Une expérience médicamenteuse amorce de manière épigénétique l'inductibilité du gène Fosb dans le noyau accumbens du rat (2012)

COMMENTAIRES: La preuve que le deltafosb laisse des traces longtemps après son rétablissement de la dépendance. Plus précisément, la dépendance entraîne des changements épigénétiques qui entraînent une induction beaucoup plus rapide du deltafosbe en cas de rechute. Cela explique comment une rechute, même après des années, peut rapidement dégénérer en un état de dépendance complètement développé.



J Neurosci. Manuscrit de l'auteur; disponible dans PMC 2013 January 25.

 

Abstrait

ΔFosB, un Fosb produit génique, est induit dans le noyau accumbens (NAc) et le putamen caudé (CPu) par exposition répétée à des drogues faisant l’abus telles que la cocaïne. Cette induction contribue aux profils aberrants d'expression génique et aux anomalies comportementales observées lors d'une exposition répétée au médicament..

Ici, nous avons évalué si des antécédents lointains d’exposition au médicament pouvaient modifier l’inductibilité de la Fosb gène induit par une exposition ultérieure à la cocaïne. Nous montrons que l’administration chronique antérieure de cocaïne, suivie d’un sevrage prolongé, augmente l’inductibilité de Fosb dans NAc comme en témoignent une plus grande induction aiguë d'ARNm de ΔFosB et une accumulation plus rapide de la protéine ΔFosB après une nouvelle exposition répétée à la cocaïne. Pas apprêté Fosb une induction a été observée dans le CPu; en fait, une induction aiguë subséquente de l’ARNm de ΔFosB a été supprimée dans le CPu.

Ces modèles anormaux de Fosb expression sont associés à des modifications de la chromatine à la Fosb promoteur de gène. Une administration préalable chronique de cocaïne induit une augmentation durable de la liaison de l'ARN polymérase II (Pol II) au Fosb promoteur dans NAc uniquement, suggérant que Pol II «décrochant» prime Fosb pour l'induction dans cette région lors d'une nouvelle exposition à la cocaïne. Une exposition à la cocaïne déclenche ensuite la libération de Pol II du promoteur du gène, permettant ainsi une réaction plus rapide. Fosb transcription. Un défi à la cocaïne diminue également les modifications répressives de l’histone au Fosb promoteur dans NAc, mais augmente ces marques répressives et diminue les marques activantes dans CPu.

Ces résultats fournissent de nouvelles informations sur la dynamique de la chromatine au Fosb promoteur et révéler un nouveau mécanisme pour amorcé Fosb induction dans NAc lors d'une nouvelle exposition à la cocaïne.

Introduction

La toxicomanie se caractérise par la recherche et la prise compulsives de drogues en dépit de graves conséquences néfastes (Kalivas et al., 2005; Hyman et al., 2006). L'exposition chronique à un médicament entraîne des modifications persistantes de l'expression des gènes dans le striatum ventral (ou noyau accumbens; NAc) et dans le striatum dorsal (ou putamen caudé; CPu), des structures striatales impliquées dans la récompense du médicament et la dépendance (Freeman et al., 2001; Robinson et Kolb, 2004; Shaham et Hope, 2005; Maze et Nestler, 2011). ΔFosB, une protéine tronquée et stable codée par le gène immédiat-précoce, Fosb, est un facteur de transcription bien caractérisé induit dans le NAc et le CPu par l'exposition chronique à pratiquement toutes les drogues d'abus, où il intervient dans les réactions comportementales sensibilisées à l'administration répétée de médicaments. (Nestler, 2008). Toutefois, on ignore si une exposition chronique antérieure à un médicament abusif modifie l'induction ultérieure de ΔFosB.

Nous avons récemment émis l’hypothèse que des modifications de la chromatine en réponse à une exposition chronique à un médicament pourraient modifier l’inductibilité de gènes spécifiques dans des régions cérébrales cibles (Robison et Nestler, 2011). De plus en plus de preuves ont montré que les médicaments d'abus après administration chronique modifient la structure et l'accessibilité transcriptionnelle de la chromatine par le biais de nombreux types de modifications, notamment la phosphorylation, l'acétylation et la méthylation des résidus d'histone. Des travaux plus récents dans des systèmes de culture cellulaire ont porté sur le recrutement de l'ARN polymérase II (Pol II) pour le promoteur de gènes «inductibles» avant leur expression, Pol II étant lié de manière persistante aux régions promotrices proximales et autour du site d'initiation de la transcription (TSS). ) dans un état «bloqué» (Core et Lis, 2008; Nechaev et Adelman, 2008). On pense alors que l'activation du Pol II bloqué est responsable de son échappement des régions promotrices et TSS et de sa transcription de ces gènes «amorcés» (Zeitlinger et al., 2007; Saha et al., 2011; Bataille et al., 2012).

Nous montrons ici que l’exposition chronique antérieure à la cocaïne, suivie d’une période de sevrage prolongée, modifie l’inductibilité des Fosb l’administration ultérieure de cocaïne, le NAc étant préparé pour l’induction alors que le CPu ne l’est pas. Nous identifions ensuite des signatures de chromatine distinctes au Fosb promoteur de gène dans NAc et CPu associés à une telle inductibilité aberrante du Fosb gène, y compris le recrutement de Pol II bloqué au stade Fosb promoteur proximal dans NAc uniquement, ainsi que des modifications de plusieurs modifications histones activantes ou répressives dans les deux régions du cerveau. Ces résultats fournissent de nouvelles informations sur la dynamique de la chromatine au Fosb promoteur du gène et indiquer pour la première fois un mécanisme par lequel le décrochage de Pol II prime Fosb pour une plus grande activation dans NAc lors d'une nouvelle exposition à la cocaïne.

Matériels et méthodes

Animaux

Des rats mâles Sprague Dawley (250 – 275 g; Charles River Laboratories), utilisés dans toutes les expériences, ont été hébergés par paire dans une pièce à température contrôlée selon un cycle lumière / obscurité 12 hr (éclairage allumé à 7 AM) avec accès à de la nourriture et eau ad libitum. Tous les animaux ont été injectés deux fois par jour pendant dix jours avec de la cocaïne (15 mg / kg, ip) ou une solution saline (ip) dans leurs cages domestiques. Les expériences sur les animaux ont été approuvées par le Comité institutionnel de protection et d'utilisation des animaux (IACUC) au mont Sinaï.

Mesures locomotrices

Les animaux ont été habitués dans la chambre locomotrice le premier jour pendant 1 hr, puis surveillés pour l'activité locomotrice après une injection de solution saline à l'aide du système de photobeam activity (San Diego Instruments). Après l'accoutumance quotidienne de 1 heures dans les chambres locomotrices, une cocaïne (15 mg / kg, ip) était administrée quotidiennement pendant les jours 2 et les animaux étaient à nouveau surveillés pour l'activité locomotrice de 1 heures.

Immunohistochimie

Les animaux ont été perfusés 24 h après leur dernière exposition au médicament. L’immunoréactivité à ΔFosB / FosB a été détectée comme décrit (Perrotti et al., 2004). Le transfert Western a confirmé que toute l'immunoréactivité de type FOSB / FosB observée pendant au moins 24 heures après l'injection de cocaïne reflétait le FOSB, le FosB étant indétectable (non présenté).

Isolement de l'ARN, transcription inverse et PCR

Les poinçons bilatéraux de calibre 12 de NAc et de CPu dorsolatérale / dorsomédiale ont été obtenus comme décrit (Perrotti et al., 2004), congelés sur de la neige carbonique et traités conformément aux protocoles publiés (Covington et al., 2011). Les ARNm de ΔFosB et FosB ont été mesurés par PCR quantitative (qPCR) avec des amorces ΔFosB et FosB spécifiques de l’isoforme (Alibhai et al., 2007). Les niveaux d'ARNm de ΔFosB et de FosB ont été normalisés par rapport aux niveaux d'ARNm de GAPDH, qui n'étaient pas affectés par l'exposition à la cocaïne (non présenté).

Western blot

Les poinçons NAc et CPu ont été recueillis comme ci-dessus et traités pour le Western blot comme décrit (Covington et al., 2011), en utilisant des anticorps contre ERK44 / 42 [kinase 44 / 42] et phosphoERK44 (pERK), AKT [proto-oncogène viral du thymome] et p-AKT, SRF (facteur de réponse sérum) et pSRF, CREB [protéine de liaison d'élément de réponse cAMP], et pCREB. La quantité de protéine transférée sur chaque piste a été normalisée à des taux d'actine ou de tubuline non affectés par l'exposition à la cocaïne.

Immunoprécipitation de la chromatine (ChIP)

Les poinçons NAc et CPu fraîchement disséqués ont été préparés pour ChIP comme décrit (Maze et al., 2010). Chaque condition expérimentale a été analysée en triple exemplaire à partir de groupes d’animaux indépendants. Pour chaque échantillon de puce, les poinçons bilatéraux de NAc et de CPu ont été regroupés chez cinq rats (poinçons 10). Les anticorps utilisés pour des modifications spécifiques d'histones sont les mêmes que ceux publiés (Maze et al., 2010) les anticorps anti-Pol II phosphorylés au niveau de Ser5 de sa région répétée du domaine terminal carboxyle (CTD) (Pol II-pSer5) ont été obtenus auprès de abcam 5131. Quatre jeux d’amorces ChIP ont été conçus pour Fosb (Lazo et al., 1992; Mandelzys et al., 1997): 1F: GTACAGCGGAGGTCTGAAGG, 1R: GAGTGGGATGAGATGCGAGT; 2F: CATCCCACTCGGCCATAG, 2R: CCACCGAAGACAGGTACTGAG; 3F: GCTGCCTTTAGCCAATCAAC, 3R: CCAGGTCCAAAGAAAGTCCTC; 4F: GGGTGTTTGTGTGTGAGTGG, 4R: AGAGGAGGCTGGACAGAACC. Les niveaux de modification de la chromatine sont comparés à ceux de l’ADN d’entrée tel que décrit (Maze et al., 2010).

analyses statistiques

Toutes les valeurs rapportées sont des moyennes ± sem. Les données relatives à l'activité locomotrice et au comptage cellulaire ont été analysées par des ANOVA bidirectionnels avec traitement et injection comme facteurs. Les expériences de qPCR ont été analysées par point dans le temps par des ANOVA à un facteur avec traitement comme facteur. Lorsque des effets principaux significatifs ont été observés (p <0.05), des tests post-hoc de Bonferroni ont été menés pour des comparaisons avec des animaux naïfs traités avec une solution saline (^ en chiffres) et des animaux naïfs traités à la cocaïne (* en chiffres). Des tests t de Student bilatéraux non appariés ont été utilisés pour les données Western blot et ChIP, avec des corrections pour des comparaisons multiples.

Resultats

Plus grand Inductibilité du fosb dans le NAc, mais pas dans le CPu, chez des rats expérimentés à la cocaïne

Examiner l’influence d’une prise chronique de cocaïne, suivie d’une période de sevrage prolongée, sur l’inductibilité de la Fosb en réponse à une exposition ultérieure à la cocaïne, des doses de provocation du médicament ont été administrées à des rats auxquels on avait précédemment injecté deux fois par jour une solution saline ou de la cocaïne (15 en mg / kg) pendant X jours, après l'administration de 10 jours de sevrage (Fig 1A). Nous avons d’abord mesuré les réponses locomotrices chez un groupe d’animaux pour confirmer l’induction d’une sensibilisation locomotrice par une exposition antérieure à la cocaïne, une conséquence durable attendue de l’administration du médicament. Les rats ayant déjà consommé de la cocaïne ou naïfs ont présenté une activité locomotrice de base équivalente, une provocation à la cocaïne chez des animaux naïfs de drogue augmentant leur locomotion (Fig 1B. ANOVA dans les deux sens et mesures répétées, traitement: F1,66 = 30.42, p <0.0001; défi de la cocaïne: F2,66= 58.39, p <0.0001; traitement x défi à la cocaïne: F2,66= 8.56, p = 0.0005, post-tests de Bonferroni ^p <0.001). Cette provocation à la cocaïne a induit une activité locomotrice significativement plus élevée, c'est-à-dire une sensibilisation, chez les rats ayant subi de la cocaïne (post-tests de Bonferroni * p <0.001).

Figure 1  

Effet d'une exposition chronique antérieure à la cocaïne sur l'activité locomotrice et Fosb induction dans NAc et CPu lors d'une nouvelle exposition au médicament

Pour évaluer les effets de ce régime de prétraitement à la cocaïne sur l'expression du ΔFosB dans les anticorps NAc et CPu, nous avons mesuré la protéine ΔFosB à l'aide de méthodes immunohistochimiques 24 hr après la prise quotidienne de cocaïne chez des animaux n'ayant jamais subi de cocaïne ni de cocaïne. injections (0 mg / kg; voir Fig 1A). Comme précédemment établi (Nye et al., 1995), Les injections de cocaïne 3 étaient suffisantes pour induire de manière significative la protéine ΔFosB dans les NAc et les CPu d’animaux n'ayant jamais reçu de drogue, et son accumulation demeurait significative après les jours 6 d’injections de cocaïne (Fig 1C. ANOVA à deux voies avec mesures répétées, cœur NAc, traitement: F1,28= 23.5, p <0.0001; défi de la cocaïne: F3,28= 49.16, p <0.0001; traitement x défi à la cocaïne: F3,28= 6.83, p = 0.0014; Coque NAc, traitement: F1,28= 18.69, p <0.0001; défi de la cocaïne: F3,28= 31.52, p <0.0001; traitement x défi à la cocaïne: F3,28= 3.21, p <0.05; CPu, traitement: F1,28= 9.47, p <0.001; défi de la cocaïne: F3,28= 19.74, p <0.0001; traitement x défi à la cocaïne: F3,28= 0.94, p> 0.05. Dans NAc core, shell et CPu, les post-tests de Bonferroni ^p <0.05). Chez les animaux ayant déjà consommé de la cocaïne, il n'y avait aucune preuve d'induction persistante de ΔFosB dans NAc ou CPu après 28 jours de sevrage, ce qui concorde avec les rapports antérieurs selon lesquels le signal ΔFosB se dissipe complètement à ce moment (Nye et al., 1995), la raison pour laquelle ce moment a été utilisé dans cette étude. De manière frappante, cependant, des rats cocaïnogènes ayant reçu des injections de provocation à la cocaïne 3 ou 6 ont montré une induction de la protéine ΔFosB significativement plus grande dans le NAc, un effet apparent dans les sous-régions centrale et de la coquille (Fig 1C. Post-tests de Bonferroni * p <0.05). En revanche, aucune induction plus importante de la protéine ΔFosB n'a été observée dans le CPu; au lieu de cela, une induction ΔFosB équivalente a été observée dans cette région après 3 ou 6 jours d'injections de provocation à la cocaïne chez des rats naïfs et expérimentés en cocaïne (Fig 1C).

Afin de mieux comprendre les altérations de la transcription survenant dans NAc et CPu en réponse à un problème de cocaïne, nous avons étudié l'évolution dans le temps (45, 90 et 180 min) de l'inductibilité des transcrits d'ARNm ΔFosB et FosB sur une seule injection de cocaïne ou de solution saline à des rats naïfs et expérimentés à la cocaïne après 28 jours de sevrage (voir Fig 1A). Par rapport à un défi salin, un défi à la cocaïne a entraîné une augmentation rapide des niveaux d'ARNm de ΔFosB et de FosB aux trois points de temps à la fois chez NAc et CPu chez des animaux n'ayant jamais pris de cocaïne (Fig 1D. Mesures répétées ANOVA à sens unique par point de temps; Bonferroni post-tests ^p <0.05). Dans NAc, nous avons observé une plus grande induction d'ARNm de ΔFosB et FosB chez les animaux expérimentés en cocaïne par rapport aux animaux naïfs de cocaïne après la provocation à la cocaïne, l'effet étant significatif à 90 min alors que, en revanche, l'inductibilité de l'ARNm de ΔFosB et FosB dans le CPu était significativement diminution chez les animaux ayant déjà consommé de la cocaïneFig 1D. Bonferroni post-tests %p = 0.08, * p <0.05).

Caractérisation des voies de signalisation en amont dans NAc et CPu de rats expérimentés à la cocaïne

Une explication possible de l’inductibilité modifiée de la Fosb Un gène présent dans NAc et CPu après un traitement antérieur chronique à la cocaïne est qu’un historique lointain d’exposition à la cocaïne pourrait induire des modifications durables des voies de signalisation en amont de la maladie. Fosb une induction génique telle qu'une provocation à la cocaïne induit le gène à un degré aberrant. Pour étudier cette hypothèse, nous avons analysé les deux facteurs de transcription, SRF et CREB, dont il a été récemment démontré qu’ils étaient nécessaires pour l’induction de ΔFosB par la cocaïne dans ces régions du cerveau (Vialou et al., 2012) ainsi que les protéines kinases en amont, ERK et AKT, également impliqués dans l'action de la cocaïne (Valjent et al., 2000; Lu et al., 2006; Boudreau et al., 2009). Nous n'avons pas détecté de changement dans les niveaux totaux ou phosphorylés de ces différentes protéines qui pourrait expliquer la modification de l'induciblilité de Fosb observés, y compris aucun changement dans SRF, CREB ou AKT (Figue 2B, C). L’absence de changement de pSRF et de pCREB dans l’acide naoc en réponse à un problème de cocaïne est cohérente avec un rapport récent qui révélait que les deux médicaments étaient induits significativement par la cocaïne chronique uniquement (Vialou et al., 2012).

Figure 2  

Effet d'une exposition chronique antérieure à la cocaïne sur les cascades de signalisation moléculaire en amont dans le NAc et le CPu

Dans NAc et CPu d’animaux n'ayant jamais reçu de médicament, 20 min après une exposition initiale au médicament (Fig 2A), une seule injection de cocaïne a réduit les concentrations de pERK42 / 44 (Figue 2B, C. Test t de Student bilatéral: * p <0.05). Il y a eu des rapports antérieurs d'augmentation des niveaux de pERK dans ces régions après l'administration aiguë de cocaïne (Valjent et al., 2000). C’est difficile à comparer à d’autres articles examinant la phosphorylation de ERK dans l’acide nitrique pendant le sevrage d’injections répétées de cocaïne (Boudreau et al., 2007; Shen et al., 2009), comme dans notre étude, le PERK a été quantifié après 28 jours de sevrage et après une exposition à la cocaïne ou à une solution saline. Par rapport aux animaux n'ayant jamais pris de drogue et ayant consommé de la cocaïne pour la première fois, la ré-exposition à la cocaïne chez des rats expérimentés à la cocaïne, après quelques jours de sevrage chez 28, a entraîné une augmentation significative des concentrations de pERK42 / 44 dans le CPu (Figue 2B, C. Test t d'étudiant à deux queues: * p <0.05).

Paysage de chromatine au Promoteur du gène Fosb dans le NAc et le CPu de rats expérimentés à la cocaïne

Nous avons ensuite examiné si les changements dans Fosb l’inductibilité des gènes est associée à des altérations de la structure de la chromatine. ChIP a été réalisée sur NAc et CPU en utilisant des anticorps dirigés contre trois formes bien caractérisées de modifications des histones: triméthylation de Lys4 de l'histone H3 (H3K4me3) associés à l'activation des gènes, et H3K27me3 et H3K9me2 associée à la répression des gènes. Nous avons analysé des rats naïfs et expérimentés avec de la cocaïne après 28 jours de sevrage, avec ou sans injection de cocaïne, avec des animaux examinés plus tard 1 hr (Fig 3A). Dans NAc, nous n’avons trouvé aucun changement significatif dans la liaison de l’une de ces trois modifications histones à la Fosb promoteur du gène en l’absence de provocation à la cocaïne, bien qu’il y ait eu une tendance à la réduction des niveaux de H3K9me2 (Figue 3B-D. Test t étudiant à deux queues. #p = 0.2 comparé aux contrôles respectifs naïfs au médicament). Cet effet est devenu significatif après une provocation à la cocaïne et était spécifique de la région promotrice proximale du gène (Fig 3C. * p <0.05). Alors que les niveaux de H3K9me2 sont très faibles pour certains gènes, le Fosb Le promoteur du gène montre des niveaux appréciables de cette marque dans NAc dans des conditions de contrôle (Maze et al., 2010, données non montrées). En revanche, dans le fichier CPu, nous avons constaté une diminution faible mais significative de la liaison H3K4me3 et une augmentation de la liaison H3K27me3 à la Fosb promoteur en l'absence de challenge cocaïne, les effets perdus après le challenge (Fig 3D. * p <0.05).

Figure 3  

Effet d'une exposition chronique antérieure à la cocaïne sur l'amorçage épigénétique du Fosb gène dans NAc et CPu

Nous avons ensuite étudié la liaison de Pol II à la Fosb Le gène, basé sur des découvertes récentes en culture cellulaire selon lesquelles le blocage de Pol II au niveau des TSS, caractérisé par sa phosphorylation au niveau de Ser 5 dans sa région répétée CTD, est associé à l’amorçage des gènes (voir Introduction). Nous avons donc analysé la liaison de Pol II-pSer5 à Fosb dans quatre régions distinctes du gène (Fig 3B). Cette analyse a révélé un enrichissement significatif en Pol II-pSer5 au Fosb gène au niveau de sa région promotrice proximale et autour de son TSS dans NAc d’animaux expérimentés à la cocaïne, après un sevrage prolongé, en l’absence de provocation à la cocaïne par rapport aux témoins (Fig 3E. * p <0.05). Cet enrichissement n'était pas apparent dans deux régions du corps génique de Fosb, en accord avec le décrochage de Pol II décrit dans des systèmes expérimentaux plus simples. Fait intéressant, après une épreuve de consommation de cocaïne, la liaison Pol II-pSer5 montrait toujours des signes d’enrichissement, bien que de manière non significative, à la Fosb région promotrice proximale (Fig 3E. %p = 0.1), mais est revenu aux niveaux de contrôle au niveau du TSS. Les résultats de la CPu étaient plus variables, sans motif clair de liaison de Pol II-pSer5.

Discussion

La présente étude fournit de nouvelles informations sur la réglementation durable des Fosb semaines après la fin de l'exposition répétée à la cocaïne. Nous montrons qu’une administration antérieure chronique de cocaïne rend le Fosb gène plus inductible dans NAc, ce qui entraîne une accumulation plus rapide de ΔFosB lors d’une nouvelle exposition au médicament. Etant donné la prépondérance des preuves selon lesquelles l’induction du ΔFosB dans le NAc induit des réactions comportementales sensibilisées à la cocaïne (Nestler, 2008), nos résultats révèlent un nouveau mécanisme pour la réintégration plus rapide de ces réactions sensibilisées après un sevrage prolongé.

Nous démontrons que l’induction accrue de ΔFosB dans NAc est associée à des modifications de la chromatine à la Fosb gène qui devrait l’amorcer pour une plus grande induction. Ainsi, nous montrons une liaison accrue de Pol II au promoteur proximal et aux régions TSS du gène qui sont présentes après plusieurs semaines d'absence de 4 après l'administration chronique de cocaïne. Cet enrichissement en Pol II au niveau du TSS est rapidement perdu lors de la consommation de cocaïne et Fosb induction, conforme à un modèle en culture cellulaire qui stagne Pol II est libéré des TSS lors de l'activation du gène (voir Introduction). Un défi à la cocaïne induit également une diminution rapide de la liaison de H3K9me2 - une marque de répression du gène - à la Fosb promoteur. En revanche, nous n’avons détecté aucune induction durable de plusieurs facteurs de transcription ou de leurs kinases en amont, connus pour induire une médiation. Fosb induction par la cocaïne. Ces résultats corroborent notre hypothèse selon laquelle l’induction accrue de ΔFosB dans NAc est induite par amorçage épigénétique du Fosb gène et non via la régulation en amont des événements en amont.

Des résultats très différents ont été obtenus pour le CPu. Il n'y avait aucune preuve de Pol II en train de caler à Fosb chez des rats cocaïnomanes avant une provocation à la cocaïne, bien qu'il y ait eu de petites modifications significatives de l'histone correspondant à la répression des gènes: augmentation de la liaison à H3K27me3 et diminution de la liaison à H3K4me3. Il n’existait pas non plus de changement des facteurs de transcription en amont ni des kinases compatibles avec une réduction de la Fosb induction. Ces résultats suggèrent qu'après une administration chronique de cocaïne, des modifications épigénétiques ont pour effet d'atténuer Fosb inductibilité des gènes dans le CPu, contrairement à l’amorçage observé dans le NAc. Cependant, alors que ces effets répriment l'induction d'ARNm ΔFosB lors d'une nouvelle exposition à la cocaïne, il n'y a pas de perte d'accumulation de la protéine ΔFosB. Le mécanisme sous-jacent à ce paradoxe nécessite maintenant des recherches plus approfondies.

Plus généralement, nos résultats appuient un modèle dans lequel des altérations du paysage chromatinien au niveau de gènes spécifiques en réponse à une administration chronique de cocaïne permettent d’amorcer ou d’émousser ces gènes en vue de leur induction ultérieure lors de la nouvelle exposition au médicament. Ces modifications de la chromatine, qui peuvent être considérées comme des «cicatrices épigénétiques», ne seraient pas prises en compte dans les analyses des niveaux de gènes d'ARNm à l'état d'équilibre. De cette manière, la caractérisation de l'épigénome de la toxicomanie promet de révéler de nouvelles informations sur la pathogenèse moléculaire du trouble, qui peuvent être exploitées pour le développement de nouveaux traitements.

Remerciements

Ce travail a été financé par des subventions de l'Institut national sur l'abus de drogues.

Références

  • Alibhai IN, TA verte, Potashkin JA, Nestler EJ. Régulation de l'expression des ARNm de fosB et DeltafosB: études in vivo et in vitro. Cerveau Res. 2007;1143: 22-33. [Article gratuit PMC] [PubMed]
  • Bataille AR, Jerónimo C, Jacques PE, Laramee L, Fortin ME, Forêt A, Bergeron M, Hanes SD, Robert F. Un cycle universel de CTD à ARN polymérase II est orchestré par des jeux complexes entre les enzymes kinase, phosphatase et isomérase le long des gènes. Mol Cell. 2012;45: 158-170. [PubMed]
  • Boudreau AC, Reimers JM, Milovanovic M, Wolf ME. Les récepteurs AMPA de la surface cellulaire dans le noyau accumbens du rat augmentent pendant le sevrage de la cocaïne, mais intériorisent après une provocation à la cocaïne en association avec une activation altérée des protéines kinases activées par le mitogène. J Neurosci. 2007;27: 10621-10635. [Article gratuit PMC] [PubMed]
  • Boudreau AC, CR Ferrario, MJ Glucksman, Wolf ME. Adaptations de la voie de signalisation et nouveaux substrats de la protéine kinase A liés à la sensibilisation comportementale à la cocaïne. J Neurochem. 2009;110: 363-377. [Article gratuit PMC] [PubMed]
  • Core LJ, Lis JT. Régulation de la transcription par la mise en veille proximale du promoteur de l'ARN polymérase II. Science. 2008;319: 1791-1792. [Article gratuit PMC] [PubMed]
  • Covington HE, 3rd, Maze I, Sun H, Bomze HM, DeMaio KD, Wu EY, Dietz DM, Lobo MK, Ghose S, Mouzon E, Neve RL, Tamminga CA, Nestler EJ. Rôle de la méthylation répressive des histones dans la vulnérabilité au stress induite par la cocaïne. Neuron. 2011;71: 656-670. [Article gratuit PMC] [PubMed]
  • Freeman WM, Nader MA, Nader SH, DJ Robertson, Gioia L, Mitchell SM, Daunais JB, Porrino LJ, PDD Friedman, Vrana KE. Changements chroniques induits par la cocaïne dans l'expression du gène du noyau accumbens de primate non humain. J Neurochem. 2001;77: 542-549. [PubMed]
  • Hyman SE, Malenka RC, Nestler EJ. Mécanismes neuronaux de la dépendance: rôle de l'apprentissage et de la mémoire liés aux récompenses. Annu Rev Neurosci. 2006;29: 565-598. [PubMed]
  • Kalivas PW, Volkow N, Seamans J. Motivation ingérable dans la toxicomanie: une pathologie de la transmission du glutamate préfrontal-accumbens. Neuron. 2005;45: 647-650. [PubMed]
  • Lazo PS, K Dorfman, T Noguchi, MG Mattei, Bravo R. Structure et cartographie du gène fosB. FosB régule à la baisse l'activité du promoteur fosB. Nucleic Acids Res. 1992;20: 343-350. [Article gratuit PMC] [PubMed]
  • Lu L, Koya E, H Zhai, Hope BT, Shaham Y. Rôle d'ERK dans la dépendance à la cocaïne. Tendances Neurosci. 2006;29: 695-703. [PubMed]
  • Mandelzys A, MA Gruda, Bravo R, Morgan JI. Absence d'antigène apparenté à kDa kDa 37 élevé de manière persistante et activité de liaison à l'ADN apparentée à AP-1 dans le cerveau de souris fosB null traitées à l'acide kaïnique. J Neurosci. 1997;17: 5407-5415. [PubMed]
  • Maze I, Nestler EJ. Le paysage épigénétique de la dépendance. Ann NY Acad Sci. 2011;1216: 99-113. [Article gratuit PMC] [PubMed]
  • Maze I, Covington HE, 3rd, DM Dietz, LaPlant Q, Renthal W, Russo SJ, Mécanicien M, Mouzon E., Neve RL, Haggarty SJ, Ren Y, Sampath SC, Hurd YL, Greengard P, Tarakhovsky A, Schaefer A, Nestler EJ. Rôle essentiel de l'histone méthyltransférase G9a dans la plasticité induite par la cocaïne. Science. 2010;327: 213-216. [Article gratuit PMC] [PubMed]
  • Nechaev S, Adelman K. Pol II, promoteur-proximal: ralentir en accélérant. Cycle cellulaire. 2008;7: 1539-1544. [PubMed]
  • Nestler EJ. La revue. Mécanismes transcriptionnels de la dépendance: rôle de DeltaFosB. Philos Trans R Soc Lond B Biol Sci. 2008;363: 3245-3255. [Article gratuit PMC] [PubMed]
  • Nye HE, espoir BT, Kelz MB, Iadarola M, Nestler EJ. Études pharmacologiques sur la régulation de l'induction chronique de l'antigène lié au FOS par la cocaïne dans le striatum et le noyau accumbens. J Pharmacol Ther Exp. 1995;275: 1671-1680. [PubMed]
  • Perrotti LI, Y Hadeishi, PG Ulery, M. Barrot, L Monteggia, Duman RS, EJ Nestler. Induction de deltaFosB dans les structures cérébrales liées aux récompenses après un stress chronique. J Neurosci. 2004;24: 10594-10602. [PubMed]
  • Robinson TE, Kolb B. Plasticité structurelle associée à l'exposition à des drogues d'abus. Neuropharmacologie 47 Suppl. 2004;1: 33-46. [PubMed]
  • Robison AJ, Nestler EJ. Mécanismes transcriptionnels et épigénétiques de la dépendance. Nat Rev Neurosci. 2011;12: 623-637. [Article gratuit PMC] [PubMed]
  • Saha RN, Wissink EM, Bailey ER, Zhao M, Fargo DC, Hwang JY, Daigle KR, Fenn JD, Adelman K, Dudek SM. La transcription rapide induite par l’activité de l’Arc et d’autres IEG repose sur l’ARN polymérase II en suspens. Nat Neurosci. 2011;14: 848-856. [Article gratuit PMC] [PubMed]
  • Shaham Y, espère BT. Le rôle des neuro-adaptations dans la rechute à la recherche de drogues. Nat Neurosci. 2005;8: 1437-1439. [PubMed]
  • Shen HW, S Toda, K Moussawi, Bouknight A, DS Zahm, PW Kalivas. Modification de la plasticité de l'épine dendritique chez des rats retirés de la cocaïne. J Neurosci. 2009;29: 2876-2884. [Article gratuit PMC] [PubMed]
  • Valjent E, JC Corvol, Pages C, MJ Besson, R Maldonado et J. Caboche. Implication de la cascade de kinases à signal régulé extracellulaire pour des propriétés récompensant la cocaïne. J Neurosci. 2000;20: 8701-8709. [PubMed]
  • Zeitlinger J, Stark A, Kellis M, Hong JW, Nechaev S, Adelman K, Levine M, Young RA. L'ARN polymérase décale au niveau des gènes de contrôle du développement chez l'embryon de Drosophila melanogaster. Nat Genet. 2007;39: 1512-1516. [Article gratuit PMC] [PubMed]
  • Vialou VF, Feng J, AJ Robison, Ferguson D, Scobie KN, M Mazei-Robison, E Mouzon, EJ Nestler. Le facteur de réponse sérique et la protéine de liaison à l'élément de réponse à l'AMPc sont tous deux nécessaires à l'induction de ΔFosB par la cocaïne. J Neurosci. 2012 accepté. [Article gratuit PMC] [PubMed]