La experiencia farmacológica estimula de forma epigenética la inducibilidad del gen Fosb en el núcleo de rata accumbens (2012)

COMENTARIOS: Evidencia de que el deltafosb deja rastros mucho después de recuperarse de la adicción. Específicamente, la adicción causa cambios epigenéticos, que resultan en una inducción mucho más rápida de deltafosb cuando ocurre una recaída. Esto explica cómo las recaídas, incluso después de años, pueden escalar rápidamente a un estado adicto completo.



J Neurosci. Manuscrito del autor; Disponible en PMC 2013 Enero 25.

 

Resumen

ΔFosB, un Fosb El producto genético, se induce en el núcleo accumbens (NAc) y el caudato putamen (CPu) por la exposición repetida a drogas de abuso como la cocaína. Esta inducción contribuye a patrones aberrantes de expresión génica y anomalías de comportamiento observadas con la exposición repetida al fármaco.

Aquí, evaluamos si un historial remoto de exposición al fármaco en ratas podría alterar la inducibilidad de la Fosb Gen inducido por la posterior exposición a la cocaína. Mostramos que la administración previa crónica de cocaína, seguida de un retiro prolongado, aumenta la inducibilidad de Fosb en NAc como lo demuestra una mayor inducción aguda de ARNm de ΔFosB y una acumulación más rápida de proteína ΔFosB después de la repetida reexposición a la cocaína. No hay tal imprimación Fosb la inducción se observó en CPu, de hecho, la inducción aguda posterior del ARNm de ΔFosB se suprimió en CPu.

Estos patrones anormales de Fosb expresión están asociados con modificaciones de la cromatina en el Fosb promotor genético. La administración previa crónica de cocaína induce un aumento de larga duración en la unión de la ARN polimerasa II (Pol II) en el Fosb promotor solo en NAc, lo que sugiere que Pol II "se estanca" primos Fosb para la inducción en esta región tras la reexposición a la cocaína. Un desafío de la cocaína luego dispara la liberación de Pol II del promotor genético, lo que permite una mayor velocidad. Fosb transcripción. Un desafío con la cocaína también disminuye las modificaciones represivas de las histonas en el Fosb promotor en NAc, pero aumenta tales marcas represivas y disminuye las marcas de activación en CPu.

Estos resultados proporcionan una nueva visión de la dinámica de la cromatina en el Fosb Promotor y revelador de un novedoso mecanismo de cebado. Fosb Inducción en NAc tras la reexposición a la cocaína.

Introducción

La adicción a las drogas se caracteriza por la búsqueda y el consumo compulsivo de drogas a pesar de las graves consecuencias adversas (Kalivas et al., 2005; Hyman et al., 2006). La exposición crónica a medicamentos causa cambios persistentes en la expresión génica en el estriado ventral (o núcleo accumbens; NAc) y en el estriado dorsal (o caudado putamen; CPu), estructuras estriatales implicadas en la recompensa y la adicción al medicamento. (Freeman et al., 2001; Robinson y Kolb, 2004; Shaham y la esperanza, 2005; Maze y Nestler, 2011). ΔFosB, una proteína truncada y estable codificada por el gen inmediato inmediato, Fosb, es un factor de transcripción bien caracterizado inducido en NAc y CPu por exposición crónica a prácticamente todas las drogas de abuso, donde media respuestas de comportamiento sensibilizadas a la administración repetida de drogas. (Nestler, 2008). Sin embargo, se desconoce si la exposición crónica previa a una droga de abuso altera la inducción posterior de ΔFosB.

Nuestra hipótesis es que las modificaciones de la cromatina en respuesta a la exposición crónica a medicamentos podrían alterar la inducibilidad de genes específicos en regiones del cerebro objetivo (Robison y Nestler, 2011). La evidencia creciente ha demostrado que los fármacos de abuso después de la administración crónica alteran la estructura y el acceso transcripcional de la cromatina a través de numerosos tipos de modificaciones, incluida la fosforilación, la acetilación y la metilación de las colas de histonas. Un trabajo más reciente en sistemas de cultivo celular se ha centrado en el reclutamiento de la ARN polimerasa II (Pol II) para el promotor de genes "inducibles" antes de su expresión, con Pol II unida persistentemente a las regiones promotoras proximales y alrededor del sitio de inicio de la transcripción (TSS). ) en un estado "estancado" (Core y Lis, 2008; Nechaev y Adelman, 2008). Se piensa entonces que la activación de la Pol II estancada es responsable de su escape de las regiones promotoras y SST y de su transcripción de estos genes "cebados" (Zeitlinger et al., 2007; Saha et al., 2011; Bataille et al., 2012).

Aquí, mostramos que la exposición crónica previa a la cocaína, seguida de un período de retiro prolongado, altera la indiferencia de la Fosb gen para la posterior administración de cocaína, con NAc preparada para la inducción, mientras que CPu no lo está. Luego identificamos distintas firmas de cromatina en el Fosb promotor de genes en NAc y CPu que están asociados con una inducibilidad tan aberrante de la Fosb gen, incluyendo el reclutamiento de Pol II estancado en el Fosb El promotor proximal en NAc solo así como los cambios en varias modificaciones de histonas activadoras o represivas en ambas regiones del cerebro. Estos resultados proporcionan una visión novedosa de la dinámica de la cromatina en el Fosb promotor de genes e indica por primera vez un mecanismo por el cual el estancamiento de los primos Pol II Fosb para una mayor activación en NAc tras la reexposición a la cocaína.

Materiales y Métodos

Animales

Las ratas Sprague Dawley macho (250 – 275 g; Charles River Laboratories), utilizadas en todos los experimentos, se alojaron en parejas en una habitación con clima controlado en un ciclo de luz / oscuridad 12 hr (se encienden las luces en 7 AM) con acceso a alimentos y agua ad libitum. Todos los animales fueron inyectados dos veces al día durante diez días con cocaína (15 mg / kg, ip) o solución salina (ip) en sus jaulas. Los experimentos con animales fueron aprobados por el Comité Institucional de Cuidado y Uso de Animales (IACUC) en Mount Sinai.

Mediciones locomotoras

Los animales se habituaron en la cámara locomotora el primer día durante 1 hr, y luego se monitorearon para determinar la actividad locomotora después de una inyección de solución salina utilizando el Sistema de Actividad Photobeam (San Diego Instruments). Después de la habituación de 1 hr en las cámaras locomotoras cada día, se administró cocaína (15 mg / kg, ip) diariamente durante los días de 2 y se controló nuevamente a los animales para determinar la actividad locomotora de 1 hr.

Inmunohistoquímica

Los animales se perfundieron 24 hr después de su última exposición al fármaco. La inmunorreactividad de ivityFosB / FosB se detectó como se describe (Perrotti et al., 2004). La transferencia de Western confirmó que toda la inmunorreactividad de tipo osFosB / FosB observó 24 hr o más después de que las inyecciones de cocaína reflejaron ΔFosB, siendo el FosB indetectable (no se muestra).

Aislamiento de ARN, transcripción inversa y PCR.

Los punzones de calibre 12 bilaterales de NAc y dorulateral / dorsomedial CPu se obtuvieron como se describe (Perrotti et al., 2004), congelados en hielo seco y procesados ​​según los protocolos publicados (Covington et al., 2011). El ARNm de ΔFosB y FosB se midió usando PCR cuantitativa (qPCR) con los cebadores específicos de ΔFosB y FosB de isoformas (Alibhai et al., 2007). Los niveles de ARNm de BFosB y FosB se normalizaron a los niveles de ARNm de GAPDH, que no se vieron afectados por la exposición a la cocaína (no se muestra).

Western blotting

Los punzones NAc y CPu se recolectaron como se indicó anteriormente y se procesaron para la transferencia Western como se describe (Covington et al., 2011), utilizando anticuerpos contra ERK44 / 42 [quinasa regulada por señal extracelular-44 / 42] y phosphoERK44 / 42 (pERK), AKT [proto-oncogén viral del timoma] y p-AKT, SRF (factor de respuesta del suero), y pSRF, RA [proteína de unión al elemento de respuesta cAMP], y pCREB. La cantidad de proteína secada en cada carril se normalizó a los niveles de actina o tubulina, que no se vieron afectados por la exposición a la cocaína.

Inmunoprecipitación de cromatina (ChIP)

Se prepararon punzones NAc y CPu recién diseccionados para ChIP como se describe (Maze et al., 2010). Cada condición experimental se analizó por triplicado de grupos independientes de animales. Para cada muestra de ChIP, se combinaron los punzones NAc y CPu bilaterales de cinco ratas (punzones 10). Los anticuerpos utilizados para modificaciones específicas de histonas son los mismos que los publicados (Maze et al., 2010); Los anticuerpos para Pol II fosforilados en Ser5 de su región de repetición del dominio del terminal carboxilo (CTD) (Pol II-pSer5) se obtuvieron de abcam 5131. Cuatro conjuntos de cebadores ChIP fueron diseñados para Fosb (Lazo et al., 1992; Mandelzys et al., 1997): 1F: GTACAGCGGAGGTCTGAAGG, 1R: GAGTGGGATGAGATGCGAGT; 2F: CATCCCACTCGGCCATAG, 2R: CCACCGAAGACAGGTACTGAG; 3F: GCTGCCTTTAGCCAATCAAC, 3R: CCAGGTCCAAAGAAAGTCCTC; 4F: GGGTGTTTGTGTGTGAGTGG, 4R: AGAGGAGGCTGGACAGAACC. Los niveles de modificación de la cromatina se comparan con los del ADN de entrada como se describe (Maze et al., 2010).

análisis estadístico

Todos los valores informados son la media ± sem. Los datos para la actividad locomotora y el recuento de células se analizaron mediante ANOVA de dos vías con tratamiento e inyección como factores. Los experimentos de qPCR se analizaron por punto de tiempo mediante ANOVA unidireccionales con el tratamiento como factor. Cuando se observaron efectos principales significativos (p <0.05), se realizaron pruebas post-hoc de Bonferroni para realizar comparaciones con animales tratados con solución salina sin tratamiento previo (^ en cifras) y animales tratados con cocaína sin tratamiento previo (* en cifras). Se utilizaron pruebas t de Student de dos colas no apareadas para la transferencia de Western y los datos de ChIP, con correcciones para comparaciones múltiples.

Resultados

Mayor Inductibilidad de Fosb en NAc, pero no en CPu, de ratas experimentadas con cocaína

Examinar la influencia de un curso crónico previo de cocaína, seguido de un período prolongado de abstinencia, sobre la inducibilidad de la cocaína. Fosb En respuesta a un desafío posterior a la cocaína, a las ratas que se inyectaron previamente ip dos veces al día con solución salina o cocaína (15 mg / kg) durante los días 10 se administraron dosis de prueba del fármaco después de 28 días de abstinencia (Fig 1A). Primero medimos las respuestas locomotoras en un grupo de animales para confirmar la inducción de la sensibilización locomotora por exposición previa a la cocaína, una consecuencia esperada y duradera de la administración de drogas. Las ratas experimentadas por la cocaína y las naïve mostraron una actividad locomotora basal equivalente, con un desafío de la cocaína a los animales sin droga que aumentaron su locomoción (Fig 1B. Medidas repetidas de doble vía ANOVA, tratamiento: F1,66 = 30.42, p <0.0001; desafío de cocaína: F2,66= 58.39, p <0.0001; tratamiento x desafío con cocaína: F2,66= 8.56, p = 0.0005, pruebas posteriores de Bonferroni ^p <0.001). Este desafío con cocaína indujo una actividad locomotora significativamente mayor, es decir, sensibilización, en ratas experimentadas con cocaína (post-pruebas de Bonferroni * p <0.001).

Figura 1  

Efecto de la exposición crónica previa a la cocaína sobre la actividad locomotora y Fosb Inducción en NAc y CPu tras la reexposición al fármaco.

Para evaluar los efectos de este régimen de pretratamiento de cocaína en la expresión de osFosB en NAc y CPu, medimos la proteína osFosB con métodos inmunohistoquímicos 24 hr después de que los animales sin experiencia con cocaína y los que habían experimentado la cocaína se trataron con 0, 1, 3 o 6. inyecciones (15 mg / kg; ver Fig 1A). Según lo establecido previamente (Nye et al., 1995), Las inyecciones de cocaína 3 fueron suficientes para inducir significativamente la proteína osFosB en NAc y CPu de animales sin fármacos y su acumulación siguió siendo significativa después de los días 6 de las inyecciones de cocaína (Fig 1C. Medidas repetidas ANOVA bidireccional, núcleo NAc, tratamiento: F1,28= 23.5, p <0.0001; desafío de cocaína: F3,28= 49.16, p <0.0001; tratamiento x desafío con cocaína: F3,28= 6.83, p = 0.0014; Shell NAc, tratamiento: F1,28= 18.69, p <0.0001; desafío de cocaína: F3,28= 31.52, p <0.0001; tratamiento x desafío con cocaína: F3,28= 3.21, p <0.05; CPu, tratamiento: F1,28= 9.47, p <0.001; desafío de cocaína: F3,28= 19.74, p <0.0001; tratamiento x desafío con cocaína: F3,28= 0.94, p> 0.05. En NAc core, shell y CPu, las pruebas posteriores de Bonferroni ^p <0.05). En animales experimentados con cocaína, no hubo evidencia de inducción de ΔFosB persistente en NAc o CPu después de 28 días de abstinencia, de acuerdo con informes anteriores de que la señal de ΔFosB se disipa completamente en este momento (Nye et al., 1995), la razón de este punto de tiempo se utilizó en este estudio. Sin embargo, sorprendentemente, las ratas experimentadas con cocaína que recibieron inyecciones de prueba de cocaína 3 o 6 mostraron una inducción de proteína ΔFosB significativamente mayor en NAc, un efecto aparente tanto en las subregiones del núcleo como de la concha (Fig 1C. Pruebas posteriores de Bonferroni * p <0.05). Por el contrario, no se observó una inducción tan mayor de la proteína ΔFosB en CPu; en cambio, se observó una inducción de ΔFosB equivalente en esta región después de 3 o 6 días de inyecciones de provocación de cocaína en ratas sin experiencia y sin experiencia con cocaína (Fig 1C).

Para comprender mejor las alteraciones transcripcionales que se producen en NAc y CPu en respuesta a un desafío de cocaína, estudiamos el curso temporal (45, 90 y 180 min) de la inducibilidad de los transcritos de ARNm de ΔFosB y FosB en una sola inyección de cocaína o salina. a ratas sin experiencia con cocaína y con experiencia después de 28 días de abstinencia (ver Fig 1A). En relación con un desafío con solución salina, un desafío con cocaína indujo un rápido aumento en los niveles de ARNm de ΔFosB y FosB en los tres puntos de tiempo tanto en NAc como en CPu de los animales que no habían recibido cocaína (Fig 1D. Medidas repetidas ANOVA de una vía por punto de tiempo; Pruebas posteriores de Bonferroni ^p <0.05). En NAc, observamos una mayor inducción de ARNm de ΔFosB y FosB en animales experimentados con cocaína en comparación con animales sin experiencia con cocaína después del desafío con cocaína, el efecto fue significativo a los 90 min mientras que, en contraste, la inducibilidad de ARNm de ΔFosB y FosB en CPu fue significativamente disminuido en animales que han experimentado cocaína (Fig 1D. Pruebas posteriores de Bonferroni %p = 0.08, * p <0.05).

Caracterización de las vías de señalización en sentido ascendente en NAc y CPu de ratas experimentadas con cocaína

Una posible explicación para la inducibilidad alterada de la Fosb El gen en NAc y CPu después de un curso crónico previo de cocaína es que un historial remoto de exposición a la cocaína podría inducir cambios duraderos en las vías de señalización que están aguas arriba de Fosb Inducción de genes de tal manera que un desafío de cocaína induce al gen en un grado aberrante. Para estudiar esta hipótesis, analizamos los dos factores de transcripción, SRF y CREB, que se ha demostrado recientemente que se requieren para la inducción de cocaína de ΔFosB en estas regiones del cerebro (Vialou et al., 2012) junto con las proteínas quinasas aguas arriba, ERK y AKT, también implicadas en la acción de la cocaína (Valjent et al., 2000; Lu et al., 2006; Boudreau y otros, 2009). No pudimos detectar ningún cambio en los niveles totales o fosforilados de estas diversas proteínas que pudieran explicar la alteración de la inducibilidad de Fosb observado, incluidos los cambios en SRF, CREB o AKT (Fig. 2B, C). La falta de cambio en pSRF y pCREB en NAc en respuesta a un desafío de cocaína es consistente con un informe reciente, que encontró que ambos solo fueron inducidos significativamente por la cocaína crónica (Vialou et al., 2012).

Figura 2  

Efecto de la exposición crónica previa a la cocaína en las cascadas de señalización molecular aguas arriba en NAc y CPu

En NAc y CPu de animales sin fármacos, 20 min después de una exposición inicial al fármaco (Fig 2A), un solo desafío con la cocaína redujo los niveles de pERK42 / 44 (Fig. 2B, C. Prueba t de Student de dos colas: * p <0.05). Hay informes previos de niveles elevados de pERK en estas regiones después de la administración aguda de cocaína (Valjent et al., 2000). Esto es difícil de comparar con otros documentos que examinan la fosforilación de ERK en NAc durante la abstinencia de inyecciones repetidas de cocaína (Boudreau y otros, 2007; Shen et al., 2009), como en nuestro estudio, pERK se cuantificó después de 28 días de abstinencia y después de un desafío con cocaína o solución salina. En relación con los animales sin experiencia en drogas que experimentaron cocaína por primera vez, la reexposición a la cocaína en ratas con experiencia con cocaína, luego de 28 días de abstinencia, causó un aumento significativo en los niveles de pERK42 / 44 en CPu (Fig. 2B, C. Prueba t de Student de dos colas: * p <0.05).

Paisaje de cromatina en el Promotor del gen Fosb en NAc y CPu de ratas experimentadas con cocaína

A continuación investigamos si los cambios en Fosb La inducibilidad de los genes se asocia con alteraciones en la estructura de su cromatina. ChIP se realizó en NAc y CPu utilizando anticuerpos dirigidos contra tres formas bien caracterizadas de modificaciones de histonas: trimetilación de Lys4 de histona H3 (H3K4me3) asociada con la activación del gen, y H3XXXUMXme27 Analizamos ratas sin experiencia y sin experiencia con cocaína después de 3 días de abstinencia, ya sea con o sin una inyección de desafío de cocaína, con animales examinados 3 hr más tarde (Fig 3A). En NAc, no encontramos cambios significativos en la unión de ninguna de estas tres modificaciones de histonas a la Fosb promotor de genes en ausencia de un desafío de cocaína, aunque hubo una tendencia a niveles reducidos de H3K9me2 (Fig 3B-D. Prueba t de Student de dos colas. #p = 0.2 en comparación con los respectivos controles de Drug Naïve). Este efecto se volvió significativo después de un desafío con la cocaína y fue específico para la región promotora proximal del gen (Fig 3C. * p <0.05). Si bien los niveles de H3K9me2 son muy bajos en algunos genes, la Fosb El promotor genético muestra niveles apreciables de esta marca en NAc bajo condiciones de control (Maze et al., 2010, datos no mostrados). Por el contrario, en CPu, encontramos pequeñas pero significativas disminuciones en la unión H3K4me3, y aumentos en la unión H3K27me3, en el Fosb promotor en ausencia de un desafío de cocaína, efectos perdidos después del desafío (Fig 3D. * p <0.05).

Figura 3  

Efecto de la exposición crónica previa a la cocaína en el cebado epigenético del Fosb Gen en NAc y CPU

A continuación investigamos la unión de Pol II a la Fosb El gen, basado en hallazgos recientes en el cultivo de células que el estancamiento de Pol II en TSS, que se caracteriza por su fosforilación en Ser 5 en su región de repetición de CTD, está asociado con el cebado de genes (ver Introducción). Así analizamos la unión de Pol II-pSer5 a Fosb en cuatro regiones distintas del gen (Fig 3B). Este análisis reveló un enriquecimiento significativo de Pol II-pSer5 en el Fosb gen en su región promotora proximal y alrededor de su TSS en NAc de animales experimentados con cocaína, después de un retiro prolongado, en ausencia de un desafío de cocaína en comparación con los controles (Fig 3E. * p <0.05). Este enriquecimiento no fue evidente en dos regiones del cuerpo genético de Fosb, consistente con el bloqueo de Pol II descrito en sistemas experimentales más simples. Curiosamente, después de un desafío con la cocaína, la unión de Pol II-pSer5 todavía mostraba signos de enriquecimiento, aunque ya no de manera significativa, en el Fosb región promotora proximal (Fig 3E. %p = 0.1), pero regresó a los niveles de control en el TSS. Los hallazgos en CPu fueron más variables, sin que se observara un patrón claro de unión a Pol II-pSer5.

Discusión

El presente estudio proporciona una nueva visión de la regulación sostenida de Fosb Semanas después del cese de la exposición repetida a la cocaína. Mostramos que la anterior administración crónica de cocaína hace que Fosb gen más inducible en NAc, lo que resulta en una acumulación más rápida de ΔFosB al volver a exponerse al medicamento. Dada la preponderancia de la evidencia de que la inducción de BFosB en NAc media respuestas de comportamiento sensibilizadas a la cocaína (Nestler, 2008), nuestros hallazgos revelan un mecanismo novedoso para el restablecimiento más rápido de tales respuestas sensibilizadas después de un retiro prolongado.

Demostramos que la inducción mejorada de ΔFosB en NAc está asociada con cambios de cromatina en el Fosb Gen que se esperaría que lo cebara para una mayor inducción. Por lo tanto, mostramos una mayor unión de Pol II al promotor proximal y las regiones de TSS del gen que están presentes después de 4 semanas de retiro de la administración de cocaína crónica anterior. Tal enriquecimiento de Pol II en el TSS se pierde rápidamente en el desafío de la cocaína y Fosb Inducción, consistente con un modelo en cultivo celular que la Pol II estancada se libera de los TSS tras la activación del gen (ver Introducción). Un desafío con la cocaína también induce una rápida disminución en la unión de H3K9me2, una marca de la represión de genes, a la Fosb promotor. En contraste, no detectamos una inducción duradera de varios factores de transcripción, o de sus quinasas en sentido ascendente, que se sabe que median Fosb Inducción por la cocaína. Estos resultados apoyan nuestra hipótesis de que la inducción mejorada de ΔFosB en NAc está mediada por el cebado epigenético del Fosb Gen y no vía upregulation de eventos upstream.

Se obtuvieron resultados muy diferentes para CPu. No hubo evidencia de que Pol II se estancara en Fosb en ratas experimentadas con cocaína antes de un ataque con cocaína, aunque hubo modificaciones de histonas pequeñas pero significativas compatibles con la represión génica: aumento de la unión de H3K27me3 y disminución de la unión de H3K4me3. Tampoco se observaron cambios en los factores de transcripción en sentido ascendente o quinasas compatibles con una reducción Fosb inducción. Estos hallazgos sugieren que después de la administración crónica de cocaína, las modificaciones epigenéticas sirven para amortiguar Fosb Inductibilidad génica en CPu, en contraste con el cebado visto en NAc. Sin embargo, mientras estos efectos reprimen la inducción del ARNm de ΔFosB en la reexposición a la cocaína, no hay pérdida en la acumulación de proteína ΔFosB. El mecanismo subyacente a esta paradoja ahora requiere más investigación.

De manera más general, nuestros resultados respaldan un modelo en el que las alteraciones en el paisaje de la cromatina en genes específicos en respuesta a la administración crónica de cocaína sirven para cebar o atenuar esos genes para la inducción posterior a la reexposición al medicamento. Dichos cambios en la cromatina, que se pueden ver como "cicatrices epigenéticas", se perderían en los análisis de los niveles de ARNm en estado estable de los genes. De esta manera, la caracterización del epigenoma de la adicción promete revelar información nueva sobre la patogénesis molecular del trastorno, que se puede extraer para el desarrollo de nuevos tratamientos.

Agradecimientos

Este trabajo fue apoyado por becas del Instituto Nacional sobre el Abuso de Drogas.

Referencias

  • Alibhai IN, Green TA, Potashkin JA, Nestler EJ. Regulación de la expresión del ARNm de fosB y DeltafosB: estudios in vivo e in vitro. Brain Res. 2007;1143: 22-33. [Artículo gratuito de PMC] [PubMed]
  • Bataille AR, Jeronimo C, Jacques PE, Laramee L, Fortin ME, Forest A, Bergeron M, Hanes SD, Robert F. Un ciclo de CTD de polimerasa II de ARN universal está orquestado por interacciones complejas entre enzimas quinasa, fosfatasa e isomerasa a lo largo de los genes. Mol Cell. 2012;45: 158-170. [PubMed]
  • Boudreau AC, Reimers JM, Milovanovic M, Wolf ME. Los receptores AMPA de la superficie celular en el núcleo accumbens de la rata aumentan durante la retirada de la cocaína, pero se internalizan después de la exposición a la cocaína en asociación con la activación alterada de las proteínas quinasas activadas por mitógenos. J Neurosci. 2007;27: 10621-10635. [Artículo gratuito de PMC] [PubMed]
  • Boudreau AC, Ferrario CR, Glucksman MJ, Wolf ME. Adaptaciones de la vía de señalización y nuevos sustratos de proteína quinasa A relacionados con la sensibilización del comportamiento a la cocaína. J Neurochem. 2009;110: 363-377. [Artículo gratuito de PMC] [PubMed]
  • Core LJ, Lis JT. Regulación de la transcripción mediante la pausa proximal del promotor de la ARN polimerasa II. Ciencia. 2008;319: 1791-1792. [Artículo gratuito de PMC] [PubMed]
  • Covington HE, 3rd, Maze I, Sun H, Bomze HM, DeMaio KD, Wu EY, Dietz DM, Lobo MK, Ghose S, Mouzon E, Neve RL, Tamminga CA, Nestler EJ. Un papel para la metilación represiva de histonas en la vulnerabilidad al estrés inducida por la cocaína. Neuron. 2011;71: 656-670. [Artículo gratuito de PMC] [PubMed]
  • Freeman WM, Nader MA, Nader SH, Robertson DJ, Gioia L, Mitchell SM, Daunais JB, Porrino LJ, Friedman DP, Vrana KE. Cambios mediados por la cocaína crónica en la expresión de genes de núcleos de primates no humanos no humanos. J Neurochem. 2001;77: 542-549. [PubMed]
  • Hyman SE, Malenka RC, Nestler EJ. Mecanismos neuronales de la adicción: el papel del aprendizaje y la memoria relacionados con la recompensa. Annu Rev Neurosci. 2006;29: 565-598. [PubMed]
  • Kalivas PW, Volkow N, Seamans J. Motivación inmanejable en la adicción: una patología en la transmisión de glutamato prefrontal-accumbens. Neuron. 2005;45: 647-650. [PubMed]
  • Lazo PS, Dorfman K, Noguchi T, Mattei MG, Bravo R. Estructura y mapeo del gen fosB. FosB regula a la baja la actividad del promotor fosB. Nucleic Acids Res. 1992;20: 343-350. [Artículo gratuito de PMC] [PubMed]
  • Lu L, Koya E, Zhai H, Hope BT, Shaham Y. Papel de ERK en la adicción a la cocaína. Tendencias Neurosci. 2006;29: 695-703. [PubMed]
  • Mandelzys A, Gruda MA, Bravo R, Morgan JI. Ausencia de un antígeno 37 kDa relacionado con fos y persistentemente elevado y actividad de unión al ADN tipo AP-1 en los cerebros de ratones fosB nulos tratados con ácido kaínico. J Neurosci. 1997;17: 5407-5415. [PubMed]
  • Laberinto I, Nestler EJ. El paisaje epigenético de la adicción. Ann NY Acad Sci. 2011;1216: 99-113. [Artículo gratuito de PMC] [PubMed]
  • Maze I, Covington HE, 3rd, Dietz DM, LaPlant Q, Renthal W, Russo SJ, Mecánico M, Mouzon E, Neve RL, Haggarty SJ, Ren Y, Sampath SC, Hurd YL, Greengard P, Tarakhovsky A, Schaefer A, Nestler EJ. Papel esencial de la histona metiltransferasa G9a en la plasticidad inducida por la cocaína. Ciencia. 2010;327: 213-216. [Artículo gratuito de PMC] [PubMed]
  • Nechaev S, Adelman K. Promotor-proximal Pol II: cuando el atasco acelera las cosas. Ciclo celular. 2008;7: 1539-1544. [PubMed]
  • Nestler EJ. Revisión. Mecanismos transcripcionales de la adicción: papel de DeltaFosB. Philos Trans R Soc Lond B Biol Sci. 2008;363: 3245-3255. [Artículo gratuito de PMC] [PubMed]
  • Nye HE, Hope BT, Kelz MB, Iadarola M, Nestler EJ. Estudios farmacológicos de la regulación de la inducción crónica de antígenos relacionados con el FOS por la cocaína en el estriado y el núcleo accumbens. J Pharmacol Exp Ther. 1995;275: 1671-1680. [PubMed]
  • Perrotti LI, Hadeishi Y, Ulery PG, Barrot M, Monteggia L, Duman RS, Nestler EJ. Inducción de deltaFosB en estructuras cerebrales relacionadas con la recompensa después del estrés crónico. J Neurosci. 2004;24: 10594-10602. [PubMed]
  • Robinson TE, Kolb B. Plasticidad estructural asociada con la exposición a drogas de abuso. Neurofarmacología 47 Suppl. 2004;1: 33-46. [PubMed]
  • Robison AJ, Nestler EJ. Mecanismos transcripcionales y epigenéticos de la adicción. Nat Rev Neurosci. 2011;12: 623-637. [Artículo gratuito de PMC] [PubMed]
  • Saha RN, Wissink EM, Bailey ER, Zhao M, Fargo DC, Hwang JY, Daigle KR, Fenn JD, Adelman K, Dudek SM. La transcripción rápida inducida por la actividad de Arc y otros IEG se basa en la RNA polimerasa II preparada. Nat Neurosci. 2011;14: 848-856. [Artículo gratuito de PMC] [PubMed]
  • Shaham Y, esperanza BT. El papel de las neuroadaptaciones en la recaída a la búsqueda de drogas. Nat Neurosci. 2005;8: 1437-1439. [PubMed]
  • Shen HW, Toda S, Moussawi K, Bouknight A, Zahm DS, Kalivas PW. Alteración de la plasticidad de la columna dendrítica en ratas retiradas de cocaína. J Neurosci. 2009;29: 2876-2884. [Artículo gratuito de PMC] [PubMed]
  • Valjent E, Corvol JC, Páginas C, Besson MJ, Maldonado R, Caboche J. Participación de la cascada de quinasa regulada por señal extracelular para propiedades de recompensa de la cocaína. J Neurosci. 2000;20: 8701-8709. [PubMed]
  • Zeitlinger J, Stark A, Kellis M, Hong JW, Nechaev S, Adelman K, Levine M, Young RA. ARN polimerasa que se detiene en los genes de control del desarrollo en el embrión Drosophila melanogaster. Nat Genet. 2007;39: 1512-1516. [Artículo gratuito de PMC] [PubMed]
  • Vialou VF, Feng J, Robison AJ, Ferguson D, Scobie KN, Mazei-Robison M, Mouzon E, Nestler EJ. El factor de respuesta sérica y la proteína de unión al elemento de respuesta cAMP son necesarios para la inducción de cocaína de ΔFosB. J Neurosci. 2012 aceptado. [Artículo gratuito de PMC] [PubMed]