNQX in the Stressful environment (Figure 4; rostral sites, raclopride, F(1,4) = 19.9, p = .021, all rats, raclopride, F(1,7) = 10.7, p = .022, site × drug interaction, F(1,7) < 1, p = .730). However, the D2 antagonist never blocked or suppressed eating behavior (i.e., appetitive motivation) generated at the same sites by DNQX in the Home environment; in fact, adding the D2 antagonist actually enhanced the levels of eating behavior generated by DNQX in the Stressful environment to 463% of vehicle levels and 140% of levels on DNQX alone for the same sites (Figure 4c; average of 712 sec +/− 178 SEM on DNQX plus raclopride versus 507 sec on DNQX alone and 153 sec on vehicle). In the Stressful environment, D2 blockade magnified DNQX-stimulation of eating and increased grams of food consumed, regardless of rostrocaudal location (within the intermediate zone), confirming that local D2 neurotransmission is not only unnecessary for eating enhancement but actually can oppose the generation of intense eating by local AMPA receptor blockade in medial shell (eating, raclopride, F(1,7) = 18.5, p = .008; site × drug interaction, F(1,7) < 1, p = .651; food intake, raclopride, F(1,7) = 5.6, p = .064, site × drug interaction, F(1,6) = 2.5, p = .163). While in the Standard environment D2 blockade disinhibited DNQX-eating only in caudal shell (Figure 2a), the Stressful environment expanded the fear generating zone and likewise expanded the zone in which D2-blockade disinhibits DNQX-eating to include mid-rostral zones of medial shell (Figure 4c; eating, raclopride × environment × site interaction, F(1,25) = 6.2, p = .020).

Dopamine receptor roles flip reversibly between multiple transitions

In rats that displayed ambivalent (both) motivations in the Stressful environment (60% of rats), DNQX-induced eating peaked in the first 15 minutes, while defensive treading peaked later in the trial (30 – 45 minutes after the microinjection, Figure 5a). During the 20 minutes period of maximal overlap between appetitive and defensive behavior (minutes 10 – 30), most rats transitioned from appetitive to defensive only once (16%) or 2 to 6 times (50%). With relatively few transitions during the hour, any single minute was likely to consist of pure rather than mixed motivated behaviors (Figure 5b), consistent with previous reports (Reynolds and Berridge, 2008). Dopamine D2 receptor blockade did not block eating behavior (which dominated in the first 20 minutes of the session), but effectively blocked defensive treading behavior (which dominated in the final 20 minutes).

Figure 5 
Appetitive and defensive behavior elicited from mixed valence sites in the Stressful environment

However, two rats stood out as especially ambivalent, transitioning between appetitive and defensive behavior more than 25 times each within the hour after pure DNQX microinjections in the Stressful environment. This represented the closest approach to simultaneous display of opposite motivations that we observed. Even in these rats, however, D2 receptor blockade consistently blocked only defensive behavior emitted under the loud and bright conditions, and never appetitive behavior (in either Stressful or Home environments) (example rat, Figure 5c) which continued to occur at similar levels and time points after DNQX plus D2 antagonist microinjection as after pure DNQX in the corresponding environment. Thus motivated behavior produced by dopamine-glutamate interactions appeared to be able shift rapidly and repeatedly between appetitive and fearful modes. When environmental conditions fostered ambivalence in a susceptible individual, a site could flip valence modes more than 20 times in a single hour.

Fos plume analysis: defining size of microinjection local impact

Localization of function was aided by assessing the extent of local impact of drug microinjections on nearby tissue, as reflected in Fos plumes around the microinjection center (Figure 1b). Rats used previously for behavioral testing in the environmental shift group were assessed for Fos plumes after the end of the experiment. However, as anticipated, we confirmed that rats that had already completed behavioral testing had shrunken Fos plumes compared to the dedicated Fos group that received only a single microinjection, indicating that DNQX-induced plumes from rats that received 6 previous microinjections no longer represent the maximal impact radius of drug spread. DNQX produced plumes in the dedicated Fos group that were nearly 4 times larger in volume (nearly 2 times larger in radius) than in the previously behaviorally-tested group (F(9,90) = 3.3, p < .002). Therefore, when mapping functional drug spread in all figures, we relied on plume radius data from the dedicated Fos group (matched to initial behavioral test conditions) to avoid underestimation when assessing the maximal spread of local impact for microinjections, and to construct plume maps for localization of function. However, all other data besides plume radii shown in maps were obtained exclusively from the behaviorally-tested group (i.e., colors and bar graphs reflecting intensities of eating and fearful behaviors induced at particular sites).

Pure DNQX microinjections produced plume centers of double the intensity of vehicle-level Fos expression, in a small volume of 0.02 mm3 for the dedicated Fos group (Figure 1b, top middle; radius = 0.18 +/− 0.04 mm SEM). Rats that had received 6 previous microinjections had an even smaller volume center of 0.004 mm3 (radius = 0.1 mm). Surrounding plume centers, Fos expression in the maximal group had a larger halo of 0.23 mm3 volume of milder elevation >1.5 times vehicle levels (radius = 0.38 +/− 0.05 mm SEM; rats previously tested 6 times had smaller outer halos of 0.05 mm3 volume, radius = .23 mm). Addition of the D1 antagonist (SCH23390) shrank plumes and attenuated the intensity of DNQX-induced elevations in local Fos expression (Figure 1b, bottom middle; DNQX versus DNQX plus SCH23390, Post hoc pairwise comparison with Sidak corrections, p < 0.01). SCH23390 shrank the total volume of DNQX Fos plumes to less than 0.18mm3 (outer halo radius = 0.35 +/− 0.05 mm SEM). By contrast, addition of the D2 antagonist (raclopride) expanded intense centers of Fos expression and enhanced DNQX-induced elevation in local Fos expression (Figure 1b, bottom left; DNQX versus DNQX plus raclopride, Post hoc pairwise comparisons with Sidak corrections, p < 0.05). Raclopride expanded the inner center of doubled Fos expression produced by DNQX to a volume of 0.15 mm3 (radius = .33 +/− 0.042 mm SEM), and left unchanged the radius and intensity of the outer plume halo (of 1.5x expression). We note that the D1 antagonist apparently predominates over the D2 antagonist in effects on local Fos when both are microinjected jointly with DNQX, as DNQX Fos plumes shrink following the addition of combined D1 and D2 antagonists (Faure et al., 2008).

Discussion

In rostral shell, only endogenous dopamine signaling at D1-like receptors was needed for DNQX microinjections to stimulate 5-fold increases in eating. By contrast, in caudal shell, simultaneous signaling at D1- and D2-like receptors was needed for DNQX to generate 10-times increases in fearful reactions (distress calls, escape attempts and active defensive treading directed at objects in cage or beyond). Yet, rostral sites in medial shell were not simply D1 dominant nor were caudal sites D1–D2 co-dominant for generation of motivations by glutamate disruptions. Most intermediate sites in shell switched flexibly between generating appetitive and fearful motivations when environmental ambience changed. For those sites, D2 activity was always required for fear generation by DNQX microinjection (in the stressful environment) but never required for appetitive generation of eating (in the familiar home environment). Not only was D2 signaling unnecessary, D2 receptor blockade actually disinhibited DNQX-stimulation of eating at sites when placement/environment combination otherwise facilitated fear. In short, rostrocaudal placement strongly biases the valence of motivational salience produced by glutamatergic disruptions, but dopamine interaction modes are more closely tied to appetitive/fearful valence generated at a given moment than to location per se (Reynolds and Berridge, 2008).

Mechanism of interaction between dopamine and glutamate blockade

The precise mechanism of NAc dopamine-glutamate interaction in generating intense incentive salience versus fearful salience remains a puzzle. Purely speculatively, we offer several possibilities. In the absence of glutamatergic input during AMPA blockade, NAc neurons reduce already low rates of firing, become hyperpolarized, and possibly disinhibit downstream targets in ventral pallidum (VP), lateral hypothalamus (LH) and ventral tegmentum (VTA) to stimulate motivated behaviors (Taber and Fibiger, 1997; Kelley, 1999; Meredith et al., 2008; Roitman et al., 2008; Krause et al., 2010). However, if dopamine primarily modulates glutamatergic depolarizations (Calabresi et al., 1997) then dopamine might be viewed as largely irrelevant to such hyperpolarizations.

Still, one possibility is that D2 receptor activation attenuates remaining excitatory AMPA postsynaptic impact (Cepeda et al., 1993), and so D2 blockade might prevent AMPA attenuation, disrupting local hyperpolarizations. Alternatively, D1-receptor activation may facilitate hyperpolarization in relatively inhibited neurons (Higashi et al., 1989; Pennartz et al., 1992; Moyer et al., 2007; Surmeier et al., 2007), and so D1 blockade might likewise disrupt those hyperpolarizations. Presynaptic mechanisms might also contribute, based on potential suppression of glutamate release by NAc D1 receptor activation on hippocampal or amygdala terminals, and similar presynaptic D2 suppression at prefrontal terminals (Pennartz et al., 1992; Nicola et al., 1996; Charara and Grace, 2003; Bamford et al., 2004). Presynaptic dopamine blockade might disrupt such suppressions, and consequently increase glutamate release, potentially overcoming DNQX effects.

A remaining class of explanation could involve more subtle dopamine/glutamate interaction. For example, DNQX microinjections might shift AMPA/NMDA activation ratios towards NMDA, potentially relevant if NMDA receptors provide current contributions in the absence of AMPA currents (Cull-Candy and Leszkiewicz, 2004; Hull et al., 2009). Additionally, DNQX-induced local hyperpolarization may, via GABAergic connections between neighbors, laterally disinhibit surrounding neurons (Mao and Massaquoi, 2007; Faure et al., 2008 ; Tepper et al., 2008). Dopamine blockade could counteract both of these effects by disrupting both NMDA-mediated currents (Cepeda et al., 1993; Surmeier et al., 2007; Sun et al., 2008) and lateral inhibition (Taverna et al., 2005; Grace et al., 2007; Moyer et al., 2007; Nicola, 2007). The actual roles of these or other mechanisms in generating these phenomena will need future clarification.

Direct and indirect output pathways in D1 and D2 dependent motivation

Direct and indirect pathways from shell may differentially contribute to incentive versus aversive motivation (Hikida et al., 2010). In general for striatum, D2-expressing outputs travel chiefly via the indirect pathway, and D1-expressing outputs travel via the direct pathway (Gerfen and Young, 1988; Gerfen et al., 1990; Bertran-Gonzalez et al., 2008; Matamales et al., 2009). For NAc medial shell in particular, D1-expressing neurons similarly constitute the direct output pathway to VTA, whereas equal populations of D1 and D2-dominant neurons project along the indirect pathway to VP and LH (Figure 6) (Haber et al., 1985; Heimer et al., 1991; Lu et al., 1998; Zhou et al., 2003; Humphries and Prescott, 2010). Additionally, 15% – 30% of shell neurons, likely projecting along the indirect pathway, co-express both D1 and D2 receptors, which sometimes form a conjoined heteromer (Humphries and Prescott, 2010; Perreault et al., 2010; Perreault et al., 2011). Speculatively, the importance of D1 receptors in enabling glutamate disruptions to generate appetitive behavior might reflect a primacy of the direct pathway from NAc to VTA. In contrast, the need for D1 and D2 co-activation for DNQX-fear generation might highlight a greater contribution of the indirect pathway.

Figure 6 
Mesocorticolimbic circuits impacted by glutamate-dopamine interactions

Valence mode shifts and rostrocaudal biases: Mesocorticolimbic circuits

Shifts between familiar and stressful environmental ambience modulate mesocorticolimbic circuits, likely altering glutamatergic inputs to NAc from prefrontal cortex, basolateral amygdala (BLA), hippocampus and thalamus (Swanson, 2005; Zahm, 2006; Belujon and Grace, 2008), which may interact with D1/D2 dopamine signals. For example, after theta burst firing from the BLA, rostral shell neurons can show decreased responsiveness to subsequent BLA stimulations, whereas neurons in caudal shell are more likely to increase subsequent firing to the same BLA stimulations, a difference which requires D2 receptors and which might modulate the size of appetitive vs. fear-generation zones within medial shell (Gill and Grace, 2011). Particular features of mesocorticolimbic inputs may also be important for the shell’s intrinsic rostrocaudal gradient. For instance, norepinephrine from hindbrain is released chiefly in caudal regions of shell, facilitated by dopamine D1 stimulation but inhibited by D2, and might help modulate motivation valence (Berridge et al., 1997; Delfs et al., 1998; Vanderschuren et al., 1999; Schroeter et al., 2000; Park et al., 2010). Finally, point-to-point corticolimbic targeting from prefrontal cortex zones to subregions of medial shell, VP/LH and their downstream targets, permit multiple segregated loops to travel through mesocorticolimbic circuits (Thompson and Swanson, 2010), which could further contribute to localization of desire and dread generators.

Caveats regarding D1 and D2 receptors in motivated behavior

We believe our findings do not necessarily conflict with others’ reports of D2/D3 involvement in incentive motivation (Bachtell et al., 2005; Bari and Pierce, 2005; Xi et al., 2006; Heidbreder et al., 2007; Gardner, 2008; Khaled et al., 2010; Song et al., 2011). As caveat, we note our findings are strictly limited to mechanisms that simultaneously involve: a) glutamate-dopamine interactions, b) within NAc medial shell, that c) generate intense elevation of appetitive/fearful motivations. Although our conclusions are consistent with reports that D1 (but not D2) blockade in NAc shell prevents appetitive VTA-stimulated eating (MacDonald et al., 2004) and prevents appetitive self-stimulation via optogenetic activation of glutamatergic amygdala-NAc projections (Stuber et al., 2011), as well as reports that D2 signaling contributes to active defensive behaviors (Filibeck et al., 1988; Puglisi-Allegra and Cabib, 1988), our results do not preclude other roles for D2/D3 receptors in generating appetitive motivation in different situations. In particular, we do not contradict appetitive roles produced in different brain structures, involving different reactions (e.g., learned rather than unconditioned) or that involve deficits below normal levels of motivation. Understanding dopamine receptor roles in generating motivations will eventually require integration of all relevant facts.

GABA and metabotropic glutamate generation of motivated behavior

We suggest that rostral dopamine/glutamate interactions here generated positive incentive salience, making food perceived as more attractive to eat. By contrast, caudal or negatively-valenced interactions generated fearful salience, making objects and experimenter perceived as threatening. We previously reported metabotropic glutamate blockade at sites throughout medial shell to generate fear and disgust (Richard and Berridge, 2011), and reported local GABAergic hyperpolarizations to generate rostrocaudal gradients of feeding and fear, similar to the keyboard pattern described here (Reynolds and Berridge, 2001; Faure et al., 2010). However, we do not suggest that the dopamine interactions with ionotropic glutamatergic disruptions identified here necessarily apply to metabotropic or to GABAergic NAc mechanisms of motivation. Dopamine involvement in those remains an open question. There are several neuronal differences (e.g., direct GABAergic hyperpolarizations of neurons versus glutamate blockade-mediated hyperpolarization) and functional differences (e.g., shifts in hedonic impact versus induction of motivated behavior) that could prove important.

Implications for psychopathology

Corticolimbic dopamine-glutamate interactions have been linked to both intense incentive salience and fearful salience, contributing to appetitive motivation in addiction and to intense fearful motivation in psychotic paranoia (Wang and McGinty, 1999; Barch, 2005; Taylor et al., 2005; Lapish et al., 2006; Faure et al., 2008; Jensen et al., 2008; Kalivas et al., 2009). Flips in the valence of pathologically intense motivational salience also can occur (Morrow et al., 2011). Amphetamine addicts can experience fearful “amphetamine psychosis” similar to paranoia, which may involve pathological exaggerations of fearful salience (Featherstone et al., 2007; Jensen et al., 2008; Howes and Kapur, 2009). Conversely, some schizophrenic patients exhibit higher brain activations that encode appetitive incentive salience (Elman et al., 2006; Diaconescu et al., 2011). Overall, understanding how glutamate-dopamine interactions within NAc shell create intense appetitive and/or fearful motivations may illuminate the mechanisms underlying such intense but opposite disorders of motivation.

Acknowledgments

This research was supported by National Institutes of Health Grants (DA015188 and MH63649 to KCB) and by a National Research Service Award fellowship to JMR (MH090602). We thank Stephen Burwell and Andy Deneen for assistance with histology, and Brandon Aragona, Geoffrey Murphy, Joshua Berke, and Benjamin Saunders for helpful comments and discussion.

References

  • Bachtell RK, Whisler K, Karanian D, Self DW. Effects of intra-nucleus accumbens shell administration of dopamine agonists and antagonists on cocaine-taking and cocaine-seeking behaviors in the rat. Psychopharmacology (Berl) 2005;183:41–53. [PubMed]
  • Bamford NS, Zhang H, Schmitz Y, Wu NP, Cepeda C, Levine MS, Schmauss C, Zakharenko SS, Zablow L, Sulzer D. Heterosynaptic dopamine neurotransmission selects sets of corticostriatal terminals. Neuron. 2004;42:653–663. [PubMed]
  • Barch DM. The relationships among cognition, motivation, and emotion in schizophrenia: how much and how little we know. Schizophr Bull. 2005;31:875–881. [PubMed]
  • Bari AA, Pierce RC. D1-like and D2 dopamine receptor antagonists administered into the shell subregion of the rat nucleus accumbens decrease cocaine, but not food, reinforcement. Neuroscience. 2005;135:959–968. [PubMed]
  • Belujon P, Grace AA. Critical Role of the Prefrontal Cortex in the Regulation of Hippocampus-Accumbens Information Flow. J Neurosci. 2008;28:9797–9805. [PMC free article] [PubMed]
  • Berridge CW, Stratford TL, Foote SL, Kelley AE. Distribution of dopamine beta-hydroxylase-like immunoreactive fibers within the shell subregion of the nucleus accumbens. Synapse. 1997;27:230–241. [PubMed]
  • Bertran-Gonzalez J, Bosch C, Maroteaux M, Matamales M, Herve D, Valjent E, Girault JA. Opposing patterns of signaling activation in dopamine D1 and D2 receptor-expressing striatal neurons in response to cocaine and haloperidol. J Neurosci. 2008;28:5671–5685. [PubMed]
  • Cabib S, Puglisi-Allegra S. The mesoaccumbens dopamine in coping with stress. Neurosci Biobehav Rev 2011 [PubMed]
  • Calabresi P, Pisani A, Centonze D, Bernardi G. Synaptic plasticity and physiological interactions between dopamine and glutamate in the striatum. Neurosci Biobehav Rev. 1997;21:519–523. [PubMed]
  • Carlezon WA, Thomas MJ. Biological substrates of reward and aversion: A nucleus accumbens activity hypothesis. Neuropharmacology. 2009;56:122–132. [PMC free article] [PubMed]
  • Cepeda C, Buchwald NA, Levine MS. Neuromodulatory actions of dopamine in the neostriatum are dependent upon the excitatory amino acid receptor subtypes activated. Proc Natl Acad Sci U S A. 1993;90:9576–9580. [PMC free article] [PubMed]
  • Charara A, Grace AA. Dopamine receptor subtypes selectively modulate excitatory afferents from the hippocampus and amygdala to rat nucleus accumbens neurons. Neuropsychopharmacology. 2003;28:1412–1421. [PubMed]
  • Coss RG, Owings DH. Snake-Directed Behavior By Snake Naive and Experienced California Ground Squirrels in a Simulated Burrow. Zeitschrift Fur Tierpsychologie-Journal of Comparative Ethology. 1978;48:421–435.
  • Cull-Candy SG, Leszkiewicz DN. Role of distinct NMDA receptor subtypes at central synapses. Sci STKE. 2004;2004:re16. [PubMed]
  • Delfs JM, Zhu Y, Druhan JP, Aston-Jones GS. Origin of noradrenergic afferents to the shell subregion of the nucleus accumbens: anterograde and retrograde tract-tracing studies in the rat. Brain Res. 1998;806:127–140. [PubMed]
  • Diaconescu AO, Jensen J, Wang H, Willeit M, Menon M, Kapur S, McIntosh AR. Aberrant effective connectivity in schizophrenia patients during appetitive conditioning. Front Hum Neurosci. 2011;4:239. [PMC free article] [PubMed]
  • Elman I, Borsook D, Lukas SE. Food intake and reward mechanisms in patients with schizophrenia: implications for metabolic disturbances and treatment with second-generation antipsychotic agents. Neuropsychopharmacology. 2006;31:2091–2120. [PubMed]
  • Faure A, Richard JM, Berridge KC. Desire and dread from the nucleus accumbens: Cortical glutamate and subcortical GABA differentially generate motivation and hedonic impact in the rat. PloS one. 2010;5:e11223. [PMC free article] [PubMed]
  • Faure A, Reynolds SM, Richard JM, Berridge KC. Mesolimbic dopamine in desire and dread: enabling motivation to be generated by localized glutamate disruptions in nucleus accumbens. J Neurosci. 2008;28:7184–7192. [PMC free article] [PubMed]
  • Featherstone RE, Kapur S, Fletcher PJ. The amphetamine-induced sensitized state as a model of schizophrenia. Prog Neuropsychopharmacol Biol Psychiatry. 2007;31:1556–1571. [PubMed]
  • Filibeck U, Cabib S, Castellano C, Puglisi-Allegra S. Chronic cocaine enhances defensive behaviour in the laboratory mouse: involvement of D2 dopamine receptors. Psychopharmacology (Berl) 1988;96:437–441. [PubMed]
  • Gardner EL. Use of animal models to develop antiaddiction medications. Curr Psychiatry Rep. 2008;10:377–384. [PMC free article] [PubMed]
  • Gerfen CR, Young WS., 3rd Distribution of striatonigral and striatopallidal peptidergic neurons in both patch and matrix compartments: an in situ hybridization histochemistry and fluorescent retrograde tracing study. Brain Res. 1988;460:161–167. [PubMed]
  • Gerfen CR, Engber TM, Mahan LC, Susel Z, Chase TN, Monsma FJ, Jr, Sibley DR. D1 and D2 dopamine receptor-regulated gene expression of striatonigral and striatopallidal neurons. Science. 1990;250:1429–1432. [PubMed]
  • Gill KM, Grace AA. Heterogeneous processing of amygdala and hippocampal inputs in the rostral and caudal subregions of the nucleus accumbens. Int J Neuropsychopharmacol. 2011:1–14. [PMC free article] [PubMed]
  • Grace AA, Floresco SB, Goto Y, Lodge DJ. Regulation of firing of dopaminergic neurons and control of goal-directed behaviors. Trends in Neurosciences. 2007;30:220–227. [PubMed]
  • Haber SN, Groenewegen HJ, Grove EA, Nauta WJ. Efferent connections of the ventral pallidum: evidence of a dual striato pallidofugal pathway. Journal of Comparative Neurology. 1985;235:322–335. [PubMed]
  • Heidbreder CA, Andreoli M, Marcon C, Hutcheson DM, Gardner EL, Ashby CR., Jr Evidence for the role of dopamine D3 receptors in oral operant alcohol self-administration and reinstatement of alcohol-seeking behavior in mice. Addiction Biology. 2007;12:35–50. [PubMed]
  • Heimer L, Zahm DS, Churchill L, Kalivas PW, Wohltmann C. Specificity in the projection patterns of accumbal core and shell in the rat. Neuroscience. 1991;41:89–125. [PubMed]
  • Higashi H, Inanaga K, Nishi S, Uchimura N. Enhancement of dopamine actions on rat nucleus accumbens neurones in vitro after methamphetamine pre-treatment. J Physiol. 1989;408:587–603. [PMC free article] [PubMed]
  • Hikida T, Kimura K, Wada N, Funabiki K, Nakanishi S. Distinct roles of synaptic transmission in direct and indirect striatal pathways to reward and aversive behavior. Neuron. 2010;66:896–907. [PubMed]
  • Howes OD, Kapur S. The Dopamine Hypothesis of Schizophrenia: Version III-025EFThe Final Common Pathway. Schizophrenia Bulletin. 2009;35:549–562. [PMC free article] [PubMed]
  • Hull C, Isaacson JS, Scanziani M. Postsynaptic mechanisms govern the differential excitation of cortical neurons by thalamic inputs. J Neurosci. 2009;29:9127–9136. [PMC free article] [PubMed]
  • Humphries MD, Prescott TJ. The ventral basal ganglia, a selection mechanism at the crossroads of space, strategy, and reward. Prog Neurobiol. 2010;90:385–417. [PubMed]
  • Jensen J, Willeit M, Zipursky RB, Savina I, Smith AJ, Menon M, Crawley AP, Kapur S. The formation of abnormal associations in schizophrenia: neural and behavioral evidence. Neuropsychopharmacology. 2008;33:473–479. [PubMed]
  • Kalivas PW, Volkow ND. The neural basis of addiction: a pathology of motivation and choice. Am J Psychiatry. 2005;162:1403–1413. [PubMed]
  • Kalivas PW, LaLumiere RT, Knackstedt L, Shen HW. Glutamate transmission in addiction. Neuropharmacology. 2009;56:169–173. [PMC free article] [PubMed]
  • Kelley AE. Neural integrative activities of nucleus accumbens subregions in relation to learning and motivation. Psychobiology. 1999;27:198–213.
  • Kelley AE, Swanson CJ. Feeding induced by blockade of AMPA and kainate receptors within the ventral striatum: a microinfusion mapping study. Behavioural Brain Research. 1997;89:107–113. [PubMed]
  • Kelley AE, Baldo BA, Pratt WE, Will MJ. Corticostriatal-hypothalamic circuitry and food motivation: Integration of energy, action and reward. Physiol Behav. 2005;86:773–795. [PubMed]
  • Khaled MA, Farid Araki K, Li B, Coen KM, Marinelli PW, Varga J, Gaal J, Le Foll B. The selective dopamine D3 receptor antagonist SB 277011-A, but not the partial agonist BP 897, blocks cue-induced reinstatement of nicotine-seeking. Int J Neuropsychopharmacol. 2010;13:181–190. [PubMed]
  • Krause M, German PW, Taha SA, Fields HL. A pause in nucleus accumbens neuron firing is required to initiate and maintain feeding. J Neurosci. 2010;30:4746–4756. [PMC free article] [PubMed]
  • Lapish CC, Seamans JK, Chandler LJ. Glutamate-dopamine cotransmission and reward processing in addiction. Alcoholism-Clinical and Experimental Research. 2006;30:1451–1465. [PubMed]
  • Levita L, Dalley JW, Robbins TW. Nucleus accumbens dopamine and learned fear revisited: a review and some new findings. Behavioural Brain Research. 2002;137:115–127. [PubMed]
  • Lu XY, Ghasemzadeh MB, Kalivas PW. Expression of D1 receptor, D2 receptor, substance P and enkephalin messenger RNAs in the neurons projecting from the nucleus accumbens. Neuroscience. 1998;82:767–780. [PubMed]
  • MacDonald AF, Billington CJ, Levine AS. Alterations in food intake by opioid and dopamine signaling pathways between the ventral tegmental area and the shell of the nucleus accumbens. Brain Res. 2004;1018:78–85. [PubMed]
  • Maldonado-Irizarry CS, Swanson CJ, Kelley AE. Glutamate receptors in the nucleus accumbens shell control feeding behavior via the lateral hypothalamus. Journal of Neuroscience. 1995;15:6779–6788. [PubMed]
  • Mao ZH, Massaquoi SG. Dynamics of winner-take-all competition in recurrent neural networks with lateral inhibition. IEEE Trans Neural Netw. 2007;18:55–69. [PubMed]
  • Matamales M, Bertran-Gonzalez J, Salomon L, Degos B, Deniau JM, Valjent E, Herve D, Girault JA. Striatal medium-sized spiny neurons: identification by nuclear staining and study of neuronal subpopulations in BAC transgenic mice. PLoS One. 2009;4:e4770. [PMC free article] [PubMed]
  • Matsumoto M, Hikosaka O. Two types of dopamine neuron distinctly convey positive and negative motivational signals. Nature. 2009;459:837–841. [PMC free article] [PubMed]
  • Meredith GE, Baldo BA, Andrezjewski ME, Kelley AE. The structural basis for mapping behavior onto the ventral striatum and its subdivisions. Brain Struct Funct. 2008;213:17–27. [PMC free article] [PubMed]
  • Morrow JD, Maren S, Robinson TE. Individual variation in the propensity to attribute incentive salience to an appetitive cue predicts the propensity to attribute motivational salience to an aversive cue. Behav Brain Res. 2011;220:238–243. [PMC free article] [PubMed]
  • Moyer JT, Wolf JA, Finkel LH. Effects of dopaminergic modulation on the integrative properties of the ventral striatal medium spiny neuron. J Neurophysiol. 2007;98:3731–3748. [PubMed]
  • Nicola SM. The nucleus accumbens as part of a basal ganglia action selection circuit. Psychopharmacology (Berl) 2007;191:521–550. [PubMed]
  • Nicola SM, Kombian SB, Malenka RC. Psychostimulants depress excitatory synaptic transmission in the nucleus accumbens via presynaptic D1-like dopamine receptors. J Neurosci. 1996;16:1591–1604. [PubMed]
  • Park J, Aragona BJ, Kile BM, Carelli RM, Wightman RM. In vivo voltammetric monitoring of catecholamine release in subterritories of the nucleus accumbens shell. Neuroscience. 2010;169:132–142. [PMC free article] [PubMed]
  • Paxinos G, Watson C. The rat brain in stereotaxic coordinates. New York: Academic Press; 2007.
  • Pennartz CM, Dolleman-Van der Weel MJ, Kitai ST, Lopes da Silva FH. Presynaptic dopamine D1 receptors attenuate excitatory and inhibitory limbic inputs to the shell region of the rat nucleus accumbens studied in vitro. J Neurophysiol. 1992;67:1325–1334. [PubMed]
  • Perreault ML, O’Dowd BF, George SR. Dopamine receptor homooligomers and heterooligomers in schizophrenia. CNS Neurosci Ther. 2011;17:52–57. [PMC free article] [PubMed]
  • Perreault ML, Hasbi A, Alijaniaram M, Fan T, Varghese G, Fletcher PJ, Seeman P, O’Dowd BF, George SR. The dopamine D1–D2 receptor heteromer localizes in dynorphin/enkephalin neurons: Increased high affinity state following amphetamine and in schizophrenia. J Biol Chem 2010 [PMC free article] [PubMed]
  • Puglisi-Allegra S, Cabib S. Pharmacological evidence for a role of D2 dopamine receptors in the defensive behavior of the mouse. Behav Neural Biol. 1988;50:98–111. [PubMed]
  • Reynolds SM, Berridge KC. Fear and feeding in the nucleus accumbens shell: rostrocaudal segregation of GABA-elicited defensive behavior versus eating behavior. Journal of Neuroscience. 2001;21:3261–3270. [PubMed]
  • Reynolds SM, Berridge KC. Glutamate motivational ensembles in nucleus accumbens: rostrocaudal shell gradients of fear and feeding. Eur J Neurosci. 2003;17:2187–2200. [PubMed]
  • Reynolds SM, Berridge KC. Emotional environments retune the valence of appetitive versus fearful functions in nucleus accumbens. Nat Neurosci. 2008;11:423–425. [PMC free article] [PubMed]
  • Richard JM, Berridge KC. Metabotropic glutamate receptor blockade in nucleus accumbens shell shifts affective valence towards fear and disgust. Eur J Neurosci. 2011;33:736–747. [PMC free article] [PubMed]
  • Roitman MF, Wheeler RA, Wightman RM, Carelli RM. Real-time chemical responses in the nucleus accumbens differentiate rewarding and aversive stimuli. Nat Neurosci. 2008;11:1376–1377. [PMC free article] [PubMed]
  • Salamone JD, Correa M, Mingote SM, Weber SM. Beyond the reward hypothesis: alternative functions of nucleus accumbens dopamine. Current Opinion In Pharmacology. 2005;5:34–41. [PubMed]
  • Schroeter S, Apparsundaram S, Wiley RG, Miner LH, Sesack SR, Blakely RD. Immunolocalization of the cocaine- and antidepressant-sensitive l-norepinephrine transporter. J Comp Neurol. 2000;420:211–232. [PubMed]
  • Schultz W. Behavioral dopamine signals. Trends Neurosci. 2007;30:203–210. [PubMed]
  • Song R, Yang RF, Wu N, Su RB, Li J, Peng XQ, Li X, Gaal J, Xi ZX, Gardner EL. YQA14: a novel dopamine D(3) receptor antagonist that inhibits cocaine self-administration in rats and mice, but not in D(3) receptor-knockout mice. Addict Biol 2011 [PubMed]
  • Stuber GD, Sparta DR, Stamatakis AM, van Leeuwen WA, Hardjoprajitno JE, Cho S, Tye KM, Kempadoo KA, Zhang F, Deisseroth K, Bonci A. Excitatory transmission from the amygdala to nucleus accumbens facilitates reward seeking. Nature 2011 [PMC free article] [PubMed]
  • Sun X, Milovanovic M, Zhao Y, Wolf M. Acute and chronic dopamine receptor stimulation modulates AMPA receptor trafficking in nucleus accumbens neurons cocultured with prefrontal cortex neurons. J Neurosci. 2008;28:4216–4230. [PMC free article] [PubMed]
  • Surmeier DJ, Ding J, Day M, Wang Z, Shen W. D1 and D2 dopamine-receptor modulation of striatal glutamatergic signaling in striatal medium spiny neurons. Trends in Neurosciences. 2007;30:228–235. [PubMed]
  • Swanson LW. Anatomy of the soul as reflected in the cerebral hemispheres: neural circuits underlying voluntary control of basic motivated behaviors. J Comp Neurol. 2005;493:122–131. [PubMed]
  • Taber MT, Fibiger HC. Feeding-evoked dopamine release in the nucleus, accumbens: regulation by glutamatergic mechanisms. Neuroscience. 1997;76:1105–1112. [PubMed]
  • Taverna S, Canciani B, Pennartz CM. Dopamine D1-receptors modulate lateral inhibition between principal cells of the nucleus accumbens. J Neurophysiol. 2005;93:1816–1819. [PubMed]
  • Taylor SF, Phan KL, Britton JC, Liberzon I. Neural response to emotional salience in schizophrenia. Neuropsychopharmacology. 2005;30:984–995. [PubMed]
  • Tepper JM, Wilson CJ, Koos T. Feedforward and feedback inhibition in neostriatal GABAergic spiny neurons. Brain Res Rev. 2008;58:272–281. [PMC free article] [PubMed]
  • Thompson RH, Swanson LW. Hypothesis-driven structural connectivity analysis supports network over hierarchical model of brain architecture. Proc Natl Acad Sci U S A. 2010;107:15235–15239. [PMC free article] [PubMed]
  • Treit D, Pinel JP, Fibiger HC. Conditioned defensive burying: a new paradigm for the study of anxiolytic agents. Pharmacology, Biochemistry & Behavior. 1981;15:619–626. [PubMed]
  • Vanderschuren L, Wardeh G, De Vries TJ, Mulder AH, Schoffelmeer ANM. Opposing role of dopamine D1 and D2 receptors in modulation of rat nucleus accumbens noradrenaline release. Journal of Neuroscience. 1999;19:4123–4131. [PubMed]
  • Ventura R, Morrone C, Puglisi-Allegra S. Prefrontal/accumbal catecholamine system determines motivational salience attribution to both reward- and aversion-related stimuli. PNAS. 2007;104:5181–5186. [PMC free article] [PubMed]
  • Wang JQ, McGinty JF. Glutamate-dopamine interactions mediate the effects of psychostimulant drugs. Addiction Biology. 1999;4:141–150. [PubMed]
  • Wise RA. Dopamine and reward: the anhedonia hypothesis 30 years on. Neurotox Res. 2008;14:169–183. [PMC free article] [PubMed]
  • Woodward ND, Cowan RL, Park S, Ansari MS, Baldwin RM, Li R, Doop M, Kessler RM, Zald DH. Correlation of individual differences in schizotypal personality traits with amphetamine-induced dopamine release in striatal and extrastriatal brain regions. Am J Psychiatry. 2011;168:418–426. [PMC free article] [PubMed]
  • Xi ZX, Newman AH, Gilbert JG, Pak AC, Peng XQ, Ashby CR, Jr, Gitajn L, Gardner EL. The novel dopamine D3 receptor antagonist NGB 2904 inhibits cocaine’s rewarding effects and cocaine-induced reinstatement of drug-seeking behavior in rats. Neuropsychopharmacology. 2006;31:1393–1405. [PubMed]
  • Zahm DS. The evolving theory of basal forebrain functional--anatomical ‘macrosystems’ Neuroscience & Biobehavioral Reviews. 2006;30:148–172. [PubMed]
  • Zhou L, Furuta T, Kaneko T. Chemical organization of projection neurons in the rat accumbens nucleus and olfactory tubercle. Neuroscience. 2003;120:783–798. [PubMed]
  • Zubieta JK, Stohler CS. Neurobiological mechanisms of placebo responses. Ann N Y Acad Sci. 2009;1156:198–210. [PMC free article] [PubMed]

 

Optogenetics reveals a role for accumbal medium spiny neurons expressing dopamine D2 receptors in cocaine-induced behavioral sensitization (2014)

Go to:

Abstract

Long-lasting, drug-induced adaptations within the nucleus accumbens (NAc) have been proposed to contribute to drug-mediated addictive behaviors. Here we have used an optogenetic approach to examine the role of NAc medium spiny neurons (MSNs) expressing dopamine D2 receptors (D2Rs) in cocaine-induced behavioral sensitization. Adeno-associated viral vectors encoding channelrhodopsin-2 (ChR2) were delivered into the NAc of D2R-Cre transgenic mice. This allowed us to selectively photostimulate D2R-MSNs in NAc. D2R-MSNs form local inhibitory circuits, because photostimulation of D2R-MSN evoked inhibitory postsynaptic currents (IPSCs) in neighboring MSNs. Photostimulation of NAc D2R-MSN in vivo affected neither the initiation nor the expression of cocaine-induced behavioral sensitization. However, photostimulation during the drug withdrawal period attenuated expression of cocaine-induced behavioral sensitization. These results show that D2R-MSNs of NAc play a key role in withdrawal-induced plasticity and may contribute to relapse after cessation of drug abuse.

Keywords: optogenetics, medium spiny neurons, dopamine D2 receptors, cocaine, drug addiction

Introduction

Dopamine (DA) signaling is associated with reward expectation and goal-directed behavior (Wise, 2004; Goto and Grace, 2005; Berridge, 2007). One of the well-known pathologies of dopaminergic disorders is drug addiction (Robinson and Berridge, 1993, 2003). Following repeated exposure to addictive substances, adaptive changes occur at the molecular and cellular level in the DA mesolimbic pathway; these can lead to drug dependence, which is a chronic, relapsing disorder in which compulsive drug-seeking and drug-taking behaviors persist despite their serious negative consequences (Thomas et al., 2008; Baik, 2013). Characterization of the modifications that take place in the mesolimbic dopaminergic system is thus key to understanding drug addiction.

Dopamine D1 receptors (D1R) and D2 receptors (D2R) are highly expressed in the medium spiny neurons (MSNs) of the striatum. It has been suggested that long-lasting drug-induced adaptations in the ventral striatum, better known as the nucleus accumbens (NAc), contribute to the development of addiction as well as drug-seeking and relapse behaviors (Lobo and Nestler, 2011; Smith et al., 2013). Dopaminergic cell bodies from the ventral tegmental area mostly innervate the NAc. Over 95% of the cells within the NAc are MSNs, which receive excitatory inputs from four major brain regions: the prefrontal cortex, the ventral subiculum of the hippocampus, the basolateral amygdala, and the thalamus (Sesack and Grace, 2010; Lüscher and Malenka, 2011). MSNs within the NAc can be divided into two major subpopulations: direct pathway MSNs that express D1Rs and project directly to midbrain DA areas, and indirect pathway MSNs that express D2Rs and project to the ventral pallidum (Kreitzer and Malenka, 2008; Sesack and Grace, 2010; Lüscher and Malenka, 2011; Smith et al., 2013). Because MSN are GABAergic, activation of MSNs neurons will inhibit their downstream targets which are also GABAergic (Chevalier and Deniau, 1990). Therefore, activation of D1R-MSNs will excite midbrain DA neurons, which then contributes to the regulation of reward-related behaviors (Lüscher and Malenka, 2011; Bocklisch et al., 2013).

Recent studies using genetically engineered mice that express Cre recombinase in a cell-type specific manner have revealed different roles for D1R-MSNs and D2R-MSNs in cocaine addiction behaviors. Such mice enable genetic targeting of specific toxins, optogenetic probes or DREADD (designer receptors exclusively activated by a designer drug) to selectively manipulate D1R-MSN or D2R-MSN. This approach has led to some consensus about the role of MSNs in addictive behaviors: D1R-MSNs apparently promote addictive behaviors, while no specific role (or an inhibitory role) in the development of drug-induced addictive behaviors has been suggested for D2R-MSNs (Hikida et al., 2010; Lobo et al., 2010; Ferguson et al., 2011; Bock et al., 2013). Cocaine exposure apparently induces synaptic modification and alterations in gene expression in both MSN populations (Lobo et al., 2010; Lobo and Nestler, 2011; Grueter et al., 2013). Although it appears that D1R-MSNs and D2R-MSNs play opposing roles in cocaine-mediated addictive behaviors, the precise role of D2R-MSNs is not clear.

Previously it has been shown that D2R knockout (KO) mice display normal cocaine-mediated behavioral sensitization and cocaine-seeking behaviors, with only a slight decrease in sensitivity caused by the absence of D2R (Baik et al., 1995; Chausmer et al., 2002; Sim et al., 2013). However, exposure to stress during drug withdrawal suppresses expression of cocaine-induced behavioral sensitization as well as cocaine-seeking and relapse behaviors in D2R KO mice (Sim et al., 2013). Specific knock-down of D2R in the NAc does not affect basal locomotor activity, nor cocaine-induced behavioral sensitization, but does confer the ability of stress to inhibit expression of cocaine-induced behavioral sensitization (Sim et al., 2013). These findings strongly suggest that blockade of D2R in the NAc does not prevent cocaine-mediated behavioral sensitization. Rather, it appears that D2R in the NAc play a distinct role in regulation of the stress-triggered synaptic modifications during withdrawal that lead to an increase in cocaine-seeking and relapse behaviors (Sim et al., 2013).

Here we have used optogenetics to further evaluate the role of NAc D2R-MSNs in cocaine-induced behavioral sensitization. Using brain slices, we find that photostimulation of D2R-MSNs activates local inhibitory circuits within NAc involving neighboring MSNs. Photostimulation of NAc D2R-MSNs in vivo affects neither the initiation nor the expression of cocaine-induced behavioral sensitization. However, repetitive activation of NAc D2R-MSNs during the drug withdrawal period attenuates cocaine-induced addictive behavior. Our results show that D2R-MSNs of NAc play a key role in withdrawal-induced plasticity and may contribute to relapse after cessation of drug abuse.

Materials and methods

Mice

D2-Cre BAC transgenic mice on a C57Bl/6 background were obtained from MMRRC (Mutant Mouse Regional Resource Centers, B6.FVB(Cg)-Tg(Drd2-cre)ER44Gsat/Mmucd). In behavioral experiments, littermates lacking the D2-Cre transgene were used as controls for the D2-Cre mice. Mice were maintained in a specific pathogen-free barrier facility under constant conditions of temperature and humidity, and on a 12-h light, 12-h dark schedule. Animal care and handling were performed in accordance with standards approved by the Institutional Animal Care and Use Committees of Korea University and KIST.

Virus vector preparation

pAAV-EF1a-DIO-hChR2(H134R)-EYFP-WPRE was generously provided by Karl Deisseroth (Stanford Univ.). For preparation of AAV, HEK293T cells were grown in DMEM media with antibiotics and FBS. The day before transfection, four plates beyond 90% confluence from 10-cm dishes were plated onto five 15-cm dishes and incubated for 18–22 h or until 60 to 70% confluence. HEK293T cells were transfected with pAAV-DIO-ChR2-EYFP, pAAV-DJ and pHelper using jetPEI transfection reagent (QBiogene). The DNA/DMEM/PEI cocktail was vortexed and incubated at room temperature for 20 min. After incubation, the transfection mixture was added to each 15 cm dish. Transfected cells were harvested 48 h after transfection and incubated with 0.5% sodium deoxycholate (Sigma; D6750) and 50 units/ml of benzonase nuclease (Sigma; E1014) at 37°C for 1 h. After removing cellular debris by centrifuging at 3000 × g for 15 min, the supernatant was filtered through a 0.45 mm PVDF filter (Millipore). Purification of AAV- DJ particles was performed using HiTrap heparin affinity columns (GE Healthcare). For concentration of AAV, Amicon ultra-15 centrifugal filter units with a 100,000 molecular weight cutoff were used. Concentrated virus aliquoted and frozen for storage at −80°C. The final viral concentrations was 3~6 × 1012 virus particles per ml for each AAV.

Stereotaxic injection and optical fiber placement

Animals were anesthetized by i.p. injections of 1.6 µl of Zoletil and 0.05 µl of xylazine (Rompun, Bayer) per gram of body weight and placed in a stereotaxic apparatus (David Kopf Instruments, Tujunga, CA). For injection of viruses, a 31-gauge syringe needle was used to bilaterally infuse 2 µl of virus into NAc at an angle of 0° (AP +1.7; ML ±1.3; DV −4.5) at a rate of 0.1 ul/min. The needle was left in place for 10 min after injection before being slowly withdrawn. The fiber-optic cannula for implantation consisted of a zirconia ferrule (1.25 mm in diameter and 4.5 mm long) and flat tip of an optical fiber (200 µm in diameter). The implantation of the fiber-optic cannula into NAc for illumination of D2-MSNs was performed immediately after injection of viruses. The coordinates for implantation of the fiber-optic cannula were an angle of 0° (AP +1.7; ML ±1.35; DV −4.2) for targeting NAc. To help anchor the optical fiber, two screws were anchored into the skull to the rear of the implantation site of the fiber-optic cannula. To fix the fiber-optic cannula on the skull, C&B Superbond (Sun Medical) was applied to the surface of the skull around the base of the cannula. Once the C&B Superbond hardened, the cannula was released from the holder and dental cement (Poly-F, Dentsply) was applied around the cannula and screws. To close the incision around the cannulation site, Vetbond tissue adhesive (3 M, 7003449) was used. After implantation, mice were given subcutaneous injection of antibiotics (Enrofloxacin, 5 mg/kg, q 12 h) and analgesia (Carprofen, 5 mg/kg, q 24 h) for 3 consecutive days.

In vivo photostimulation

A 200 µm patch cord was connected to the external portion of the chronically implantable optical fiber using a sleeve. Optical fibers were attached through an FC/PC adaptor to a blue laser diode (473 nm, MBL-III 473-150 mW), and light pulses were generated through a stimulator (BNC 575). For photostimulation of ChR2-expressing neurons, the stimulation paradigm was 20 Hz frequency, 5 ms pulse duration and 2–5 mW of light power. Light power emitted from the patch cord was measured using a power meter (PM100D) with a S121C light sensor.

Behavioral Analysis

Behavioral experiments were performed with male D2-Cre mice at 11–13 weeks of age, with the exception of mice subjected to electrophysiological analysis which were 5–6 weeks of age. Age-matched D2-Cre and Cre negative control mice were injected with virus and housed individually and allowed to acclimate to the cage until the behavioral test. For each manipulation, mice were transferred to the experimental room 60 min before the onset of the experiment to allow for habituation and to reduce stress (brightness of the experimental room was 70 lux). Each experimental apparatus was cleaned with 70% ethanol between experiments to remove any potential odor cues.

Cocaine sensitization

For initiation of cocaine sensitization, mice were habituated to saline injections (i.p.) for 3 consecutive days and then injected with saline or cocaine (15 mg kg−1, i.p) for 5 consecutive days. Mice were injected intraperitoneally (i.p.) with either cocaine hydrochloride (Johnson Mattney, Edinburgh, UK) dissolved in saline (0.9% NaCl) or saline with a 30 G needle. Immediately after each injection, mice were tested for horizontal locomotor activity in an open-field chamber for 30 min. For measurement of the effect of photostimulation on the initiation and expression of sensitization (Figure ​(Figure​5),5), mice were given blue light illumination bilaterally through dual fiber-optic patch cords onto the NAc for four 3-min periods during 30 min sessions in home cages. Patch cords from the fiber-optic cannula located on the mouse skull was removed and mice were given at least 10 min rest. Mice were then injected with either cocaine or saline (coc 1d-coc 5d). After initiation of sensitization, cocaine was withdrawn for 14 days without any injection of saline. During this withdrawal period, no photostimulation was applied. The expression of behavioral sensitization to cocaine was then determined by injection of a challenge dose of the drug (10 mg kg−1, i.p.) after photostimulation of the NAc as illustrated in Figure ​Figure5A.5A. To measure the effect of photostimulation during the cocaine withdrawal period (Figure ​(Figure6),6), mice were subjected to the same protocol for sensitization as described above (for Figure ​Figure5)5) except photostimulation was given. After initiation of cocaine sensitization, photostimulation was applied to the NAc daily for 1 h during the total withdrawal period of 14 days. After 14 days of withdrawal, all groups of mice were injected with the challenge dosage of cocaine, (10 mg kg−1).

Figure 1 
Selective photostimulation of medium spiny neurons in nucleus accumbens. (A) Selective expression of ChR2 in NAc D2R neurons by delivery of AAV-DIO-ChR2-EYFP viral vectors. scale bars: background figure, 1 mm: insert, 200 µm. (B) Confocal images ...
Figure 2 
Photostimulation of D2RCre-MSNs drives local inhibitory circuits. (A) Confocal image of a live NAc slice, showing a dye-filled neuron that does not express ChR2 and a neighboring cell (arrowhead) that expressed ChR2 and could be photostimulated. (B) IPSC ...
Figure 3 
Properties of NAc cells. (A) Two-photon fluorescence image of neurons filled with Alexa 594. (A1) shows a neuron from the ChR2+/AP group, while (A3) shows a neuron from the ChR2−/IPSC group. (A2) and (A4) are high-magnification images from the ...
Figure 4 
Effects of in-vivo optogenetic activation of D2-MSNs in NAc on basal locomotor activity. (A) Sagittal view of D2 Cre mice injected at the NAc with AAV-DIO-ChR2-EYFP followed by bilateral implantation of fiber optic cannula. 473 nm blue light stimulation ...
Figure 5 
Effects of activation of D2-MSN during sensitization to cocaine. (A) Experimental scheme for photo-stimulation of D2-MSNs during initiation and expression of sensitization to cocaine. Blue-light illumination (2~5 mW, 5 ms, 20 Hz) was delivered for four ...
Figure 6 
Effects of activation of D2-MSN during withdrawal to repeated cocaine exposure. (A) Experimental scheme for photo-stimulation of D2-MSNs during withdrawal to cocaine. Blue-light illumination (2~5 mW, 5 ms, 20 Hz) was delivered for eight 3-min periods ...

Immunofluorescence and confocal laser microscopy

For immunofluorescence, mice were anesthetized with Zoletil (Virbac, 1.6 µl/g, intraperitoneally) and 0.05 µl/g Rompun (Bayer) and perfused with filter-sterilized 0.1 M PBS followed by fixation using 4% paraformaldehyde/PBS solution (Sigma). The brain was then removed and post-fixed for 4 h with ice-cold fixative as above. The brains were then dehydrated in 30% sucrose/0.1 M PBS for 2 days. Brains were then frozen and 40-µm-thick consecutive coronal sections were prepared on a cryostat (Leica CM 1900, Germany). Sections (40 µm) were blocked for 1 h in 0.1 M PBS containing 5% normal goat serum and 0.2% Triton X-100 and incubated with rabbit polyclonal anti-D2R (1:500, Millipore, AB5084P) at 4°C overnight. After washes with PBS containing 0.2% Triton X-100, samples were incubated at RT for 1 h with Alexa Fluor 568 goat anti-rabbit IgG (1:500; Molecular Probes, Eugene, OR, USA) and 0.2 µl/ml 4, 6-diamidino-2-phenyl-indole HCl (DAPI; Sigma, St. Louis, MO, USA) in PBS containing 1% normal goat serum and 0.2% Triton X-100. As a negative control, samples were incubated with DAPI and the secondary antibody only. Sections were examined on a C1 Plan Apo × 40/1.4 water confocal laser scanning system (LSM 700, Zeiss, Berlin, Germany).

Electrophysiology and photostimulation in nucleus accumbens slices

Mice were used for experiments 4 weeks after virus injection, to achieve optimal expression of ChR2-EYFP. Mice were then anesthetized and decapitated for preparation of acute brain slices. The brain was quickly removed and immediately placed in ice-cold cutting solution containing (in mM) 250 Sucrose, 26 NaHCO3, 10 D-Glucose, 3 Myo-inositol, 2.5 KCl, 2 Na-pyruvate, 1.25 NaH2PO4, 0.5 Ascorbic acid, 1 Kynurenic acid and 7 MgCl2 which was bubbled with 95% O2/5% CO2 (pH = 7.4). Coronal brain slices (250 µm thick) containing the NAc were prepared using a vibratome (Leica VT 1200 S) and were then incubated in gassed artificial cerebrospinal fluid (ACSF) containing (in mM): 11 D-glucose, 125 NaCl, 25 NaHCO3, 1.25 NaH2PO4, 2.5 KCl, 1.25 MgCl2 and 2.5 CaCl2 at 34°C for 1 h before recording. Slices were then transferred to a submersion recording chamber in which O2-saturated ACSF solution was continuously superfused. Cells in NAc and VTA were visualized using a 2-photon microscope (Olympus FV1000 MPE, Tokyo, Japan) equipped with a 25X water immersion lens and infrared DIC optics. Whole-cell patch clamp recordings were obtained from NAc cells with a Multiclamp 700B amplifier and Digidata 1440A digitizer (Molecular Devices, LLC). Data were sampled using pCLAMP 10.2 software and further analyzed using Clampfit 10.2 software (Molecular Devices, LLC). Patch electrodes with resistances between 3–5 MΩ were filled with an internal solution containing (in mM): 130 K-gluconate, 2 NaCl, 2 MgCl2, 20 HEPES, 4 Na2ATP, 0.4 Na3GTP, 0.5 EGTA and 10 Na2- phosphocreatine, with pH adjusted to 7.3 using 1 N KOH. Bicuculline (10 µM) was bath-applied to brain slice to block GABA receptors in a subset of experiments.

NAc cells expressing ChR2-EYFP were photostimulated by a LED light source (460 ± 27 nm, UHP-Mic-LED-460, Prizmatix). Blue light from the LED was further filtered and attenuated by a filter cube equipped with an excitation filter (470–495 nm); flashes of light (10 ms duration, 0.0366–0.354 mW/mm2) were delivered to the brain slice via the 25X objective lens at frequencies of 5–40 Hz. In a subset of experiments, photocurrents were measured in ChR2-expressing cells in response to 2 s duration light flashes.

Statistical Analysis

Data are presented as means ± s.e.m. and were analyzed with the two-tailed Student’s t-test, or with two-way analysis of variance followed by Bonferroni’s post hoc test. A P-value of <0.05 was considered statistically significant.

Results

Selective photostimulation of medium spiny neurons in nucleus accumbens

To determine the role of NAc D2R-MSNs in cocaine-mediated addictive behaviors, we used an optogenetic approach to stimulate NAc D2R neurons. To selectively control the activity of D2R-MSNs in NAc by light, viral vectors coding AAV-DIO-ChR2-EYFP were stereotaxically injected into the NAc of D2R-Cre BAC transgenic mice. 4 weeks after viral injection, robust expression of ChR2-EYFP was observed in the NAc (Figure ​(Figure1A).1A). The specificity of ChR2 expression in D2R-MSNs was confirmed by immunofluorescence confocal analysis: expression of YFP-tagged ChR2 was co-localized with D2R in NAc (Figure ​(Figure1B),1B), showing that ChR2 was expressed in D2R-expressing neurons in NAc.

Although such an approach has been used in other studies (e.g., Lobo et al., 2010), the details of virus injection procedures will vary from one lab to another, making it important to document optogenetic control under our specific experimental conditions. We assessed the functional expression of ChR2 by making whole-cell patch clamp recordings from MSNs in NAc slices. MSNs were identified by: (1) a relatively hyperpolarized resting membrane potential (RMP), typically more negative than −80 mV; (2) a regular pattern of AP firing in response to applied current pulses; (3) long latency to firing of the first AP during a current pulse; (4) absence of a voltage “sag” during hyperpolarization caused by a hyperpolarization-activated cation current (Ih); and (5) relatively small size of their cell bodies (Chang and Kitai, 1985; O’Donnell and Grace, 1993; Le Moine and Bloch, 1996; Taverna et al., 2008). Blue light (470 nm) was applied over the entire field of view (0.78 mm2) while voltage-clamping the MSNs at a holding potential of −69 mV. Some MSNs expressed ChR2, evident as YFP fluorescence in their somata (arrows in Figures 1C1,C3). Such neurons exhibited substantial photocurrents, with brighter light stimuli eliciting larger photocurrents (Figure ​(Figure1D).1D). The relationship between peak photocurrent amplitude and light intensity (Figure ​(Figure1E)1E) had a half-maximal light sensitivity of 0.054 ± 0.0023 mW/mm2 and a maximal peak amplitude of 1.16 ± 0.16 nA (mean ± s.e.m., n = 4).

Under current-clamp conditions, MSNs expressing ChR2 fired APs reliably in response to trains of light pulses (10 ms duration; Figure ​Figure1F).1F). Under these conditions, light intensities greater than 0.1 mW/mm2 were sufficient to evoke APs (Figure ​(Figure1G,1G, n = 5). APs were reliably evoked at photostimulation frequencies up to 20 Hz, while at 40 Hz the light-induced responses summed to cause a sustained depolarization that was less effective at evoking APs (Figures 1F,G).

Photostimulation of D2R-MSNs drives local inhibitory circuits

To investigate the consequences of D2R-MSNs activity on local circuits in NAc, we photostimulated presynaptic MSN expressing ChR2 while measuring postsynaptic responses in ChR2-negative MSNs (Figure ​(Figure2A).2A). The neuron shown in Figure ​Figure2A2A does not express ChR2, as indicated by the absence of EYFP fluorescence as well as the absence of short-latency photocurrents like those shown in Figure ​Figure1D.1D. However, when the postsynaptic MSNs were held as a potential of −69 mV, 10 ms duration light flashes evoked outward currents after a latency of 9.0 ± 0.42 ms (Figure ​(Figure2B,2B, n = 15). To determine the nature of these responses, the postsynaptic membrane potential was varied between −99 mV to −39 mV, while a light flash was applied (Figure ​(Figure2C).2C). Light-induced responses varied with membrane potential (Figure ​(Figure2D,2D, n = 6) and reversed their polarity at −81 ± 3.4 mV. Given that the equilibrium potential for chloride ions is −80 mV under our ionic conditions, the light-induced outward currents could be due to chloride flux mediated by postsynaptic GABAA receptors. To test this possibility, the GABAA receptor antagonist bicuculline (10 µM) was added to the external solution. This drug completely blocked light-induced responses (Figure ​(Figure2B),2B), confirming that the light-induced responses were GABAergic inhibitory postsynaptic currents (IPSCs).

Based on their responses to photostimulation, the MSNs that we recorded from could be classified into one of 4 groups: (1) cells expressing a sufficient amount of ChR2 to fire APs in response to photostimulation (ChR2+/AP), which were described above; (2) cells expressing a small amount of ChR2, which evinced a subthreshold depolarization in response to light (ChR2+/No AP); (3) silent cells that had no expression of ChR2 but received light-induced IPSCs from presynaptic MSNs expressing ChR2 (ChR2−/IPSC); and (4) ChR2-negative cells that did not exhibit IPSCs in response to photostimulation of other MSNs (ChR2−/No IPSC). The relative proportion of cells in each of these categories is shown in Figure ​Figure2E2E (n = 53). Overall, nearly half of the cells (45.3%) expressed ChR2 (sum of groups (1) and (2)). None of the MSNs that we recorded exhibited both photocurrents and IPSCs in response to photostimulation; this indicates that D2R-positive MSNs do not innervate other members of this same cell population within the NAc.

This classification of responses to light indicates that photostimulation of ChR2+/No AP cells (group 2) and ChR2−/No IPSC cells (group 4) will not generate any electrical signals that could contribute to circuit activity. Thus, to define the effects of photostimulation on circuit function, we characterized in detail the properties of ChR2+/AP MSNs (group 1), which will generate APs when the NAc is photostimulated, and ChR2−/IPSC cells (group 3), which are postsynaptic to the ChR2+/AP MSNs because they receive light-induced IPSCs. ChR2+/AP and ChR2−/IPSC cells in NAc were both identified as spiny neurons (Figure ​(Figure3A).3A). There were no significant differences in the morphological or electrophysiological properties of neurons in these two groups. For example, the somata of the neurons in those two groups were similar in size (Figure ​(Figure3B).3B). In addition, their RMPs (−83.0 ± 1.7 vs. −85.0 ± 1.8 mV; mean ± s.e.m; n = 10, Figure ​Figure3C)3C) and input resistances (113 ± 15 vs. 133 ± 13 MΩ, n = 6, Figure ​Figure3D)3D) were also not different (p > 0.05 two-tailed Student’s t-test) while their AP firing patterns in response to current pulses (Figures 3E,F) were also similar (p > 0.05 two-tailed Student’s t-test, n = 6). In summary, photostimulation of D2R-MSNs in NAc activates local inhibitory circuits with postsynaptic neurons that are very similar to the D2R-MSNs but do not express D2R.

Optogenetic stimulation of NAc D2R-MSNs in cocaine-induced behavioral sensitization

We next examined the behavioral consequences of in vivo photostimulation of NAc D2R-MSNs. Because photostimulation of D2R-MSNs in dorsal striatum decreases locomotor activity (Kravitz et al., 2010), we started by characterizing the effects of accumbens D2R-MSN activation on basal locomotor activity. For this purpose, D2R-Cre mice were injected with DIO-AAV-ChR2-EYFP virus bilaterally into the NAc (D2-Cre(+) NAc-ChR2). D2R-MSNs were then photostimulated with blue light (473 nm, 5 ms pulse duration, 20 Hz) delivered to the NAc via an optical fiber. Photostimuli were applied during four 3-min duration periods within the 50 min session when mice were kept in the locomotor activity recording chamber (Figure ​(Figure4A).4A). In parallel, as a control non-Cre WT littermate mice were similarly injected with virus and received similar blue light illumination. D2-Cre(+) NAc-ChR2 mice displayed a comparable or slightly elevated level of basal locomotor activity in comparison to the control D2R-Cre(−) NAc-ChR2 mice (Figures 4B,C). Photostimulation of D2R-MSNs in D2-Cre(+) NAc-ChR2 mice caused a significant decrease in the locomotor activity which recovered after the light stimulus stopped (Figure ​(Figure4B).4B). No such effects were observed in the control D2R-Cre(−) NAc-ChR2 mice (Figures 4B,C), indicating that the effects of photostimulation were caused by activation of ChR2, rather than possible non-specific effects such as heating of brain tissue. Therefore, our data indicated that photostimulation of D2R-MSNs in NAc elicited a decrease in locomotor activity.

These results established our ability to control the activity of D2R-MSNs within NAc in vivo. We next used this capability to examine the influence of D2R-MSN activity on behavioral sensitization to repeated administration of cocaine. Behavioral sensitization refers to the process that allows an initial exposure to psychostimulants, such as cocaine, to enhance the ability of subsequent drug exposures to stimulate locomotor activity. This process can be separated into initiation and expression phases: initiation describes the immediate neural events that induce behavioral sensitization (Vanderschuren and Kalivas, 2000; Sim et al., 2013), while expression is known to be a long-lasting form of behavioral plasticity that persists after drug withdrawal (Vanderschuren and Kalivas, 2000; Sim et al., 2013). We therefore examined cocaine-induced behavioral sensitization during repeated intraperitoneal (i.p.) injections of cocaine, while using optogenetics to control the activity of D2R-MSNs in NAc during each of these phases.

After habituation to saline injection over 3 days, mice were injected with cocaine (15 mg/kg) on 5 consecutive days and locomotor responses were recorded for 30 min after each injection (Figure ​(Figure5A).5A). Photostimuli were delivered during 30 min sessions before cocaine injection, interspersing 3 min periods of illumination with 5 min periods where the light was turned off (Figure ​(Figure5A).5A). Given that photostimulation of D2R-MSNs in NAc decreases basal locomotor activity (Figure ​(Figure4),4), photostimuli were delivered immediately prior to administration of cocaine to avoid possible interference with behavioral responses to cocaine injection.

Both control D2-Cre(−) NAc-ChR2 mice and D2-Cre(+) NAc-ChR2 mice showed a marked increase in locomotor activity in response to the repeated cocaine injections (Figure ​(Figure5B),5B), indicating initiation of sensitization. Photostimulation of D2R-MSNs in NAc did not appear to affect the initiation of behavioral sensitization, because cocaine-induced behavioral sensitization was similar in D2-Cre(+) NAc-ChR2 mice and control D2-Cre(−) NAc-ChR2 mice.

After induction of behavioral sensitization by repeating such injections of cocaine (15 mg/kg) for 5 days, the drug was withdrawn for 14 days and the degree of expression of sensitization was examined by challenging the mice with a lower dose of cocaine (10 mg/kg). Expression of sensitization is a long-lasting form of behavioral plasticity that persists after drug withdrawal (Steketee and Kalivas, 2011; Sim et al., 2013). To examine the role of D2R-MSNs in expression of sensitization, NAc was photostimulated immediately prior to administration of cocaine (Figure ​(Figure5A)5A) and sensitization was measured as the amount of locomotor activity induced by the cocaine injection.

In both cocaine-pretreated groups of mice—D2-Cre(−) NAc-ChR2 mice (D2-Cre(−):: coc-coc) and D2-Cre(+) NAc-ChR2 (D2-Cre(+):: coc-coc)—robust expression of sensitization occurred (Figure ​(Figure5C).5C). The time course of cocaine-stimulated locomotion changes was also similar between the two groups (Figure ​(Figure5C),5C), with no significant difference observed between two groups. Taken together, these two photostimulation experiments indicate that activation of D2R-MSNs in the NAc does not affect initiation or expression of cocaine-induced behavioral sensitization.

Photostimulation of NAc D2R-MSNs during drug withdrawal

Chronic stress during drug withdrawal after repeated cocaine exposure results in selective recruitment of a D2R-dependent adaptation mechanism that controls the stress-induced increase in cocaine-seeking and relapse behaviors in association with changes in synaptic plasticity in the NAc (Sim et al., 2013). This indicates that the mechanisms engaged by drug withdrawal are distinct from those involved in drug-indicted sensitization. We therefore next examined whether photostimulation of D2R-MSNs in NAc during cocaine withdrawal affects the expression of cocaine-induced behavioral sensitization.

After induction of behavioral sensitization by repeated injection of cocaine as above, D2-Cre(−) and D2-Cre(+) mice were subdivided into two groups for the 14 day withdrawal period: one group was subjected to daily blue-light stimulation of NAc for 1 h (3 min × 8 times), while the other group was not (Figure ​(Figure6A).6A). Repeated photostimulation of D2R-MSNs in NAc during cocaine withdrawal did not affect the expression of sensitization in D2-Cre(−):: coc-coc mice (Figure ​(Figure6B).6B). In contrast, in D2-Cre(+):: coc-coc mice, expression of sensitization was significantly attenuated by repeated photostimulation during drug withdrawal (Figure ​(Figure6B),6B), although the time course of the cocaine-induced stimulation of locomotion was unaffected (Figure ​(Figure6C).6C). Thus, photostimulation of D2R-MSNs of NAc during drug withdrawal reduced expression of cocaine-induced behavioral sensitization (cocaine × photo-stimulation interaction F(1,18) = 11.08, P = 0.0037, Figure ​Figure6B).6B). These data indicate that activation of D2R-NAc MSNs during the period of drug withdrawal influences cocaine-seeking and relapse behaviors.

Discussion

Considerable evidence indicates that cocaine-induced behavioral sensitization is associated with enhanced dopaminergic transmission in the mesocorticolimbic system comprising the ventral tegmental area, prefrontal cortex and nucleus accumbens (NAc). In particular, the expression phase of behavioral sensitization is characterized by a persistent drug hyper-responsiveness after cessation of the drug, which is associated with a cascade of adaptation mechanisms (Kalivas and Duffy, 1990; Robinson and Berridge, 1993; Kalivas et al., 1998) that could contribute to compulsive drug craving (Robinson and Berridge, 1993; Kalivas et al., 1998; Steketee and Kalivas, 2011). It has been suggested that cocaine-induced alterations in molecular, cellular and behavioral plasticity within the NAc, in association with DA receptor signaling in MSNs, can regulate drug-mediated addictive behaviors (Lobo et al., 2010; Schmidt and Pierce, 2010; Ferguson et al., 2011; Pascoli et al., 2011; Bocklisch et al., 2013; Grueter et al., 2013).

Recent studies using genetically-engineered mice that conditionally express Cre recombinase have revealed roles for D1R-MSNs or D2R-MSNs in cocaine addictive behaviors. Optogenetic activation of D1R-MSNs of NAc after 6 days of repeated cocaine administration increases locomotor activity, while activation of D2R-MSNs reportedly has no effect (Lobo et al., 2010). These data suggest that repeated exposure to cocaine enhances the output of D1R-MSNs of the NAc. Inhibition of D1R-expressing MSNs with tetanus toxin (Hikida et al., 2010) diminishes cocaine-conditioned place preference (CPP), while no alterations in cocaine CPP were observed after abolishing synaptic transmission in D2R-MSNs (Hikida et al., 2010). Optogenetic activation of D1R-MSNs in dorsal striatum induces persistent reinforcement, whereas stimulating D2 receptor–expressing neurons induces transient punishment (Kravitz et al., 2012). A recent study has also reported that inhibition of D2R-MSNs via a chemicogenetic approach enhances the motivation to obtain cocaine, whereas optogenetic activation of D2R-MSNs suppresses cocaine self-administration (Bock et al., 2013). On the other hand, Bocklisch et al. (2013) reported that D1R-MSNs of the NAc project to the VTA, specifically to GABAergic neurons within the VTA, while D2R-MSNs do not project directly to the VTA. This circuit means that optogenetic activation of D1R-MSNs disinhibits DA neurons, which finally enhances cocaine-induced addictive behaviors (Bocklisch et al., 2013).

Despite the seemingly simple organization of these two populations of MSNs, the fact that MSNs receive multiple inputs and have different outputs from/to other brain areas, as well as forming local circuits between MSNs and other classes of interneurons, the resulting output of D1R-MSNs and D2R-MSNs can yield complex and different molecular, cellular and behavioral consequences.

Previously it has been shown that D2R contributes to synaptic modifications induced during drug withdrawal and these potentiate the relapse to cocaine seeking, without affecting initial drug acquisition or drug-seeking (Sim et al., 2013). Our present data indicate that photostimulation of D2R-MSNs in NAc elicits a decrease in basal locomotor activity. Lobo et al. (2010) detected no change in locomotion when either MSN subtype was activated, but they only examined total locomotor activity rather than examining immediate responses of basal locomotor activity to photostimulation. Kravitz et al. (2010) also found that optogenetic activation of D2R-MSNs in dorsal striatum also decreases locomotor activity. Thus, our data are the first to demonstrate that basal locomotor activity is inhibited by photostimulation of D2R-MSNs of NAc and the first to systematically examine the time course of basal locomotor activity during photostimulation of these neurons.

In the present study, we observed that optogenetic activation of D2R-MSNs in NAc did not affect the initiation or expression of behavioral sensitization. However, photostimulation of D2R-MSNs during the drug withdrawal period blunted the expression of cocaine-induced sensitization. Therefore, our data indicate that D2R-MSNs are recruiting some signal specifically during the withdrawal period that goes on to alter gene expression or other forms of signaling and thereby trigger changes in synaptic plasticity, leading to alterations in cocaine-induced behavioral sensitization. How these MSNs employ cell-type specific adaptations that can produce their distinct consequences in addiction-related behaviors is not known. Grueter et al. (2013) suggested that ΔFosB in NAc differentially modulates synaptic properties and reward-related behaviors in a cell type- and subregion-specific fashion. Recently, Chandra et al. (2013) reported that repeated ChR2 activation of D1R-MSNs but not D2R-MSNs caused a down-regulation of Tiam1 gene, a protein involved in the rearrangement of the actin cytoskeleton, similar to the effects of cocaine. Therefore, to understand the mechanisms that yield lasting effects of drug-induced behaviors it will be important to delineate the cell-selective induction of molecular events in these MSNs that control synaptic adaptation to repetitive drug exposure.

In association with repetitive drug exposure, withdrawal has been suggested to play an important role because some changes appear only several weeks after the final exposure to cocaine. This suggests that abstinence is an important mediator in development of plasticity (Robinson and Berridge, 2003; Boudreau and Wolf, 2005; Boudreau et al., 2007; Kourrich et al., 2007). These observations raise the possibility that withdrawal itself might be a trigger for the changes in the NAc that are under the control of D2R-dependent signaling. Our result showing that activation of D2R-MSNs in NAc during drug withdrawal affect cocaine-induced behavioral sensitization provides compelling support for this idea.

It has previously been shown that repeated exposure to stress during drug withdrawal suppresses expression of cocaine-induced behavioral sensitization as well as cocaine-seeking and relapse behaviors in D2R KO mice (Sim et al., 2013). It is therefore interesting that photostimulation of D2R-MSNs during drug withdrawal also attenuates expression of sensitization. Stress-induced synaptic plasticity at glutamategic synapses is altered in the NAc of D2R KO mice (Sim et al., 2013). Although it is not yet known whether photostimulation of D2R MSNs or chronic stress during the withdrawal period elicits similar alterations in synaptic plasticity, our present findings support the hypothesis that D2R-MSNs of NAc play a key role in withdrawal-induced plasticity and may contribute to relapse after cessation of drug abuse. Further investigation will be required to find out the functional neural circuits in which D2R MSNs participate during drug withdrawal and to analyze and compare the consequences of D2R-MSNs photostimulation and chronic stress on synaptic plasticity in this particular circuit.

Another possible role for D2R-expressing MSNs could be to inhibit the output of D1R-MSNs from NAc. Previous research indicates that although MSNs project long axons to remote targets, extensive overlap occurs between axon collaterals and the dendritic trees of adjacent spiny projection neurons (Grofová, 1975; Preston et al., 1980; Wilson and Groves, 1980). This could indicate possible local synaptic connectivity for MSN within the NAc. Intracellular recordings from pairs of spiny projection neurons have identified functional inhibitory connections between MSNs in rat striatum (Czubayko and Plenz, 2002; Tunstall et al., 2002; Koos et al., 2004; Gustafson et al., 2006). It has been also reported that the synapses formed by recurrent collateral axons of MSNs in striatum are not random, D2R-MSNs make synaptic connections both with other D2R-MSNs and with D1R-MSNs, whereas D1R-MSNs almost exclusively form synaptic connections with other D1R-MSNs (Taverna et al., 2008). Although the GABAergic interconnection by local recurrent axonal collaterals between accumbal MSNs have also been reported (Taverna et al., 2004), it is still not clear yet whether D2R-MSNs randomly form local microcircuits or they contribute to microcircuits in NA with preferential connection as they do in striatum. Our data suggest that D2R-MSNs in NAc expressing ChR2 make synaptic connections with neighboring MSNs that express D1R, and that D2R-MSNs then exert an inhibitory contact to D1-MSNs to modulate the D1R-mediated promotion of addictive behaviors.

In conclusion, we have shown that optogenetic activation of NAc D2R-MSNs alters withdrawal-induced plasticity occurring during cocaine addiction. Given that activity of D2R-dependent signaling during the withdrawal period appears to be a key regulator of the expression of cocaine-induced behavioral sensitization, we propose that D2R-MSNs are an important mediator of long-lasting adaptation for drug-seeking and relapse. The identification of molecular substrates of D2R-dependent signaling, together with identification of specific circuit of NAc D2R-MSNs employed under repetitive drug exposure, should provide novel targets for therapeutic intervention in drug relapse.

Conflict of interest statement

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Acknowledgments

This work was supported by the National Research Foundation of Korea (NRF) grant funded by the Ministry of Science, ICT and Future Planning by the Brain Research Program (to Ja-Hyun Baik; Grant No. 2013M3C7A1056101) and by the Bio and Medical Technology Development Program (to Ja-Hyun Baik; Grant No. 2013M3A9D5072550) and the World Class Institute (WCI) program of the National Research Foundation of Korea (NRF) funded by the Ministry of Science, ICT and Future Planning (to George J. Augustine; WCI 2009-003), as well as by a Korea University Grant (to Ja-Hyun Baik) and a CRP grant from the National Research Foundation of Singapore (to George J. Augustine).

References

  1. Baik J. H. (2013). Dopamine signaling in reward-related behaviors. Front. Neural Circuits 7:152 10.3389/fncir.2013.00152 [PMC free article] [PubMed] [Cross Ref]
  2. Baik J. H., Picetti R., Saiardi A., Thiriet G., Dierich A., Depaulis A., et al. (1995). Parkinsonian-like locomotor impairment in mice lacking dopamine D2 receptors. Nature 377, 424–428 10.1038/377424a0 [PubMed] [Cross Ref]
  3. Berridge K. C. (2007). The debate over dopamine’s role in reward: the case for incentive salience. Psychopharmacology (Berl) 191, 391–431 10.1007/s00213-006-0578-x [PubMed] [Cross Ref]
  4. Bock R., Shin J. H., Kaplan A. R., Dobi A., Markey E., Kramer P. F., et al. (2013). Strenghtening the accumbal indirect pathway promotes resilience to compulsive cocaine use. Nat. Neurosci. 16, 632–638 10.1038/nn.3369 [PMC free article] [PubMed] [Cross Ref]
  5. Bocklisch C., Pascoli V., Wong J. C., House D. R., Yvon C., de Roo M., et al. (2013). Cocaine disinhibits dopamine neurons by potentiation of GABA transmission in the ventral tegmental area. Science 341, 1521–1525 10.1126/science.1237059 [PubMed] [Cross Ref]
  6. Boudreau A. C., Reimers J. M., Milovanovic M., Wolf M. E. (2007). Cell surface AMPA receptors in the rat nucleus accumbens increase during cocaine withdrawal but internalize after cocaine challenge in association with altered activation of mitogen-activated protein kinases. J. Neurosci. 27, 10621–10635 10.1523/jneurosci.2163-07.2007 [PMC free article] [PubMed] [Cross Ref]
  7. Boudreau A. C., Wolf M. E. (2005). Behavioral sensitization to cocaine is associated with increased AMPA receptor surface expression in the nucleus accumbens. J. Neurosci. 25, 9144–9151 10.1523/jneurosci.2252-05.2005 [PubMed] [Cross Ref]
  8. Chandra R., Lenz J. D., Gancarz A. M., Chaudhury D., Schroeder G. L., Han M. H., et al. (2013). Optogenetic inhibition of D1R containing nucleus accumbens neurons alters cocaine-mediated regulation of Tiam1. Front. Mol. Neurosci. 6:13 10.3389/fnmol.2013.00013 [PMC free article] [PubMed] [Cross Ref]
  9. Chang H. T., Kitai S. T. (1985). Projection neurons of the nucleus accumbens: an intracellular labeling study. Brain Res. 347, 112–116 10.1016/0006-8993(85)90894-7 [PubMed] [Cross Ref]
  10. Chausmer A. L., Elmer G. I., Rubinstein M., Low M. J., Grandy D. K., Katz J. L. (2002). Cocaine-induced locomotor activity and cocaine discrimination in dopamine D2 receptor mutant mice. Psychopharmacology (Berl) 163, 54–61 10.1007/s00213-002-1142-y [PubMed] [Cross Ref]
  11. Chevalier G., Deniau J. M. (1990). Disinhibition as a basic process in the expression of striatal functions. Trends Neurosci. 13, 277–280 10.1016/0166-2236(90)90109-n [PubMed] [Cross Ref]
  12. Czubayko U., Plenz D. (2002). Fast synaptic transmission between striatal spiny projection neurons. Proc. Natl. Acad. Sci. U S A 99, 15764–15769 10.1073/pnas.242428599 [PMC free article] [PubMed] [Cross Ref]
  13. Ferguson S. M., Eskenazi D., Ishikawa M., Wanat M. J., Phillips P. E., Dong Y., et al. (2011). Transient neuronal inhibition reveals opposing roles of indirect and direct pathways in sensitization. Nat. Neurosci. 14, 22–24 10.1038/nn.2703 [PMC free article] [PubMed] [Cross Ref]
  14. Goto Y., Grace A. A. (2005). Dopaminergic modulation of limbic and cortical drive of nucleus accumbens in goal-directed behavior. Nat. Neurosci. 8, 805–812 10.1038/nn1471 [PubMed] [Cross Ref]
  15. Grofová I. (1975). The identification of striatal and pallidal neurons projecting to substantia nigra. An experimental study by means of retrograde axonal transport of horseradish peroxidase. Brain Res. 91, 286–291 10.1016/0006-8993(75)90550-8 [PubMed] [Cross Ref]
  16. Grueter B. A., Robison A. J., Neve R. L., Nestler E. J., Malenka R. C. (2013). ΔFosB differentially modulates nucleus accumbens direct and indirect pathway function. Proc. Natl. Acad. Sci. U S A 110, 1923–1928 10.1073/pnas.1221742110 [PMC free article] [PubMed] [Cross Ref]
  17. Gustafson N., Gireesh-Dharmaraj E., Czubayko U., Blackwell K. T., Plenz D. (2006). A comparative voltage and current-clamp analysis of feedback and feedforward synaptic transmission in the striatal microcircuit in vitro. J. Neurophysiol. 95, 737–752 10.1152/jn.00802.2005 [PubMed] [Cross Ref]
  18. Hikida T., Kimura K., Wada N., Funabiki K., Nakanishi S. (2010). Distinct roles of synaptic transmission in direct and indirect striatal pathways to reward and aversive behavior. Neuron 66, 896–907 10.1016/j.neuron.2010.05.011 [PubMed] [Cross Ref]
  19. Kalivas P. W., Duffy P. (1990). Effect of acute and daily cocaine treatment on extracellular dopamine in the nucleus accumbens. Synapse 5, 48–58 10.1002/syn.890050104 [PubMed] [Cross Ref]
  20. Kalivas P. W., Pierce R. C., Cornish J., Sorg B. A. (1998). A role for sensitization in craving and relapse in co