Drug experience epigenetically primes Fosb gene inducibility in rat nucleus accumbens (2012)

Printer-friendly version

COMMENTS: Evidence that deltafosb leaves behind traces long after recovery from addiction. Specifically addiction causes epigenetic changes, that result in much faster induction of deltafosb when relapse occurs. This explains how relapsing, even after years can rapidly escalate to a full blown addicted state.



J Neurosci. Author manuscript; available in PMC 2013 January 25.

 

Abstract

ΔFosB, a Fosb gene product, is induced in nucleus accumbens (NAc) and caudate putamen (CPu) by repeated exposure to drugs of abuse such as cocaine. This induction contributes to aberrant patterns of gene expression and behavioral abnormalities seen with repeated drug exposure.

Here, we assessed whether a remote history of drug exposure in rats might alter inducibility of the Fosb gene elicited by subsequent cocaine exposure. We show that prior chronic cocaine administration, followed by extended withdrawal, increases inducibility of Fosb in NAc as evidenced by greater acute induction of ΔFosB mRNA and faster accumulation of ΔFosB protein after repeated cocaine re-exposure. No such primed Fosb induction was observed in CPu, in fact, subsequent acute induction of ΔFosB mRNA was suppressed in CPu.

These abnormal patterns of Fosb expression are associated with chromatin modifications at the Fosb gene promoter. Prior chronic cocaine administration induces a long-lasting increase in RNA polymerase II (Pol II) binding at the Fosb promoter in NAc only, suggesting that Pol II “stalling” primes Fosb for induction in this region upon re-exposure to cocaine. A cocaine challenge then triggers the release of Pol II from the gene promoter, allowing for more rapid Fosb transcription. A cocaine challenge also decreases repressive histone modifications at the Fosb promoter in NAc, but increases such repressive marks and decreases activating marks in CPu.

These results provide new insight into the chromatin dynamics at the Fosb promoter and reveal a novel mechanism for primed Fosb induction in NAc upon re-exposure to cocaine.

Introduction

Drug addiction is characterized by compulsive drug seeking and taking despite severe adverse consequences (Kalivas et al., 2005; Hyman et al., 2006). Chronic drug exposure causes persistent changes in gene expression in ventral striatum (or nucleus accumbens; NAc) and dorsal striatum (or caudate putamen; CPu), striatal structures implicated in drug reward and addiction (Freeman et al., 2001; Robinson and Kolb, 2004; Shaham and Hope, 2005; Maze and Nestler, 2011). ΔFosB, a truncated and stable protein encoded by the immediate-early gene, Fosb, is a well-characterized transcription factor induced in NAc and CPu by chronic exposure to virtually all drugs of abuse, where it mediates sensitized behavioral responses to repeated drug administration (Nestler, 2008). However, whether prior chronic exposure to a drug of abuse alters subsequent induction of ΔFosB remains unknown.

We hypothesized recently that chromatin modifications in response to chronic drug exposure might alter the inducibility of specific genes in target brain regions (Robison and Nestler, 2011). Increasing evidence has shown that drugs of abuse after chronic administration alter the structure and transcriptional accessibility of chromatin through numerous types of modifications, including phosphorylation, acetylation, and methylation of histone tails. More recent work in cell culture systems has focused on the recruitment of RNA polymerase II (Pol II) to the promoter of “inducible” genes prior to their expression, with Pol II bound persistently to proximal promoter regions and around the transcription start site (TSS) in a “stalled” state (Core and Lis, 2008; Nechaev and Adelman, 2008). Activation of the stalled Pol II is then thought to be responsible for its escape from promoter and TSS regions and its transcription of these “primed” genes(Zeitlinger et al., 2007; Saha et al., 2011; Bataille et al., 2012).

Here, we show that prior chronic exposure to cocaine, followed by an extended withdrawal period, alters the induciblity of the Fosb gene to subsequent cocaine administration, with NAc being primed for induction while CPu is not. We then identify distinct chromatin signatures at the Fosb gene promoter in NAc and CPu that are associated with such aberrant inducibility of the Fosb gene, including the recruitment of stalled Pol II at the Fosb proximal promoter in NAc only as well as changes in several activating or repressive histone modifications in both brain regions. These results provide novel insight into the chromatin dynamics at the Fosb gene promoter and indicate for the first time a mechanism by which stalling of Pol II primes Fosb for greater activation in NAc upon re-exposure to cocaine.

Materials and Methods

Animals

Male Sprague Dawley rats (250–275 g; Charles River Laboratories), used in all experiments, were pair-housed in a climate-controlled room on a 12 hr light/dark cycle (lights on at 7 AM) with access to food and water ad libitum. All animals were injected twice a day for ten days with cocaine (15 mg/kg, i.p.) or saline (i.p.) in their home cages. Animal experiments were approved by the Institutional Animal Care and Use Committee (IACUC) at Mount Sinai.

Locomotor measurements

Animals were habituated in the locomotor chamber the first day for 1 hr, and then monitored for locomotor activity after a saline injection using the Photobeam Activity System (San Diego Instruments). After 1 hr habituation in the locomotor chambers each day, cocaine (15 mg/kg, i.p.) was administered daily for 2 days and animals were again monitored for locomotor activity for 1 hr.

Immunohistochemistry

Animals were perfused 24 hr after their last drug exposure. ΔFosB/FosB immunoreactivity was detected as described (Perrotti et al., 2004). Western blotting confirmed that all of the ΔFosB/FosB-like immunoreactivity observed 24 hr or longer after cocaine injections reflected ΔFosB, with FosB being undetectable (not shown).

RNA isolation, reverse transcription, and PCR

Bilateral 12-gauge punches of NAc and dorsolateral/dorsomedial CPu were obtained as described (Perrotti et al., 2004), frozen on dry ice and processed according to published protocols (Covington et al., 2011). ΔFosB and FosB mRNA was measured using quantitative PCR (qPCR) with isoform specific ΔFosB and FosB primers (Alibhai et al., 2007). ΔFosB and FosB mRNA levels were normalized to GAPDH mRNA levels, which were not affected by cocaine exposure (not shown).

Western blotting

NAc and CPu punches were collected as above and processed for Western blotting as described (Covington et al., 2011), using antibodies against ERK44/42 [extracellular signal regulated kinase-44/42] and phosphoERK44/42 (pERK), AKT [thymoma viral proto-oncogene] and p-AKT, SRF (serum response factor), and pSRF, CREB [cAMP response element binding protein], and pCREB. The amount of protein blotted onto each lane was normalized to levels of actin or tubulin, which were unaffected by cocaine exposure.

Chromatin immunoprecipitation (ChIP)

Freshly dissected NAc and CPu punches were prepared for ChIP as described (Maze et al., 2010). Each experimental condition was analyzed in triplicate from independent groups of animals. For each ChIP sample, bilateral NAc and CPu punches were pooled from five rats (10 punches). The antibodies used for specific histone modifications are as the same as those published (Maze et al., 2010); antibodies to Pol II phosphorylated at Ser5 of its carboxyl terminal domain (CTD) repeat region (Pol II-pSer5) was obtained from abcam 5131. Four sets of ChIP primers were designed for Fosb (Lazo et al., 1992; Mandelzys et al., 1997): 1F: GTACAGCGGAGGTCTGAAGG, 1R: GAGTGGGATGAGATGCGAGT; 2F: CATCCCACTCGGCCATAG, 2R: CCACCGAAGACAGGTACTGAG; 3F: GCTGCCTTTAGCCAATCAAC, 3R: CCAGGTCCAAAGAAAGTCCTC; 4F: GGGTGTTTGTGTGTGAGTGG, 4R: AGAGGAGGCTGGACAGAACC. Levels of chromatin modifications are compared to those for input DNA as described (Maze et al., 2010).

Statistical analysis

All values reported are mean ± s.e.m. Data for locomotor activity and cell-counting were analyzed by two-way ANOVAs with treatment and injection as factors. qPCR experiments were analyzed per time point by one-way ANOVAs with treatment as a factor. When significant main effects were observed (p<0.05), Bonferroni post-hoc tests were conducted for comparisons to drug-naïve saline-treated animals (^ in figures) and drug-naïve cocaine-treated animals (* in figures). Unpaired two-tailed Student t-tests were used for Western blotting and ChIP data, with corrections for multiple comparisons.

Results

Greater Fosb inducibility in NAc, but not CPu, of cocaine-experienced rats

To examine the influence of a prior chronic course of cocaine, followed by a prolonged period of withdrawal, on inducibility of the Fosb gene in response to a subsequent cocaine challenge, rats that were previously injected i.p. twice daily with saline or cocaine (15 mg/kg) for 10 days were given challenge doses of the drug after 28 days of withdrawal (Fig 1A). We first measured locomotor responses in one group of animals to confirm the induction of locomotor sensitization by prior cocaine exposure, an expected lasting consequence of drug administration. Cocaine-experienced and -naïve rats showed equivalent baseline locomotor activity, with a cocaine challenge to drug-naïve animals increasing their locomotion (Fig 1B. Repeated measures two-way ANOVA, treatment: F1,66 =30.42, p<0.0001; cocaine challenge: F2,66=58.39, p<0.0001; treatment x cocaine challenge: F2,66=8.56, p=0.0005, Bonferroni post-tests ^p<0.001). This cocaine challenge induced significantly greater locomotor activity, i.e., sensitization, in cocaine-experienced rats (Bonferroni post-tests *p<0.001).

Figure 1  
Effect of prior chronic cocaine exposure on locomotor activity and Fosb induction in NAc and CPu upon re-exposure to the drug

To evaluate the effects of this cocaine-pretreatment regimen on ΔFosB expression in NAc and CPu, we measured ΔFosB protein with immunohistochemical methods 24 hr after cocaine-naïve and cocaine-experienced animals were treated with 0, 1, 3, or 6 daily cocaine challenge injections (15 mg/kg; see Fig 1A). As previously established (Nye et al., 1995), 3 cocaine injections were sufficient to significantly induce ΔFosB protein in NAc and CPu of drug-naïve animals and its accumulation remained significant after 6 days of cocaine injections (Fig 1C. Repeated measures two-way ANOVA, NAc core, treatment: F1,28=23.5, p<0.0001; cocaine challenge: F3,28=49.16, p<0.0001; treatment x cocaine challenge: F3,28=6.83, p=0.0014; NAc shell, treatment: F1,28=18.69, p<0.0001; cocaine challenge: F3,28=31.52, p<0.0001; treatment x cocaine challenge: F3,28=3.21, p<0.05; CPu, treatment: F1,28=9.47, p<0.001; cocaine challenge: F3,28=19.74, p<0.0001; treatment x cocaine challenge: F3,28=0.94, p>0.05. In NAc core, shell, and CPu, Bonferroni post-tests ^p<0.05). In cocaine-experienced animals, there was no evidence of persisting ΔFosB induction in NAc or CPu after 28 days of withdrawal, consistent with prior reports that the ΔFosB signal fully dissipates by this time point (Nye et al., 1995), the reason this time point was used in this study. Strikingly, however, cocaine-experienced rats that received 3 or 6 cocaine challenge injections showed significantly greater ΔFosB protein induction in NAc, an effect apparent in both core and shell subregions (Fig 1C. Bonferroni post-tests *p<0.05). In contrast, no such greater induction of ΔFosB protein was observed in CPu; instead, equivalent ΔFosB induction was seen in this region after 3 or 6 days of cocaine challenge injections in cocaine-naïve and -experienced rats (Fig 1C).

To gain insight into the transcriptional alterations occurring in NAc and CPu in response to a cocaine challenge, we studied the time course (45, 90, and 180 min) of the inducibility of ΔFosB and FosB mRNA transcripts upon a single cocaine or saline injection given to cocaine-naïve and -experienced rats after 28 days of withdrawal (see Fig 1A). Relative to a saline challenge, a cocaine challenge induced a rapid increase in ΔFosB and FosB mRNA levels at all three time points in both NAc and CPu of cocaine-naïve animals (Fig 1D. Repeated measures one way ANOVA per time point; Bonferroni post-tests ^p<0.05). In NAc, we observed greater ΔFosB and FosB mRNA induction in cocaine-experienced animals compared with cocaine-naïve animals after the cocaine challenge, the effect being significant at 90 min while, in contrast, the inducibility of ΔFosB and FosB mRNA in CPu was significantly decreased in cocaine-experienced animals (Fig 1D. Bonferroni post-tests %p=0.08, *p<0.05).

Characterization of upstream signaling pathways in NAc and CPu of cocaine-experienced rats

One possible explanation for the altered inducibility of the Fosb gene in NAc and CPu after a prior chronic course of cocaine is that a remote history of cocaine exposure might induce lasting changes in signaling pathways that are upstream of Fosb gene induction such that a cocaine challenge then induces the gene to an aberrant degree. To study this hypothesis, we analyzed the two transcription factors, SRF and CREB, that have been shown recently to be required for cocaine induction of ΔFosB in these brain regions (Vialou et al., 2012) along with upstream protein kinases, ERK and AKT, also implicated in cocaine action (Valjent et al., 2000; Lu et al., 2006; Boudreau et al., 2009). We failed to detect any changes in total or phosphorylated levels of these various proteins that could explain the altered induciblility of Fosb observed, including no changes in SRF, CREB, or AKT (Fig 2B, C). The lack of change in pSRF and pCREB in NAc in response to a cocaine challenge is consistent with a recent report, which found both induced significantly by chronic cocaine only (Vialou et al., 2012).

Figure 2  
Effect of prior chronic cocaine exposure on upstream molecular signaling cascades in NAc and CPu

In NAc and CPu of drug-naïve animals, 20 min after an initial drug exposure (Fig 2A), a single cocaine challenge decreased levels of pERK42/44 (Fig 2B, C. Two tailed Student t-test: *p<0.05). There are previous reports of increased pERK levels in these regions after acute cocaine administration (Valjent et al., 2000). This is difficult to compare to other papers examining ERK phosphorylation in NAc during withdrawal from repeated cocaine injections (Boudreau et al., 2007; Shen et al., 2009), as in our study pERK was quantified after 28 days of withdrawal and after a cocaine or saline challenge. Relative to drug-naïve animals experiencing cocaine for the first time, re-exposure to cocaine in cocaine-experienced rats, after 28 days of withdrawal, caused a significant increase in pERK42/44 levels in CPu (Fig 2B, C. Two tail student t-test: *p<0.05).

Chromatin landscape at the Fosb gene promoter in NAc and CPu of cocaine-experienced rats

We next investigated whether changes in Fosb gene inducibility are associated with alterations in its chromatin structure. ChIP was performed on NAc and CPu using antibodies directed against three well characterized forms of histone modifications: trimethylation of Lys4 of histone H3 (H3K4me3) associated with gene activation, and H3K27me3 and H3K9me2 associated with gene repression. We analyzed cocaine-naïve and -experienced rats after 28 days of withdrawal either without or with a challenge injection of cocaine, with animals examined 1 hr later (Fig 3A). In NAc, we found no significant changes in the binding of any of these three histone modifications to the Fosb gene promoter in the absence of a cocaine challenge, although there was a trend for reduced levels of H3K9me2 (Fig 3B-D. Two tailed Student t-test. #p=0.2 compared to respective Drug Naïve controls). This effect became significant after a cocaine challenge and was specific for the proximal promoter region of the gene (Fig 3C. *p<0.05). While levels of H3K9me2 are very low at some genes, the Fosb gene promoter shows appreciable levels of this mark in NAc under control conditions (Maze et al., 2010, data not shown). In contrast, in CPu, we found small but significant decreases in H3K4me3 binding, and increases in H3K27me3 binding, at the Fosb promoter in the absence of a cocaine challenge, effects lost after the challenge (Fig 3D. *p<0.05).

Figure 3  
Effect of prior chronic cocaine exposure on epigenetic priming of the Fosb gene in NAc and CPu

We next investigated Pol II binding to the Fosb gene, based on recent findings in cell culture that stalling of Pol II at TSSs, which is characterized by its phosphorylation at Ser 5 in its CTD repeat region, is associated with priming of genes (see Introduction). We thus analyzed Pol II-pSer5 binding to Fosb at four distinct regions of the gene (Fig 3B). This analysis revealed a significant enrichment of Pol II-pSer5 at the Fosb gene at its proximal promoter region and around its TSS in NAc of cocaine-experienced animals, after prolonged withdrawal, in the absence of a cocaine challenge compared to controls (Fig 3E. *p<0.05). This enrichment was not apparent at two gene body regions of Fosb, consistent with Pol II stalling described in simpler experimental systems. Interestingly, after a cocaine challenge, Pol II-pSer5 binding still showed signs of enrichment, though no longer significantly, at the Fosb proximal promoter region (Fig 3E. %p=0.1), but returned to control levels at the TSS. Findings in CPu were more variable, with no clear pattern of Pol II-pSer5 binding observed.

Discussion

The present study provides new insight into the sustained regulation of Fosb weeks after cessation of repeated exposure to cocaine. We show that prior chronic cocaine administration renders the Fosb gene more inducible in NAc, resulting in faster accumulation of ΔFosB upon re-exposure to the drug. Given the preponderance of evidence that ΔFosB induction in NAc mediates sensitized behavioral responses to cocaine (Nestler, 2008), our findings reveal a novel mechanism for the more rapid reinstatement of such sensitized responses after prolonged withdrawal.

We demonstrate that the enhanced induction of ΔFosB in NAc is associated with chromatin changes at the Fosb gene that would be expected to prime it for greater induction. Thus, we show increased Pol II binding to the proximal promoter and TSS regions of the gene that are present after 4 weeks of withdrawal from prior chronic cocaine administration. Such Pol II enrichment at the TSS is lost rapidly upon cocaine challenge and Fosb induction, consistent with a model in cell culture that stalled Pol II is released from TSSs upon gene activation (see Introduction). A cocaine challenge also induces a rapid decrease in binding of H3K9me2—a mark of gene repression—to the Fosb promoter. In contrast, we detected no lasting induction of several transcription factors, or of their upstream kinases, that are known to mediate Fosb induction by cocaine. These results support our hypothesis that the enhanced induction of ΔFosB in NAc is mediated via epigenetic priming of the Fosb gene and not via upregulation of upstream events.

Very different results were obtained for CPu. There was no evidence for Pol II stalling at Fosb in cocaine-experienced rats prior to a cocaine challenge, although there were small but significant histone modifications consistent with gene repression: increased H3K27me3 binding and decreased H3K4me3 binding. There was also no change in upstream transcription factors or kinases consistent with reduced Fosb induction. These findings suggest that after chronic cocaine administration, epigenetic modifications serve to dampen Fosb gene inducibility in CPu, in contrast to the priming seen in NAc. However, while these effects repress ΔFosB mRNA induction upon re-exposure to cocaine, there is no loss in accumulation of ΔFosB protein. The mechanism underlying this paradox now requires further investigation.

More generally, our results support a model where alterations in the chromatin landscape at specific genes in response to chronic cocaine administration serve to prime or blunt those genes for subsequent induction upon re-exposure to the drug. Such chromatin changes, which can be viewed as “epigenetic scars,” would be missed in analyses of steady-state mRNA levels of genes. In this way, characterization of the epigenome of addiction promises to reveal fresh information about the molecular pathogenesis of the disorder, which can be mined for the development of new treatments.

Acknowledgements

This work was supported by grants from the National Institute on Drug Abuse.

References

  • Alibhai IN, Green TA, Potashkin JA, Nestler EJ. Regulation of fosB and DeltafosB mRNA expression: in vivo and in vitro studies. Brain Res. 2007;1143:22–33. [PMC free article] [PubMed]
  • Bataille AR, Jeronimo C, Jacques PE, Laramee L, Fortin ME, Forest A, Bergeron M, Hanes SD, Robert F. A Universal RNA Polymerase II CTD Cycle Is Orchestrated by Complex Interplays between Kinase, Phosphatase, and Isomerase Enzymes along Genes. Mol Cell. 2012;45:158–170. [PubMed]
  • Boudreau AC, Reimers JM, Milovanovic M, Wolf ME. Cell surface AMPA receptors in the rat nucleus accumbens increase during cocaine withdrawal but internalize after cocaine challenge in association with altered activation of mitogen-activated protein kinases. J Neurosci. 2007;27:10621–10635. [PMC free article] [PubMed]
  • Boudreau AC, Ferrario CR, Glucksman MJ, Wolf ME. Signaling pathway adaptations and novel protein kinase A substrates related to behavioral sensitization to cocaine. J Neurochem. 2009;110:363–377. [PMC free article] [PubMed]
  • Core LJ, Lis JT. Transcription regulation through promoter-proximal pausing of RNA polymerase II. Science. 2008;319:1791–1792. [PMC free article] [PubMed]
  • Covington HE, 3rd, Maze I, Sun H, Bomze HM, DeMaio KD, Wu EY, Dietz DM, Lobo MK, Ghose S, Mouzon E, Neve RL, Tamminga CA, Nestler EJ. A role for repressive histone methylation in cocaine-induced vulnerability to stress. Neuron. 2011;71:656–670. [PMC free article] [PubMed]
  • Freeman WM, Nader MA, Nader SH, Robertson DJ, Gioia L, Mitchell SM, Daunais JB, Porrino LJ, Friedman DP, Vrana KE. Chronic cocaine-mediated changes in non-human primate nucleus accumbens gene expression. J Neurochem. 2001;77:542–549. [PubMed]
  • Hyman SE, Malenka RC, Nestler EJ. Neural mechanisms of addiction: the role of reward-related learning and memory. Annu Rev Neurosci. 2006;29:565–598. [PubMed]
  • Kalivas PW, Volkow N, Seamans J. Unmanageable motivation in addiction: a pathology in prefrontal-accumbens glutamate transmission. Neuron. 2005;45:647–650. [PubMed]
  • Lazo PS, Dorfman K, Noguchi T, Mattei MG, Bravo R. Structure and mapping of the fosB gene. FosB downregulates the activity of the fosB promoter. Nucleic Acids Res. 1992;20:343–350. [PMC free article] [PubMed]
  • Lu L, Koya E, Zhai H, Hope BT, Shaham Y. Role of ERK in cocaine addiction. Trends Neurosci. 2006;29:695–703. [PubMed]
  • Mandelzys A, Gruda MA, Bravo R, Morgan JI. Absence of a persistently elevated 37 kDa fos-related antigen and AP-1-like DNA-binding activity in the brains of kainic acid-treated fosB null mice. J Neurosci. 1997;17:5407–5415. [PubMed]
  • Maze I, Nestler EJ. The epigenetic landscape of addiction. Ann N Y Acad Sci. 2011;1216:99–113. [PMC free article] [PubMed]
  • Maze I, Covington HE, 3rd, Dietz DM, LaPlant Q, Renthal W, Russo SJ, Mechanic M, Mouzon E, Neve RL, Haggarty SJ, Ren Y, Sampath SC, Hurd YL, Greengard P, Tarakhovsky A, Schaefer A, Nestler EJ. Essential role of the histone methyltransferase G9a in cocaine-induced plasticity. Science. 2010;327:213–216. [PMC free article] [PubMed]
  • Nechaev S, Adelman K. Promoter-proximal Pol II: when stalling speeds things up. Cell Cycle. 2008;7:1539–1544. [PubMed]
  • Nestler EJ. Review. Transcriptional mechanisms of addiction: role of DeltaFosB. Philos Trans R Soc Lond B Biol Sci. 2008;363:3245–3255. [PMC free article] [PubMed]
  • Nye HE, Hope BT, Kelz MB, Iadarola M, Nestler EJ. Pharmacological studies of the regulation of chronic FOS-related antigen induction by cocaine in the striatum and nucleus accumbens. J Pharmacol Exp Ther. 1995;275:1671–1680. [PubMed]
  • Perrotti LI, Hadeishi Y, Ulery PG, Barrot M, Monteggia L, Duman RS, Nestler EJ. Induction of deltaFosB in reward-related brain structures after chronic stress. J Neurosci. 2004;24:10594–10602. [PubMed]
  • Robinson TE, Kolb B. Structural plasticity associated with exposure to drugs of abuse. Neuropharmacology 47 Suppl. 2004;1:33–46. [PubMed]
  • Robison AJ, Nestler EJ. Transcriptional and epigenetic mechanisms of addiction. Nat Rev Neurosci. 2011;12:623–637. [PMC free article] [PubMed]
  • Saha RN, Wissink EM, Bailey ER, Zhao M, Fargo DC, Hwang JY, Daigle KR, Fenn JD, Adelman K, Dudek SM. Rapid activity-induced transcription of Arc and other IEGs relies on poised RNA polymerase II. Nat Neurosci. 2011;14:848–856. [PMC free article] [PubMed]
  • Shaham Y, Hope BT. The role of neuroadaptations in relapse to drug seeking. Nat Neurosci. 2005;8:1437–1439. [PubMed]
  • Shen HW, Toda S, Moussawi K, Bouknight A, Zahm DS, Kalivas PW. Altered dendritic spine plasticity in cocaine-withdrawn rats. J Neurosci. 2009;29:2876–2884. [PMC free article] [PubMed]
  • Valjent E, Corvol JC, Pages C, Besson MJ, Maldonado R, Caboche J. Involvement of the extracellular signal-regulated kinase cascade for cocaine-rewarding properties. J Neurosci. 2000;20:8701–8709. [PubMed]
  • Zeitlinger J, Stark A, Kellis M, Hong JW, Nechaev S, Adelman K, Levine M, Young RA. RNA polymerase stalling at developmental control genes in the Drosophila melanogaster embryo. Nat Genet. 2007;39:1512–1516. [PMC free article] [PubMed]
  • Vialou VF, Feng J, Robison AJ, Ferguson D, Scobie KN, Mazei-Robison M, Mouzon E, Nestler EJ. Serum response factor and cAMP response element binding protein are both required for cocaine induction of ΔFosB. J Neurosci. 2012 accepted. [PMC free article] [PubMed]