DeltaFosB régule indirectement l'activité du promoteur Cck (2010)

Brain Res. 2010 May 6; 1329: 10 – 20.

Publié en ligne 2010 March 11. est ce que je:  10.1016 / j.brainres.2010.02.081

PMCID: PMC2876727

John F. Enwright, III,1 Megan Wald,1 Madison Paddock,1 Elizabeth Hoffman,1 Rachel Arey,2 Scott Edwards,2 Sade Spencer,2 Eric J. Nestler,3 et Colleen A. McClung2, *

Informations sur l'auteur ► Informations sur le droit d'auteur et la licence ►

La version finale modifiée de cet article par l'éditeur est disponible à l'adresse Brain Res

Voir d'autres articles dans PMC qui citer l'article publié.

Allez à:

Abstrait

Certains des changements biochimiques, structurels et comportementaux importants induits par une exposition chronique à des médicaments abusifs semblent être médiés par le facteur de transcription hautement stable AFOSB. Des travaux antérieurs ont montré que la surexpression de ΔFosB chez la souris pendant les semaines 2 entraînait une augmentation de l’expression de nombreux gènes dans le striatum, dont la plupart subit une régulation négative à la suite de l’expression de ΔFosB par les semaines 8. Fait intéressant, un grand nombre de ces gènes ont également été régulés positivement chez des souris surexprimant le facteur de transcription CREB. Cette étude ne permettait toutefois pas de savoir si ΔFosB à court terme régulait ces gènes via CREB. Nous trouvons ici que les semaines 2 de surexpression de ΔFosB augmentent l’expression de CREB dans le striatum, un effet qui se dissipe d’ici les semaines 8. L'induction précoce est associée à une augmentation de la liaison du CREB à certains promoteurs du gène cible dans cette région du cerveau. Étonnamment, un gène qui était une cible CREB présumée sur la base de rapports antérieurs, cholécystokinine (Cck), n'était pas contrôlée par la CREB dans le striatum. Pour approfondir la réglementation de Cck suite à la surexpression de ΔFosB, nous avons confirmé que la surexpression de ΔFosB à court terme augmentait à la fois Cck activité du promoteur et expression des gènes. Il augmente également l’activité de liaison sur un site de liaison CREB putatif (CRE) dans le Cck promoteur. Cependant, bien que le site CRE soit nécessaire à l’expression basale normale de Cck, il n'est pas nécessaire pour l'induction de ΔFosB de Cck. Pris ensemble, ces résultats suggèrent que si l'induction de ΔFosB à court terme augmente l'expression et l'activité de CREB chez certains promoteurs de gènes, ce n'est pas le seul mécanisme par lequel les gènes sont régulés positivement dans ces conditions.

Mots clés: nucleus accumbens, transcription, addiction

Allez à:

INTRODUCTION

L'exposition chronique à des drogues d'abus provoque des changements biochimiques et structurels dans plusieurs régions du cerveau. On pense que ces changements impliquent des modifications dans les profils d'expression génique dans le système mésolimbique. Ce système est composé de neurones dopaminergiques faisant saillie de la région tegmentale ventrale (VTA) dans le cerveau moyen aux neurones épineux moyens du noyau accumbens (NAc) (striatum ventral) ainsi que de nombreuses autres régions du cerveau. Des altérations de l’activité de deux facteurs de transcription, la protéine CREB (CREA) et l’ADFosB (protéine de la famille Fos), ont été proposées comme médiateurs de nombreux changements biochimiques, structurels et comportementaux observés lors d’une exposition chronique à des drogues abusives ( revu par Nestler, 2005).

CREB est un facteur de transcription exprimé de manière omniprésente qui appartient à la famille CREB / ATF. Les homodimères CREB se lient aux variations d'une séquence CRE (consensus: TGACGTCA) trouvée dans les promoteurs de nombreux gènes. La phosphorylation de CREB (principalement au niveau de la sérine 133, bien que d’autres sites aient été identifiés) peut être stimulée par plusieurs cascades de signalisation, y compris celles situées en aval des récepteurs de la dopamine (Cole et al., 1995). Lors de la phosphorylation au niveau de la sérine 133, CREB recrute la protéine de liaison CREB (CBP), co-activateur, ou des protéines apparentées conduisant à une expression accrue des gènes (revue par Johannessen et al., 2004). L'exposition chronique aux drogues opiacées ou psychostimulantes entraîne une augmentation transitoire de l'activité de CREB dans le noyau accumbens (Barrot et al., 2002; Shaw-Lutchman et al., 2002, 2003), une adaptation conçue pour diminuer les propriétés enrichissantes de ces médicaments et contribuer à l'état émotionnel négatif du sevrage des médicaments (Nestler, 2005).

LOn pense que ΔFosB, une variante d'épissage très stable de FosB, permet une adaptation durable aux drogues d'abus. (Nestler et al., 1999; McClung et al., 2004; Nestler, 2008). Les membres de la famille Fos se dimérisent avec des membres de la famille Jun pour former un complexe de protéine activatrice 1 (AP-1). Les complexes de transcription AP-1 se lient aux variations de l’élément de réponse AP-1 (consensus: TGACTCA) pour réguler la transcription (revue effectuée par Chinenov et Kerppola, 2001). Bien que l'exposition aiguë aux drogues d'abus entraîne l'induction éphémère (hrs) des membres de la famille Fos (ainsi que l'activité accrue du CREB), l'exposition répétée aux médicaments entraîne l'accumulation du ΔFosB hautement stable (Hope et al., 1994; Perrotti et al., 2008), dont l'expression persiste pendant des semaines.

Les souris bi-transgéniques surexprimant de manière inductible ΔFosB ou CREB chez le striatum adulte présentent de nombreux phénotypes biochimiques et comportementaux observés chez des animaux exposés de manière répétée à des psychostimulants ou à d'autres drogues abusives. UNEL’analyse des modifications de l’expression des gènes chez ces animaux transgéniques a identifié de nombreux gènes surexprimés par une surexpression à court terme (semaines 2) de ΔFosB, modifications associées à une diminution concomitante de la récompense médicamenteuse. Les modifications de l’expression des gènes et de la réponse comportementale avec ΔFosB à court terme étaient remarquablement similaires à celles observées chez les animaux surexprimant CREB pendant les semaines 2 ou 8 (McClung et Nestler, 2003). En revanche, la surexpression à long terme (8 semaines) de ΔFosB a diminué l’expression de plusieurs de ces mêmes gènes et conduit à une augmentation de la récompense du médicament (Kelz et al., 1999; McClung et Nestler, 2003).

Un gène identifié dans ces études est cholécystokinine (Cck), un neuropeptide produit dans plusieurs régions du cerveau, y compris le striatum (Hokfelt et al., 1980). La CCK peut moduler la transmission dopaminergique (Vaccarino, 1992), participe à la récompense et au renforcement des médicaments (Josselyn et al., 1996; Josselyn et al., 1997; Hamilton et al., 2000; Beinfeld et al., 2002; Rotzinger et al., 2002), et est induite dans le striatum par la cocaïne chronique (Ding et Mocchetti, 1992). De plus le Cck Il a été démontré que le promoteur réagissait à la fois aux complexes CREB et AP-1 (Haun et Dixon, 1990; Deavall et al., 2000; Hansen, 2001). Depuis beaucoup de gènes (y compris Cck) qui présentaient une expression accrue après CREB et que l'expression de ΔFosB à court terme étaient des gènes cibles connus ou suspectés de CREB (McClung et Nestler, 2003), nous voulions déterminer si l’expression de ΔFosB à court terme conduisait à la régulation de ces gènes (en mettant l’accent sur Cck) par la régulation de CREB ou par des mécanismes plus complexes de régulation des gènes.

Allez à:

RÉSULTATS

La surexpression de ΔFosB augmente de manière transitoire les niveaux de CREB

Nous avons utilisé un transfert Western pour déterminer si la surexpression de ΔFosB augmente les niveaux de protéine CREB dans le striatum de souris. Pour cette étude, nous avons utilisé des souris bi-transgéniques (lignée 11A) portant à la fois un transgène NSE-tTA et un transgène TetOp-ΔFosB. En l'absence de doxycycline, ces souris montrent une augmentation robuste de l'expression de ΔFosB dans les neurones positifs à la dynorphine du striatum (Kelz et al., 1999). Cette méthode de surexpression de ΔFosB a été largement documentée et permet une surexpression spécifique à une région, parallèle à l’induction de ΔFosB chez des animaux exposés à la cocaïne chronique (Hope et al., 1994; Kelz et al., 1999). Nous avons constaté que chez les souris 11A surexprimant ΔFosB, les niveaux de protéine CREB étaient nettement surexprimés après des semaines d'expression de 2 et ces niveaux revenaient à leur niveau initial après les semaines d'expression de 8 (Figure 1A, n = 8). Pour déterminer si les changements dans les niveaux de CREB avec surexpression de ΔFosB à court terme pouvaient être répliqués dans un autre système, nous avons surexprimé de manière transitoire ΔFosB dans les cellules PC12 et avons constaté que les niveaux de CREB augmentaient de manière significative (p <0.05) par rapport aux témoins (Figure 1B, n = 4). Ces résultats démontrent que l'expression de ΔFosB à court terme augmente les niveaux de protéine CREB.

Figure 1

Figure 1

Les niveaux de CREB augmentent avec la surexpression de ΔFosB. Analyse par Western blot de lysats de (A) striata de souris de souris 11A off dox pour les semaines 2 ou 8 ou (B) Cellules PC12 surexprimant ΔFosB. Données en A sont indiqués en pourcentage de variation hors dox par rapport ...

ΔFosB et CREB se lient aux promoteurs de gènes cibles spécifiques dans le striatum après une surexpression de ΔFosB à court terme

Nous avons utilisé des dosages de tissu striatal par ChIP (immunoprécipitation de la chromatine) pour déterminer si la liaison ΔFosB ou CREB s’est produite au niveau de certains promoteurs du gène cible et si cette liaison a été augmentée à la suite d’une surexpression de ΔFosB à court terme. Nous avons analysé la liaison à la BDNF et Cck promoteurs, car les deux gènes sont fortement régulés positivement après une surexpression de ΔFosB à court terme, une surexpression de CREB ou un traitement chronique à la cocaïne (McClung et Nestler, 2003). Nous avons également analysé la reliure à la CDK5 promoteur, puisqu'il s'agit d'une cible directe connue de ΔFosB (Chen et al., 2000; Bibb et al., 2001; Kumar et al., 2005). Enfin, nous avons mesuré la liaison à la prodynorphine des études antérieures ont montré qu'il peut être lié à la fois par ΔFosB et CREB dans différentes conditions (Andersson et al., 2001; Zachariou et al., 2006).

L'analyse par puce a été réalisée sur des striata de souris 11A surexprimant ΔFosB pendant des semaines 2 en utilisant des anticorps qui reconnaissent CREB ou ΔFosB. Dans des conditions normales, nous avons constaté que ΔFosB se lie à la CDK5 et prodynorphine promoteurs, alors qu’il n’existe aucune liaison détectable au BDNF or Cck promoteurs (Tableau 1). De plus, la surexpression de ΔFosB augmentait la liaison de ΔFosB à la CDK5 promoteur, mais pas au prodynorphine promoteur. Nous avons ensuite mesuré la liaison CREB au niveau de ces promoteurs et avons trouvé que CREB se lie à la CDK5, BDNF et prodynorphine promoteurs, mais pas à la Cck promoteur, dans le striatum normal, et que la surexpression de ΔFosB pendant les semaines 2 augmente la liaison du CREB à la BDNF et prodynorphine promoteurs, mais pas les CDK5 promoteur. Pris ensemble, ces résultats montrent que ΔFosB et CREB peuvent tous deux se lier à certains promoteurs de gènes tels que prodynorphine et CDK5Cependant, la liaison CREB est spécifique à d’autres promoteurs tels que BDNF. En outre, la surexpression de ΔFosB conduit à des augmentations de la liaison de ΔFosB au niveau de certains promoteurs, comme on pouvait s’y attendre, mais également à une liaison de CREB à des promoteurs spécifiques, ce qui est cohérent avec l’induction CREB à médiation de ΔFosB observée à ce stade.

Tableau 1

Tableau 1

Liaison de protéines de régulation putatives à divers promoteurs chez des souris surexprimant AFOSB pendant deux semaines.

Des travaux antérieurs ont montré que les modifications de l'expression génique induites par une surexpression de ΔFosB à long terme sont associées à des modifications de la chromatine, en particulier l'acétylation de l'histone H3, chez des promoteurs de gènes spécifiques (Kumar et al., 2005). Pour déterminer si cela pouvait expliquer les modifications de l'expression des gènes lors d'une surexpression de ΔFosB à court terme, nous avons mesuré la liaison de l'histone acétylée H3 (modification de l'histone associée à la chromatine active sur le plan de la transcription) ou de l'histone H3 méthylée (Lys9, modification de l'histone associée à la transcription). chromatine inactive). Nous avons constaté que la surexpression de ΔFosB pendant les semaines 2 n’entraînait aucun changement de la liaison de H3 acétylé au niveau des promoteurs de gènes étudiés (Tableau 1). Nous avons constaté une diminution significative de la liaison de l'histone méthylée H3 à la prodynorphine promoteur, mais pas de liaison à la Cck promoteur et aucun changement de liaison à la CDK5 et BDNF Les promoteurs suggèrent qu'il ne s'agit pas d'un mécanisme général par lequel ΔFosB régule à court terme l'expression des gènes. Nous avons été surpris et intéressés par le fait que nous n’avons trouvé aucune différence dans nos tests ChIP pouvant expliquer l’augmentation du Cck L’expression de l’ARNm chez les souris 11A après l’expression de ΔFosB durant les semaines 2 et a décidé d’étudier plus avant ce mécanisme.

Augmentation de ΔFosB à court terme Cck expression dans plusieurs systèmes

La caractérisation par micropuce de souris 11A bi-transgéniques surexprimant ΔFosB dans le striatum a révélé que Cck les niveaux d'expression augmentent après les semaines de surexpression 2, puis diminuent progressivement avec des périodes plus longues d'expression de ΔFosB (Figure 2A, n = 3). Nous avons validé cet effet pour Cck utilisant la PCR en temps réel sur un groupe séparé d'animaux aux semaines 2 et 8 et ont trouvé que les résultats aux deux moments étaient similaires à l'analyse par micropuce (données non présentées).

Figure 2

Figure 2

La surexpression à court terme de ΔFosB augmente Cck l'expression du gène. (A) Cck Expression de l'ARNm dans le striatum après la surexpression de ΔFosB chez la souris 11A pendant les semaines 1, 2, 4 ou 8. L’analyse par micropuce a été réalisée sur des échantillons striataux et Cck niveaux ...

Pour approfondir la capacité de ΔFosB à réguler Cck expression, nous avons utilisé des cellules PC12 transfectées de façon transitoire avec un Cck-luciférase rapporteur plasmatique et soit un plasmide d'expression ΔFosB, soit une quantité égale de pCDNA. Deux jours (n = 5-9) et trois (n = 11-13) de surexpression de ΔFosB ont entraîné une augmentation significative du Cck-expression de la luciférase. De plus, trois jours de surexpression de ΔFosB ont entraîné une augmentation significative du Cck-luciférase par rapport à deux jours de surexpression (Figure 2B). La surexpression de AFOSB n'a pas induit l'expression d'une construction de luciférase sans promoteur (données non présentées). En l'absence de traitement, la réduction de la Cck-luciférase activité apparente. Ces résultats montrent que l’expression de ΔFosB à court terme augmente l’activité de la Cck promoteur et laisse sans réponse le mécanisme par lequel la surexpression de ΔFosB à long terme supprime Cck expression.

La surexpression de ΔFosB augmente la liaison au niveau d’un site de liaison CREB putatif dans Cck promoteur

Nos analyses ont révélé que Cck L'expression de ΔFosB augmente après l'expression à court terme de ΔFosB. Cependant, nos tests de ChIP ont révélé que ni CREB ni ΔFosB ne se lient à la Cck promoteur. Pour déterminer s’il existe des changements dans la liaison aux protéines au Cck Après la surexpression de ΔFosB, nous avons utilisé des dosages électrophorétiques à décalage de mobilité (EMSA) avec une sonde contenant le site putatif de type CRE présent dans le Cck promoteur. En utilisant des extraits nucléaires de striata de souris 11A surexprimant ΔFosB pendant les semaines 2, nous avons constaté une augmentation de la liaison au site putatif de CRE dans le Cck promoteur (Figure 3 A, C, n = 4). Fait intéressant, les souris 11A surexprimant ΔFosB pendant les semaines 8, qui présentent une diminution de la Cck expression, a également montré une liaison accrue sur ce site (Figure 3B, C, n = 4). À titre de comparaison, nous avons examiné la liaison à un site CRE consensuel chez des souris surexprimant AFOSB pendant des semaines 2 et avons trouvé une liaison robuste à la CRE dans des extraits striataux, mais aucune augmentation de la liaison après l'induction de AFOSB (Figure 3F, n = 4). Ainsi, malgré une augmentation induite par ΔFosB des niveaux totaux de CREB observés à ce moment-là, ces résultats sont conformes à nos tests de puce qui découvrent qu'une augmentation de la liaison de CREB au niveau des promoteurs à la suite de la surexpression de ΔFosB est spécifique à certains gènes et ne constitue pas un phénomène global. . Pour déterminer si CREB est lié à la Cck Dans notre analyse EMSA, nous avons effectué des tests de supershift avec un anticorps spécifique de CREB. En accord avec nos tests ChIP, nous n’avons trouvé aucune liaison de CREB avec un Cck sonde contenant le site CRE supposé dans les tests EMSA, alors que CREB a lié et supershift de manière significative un site CRE consensuel (Figure 3D, E, n = 4). L’activité de liaison à l’ADN au Cck Le promoteur n'était pas non plus affecté par un anticorps anti-ΔFosB (données non présentées), dans les conditions montrées dans plusieurs études antérieures, pour bloquer la liaison de ΔFosB aux sites véritablement AP-1 (Hope et al., 1994a, 1994b; Chen et al., 1995, Hiroi et al., 1998). Nous avons également effectué des tests de ChIP sur des striata d'animaux 11A après l'expression de ΔFosB pendant des semaines 8 et nous n'avons trouvé aucune liaison de CREB ou de ΔFosB à la Cck promoteur (données non présentées). Ainsi, l’expression de ΔFosB entraîne une augmentation de la liaison aux protéines à la Cck promoteur après les semaines d'expression 2 et 8; Cependant, l'identité de ces facteurs reste inconnue.

Figure 3

Figure 3

Liaison aux protéines au Cck promoteur. (A, B) Essai de décalage de mobilité électrophorétique utilisant le Cck Site ressemblant à une CRE avec un tissu striatal chez des animaux surexprimant ΔFosB pendant les semaines 2 (A) ou 8 (B). En (A), concurrence avec un concurrent non étiqueté en excès ...

Le site putatif de la CRE dans le Cck promoteur n'est pas responsable de l'activité accrue du promoteur

Depuis que nous avons trouvé une augmentation de la liaison aux protéines en utilisant un fragment de la Cck promoteur, qui contient le site CRE supposé, à la suite de la surexpression de ΔFosB, nous voulions déterminer si ce site était nécessaire pour augmenter Cck expression suivant la surexpression de ΔFosB. Pour tester cette possibilité, nous avons transfecté des cellules PC12 avec un Cck-Luciférase contenant son site intact de type CRE ou contenant une mutation dans le site qui supprimerait toute interaction avec CREB. Fait intéressant, la mutation du site de type CRE a diminué la croissance basale Cck activité de promoteur par 32% (Figure 4A, n = 9), mais n’a pas affecté le Cck induction du promoteur par surexpression de ΔFosB (Figure 4B, n = 11-13). Ceci suggère que, bien que le Cck Le promoteur nécessite un site intact de type CRE pour une activité de base complète. L'activité accrue du promoteur induite par la surexpression de AFOSB ne nécessite pas la séquence de type CRE.

Figure 4

Figure 4

La Ccktype de site CRE n'est pas nécessaire pour Cck induction par ΔFosB. (A) Cck-luciférase a été mesurée 2 jours après la transfection avec l'un ou l'autre Cck-luciférase ou dans laquelle le site de type CRE a été muté. * p <0.05 (B) Cck-luciférase ...

cFos se lie au Cck promoteur

Des études antérieures ont montré que cFos L’ARNm augmente avec l’expression de ΔFosB à court terme. Cependant, après une expression prolongée de ΔFosB, la capacité du traitement à la cocaïne à induire des cFos dans le striatum est réduite (McClung et Nestler, 2003; Renthal et al., 2008). Par conséquent, il se peut que cFos contribue à l’augmentation du Cck expression suivant l'expression ΔFosB à court terme. Nous avons effectué des tests de ChIP avec un anticorps spécifique de cFos et avons mesuré la liaison de cFos à la Cck promoteur avec et sans expression ΔFosB à court terme. Bien que nous ayons constaté que cFos ne se lie pas à la Cck promoteur, cette liaison n’a pas significativement augmenté après la surexpression de ΔFosB (Figure 5, n = 5). Ceci suggère que puisque cFos lie le Cck promoteur, il peut contribuer à la réglementation générale des Cck expression, mais il n’est probablement pas impliqué dans la régulation de la Cck promoteur par AFOSB.

Figure 5

Figure 5

cFos se lie au Cck promoteur. Les tests d'immunoprécipitation de la chromatine ont été réalisés avec un anticorps spécifique du cFos en utilisant du tissu striatal provenant de souris surexprimant ΔFosB, soit sur dox, soit après des semaines de prélèvement de dox par 2. L'analyse PCR en temps réel était ...

Allez à:

DISCUSSION

Cette étude confirme et approfondit les découvertes précédentes montrant que ΔFosB régule l'expression des gènes dans le striatum et nous découvrons qu'il le fait par le biais de multiples mécanismes après une expression à court terme. Nous montrons qu’après des semaines de surexpression 2, ΔFosB se lie directement aux promoteurs de certains gènes, ce qui entraîne des modifications de l’expression CDK5). De plus, il augmente les niveaux de protéine CREB, un effet observé dans les cellules en culture ainsi que dans le striatum, entraînant une augmentation de la liaison de CREB à d'autres promoteurs de gènes (c'est-à-dire dynorphine et BDNF). Dans une étude précédente, nous avons constaté que la surexpression à court terme de ΔFosB dans le striatum entraîne bon nombre des mêmes changements d’expression génique que ceux observés lorsque CREB est surexprimé et conduit à des réponses comportementales similaires dans les mesures de la préférence pour la cocaïne (McClung et Nestler, 2003). Ainsi, la découverte actuelle que ΔFosB conduit à une induction de CREB, ainsi que la liaison de CREB à certains promoteurs de gènes, aide à expliquer pourquoi tant de changements dans l'expression des gènes ont été partagés par ces deux facteurs de transcription.

L’induction de CREB par ΔFosB est intéressante car il a été démontré que les drogues faisant l’abus induisent des modifications du taux de CREB phosphorylé par la sérine 133 (Mattson et al., 2005) et augmenter la transcription médiée par la CRE (Barrot et al., 2002; Shaw-Lutchman et al., 2002, 2003), sans modifier les niveaux globaux de CREB. Il est possible que les changements dans les niveaux de CREB soient transitoires et, par conséquent, facilement oubliés dans d'autres études. Dans nos mains, nous avons vu des augmentations induites par la cocaïne d'ARNm de CREB dans certaines expériences, mais cet effet est très variable (observation non publiée). Etant donné que les souris transgéniques 11A et les cellules PC-12 présentent une induction de CREB après une surexpression de ΔFosB à court terme, cela suggère que CREB est effectivement induit par ΔFosB (ou une cible de ΔFosB), ce qui fournit un autre mécanisme pour expliquer les modifications induites par le médicament du gène. expression.

De manière surprenante, nous avons constaté que ni CREB ni ΔFosB ne se lient à la Cck promoteur même si Cck l'expression est clairement régulée positivement après l'expression de ΔFosB à court terme. Cck est un neuropeptide abondant exprimé à la fois dans la VTA et dans le NAc (Hokfelt et al., 1980) et est probablement impliqué dans les réponses comportementales à la toxicomanie (Josselyn et al., 1996; Josselyn et al., 1997; Hamilton et al., 2000; Beinfeld et al., 2002; Rotzinger et al., 2002). Dans les tests de culture cellulaire, le Cck Le promoteur a été caractérisé de manière approfondie et s’est montré réactif aux membres des familles CREB et AP-1 (examiné par le Hansen, 2001). Haun et Dixon (1990) a montré que les complexes AP-1 peuvent se lier au Cck Site de type CRE in vitroet il a été démontré par la suite, à l'aide de cellules de neuroblastome SK-N-MC, que la mutation du site de type CRE réduisait la réactivité du promoteur à la surexpression de cFos / cJun (Rourke et al., 1999). En effet, nous trouvons également une augmentation Cck activité de promoteur (Figure 2) et la liaison au niveau de ou autour de l'élément de type CRE (Figure 3) lors de la surexpression de ΔFosB, un autre membre de la famille AP-1, mais nous ne trouvons aucune liaison directe de ΔFosB au Cck promoteur in vivo or in vitro, même sur sa surexpression.

Beaucoup de travaux ont démontré un rôle pour le CREB dans la réglementation des Cck activité de promoteur. le Cck Le site de type CRE est conservé entre vertébrés (Hansen, 2001) et, dans certaines analyses de culture cellulaire, les complexes CREB et AP-1 se lient à ce site et sont nécessaires à la Cck activité de promoteur (Haun et Dixon, 1990; Deavall et al., 2000; Hansen, 2001). En outre, plusieurs activateurs connus de Cck expression (y compris le bFGF, le PACAP, les peptones et la dépolarisation) s’est avérée agir via CREB (Hansen et al., 1999; Deavall, et al, 2000; Bernard et al., 2001; Gevrey et al., 2002; Hansen et al., 2004). Notre Cck-luciférase Les données du gène rapporteur confirment le rôle essentiel du site de type CRE dans la régulation de la Cck activité de promoteur, car la mutation de ce site réduit les effets basaux Cck activité de promoteur et Cck-expression de la luciférase induite par VP16-CREB, une forme constitutivement active de CREB, est perdue lorsque ce site est muté (observation non publiée). Nous avons donc été surpris de constater que le CREB ne semble pas se lier au Cck promoteur dans les extraits striataux soit au début soit lors d’une surexpression de ΔFosB à court terme lorsque les niveaux de CREB sont augmentés. Cela fait valoir que les niveaux de CREB en soi n’est pas le seul facteur à prendre en compte pour déterminer le montant de la reliure sur ce site, et ceci est corroboré par le travail de tiers (Cha-Molstad, et al., 2004). Comme les promoteurs d’autres gènes cibles de CREB, précédemment identifiés, tels que BDNF et prodynorphine, lie la CREB, nous sommes confiants dans notre conclusion que CREB ne lie pas la Cck promoteur dans les extraits nucléaires striataux. En outre, l'induction de Cck-luciférase par ΔFosB ne dépend pas du site intact de type CRE, ce qui suggère que ΔFosB ne régule pas Cck expression en régulant la liaison directe de CREB à la Cck promoteur.

Notre incapacité à détecter CREB interagissant avec le Cck le promoteur est soutenu par Renthal et al. (2009), qui a utilisé une approche Puce-puce pour examiner les changements globaux dans la liaison du CREB phosphorylé (pCREB) et du ΔFosB dans le striatum après une exposition chronique à la cocaïne. Dans ces expériences, les complexes ADN-protéine ont été immunoprécipités avec des anticorps anti-AFBB ou pCREB et l'ADN précipité, après marquage, a été hybridé à une puce à promoteur. Alors que de nombreux gènes cibles CREB caractérisés auparavant ont été identifiés avec cette approche (par exemple, BDNF, prodynorphine), Cck n'a pas été identifié. De plus, il a été démontré que la liaison de CREB à un site consensuel de CRE varie considérablement entre les lignées cellulaires cultivées (Cha-Molstad, et al., 2004). Toutes les études précédentes qui ont trouvé des interactions CREB avec le Cck Les promoteurs ont été réalisés en culture cellulaire (pas le cerveau à partir duquel nos échantillons EMSA et ChIP ont été dérivés) et ont utilisé des tests de décalage sur gel pour étudier les interactions protéine-ADN. Alors qu'une EMSA peut évaluer le potentiel d'un facteur de se lier à une séquence d'ADN, les tests ChIP fournissent un nouveau regard sur ces interactions. in vivo. En outre, une grande partie des données démontrant soit l’induction de Cck activité de promoteur ou de liaison CREB à la Cck promoteur ont été obtenus à partir de cellules stimulées par des facteurs tels que les peptones (Bernard et al., 2001), dépolarisation (Hansen et al., 2004), ou une variété d’activateurs de cascades de signalisation intracellulaire, notamment AMPc et ERK (Hansen et al., 1999). Dans nos expériences, le seul "stimulus" utilisé était la surexpression de ΔFosB, suffisante pour induire Cck expression. Pris ensemble, cela suggère que la capacité du CREB à se lier (et éventuellement à réguler) le Cck Le promoteur dépend fortement du type de cellule et de l'activation de voies de signalisation particulières. De plus, le Cck L'élément promoteur de type CRE (au moins dans les cellules PC12 non induites et dans le striatum de souris) n'est pas une cible directe de CREB ou de AFOSB. Fait intéressant, la réglementation de FosB l'expression par CREB est également spécifique au type de cellule et au type de stimulation. Une étude d'Andersson et al. ont constaté que l’injection d’oligonucléotides antisens CREB dans le striatum de souris inhibait partiellement l’induction de FosB suite à l'administration de cocaïne (Andersson et al., 2001). Cependant, ils ont également constaté que la capacité de la L-Dopa à induire FosB l'expression dans le striatum lésé par 6-OHDA n'était pas influencée par la présence d'oligonucléotides antisens CREB.

CREB et ΔFosB semblent réguler indirectement la Cck promoteur, et des modifications de la structure de la chromatine ont été documentées en réponse à une variété de stimuli induisant ΔFosB (Tsankova et al., 2004; Kumar et al., 2005; Renthal et al., 2008), nous avons estimé que ΔFosB pourrait moduler indirectement l’activité du promoteur en modifiant la structure de la chromatine. Cependant, chez les souris surexprimant ΔFosB pendant les semaines 2, aucune modification de l'acétylation de l'histone H3 n'a ​​été observée. Cck promoteur (Tableau 1). Ceci est supporté par les données de la puce ChIP de Renthal et al. (2009), qui n'a signalé aucun changement dans la liaison de H3 acétylée à la Cck promoteur chez des souris exposées à la cocaïne chronique. Depuis le Cck Le promoteur est actif dans le striatum, aucune liaison répressive à l’histone méthylée H3 n’a été prévue ni observée. Fait intéressant, nous n’avons également observé aucun changement en raison de la surexpression de ΔFosB dans la liaison de H3 acétylée à la BDNF promoteur (qui a montré une augmentation de la liaison CREB) ou à la CDK5 et prodynorphine promoteurs (qui ont montré une liaison accrue à ΔFosB). Comme il existe une myriade de modifications de l’histone associées à des modifications de l’activité du promoteur (examinées par Rando et Chang, 2009), il existe probablement d'autres modifications de la chromatine associées à l'induction de ces gènes. Toute modification de la chromatine, bien que souvent prédictive du niveau d'activité du promoteur, peut ne pas changer pendant l'activation d'un gène particulier. Dans les travaux futurs, il serait intéressant d’examiner d’autres changements potentiels dans la structure de la chromatine autour du Cck promoteur après surexpression de ΔFosB. Fait intéressant, la cocaïne chronique (probablement via Il a été démontré que ΔFosB induction) induisait l’expression de la sirtuine 1 et 2, des histones désacétylases de classe III, qui semblent modifier la physiologie neuronale, la signalisation ERK et les réponses comportementales à la cocaïne (Renthal et al., 2009). L'induction d'une histone déacétylase aurait la capacité de réguler simultanément l'expression d'un grand nombre de gènes via changements globaux dans la structure de la chromatine.

Un candidat possible impliqué dans Cck La régulation suivant la surexpression de ΔFosB était le cFos, membre de la famille AP-1. L’expression de cFos est réglementée par le CREB (Sheng et al., 1990; Impey et al., 2004), et la surexpression de cFos (concordant avec la surexpression de son partenaire de liaison, cJun) augmente Cck activité de promoteur (Rourke et al., 1999). Par conséquent, une augmentation des niveaux de CREB due à une surexpression de ΔFosB à court terme pourrait augmenter les niveaux de cFos et entraîner une augmentation de la liaison au récepteur. Cck Site de type CRE. cfos L'ARNm est induit chez la souris après deux semaines de surexpression de ΔFosB (McClung et Nestler, 2003) et diminué chez les souris exposées à la cocaïne chronique ou à la surexpression de ΔFosB à long terme (Renthal et al., 2008). Nous constatons ici que cFos se lie directement à la Cck promoteur dans le tissu striatal, cependant, la surexpression de ΔFosB n’augmente pas significativement la liaison. Ceci suggère que, même si les CFOS pourraient être impliqués dans la régulation Cck En général, une modification de la liaison de cFos seule n’est pas le mécanisme par lequel ΔFosB régule Cck expression. Cependant, il est possible que ΔFosB puisse induire des modifications post-traductionnelles de cFos (par exemple, une phosphorylation modifiée) ou induire l'expression d'un partenaire de liaison (tel que cJun) ou d'une protéine co-activatrice. Cependant, étant donné que le site intact de type CRE (qui s’est déjà révélé être un site de liaison pour les complexes AP-1, voir Haun et Dixon, 1990) n'est pas nécessaire pour l'augmentation Cck l’activité du promoteur observée avec la surexpression de ΔFosB (évaluée dans nos expériences sur le gène rapporteur), il va sans dire que d’autres facteurs agissant en trans sont également régulés par ΔFosB.

La Cck Le fragment promoteur utilisé dans nos expériences sur le gène rapporteur de la luciférase contient un site de liaison Sp1 conservé et une boîte E (revue par Hansen, 2002). En particulier, il a été démontré que les séquences E-box lient de nombreux facteurs de transcription (examinés par Forrest et McNamara, 2004). En utilisant des cellules PC12, nous avons vu que la mutation de l’E-box diminue Cck activité du promoteur, mais ne modifie pas la réponse du promoteur à AFOSB (données non présentées). Fait intéressant, un Cck-Luciferase rapporteur contenant des mutations à la fois dans le site CRE et dans l'E-box n'a pas d'activité basale détectable et ne répond pas à la surexpression de ΔFosB (observation non publiée). Un autre médiateur potentiel de l’action ΔFosB sur le Cck Les promoteurs sont des ATF, dont on sait que certaines formes sont induites dans le striatum par une exposition chronique aux psychostimulants (Green et al., 2008). Cependant, nous n’avons trouvé aucune preuve de l’induction ΔFosB de ces ATF (données non présentées), et on ne s’attendrait pas à ce que les ATF se lient au site de type CRE muté sur la Cck promoteur.

Une mise en garde de cette étude est que nous utilisons un système bi-transgénique pour surexprimer ΔFosB et qu’il faut donc être conservateur pour établir des parallèles entre ce paradigme et l’administration de cocaïne chronique. Cependant, les souris transgéniques 11A offrent l’occasion unique d’examiner les effets spécifiques de ΔFosB dans le striatum, car la surexpression est limitée à cette région du cerveau (Chen et al., 1998), alors que l’administration de cocaïne induit des modifications dans une grande variété d’autres régions du cerveau qui peuvent alors affecter indirectement le striatum. En outre, plusieurs études ont mis en évidence des phénotypes comportementaux et moléculaires similaires chez les souris 11A par rapport aux animaux non transgéniques traités avec de la cocaïne chronique (Kelz et al., 1999; McClung et Nestler, 2003; Renthal et al., 2009). Aditionellement, Bibb et al. (2001) a signalé des niveaux similaires de striatal Cdk5 L'induction d'ARNm et de protéines dans cette même souche 11A par rapport aux littermates non transgéniques traités à la cocaïne, ainsi que des modifications similaires des cibles de CDK5, p35 et DARPP-32.

En conclusion, nous trouvons que l'expression de ΔFosB à court terme conduit à l'induction de gènes dans le striatum par le biais de multiples mécanismes. Celles-ci incluent la liaison directe au promoteur, l'induction de la protéine CREB et son activité, la modification de la chromatine, en plus des voies à déterminer.

Allez à:

PROCÉDURES EXPÉRIMENTALES

Animaux

Des animaux 11A bi-transgéniques mâles (NSE-tTA x TetOP-ΔFosB) ont été utilisés dans cette étude et sont caractérisés Kelz et al., 1999. Pour surexprimer AFFB, les souris ont été retirées de la doxycycline entre l'âge de 3 et celui de 6, tandis que les souris témoins ont été maintenues sous doxycycline. Toutes les souris ont été hébergées et maintenues en groupe selon un cycle lumière / obscurité 12: 12, allumé à 13 h 7 et éteint à 7, avec ad lib accès à la nourriture et à l'eau. Toutes les expériences sur souris étaient conformes aux protocoles approuvés par le comité de protection et d'utilisation des animaux du Southwestern Medical Center de l'Université du Texas à Dallas.

Plasmides reporter et d'expression

Le type sauvage (WT) Cck Le promoteur promoteur-luciférase a été préparé en insérant un fragment de PCR d'environ 200 pb dans le vecteur pGL3-luc (Promega). Ce fragment a été obtenu à partir d'ADN génomique de souris (amorces: 5 'TATCCTCTCACTGGGACGC 3' en amont et 5 'TACCTTTGGATGGGGAAATCG 3' en aval) et initialement inséré dans le vecteur pGEM-T Easy (Promega, #AXNUM). Le fragment promoteur a ensuite été clone dans les sites d'enzyme de restriction Kpn1360 / Xho1 de pGL1-luc.

Pour créer la mutation du point CRE dans le Cck promoteur, une amorce mutagène dirigée contre un site de type CRE précédemment signalé (amorce sens: 5'CGTGTCCTGCTGGACTGAGCTCGCACTGGGTAAACA 3 ', amorce antisens: 5'CTGTTTACCCAGTGCGCGCTGAGTCCAGCAGGACACG 3') a été utilisée en combinaison avec le kit d'instructions de mutagène Stratagene II (fabrication) . Cela convertit le site de type CRE signalé (ACTGCGTCAGC) en ACTGAGCTCC. Tous les plasmides rapporteurs ont été confirmés par séquençage d'ADN. Le plasmide d'expression ΔFosB contient une séquence ΔFosB pleine longueur insérée dans le site de clonage multiple de pCDNA 3.1 et a été décrit précédemment (Ulery et Nestler, 2007).

Culture cellulaire et transfections d'ADN

Les cellules de phéochromocytome de rat (PC12) ont été maintenues dans le milieu Eagle modifié F-12 de Dulbecco, supplémenté avec 10% de sérum de cheval, 5% de sérum bovin fœtal et 1% de pénicilline / streptomycine à 37 ° C et 5% de CO2. Les cellules ont été transfectées par électroporation à l'aide d'un électroporateur BTX 360 (350 V, 0 ohms et 850 μF) dans 800 μL de solution saline tamponnée au phosphate de Dulbecco dans des cuvettes de 4 mm avec 10 μg du rapporteur et 5 μg de la construction d'expression. Le plasmide vecteur vide (pCDNA) a été utilisé pour normaliser les quantités totales d'ADN. Après transfection, les cellules ont été cultivées sur des boîtes revêtues de collagène de 35 mm pendant les durées indiquées.

Tests de luciférase

Deux ou trois jours après la transfection, les cellules ont été lavées 3 fois dans une solution saline tamponnée au phosphate de Dulbecco, lysées (en utilisant 25 mM de glycylglycine, 15 mM de MgSO4, 4 mM EGTA, 1%, Triton X-100, pH 7.8, 1 mM DTT), recueillis et éliminés par centrifugation. 30 µL de lysat a été combiné avec 140 µL, un tampon de dosage de la luciférase (25 mM glycylglycine, 15 mM MgSO4, 4 mM EGTA, 1 mM DTT, 1 mM ATP, 1 mM phosphate de potassium, 1 mM coenzyme A, pH 7.8). L'activité de luminescence a été mesurée à l'aide d'un lecteur de fluorescence de microplaques FLx-800 après une injection automatisée de luciférine 40, x 1 mM par puits. L'activité de la luciférase a été normalisée à la teneur en protéines totales, comme déterminé par un dosage de protéines BioRad.

Essai de décalage de mobilité électrophorétique

Extraits nucléaires de tranches bilatérales de striatum de souris 11A bi-transgéniques (conservés avec ou sans doxycycline pendant les semaines 2 ou 8) (McClung et Nestler, 2003) ont été préparés selon Huang et Walters (1996). 32Des sondes oligonucléotidiques à double brin marquées avec P ont été préparées en utilisant le protocole du système Promega Gel Shift Assay (#E3300) et les sondes ont été purifiées en utilisant des colonnes Roche Quick Spin. Les séquences de sonde consensus CRE et AP-1 provenaient de Promega (#E328A et E320B, respectivement) et Cck Les séquences CRE étaient (sens Cck-CRE: CTAGCGAGCTCTGGACTGCGTCAGCACTGGGTGCA; antisens Cck-CRE: CCCAGTGCTGACGCAGTCCAGAGCTCGCTAGCTTT).

Les réactions de liaison et l'électrophorèse ont été réalisées en utilisant des modifications de la procédure du système Promega Gel Shift Assay (#E3300). La CPM 50,000 de la sonde marquée a été combinée avec l'extrait nucléaire striatal de 10, ug. De l'ADN compétitif froid ou des anticorps ont été ajoutés avant l'introduction des sondes radiomarquées. Pour les expériences de supershift, 2, ig d’anticorps CREB (Upstate Biotechnology N ° 06-083) a été utilisé. Les réactions ont été soumises à une électrophorèse sur des gels 4% Polyacrylamide, séchées et exposées à un film (en utilisant des écrans renforçateurs pendant des heures 1 à 2).

Immunoblot

Pour les cellules PC12, des plaques de 35 mm de cellules transfectées ont été lavées dans une solution saline tamponnée au phosphate de Dulbecco glacée et les lysats ont été préparés dans un tampon de lyse RIPA glacé (50 mM Tris pH 7.4, 5 mM NaCl, 5 mM EDTA, 1% de désoxycholate, 1 % Triton X-100, 0.1% de dodécylsulfate de sodium) contenant des inhibiteurs de protéase. Après sonication, clarification et dosage des protéines de Bradford, les lysats ont été entièrement dénaturés et 50 pg de chaque échantillon ont été soumis à une électrophorèse sur des gels de polyacrylamide SDS à 10%. Les protéines ont été transférées à la membrane PVDF, bloquées pendant 1 heure dans du lait sec non gras à 3% dans une solution saline tamponnée au Tris contenant 0.1% de Tween-20 (lait TBS-T), et sondées pendant une nuit à 4 ° C avec des anticorps primaires (CREB- Upstate Biotechnology # 06-083, utilisé à 1: 1,000 8795; GAPDH-Sigma # G1, utilisé à 80,000: 1 5,000) dilué dans du lait TBS-T. Après plusieurs lavages dans du TBS-T, des transferts ont été sondés pendant une heure à température ambiante en utilisant des anticorps secondaires conjugués à la phosphatase alcaline (Sigma) dilués au 170: 6432 XNUMX dans du lait TBS-T. Après plusieurs lavages dans une solution saline tamponnée au Tris, la réaction colorée a été effectuée selon les instructions du BioRad (# XNUMX-XNUMX). Les membranes ont été séchées pendant une nuit, scannées sur un scanner à plat et une densitométrie réalisée en utilisant ImageJ (voir ci-dessous).

Pour les extraits striataux, les tests de Western blot ont été effectués tels que publiés précédemment (Hope et al., 1994). Les tissus ont été prélevés sur des souris décapitées, placés sur de la glace et sectionnés sur une matrice cérébrale d'une épaisseur de 1 mm. Les poinçons ont ensuite été prélevés et congelés à -80 ° C jusqu'à utilisation. Le tissu a été traité par ultrasons sur de la glace dans un tampon à base de détergent modifié contenant à la fois des inhibiteurs de la phosphatase et de la protéase (Roche, Sigma). Après sonification, les échantillons ont été dénaturés dans de l'eau bouillante et centrifugés à 15,000xg pendant X minutes. le surnageant a ensuite été recueilli et traité; les quantités de concentration en protéines ont ensuite été quantifiées à l'aide d'un dosage de Bradford (Bio-Rad). Les échantillons ont été passés sur un gel 15% acrylamide / bisacrylamide, transférés sur une membrane de PVDF, bloqués dans du lait 10% et incubés avec des anticorps primaires (Anti-CREB, Upstate, Lake Placid, NY). Les transferts ont ensuite été visualisés à l'aide d'un système de chimioluminescence (Pierce). Tous les échantillons ont été normalisés à GAPDH (Fitzgerald, Concord, MA). Des courbes standard ont été établies pour nous assurer que nous nous situons dans la plage linéaire du test.

Analyse densitométrique

Pour les immunoblots de PC12, une analyse densitométrique a été réalisée à l’aide d’ImageJ avec étalonnage Rodbard. Le signal de fond moyen a été soustrait de chaque mesure et le rapport du signal CREB sur GAPDH a été calculé pour chaque échantillon. Pour l’immunoblot striatal et l’analyse EMSA, Scion Image 1.62c a été utilisé avec soustraction de fond.

Immunoprécipitation de la chromatine (ChIP)

Les dosages sur puce ont été effectués selon les méthodes de Tsankova et al. (2004) et Kumar et al. (2005). En bref, des échantillons striataux bilatéraux de souris 11A maintenues sur ou hors doxycycline ont été réticulés avec 1% de formaldéhyde et la réticulation a été désactivée avec de la glycine (concentration finale de 0.125 M). Ces échantillons provenaient de tranches de cerveau entières prélevées au niveau du noyau accumbens avec le cortex retiré. La chromatine a été cisaillée en fragments d'approximativement 0.2 à 1 kb par sonication, clarifiée avec des billes de protéine G (Thermo Scientific # 22852) et les échantillons d'entrée ont été congelés à -80 ° C. Entre 60 et 100 µg de chromatine ont été utilisés pour chaque précipitation. 5 à 10 μg de chaque anticorps primaire ont été utilisés (CREB: Upstate Biotechnology # 06-863, ΔFosB: Santa Cruz Biotechnology # SC-48x, acétylé H3: Upstate Biotechnology # 06-599, méthylé H3 (LYS9): Cell Signaling Technology, cFos: Santa Cruz Biotechnology # SC-7202x). Les complexes anticorps-chromatine ont été immunoprécipités avec des billes de protéine G plus selon les instructions du fabricant (Thermo Scientific # 22852). Suite à la réticulation inverse des échantillons d'entrée et précipités, chaque échantillon a été soumis à une PCR quantitative (qPCR). L'utilisation de tous ces anticorps pour ChIP a été largement validée (Tsankova et al., 2004; Kumar et al., 2005; Renthal et al., 2009).

Les niveaux de liaison des protéines à chaque promoteur de gène d'intérêt ont été déterminés en mesurant la quantité d'ADN associé par qPCR (ABI) Prism 7700, Foster City, CA). L'ADN total ou total (non immunoprécipité) et l'ADN immunoprécipité ont été amplifiés trois fois en présence de SYBR Green (Applied Biosystems, CA). Les valeurs Ct de chaque échantillon ont été obtenues en utilisant le logiciel Sequence Detector 1.1. La quantification relative de l’ADN matrice a été réalisée à l’aide de la méthode ΔΔCt (Tsankova et al., 2004). Amorces utilisées: promoteur BDNF 4: CTTCTGTGTGCGTGAATTTGCT; AGTCCACGAGAGGGCTCCA CDK5 promoteur: GCTGAAGCTGTCAGGAGGTC; GTGCCCCGCTCTTGTTATTA Promoteur Cck: CTTGGGCTAGCCTCATTCACTG; TTAAATAGCTCCTCCCGGTTCG Promoteur de la prodynorphine: GGCTTCCTTGTGCTTCAGAC; GCGCTGTTTGTCACTTTCAA.

analyses statistiques

Toutes les données sont présentées sous forme de moyennes ± erreur standard de la moyenne. La différence statistique a été déterminée par le test t bilatéral de Student (p <0.05). Lorsque plusieurs comparaisons ont été effectuées, les valeurs p ont été ajustées à l'aide de la correction de Bonferroni.

Allez à:

Remerciements

Nous voudrions remercier Will Renthal et Arvind Kumar pour leurs discussions utiles. Nous souhaitons également remercier le NIDA pour le financement de ces expériences.

Allez à:

Notes

Avis de non-responsabilité de l'éditeur: Ceci est un fichier PDF d’un manuscrit non édité qui a été accepté pour publication. En tant que service à nos clients, nous fournissons cette première version du manuscrit. Le manuscrit subira une révision, une composition et une révision de la preuve résultante avant sa publication dans sa forme définitive. Veuillez noter que des erreurs pouvant affecter le contenu peuvent être découvertes au cours du processus de production, de même que tous les dénis de responsabilité qui s'appliquent à la revue.

Termes de classification:

Section: Biologie moléculaire et cellulaire des systèmes nerveux #1

Allez à:

Références

  1. Andersson M, Konradi C, MA Cenci. La protéine de liaison aux éléments de réponse à l'AMPc est nécessaire pour l'expression des gènes dépendants de la dopamine dans le striatum intact mais non dénervé par la dopamine. J Neurosci. 2001; 21: 9930 – 43. [PubMed]
  2. Barrot M, Olivier JD, LI Perrotti, RJ DiLeone, O Berton, Eisch AJ, S Impey, Storm DR, Neve RL, Yin JC, Zachariou V, Nestler EJ. L’activité CREB dans la coquille du noyau accumbens contrôle l’adaptation des réponses comportementales aux stimuli émotionnels. Proc Natl Acad Sci US A. 2002; 99: 11435 – 40. [Article gratuit PMC] [PubMed]
  3. Beinfeld MC, Connolly KJ, Pierce RC. Le traitement à la cocaïne augmente la cholécystokinine extracellulaire (CCK) dans la coquille du noyau accumbens de rats éveillés à mouvement libre, un effet renforcé chez les rats sensibilisés comportementalement à la cocaïne. J Neurochem. 2002; 81: 1021 – 7. [PubMed]
  4. Bernard C, Sutter A, Vinson C, Ratineau C, Chayvialle J, Cordier-Bussat M. Les peptones stimulent la transcription du gène de la cholécystokinine intestinale via des facteurs de liaison aux éléments de réponse à l'adénosine monophosphate cycliques. Endocrinologie. 2001; 142: 721 – 9. [PubMed]
  5. Bibb JA, Chen J, Taylor JR, P Svenningsson, Nishi A, GL Snyder, Yan Z, Sagawa ZK, CC Ouimet, CC Nairn, EJ Nestler, Greengard P. Les effets de l'exposition chronique à la cocaïne sont régulés par la protéine neuronale Cdk5. La nature. 2001; 410: 376 – 80. [PubMed]
  6. Cha-Molstad H, DM Keller, GS Yochum, S Impey, RH Goodman. Liaison spécifique du type cellulaire du facteur de transcription CREB à l'élément de réponse à l'AMPc. Proc Natl Acad Sci US A. 2004; 101: 13572 – 7. [Article gratuit PMC] [PubMed]
  7. Chen J, Nye HE, Kelz MB, Hiroi N, Nakabeppu Y, Espoir BT, Nestler EJ. Régulation des protéines delta FosB et de type FosB par des convulsions électroconvulsives et des traitements à la cocaïne. Mol Pharmacol. 1995; 48: 880 – 9. [PubMed]
  8. Chen J, MB Kelz, G Zeng, N Sakai, C Steffen, PE Shockett, MR Picciotto, RS Duman, EJ Nestler. Animaux transgéniques à expression génique ciblée et inductible dans le cerveau. Mol Pharmacol. 1998; 54: 495 – 503. [PubMed]
  9. J Chen, Zhang Y, MB Kelz, Steffen C, ES Ang, Zeng L, Nestler EJ. Induction de la kinase 5 cycline-dépendante dans l'hippocampe par des convulsions électroconvulsives chroniques: rôle de ΔFosB. J Neurosci. 2000; 20: 8965 – 71. [PubMed]
  10. Chinenov Y, Kerppola TK. Rencontres rapprochées de toutes sortes: Interactions Fos-Jun qui interviennent dans la spécificité régulatrice de la transcription. Oncogène. 2001; 20: 2438 – 52. [PubMed]
  11. Cole RL, C Konradi, J Douglass, Hyman SE. Adaptation neuronale à l'amphétamine et à la dopamine: mécanismes moléculaires de la régulation du gène de la prodynorphine dans le striatum de rat. Neurone. 1995; 14: 813 – 23. [PubMed]
  12. Deavall DG, Raychowdhury R, ​​Dockray GJ, Dimaline R. Contrôle de la transcription du gène CCK par PACAP dans des cellules STC-1. Am J Physiol Gastrointest Foie Physiol. 2000; 279: G605 – 12. [PubMed]
  13. Ding XZ, Mocchetti I. Régulation dopaminergique de la teneur en ARNm de la cholécystokinine dans le striatum de rat. Brain Res Mol Brain Res. 1992; 12: 77 – 83. [PubMed]
  14. Forrest S, famille McNamara C. Id de facteurs de transcription et de formation de lésions vasculaires. Arterioscler Thromb Vasc Biol. 2004; 24: 2014 – 20. [PubMed]
  15. JC Gevrey, Cordier-Bussat M, E Némoz-Gaillard, JA Chayvialle, Abello J. Co-besoin de protéines kinases dépendantes de l'AMP et du calcium cycliques pour l'activation de la transcription du gène de la cholécystokinine par des hydrolysats de protéines. J Biol Chem. 2002; 277: 22407 – 13. [PubMed]
  16. Green TA, Alibhai IN, Unterberg S, Neve RL, Ghose S, Tamminga CA, Nestler EJ. Induction de facteurs de transcription activant (ATF) ATF2, ATF3 et ATF4 dans le noyau accumbens et leur régulation du comportement émotionnel. J Neurosci. 2008; 28: 2025 – 32. [PubMed]
  17. Hamilton ME, Redondo JL, AS Freeman. Débordement de dopamine et de cholécystokinine dans le noyau accumbens du rat en réponse à l'administration aiguë d'un médicament. Synapse. 2000; 38: 238 – 42. [PubMed]
  18. Hansen TV, Rehfeld JF, Nielsen FC. Les voies de signalisation de la protéine kinase activée par un mitogène et de la protéine kinase A stimulent la transcription de la cholécystokinine via l'activation de la protéine de liaison à l'élément de réponse cyclique adénosine 3 ', 5'-monophosphate. Mol Endocrinol. 1999; 13: 466–75. [PubMed]
  19. Hansen TV, Nielsen FC. Régulation de la transcription du gène de la cholécystokinine neuronale. Scand J Clin Lab Invest Suppl. 2001; 234: 61 – 7. [PubMed]
  20. Hansen TV. Transcription du gène de la cholécystokinine: éléments promoteurs, facteurs de transcription et voies de signalisation. Peptides. 2001; 22: 1201 – 11. [PubMed]
  21. Hansen TV, Rehfeld JF, Nielsen FC. Le KCl et la forskoline régulent de manière synergique l’expression du gène de la cholécystokinine via l’activation coordonnée du CREB et du co-activateur CBP. J Neurochem. 2004; 89: 15 – 23. [PubMed]
  22. Haun RS, Dixon JE. Un amplificateur de transcription essentiel à l'expression du gène de la cholécystokinine de rat contient une séquence identique à l'élément -296 du gène de la protéine c-fos humain. J Biol Chem. 1990; 265: 15455 – 63. [PubMed]
  23. Hiroi N, Marek GJ, Brown JR, Ye H, F Saudou, Vaidya VA, Duman RS, ME Greenberg, Nestler EJ. Rôle essentiel du gène fosB dans les actions moléculaires, cellulaires et comportementales des crises électroconvulsives chroniques. J Neurosci 1998. 1998; 18: 6952 – 62. [PubMed]
  24. Hokfelt T, Rehfeld JF, Skirboll L, Ivemark B, Goldstein M, Markey K. Preuve de la coexistence de la dopamine et de la CCK dans les neurones méso-limbiques. La nature. 1980; 285: 476 – 8. [PubMed]
  25. Hope BT, MB Kelz, Duman RS, Nestler EJ. Le traitement des crises électroconvulsives chroniques (ECS) aboutit à l'expression d'un complexe AP-1 de longue durée dans le cerveau avec une composition et des caractéristiques altérées. J Neurosci. 1994; 14: 4318 – 28. [PubMed]
  26. Hope BT, Nye HE, Kelz MB, Self DW, Iadarola MJ, Nakabeppu Y, Duman RS, Nestler EJ. Induction d'un complexe AP-1 de longue durée composé de protéines modifiées de type Fos dans le cerveau par la cocaïne chronique et d'autres traitements chroniques. Neurone. 1994; 13: 1235 – 44. [PubMed]
  27. Huang KX, Walters JR. Régulation dopaminergique de l'activité de liaison à l'ADN du facteur de transcription AP-1 dans le striatum de rat. Neuroscience. 1996; 75: 757 – 75. [PubMed]
  28. Impey S., SR McCorkle, H. Cha-Molstad, JM Dwyer, GS Yochum, JM Boss, S. McWeeney, JJ Dunn, G Mandel, RH Goodman. Définir le régulon CREB: une analyse du génome complet des régions régulatrices des facteurs de transcription. Cellule. 2004; 119: 1041 – 54. [PubMed]
  29. Johannessen M, député de Delghandi, Moens U. Qu'est-ce qui allume le CREB? Signal cellulaire. 2004; 16: 1211 – 27. [PubMed]
  30. Josselyn SA, Vaccarino FJ. Effets opposés des antagonistes de la CCK (A) et de la CCK (B) sur le développement de l'activité conditionnée chez le rat. Comportement Pharmacol. 1996; 7: 505 – 512. [PubMed]
  31. Josselyn SA, De Cristofaro A, Vaccarino FJ. Preuve de l'implication du récepteur CCK (A) dans l'acquisition de l'activité conditionnée produite par la cocaïne chez le rat. Brain Res. 1997; 763: 93 – 102. [PubMed]
  32. Kelz MB, Chen J, Carlezon WA, Jr., Whisler K, Gilden AM, Beckmann AM, Steffen C, Zhang YJ, L Marotti, Self DW, Tkatch T, Baranauskas G, DJ Surmeier, Neve RL, Duman RS, Duman RS, Picciotto MR , Nestler EJ. L'expression du facteur de transcription deltaFosB dans le cerveau contrôle la sensibilité à la cocaïne. La nature. 1999; 401: 272 – 6. [PubMed]
  33. Kumar A, Choi KH, Renthal W, NM Tsankova, Theobald DE, Truong HT, Russo SJ, Laplant Q, Sasaki TS, Whistler KN, Neve RL, Self DW, Nestler EJ. Le remodelage de la chromatine est un mécanisme clé de la plasticité induite par la cocaïne dans le striatum. Neurone. 2005; 48: 303 – 14. [PubMed]
  34. Mattson BJ, Bossert JM, Simmons DE, Nozaki N, D Nagarkar, Kreuter JD, Hope BT. La phosphorylation de CREB induite par la cocaïne dans le noyau accumbens de rats sensibilisés à la cocaïne est activée par une activation accrue de la kinase extracellulaire liée au signal, mais non de la protéine kinase A. J Neurochem. 2005; 95: 1481 – 94. [PubMed]
  35. McClung CA, Nestler EJ. Régulation de l'expression des gènes et de la récompense de la cocaïne par CREB et DeltaFosB. Nat Neurosci. 2003; 6: 1208 – 15. [PubMed]
  36. McClung CA, Ulery PG, Perrotti LI, Zachariou V, Berton O, Nestler EJ. DeltaFosB: un commutateur moléculaire pour une adaptation à long terme dans le cerveau. Brain Res Mol Brain Res. 2004; 132: 146 – 54. [PubMed]
  37. Nestler EJ, Kelz MB, Chen JS. ΔFosB: médiateur moléculaire de plasticité neuronale et comportementale à long terme. Brain Res. 1999; 835: 10 – 17. [PubMed]
  38. Nestler EJ. Existe-t-il une voie moléculaire commune pour la dépendance? Nat Neurosci. 2005; 8: 1445 – 9. [PubMed]
  39. Nestler EJ. Mécanismes transcriptionnels de la dépendance: rôle de DeltaFosB. Philos Trans R Soc Lond B Biol Sci. 2008; 363: 3245 – 55. [Article gratuit PMC] [PubMed]
  40. Perrotti LI, RR tisserand, Robison B, Renthal W, Maze I, S Yazdani, Elmore RG, DJ Knapp, Selley DE, Martin BR, Sim-Selley L, Bachtell RK, Self DW, Nestler EJ. Schémas distincts d’induction de DeltaFosB dans le cerveau par des drogues d’abus. Synapse. 2008; 62: 358 – 69. [Article gratuit PMC] [PubMed]
  41. Rando JO, Chang HY. Vues du génome à l'échelle de la structure de la chromatine. Annu Rev Biochem. 2009; 78: 245 – 71. [Article gratuit PMC] [PubMed]
  42. Renthal W, Carle TL, Maze I, Covington HE, 3rd., Truong HT, Alibhai I, Kumar A, Montgomery RL, Olson EN, Nestler EJ. Delta FosB intervient dans la désensibilisation épigénétique du gène c-fos après une exposition chronique à l'amphétamine. J Neurosci. 2008; 28: 7344 – 9. [Article gratuit PMC] [PubMed]
  43. Renthal W, Kumar A, Xiao G, Wilkinson M, Covington HE, 3rd, Maze I, Sikder D, Robison AJ, LaPlant Q, Dietz DM, Russo SJ, Vialou V, Chakravarty S, Kodadek TJ, Pile A, Kabbaj M, Nestler EJ. L'analyse du génome de la régulation de la chromatine par la cocaïne révèle le rôle des sirtuines. Neurone. 2009; 62: 335 – 48. [Article gratuit PMC] [PubMed]
  44. Rotzinger S, DE Bush, Vaccarino FJ. Modulation de la cholécystokinine de la fonction dopaminergique mésolimbique: régulation du comportement motivé. Pharmacol Toxicol. 2002; 91: 404 – 13. [PubMed]
  45. Rourke IJ, Hansen TV, C Nerlov, Rehfeld JF, Nielsen FC. Coopérativité négative entre les éléments E-box juxtaposés et les éléments sensibles à l'AMPc / TPA dans le promoteur du gène de la cholécystokinine. FEBS Lett. 1999; 448: 15 – 8. [PubMed]
  46. Shaw-Lutchman TZ, Barrot M, Wallace T, Gilden L, Zachariou V, S Impey, Duman RS, Storm D, Nestler EJ. Cartographie régionale et cellulaire de la transcription médiée par la CRE lors du sevrage de la morphine précipitée par la naltrexone. J Neurosci. 2002; 22: 3663 – 3672. [PubMed]
  47. Shaw-Lutchman TZ, Impey S, Storm D, Nestler EJ. Régulation de la transcription médiée par la CRE dans le cerveau de souris par l'amphétamine. Synapse. 2003; 48: 10 – 7. [PubMed]
  48. Sheng M, G McFadden, ME Greenberg. La dépolarisation membranaire et le calcium induisent la transcription de c-fos via la phosphorylation du facteur de transcription CREB. Neurone. 1990; 4: 571 – 82. [PubMed]
  49. Tsankova NM, Kumar A, Nestler EJ. Modifications des histones au niveau des régions promotrices du gène dans l'hippocampe de rat après des crises convulsives aiguës et chroniques. J Neurosci. 2004; 24: 5603 – 10. [PubMed]
  50. Ulery PG, Nestler EJ. Régulation de l'activité de transcription de DeltaFosB par la phosphorylation de Ser27. Eur J Neurosci. 2007; 25: 224 – 30. [PubMed]
  51. Vaccarino FJ. Le noyau accumule les interactions dopamine-CCK dans la récompense psychostimulante et les comportements associés. Neurosci Biobehav Rev. 1992; 18: 207 – 14. [PubMed]
  52. Zachariou V, CA Bolanos, DE Selley, D. Theobald, député de Cassidy, MB Kelz, T Shaw-Lutchmann, O Berton, LJ Sim-Selley, RJ DiLeone, Kumar A et Nestler EJ. ΔFosB: Un rôle essentiel pour ΔFosB dans le noyau accumbens dans l’action de la morphine. Nature Neurosci. 2006; 9: 205 – 11. [PubMed]