La surexpression de DeltaFosB dans le noyau accumbens imite le phénotype protecteur de la dépendance, mais pas celui de la dépression protectrice de l'enrichissement environnemental (2014)

Front Behav Neurosci. 2014; 8: 297.

Publié en ligne en août 29, 2014. est ce que je:  10.3389 / fnbeh.2014.00297

PMCID: PMC4148937

Abstrait

L'enrichissement de l'environnement produit des phénotypes protecteurs de dépendance et de dépression chez le rat. ΔFosB est un facteur de transcription qui régule la récompense dans le cerveau et est induit par le stress psychologique ainsi que par la toxicomanie. Cependant, le rôle joué par ΔFosB dans les phénotypes protecteurs de l'enrichissement de l'environnement n'a pas été bien étudié. Ici, nous démontrons que ΔFosB est régulé de manière différenciée chez les rats élevés dans une condition isolée (IC) par rapport à ceux dans une condition enrichie (EC) en réponse à un stress de contrainte ou à la cocaïne.

Le traitement du stress chronique ou de la cocaïne chronique élève chacun les niveaux de protéine ΔFosB dans le noyau accumbens (NAc) des rats IC, mais pas chez les rats EC en raison d'une accumulation basale déjà élevée de ΔFosB observée dans des conditions EC.

La surexpression de ΔFosB à médiation virale dans la coquille de rats logés en binôme dans NAc (c'est-à-dire indépendante de l'enrichissement / isolement de l'environnement) augmente la réponse opérante au saccharose lorsque motivée par la faim, mais diminue la réponse chez les animaux rassasiés. En outre, la surexpression de ΔFosB diminue l’auto-administration de cocaïne, favorise l’extinction de la recherche de cocaïne et diminue la réintégration, par la cocaïne, de l’auto-administration de cocaïne par voie intraveineuse; toutes les observations comportementales conformes au phénotype d'enrichissement.

En revanche, la surexpression de ΔFosB n’a pas modifié les réponses des rats logés par paires dans plusieurs tests de comportement lié à l’anxiété et à la dépression.

Ainsi, ΔFosB dans le Imitations de coquilles NAc le phénotype protecteur de la dépendance, mais pas le phénotype protecteur de l'enrichissement environnemental.

Mots clés: [incrément]FosB, enrichissement de l'environnement, dépression, auto-administration de cocaïne, virus adéno-associé (AAV), surexpression

Introduction

L’expérience de la vie, en particulier au début de la vie, a de profondes répercussions sur le comportement des animaux tout au long de la vie. L’environnement joue un rôle essentiel dans la vulnérabilité et la résistance aux troubles mentaux chez l’homme (Elisei et al., 2013; Akdeniz et al., 2014; Kato et Iwamoto, 2014; van Winkel et al., 2014). Dans les modèles de rongeurs, il a été rapporté que le fait de vivre dans un environnement enrichi, du sevrage au début de l'âge adulte, produisait des phénotypes protecteurs de dépendance et de dépression. (Green et al., 2002, 2003, 2010; Laviola et al., 2008; Solinas et al., 2008, 2009; El Rawas et al., 2009; Thiel et al., 2009, 2010). Dans ce paradigme, les animaux sont affectés soit à une condition enrichie (EC) dans laquelle les animaux sont hébergés en groupe et ont un accès quotidien à de nouveaux objets, soit à une condition isolée (IC) dans laquelle des animaux sont hébergés seuls sans nouveauté ou contact social. Les animaux élevés dans un environnement enrichi, qui comprend le contact social, l'exercice et la nouveauté, manifestent moins de renforcement et cherchent de la cocaïne ou de l'amphétamine dans le paradigme de l'auto-administration de drogue par voie intraveineuse (Green et al., 2002, 2010). En plus du phénotype de dépendance, une telle exposition à un enrichissement produit un effet analogue à un antidépresseur chez les modèles animaux de dépression. (Green et al., 2010; Jha et al., 2011). Plus précisément, les animaux enrichis présentent un comportement analogue à celui de l'anhédonie dans le test de préférence pour le saccharose, un retrait moins social dans un test d'interaction sociale et une immobilité moins dans le test de la nage forcée. En dépit des effets d'enrichissement anti-addiction et de type antidépresseur, les mécanismes sous-jacents de ces phénotypes protecteurs d'enrichissement environnemental restent mal compris, bien que nos recherches précédentes aient impliqué un rôle dans la diminution de l'activité du facteur de transcription, CREB, dans le noyau accumbens (NAc ) pour atténuer certains des effets de l'enrichissement de l'environnement (Green et al., 2010; Larson et al., 2011). Ainsi, l'objectif de ces études sur l'élevage différentiel est d'utiliser une approche scientifique fondamentale pour identifier les mécanismes moléculaires de la résilience qui peuvent ensuite être traduits en clinique. Cette approche est l’équivalent environnemental de stratégies génétiques bien établies telles que la reproduction sélective (McBride et al., 2014).

Nous nous intéressons ici à un autre facteur de transcription, ΔFosB, qui est induit de manière évidente dans l'ANc par certaines formes de stress ou par pratiquement toutes les drogues faisant l'objet d'abus, notamment la cocaïne, la morphine, l'alcool, la nicotine et l'amphétamine (Hope et al., P. 1992; Kelz et Nestler, 2000; Perrotti et al., 2004, 2008). En tant que facteur de transcription, ΔFosB se dimérise avec des protéines de la famille Jun, préférentiellement JunD, pour former un complexe actif AP-1 qui se lie à l’élément de réponse AP-1 afin d’améliorer ou de réprimer la transcription de ses gènes cibles (Nestler, 1999). 2001), bien que de nouvelles recherches suggèrent que ΔFosB peut également agir comme un homodimère (Wang et al., 2012). La protéine ΔFosB est une variance d’épissure tronquée de la FosB gène qui provoque l'absence de deux domaines de degron C-terminaux dans la protéine ΔFosB, empêchant ainsi la protéine ΔFosB de se dégrader rapidement avec FosB et toutes les autres protéines de la famille Fos. Parce que ΔFosB est extraordinairement stable dans le NAc, ΔFosB agit de manière très différente en réponse aux stimuli aigus par rapport aux stimuli chroniques par rapport aux autres protéines Fos. Avec une exposition répétée à des médicaments d'abus ou de stress, la protéine ΔFosB s'accumule et persiste progressivement pendant des jours, voire des semaines, tandis que FosB et d'autres protéines Fos ne sont induites que pendant une courte période (heures) et développent une induction atténuée lors d'une exposition ultérieure (Nestler et al. 2001; Nestler, 2008).

L’importance de ΔFosB ne réside pas seulement dans le fait qu’elle est fortement induite par les drogues abusives et le stress, mais aussi dans le fait que la manipulation de ΔFosB dans le cerveau affecte le comportement des animaux. Induire sélectivement ΔFosB dans les neurones épineux de la dynorphine moyenne chez la souris adulte augmente la sensibilité locomotrice en réponse à la cocaïne aiguë et répétée, ainsi que les réponses enrichissantes à la cocaïne dans le paradigme des préférences de lieu conditionné et le renforcement dans le paradigme de l'auto-administration (Kelz et al., 1999; Kelz et Nestler, 2000; Colby et al., 2003).

Bien que les phénotypes protecteurs de dépendance et de dépression aient été décrits en détail pour les rats enrichis du point de vue de l'environnement, le rôle possible de ΔFosB dans la médiation de ces phénotypes protecteurs n'a pas été complètement évalué. Des études antérieures sur l'enrichissement de l'environnement ont montré que, comparé à l'environnement standard (SE), un environnement enrichi augmente les taux basaux de ΔFosB dans les neurones épineux des milieux D1 et D2 des régions striatales chez la souris. (Solinas et al., 2009; Lobo et al., 2013). De plus, les rats Wistar enrichis présentaient un nombre élevé de cellules positives au ΔFosB dans le NAc et le cortex préfrontal par rapport aux rats SE, ce qui suggère un rôle possible du ΔFosB dans le phénotype de dépendance à la nicotine. (Venebra-Muñoz et al., 2014). De plus, la surexpression de ΔFosB dans le striatum de souris augmente le roulement quotidien de la roue, ce qui peut être analogue à l’activité accrue de rats dans un environnement enrichi. (Werme et al., 2002).

Dans la présente étude, nous avons émis l’hypothèse suivante: l’enrichissement en environnement (1) augmenterait l’accumulation de niveaux de ΔFosB de base dans le NAc; et (2), cette accumulation de ΔFosB contribuerait aux effets protecteurs de l'enrichissement environnemental.

Matériels et méthodes

Animaux

Pour l’enrichissement de l’environnement, des rats Sprague-Dawley mâles (Harlan, Houston, Texas, États-Unis) ont été assignés de manière aléatoire à un logement EC ou IC du jour postnatal 21 au jour 51. Les rats CE ont été logés dans un groupe (20 par cage) dans une grande cage en métal (70 × 70 × 70 cm) avec plusieurs objets en plastique dur (jouets pour enfants, contenants en plastique, tubes en PVC, etc.). Ces objets ont été remplacés par de nouveaux objets et réarrangés quotidiennement dans une nouvelle configuration. Les rats IC ont été logés séparément dans des cages standard en polycarbonate. Les rats sont restés dans ces conditions tout au long des expériences et tous les tests comportementaux et biochimiques ont commencé après l'âge de 51 (c'est-à-dire au moins 30 jours d'enrichissement / isolement). Pour la surexpression de ΔFosB, des rats mâles Sprague-Dawley (Harlan, Houston, Texas, États-Unis) ont été obtenus à la taille 225 – 250 g et logés dans des cages standard en polycarbonate avant d’être injectés stéréotactiquement avec un vecteur viral associé à l’adénone (AAV2) surexprimant ΔFosB avec la protéine fluorescente verte (GFP) ou simplement la GFP comme témoin (voir ci-dessous). La nourriture et l'eau standard pour rats étaient librement disponibles pour tous les rats, sauf pendant les tests de comportement et la régulation des aliments. Tous les rats ont été maintenus dans un environnement contrôlé (température, 22 ° C; humidité relative, 50%; et cycle lumière / obscurité 12 h, lumières allumées 600 h) dans une colonie approuvée par l'Association pour l'évaluation et l'accréditation des animaux de laboratoire (AAALAC) . Toutes les expériences étaient conformes au Guide des soins de santé et d’utilisation des animaux de laboratoire du NIH et au Comité de protection et d’utilisation des animaux de la branche médicale de l’Université du Texas.

L'enrichissement de l'environnement est une manipulation composée de nouveauté, de contact social et d'exercice. Le logement en couple fournit un contact social et représente donc un CE (voir NIH Guide). Ainsi, le groupe de contrôle approprié pour une condition avec nouveauté, contact social et exercice physique serait un groupe sans nouveauté, sans contact social ni exercice, la condition IC. Les rats IC présentent moins de signes de stress chronique que les rats CE. Plus précisément, les rats EC ont des glandes surrénales élargies (Mlynarik et al., 2004), réponses CORT émoussées (Stairs et al., 2011), l’induction immédiate des gènes atténués (Zhang et al., manuscrit en préparation) et l’accumulation de ΔFosB (Solinas et al., 2009; Lobo et al., 2013), tous les signes de stress chronique (Crofton et al., en revue).

Stress psychologique

Des rats enrichis et isolés ont été placés dans des dispositifs de retenue en plastique souple jetables (DecapiCone®, Braintree Scientific Inc., Massachusetts, États-Unis) pendant 60 min pour le jour 1 (aigu) ou le jour 9 (répété). Pour les tests d'ARNm à courte exposition, les rats 30 (rats 5 par groupe) ont été décapités 30 après le début de la dernière période de contrainte de contrainte, les cerveaux de rats ont été extraits et la NAc a été disséquée pour l'analyse de l'ARNm. Pour l'immunohistochimie, les rats 12 ont été perfusés avec du sérum physiologique et 4% paraformaldéhyde, les cerveaux ont été extraits, post-fixés dans 4% paraformaldéhyde et conservés dans 20% glycérol dans 1xPBS à 4 ° C. Les cerveaux de rats ont été coupés à 40 um avec un microtome à congélation. Les cerveaux ont été récoltés 24 h après le stress final pour permettre à la protéine FosB de longueur totale de se dégrader (Perrotti et al., 2008).

Auto-administration intraveineuse de cocaïne avec enrichissement environnemental

Implantation de cathéter intraveineux

Les rats ont été anesthésiés à l'aide de kétamine (100 mg / kg IP) et de xylazine (10 mg / kg IP) et un cathéter Silastic a été inséré et fixé dans la veine jugulaire, sortant de la peau sur le dos de l'animal. Chaque jour, les cathéters ont été perfusés avec 0.1 ml d’une solution saline stérile contenant de l’héparine (30.0 U / ml), de la pénicilline G potassium (250,000 U / ml) et de la streptokinase (8000 UI / ml), afin de prévenir les infections et de maintenir la pérennité du cathéter. d'expériences.

Auto-administration de cocaïne avec enrichissement environnemental

Vingt rats enrichis et isolés de 20 ont été placés dans des chambres opérantes 30 × 24 × 21 cm (Med-Associates, St. Albans, Vermont) et autorisés à appuyer sur un levier pour des perfusions de cocaïne (0.5 en mg / kg / perfusion, approvisionnement en drogue NIDA, Research Triangle Institute, Caroline du Nord, États-Unis) ou une solution saline avec un programme 1 (FR1) à rapport fixe pour 2 h par jour pendant un total de 14 jours. Pour maintenir une consommation de cocaïne similaire entre les groupes EC et IC, il y avait un maximum de perfusions de 30 par session. La capacité de traitement des tissus étant limitée aux échantillons 30, les rats les moins répondants de chaque groupe n’ont pas été traités, ce qui laisse Ns de 8 pour la cocaïne et 7 pour les groupes de solution saline. Ainsi, il n'y avait pas de différences CE / IC dans la consommation totale de cocaïne ou dans le temps des perfusions entre les rats CE et IC. Les cerveaux de rats ont été extraits 3 h après le début de la dernière session d’auto-administration et le NAc a été disséqué pour analyse d’ARNm et de protéines. Un côté de la NAc a été utilisé pour le transfert Western, l'autre pour la qPCR.

Administration de cocaïne non contingente avec enrichissement environnemental

Pour une comparaison directe avec la littérature publiée précédemment (Hope et al., 1994; Chen et al., 1995), CE (N = 12) et les rats IC (N = 12) ont reçu une solution saline ou 20 en mg / kg de cocaïne par voie intraperitoneale (IP) pendant 1 jour (aigu) ou 9 (répété). Un échantillon de CE a été perdu pendant le traitement. Le groupe de soins de courte durée a reçu des injections de solution saline pendant 8 jours et une injection de cocaïne le jour 9, de sorte que tous les rats ont reçu le même nombre d'injections. Les cerveaux ont été extraits 30 min après la dernière injection et le NAc a été disséqué pour l'analyse de l'ARNm.

Quantification de l'ARNm à l'aide de qPCR

L'ARN a été extrait par homogénéisation dans l'ARN STAT-60 (Teltest, Friendswood, TX), en séparant l'ARN de l'ADN et des protéines en utilisant du chloroforme et en précipitant l'ARN total avec de l'isopropanol. L'ADN contaminant a été retiré (TURBO DNA-Free, Life Technologies, CA, USA) et 5, ug de l'ARN purifié, a été soumis à une transcription inverse en ADNc (Synthèse du premier brin SuperScript III: catalogue Invitrogen n ° 18080051). L'ARNm de ΔFosB a été quantifié par PCR quantitative en temps réel (SYBR Green: Applied Biosystems, Foster City, Californie) sur un thermocycleur rapide Applied Biosystems 7500 avec des amorces conçues pour détecter uniquement ΔFosB (avant: AGGCAGAGCTGGAGTCGGAGAT; inverse: GCCGAGGACTTGAACTTCAGTCG) pour détecter la GAPDH de rat (avant: AACGACCCCTTCATTGAC; inverse: TCCACGACATACTCAGCAC). Toutes les amorces ont été validées et analysées pour la spécificité et la linéarité avant les expériences (Alibhai et al., 2007).

Western blot

Le côté droit de la NAc provenant de cocaïne ou de solution saline de rats EC et IC auto-administrés a été homogénéisé dans un tampon contenant du saccharose, un tampon Hepes, du fluorure de sodium, 10% SDS et des inhibiteurs de protéase et de phosphatase (Sigma-Aldrich: P-8340, P -2850, P-5726). La concentration en protéines a été évaluée à l'aide du kit Pierce BCA Protein Assay (Thermo Scientific, IL, États-Unis). Comme les protéines extraites d'un rat n'étaient pas suffisantes pour l'analyse, les échantillons 2 du même groupe ont été regroupés, produisant des échantillons 4 pour chaque groupe. Les échantillons de protéines ont été dénaturés à 95 ° pendant 5 min et traités sur un gel à gradient de polyacrylamide 10 – 20% (Criterion TGX, Laboratoires Bio-Rad, CA, USA), puis transférés sur une membrane de polyfluorure de vinylidène (PVDF) (Millipore, MA, USA). ). La membrane a été bloquée avec un bloqueur de qualité buvard (lait écrémé en poudre), incubée avec un anticorps primaire ΔFosB (lapin, 1: 1000, #2251, Technologie de signalisation cellulaire, MA, USA) et un anticorps primaire β-actine (souris, 1: 1000 , Cell Signaling Technology, MA, USA), lavé avec du TBST puis incubé avec des anticorps secondaires fluorescents (anti-lapin anti-lapin (780 nm), anti-souris d'âne (680 nm), 1: 15000, Li-Cor Biosciences, NE, ETATS-UNIS). Des transferts de Western ont ensuite été imagés (Odyssey, Li-Cor Biosciences, NE, USA) et les niveaux de protéines quantifiés avec le logiciel Odyssey.

Immunohistochimie

Pour la figure Figure11 (N = 3), les cellules contenant ΔFosB ont été visualisées et comptées par marquage immunohistochimique de ΔFosB dans des coupes NAc colorées avec du DAB (kit de substrat DAB peroxydase, Vector Laboratories, CA, USA). Les cerveaux ont été extraits, post-fixés, cryoprotégés et découpés en tranches 40 en µm contenant le NAc sur un microtome à congélation (Leica Biosystems, IL, USA). Les tranches sont restées flottantes et ont été rincées avec du 1xPBS avant que les peroxydases endogènes ne soient refroidies avant d'être bloquées avec du sérum de chèvre 3% normal (Jackson ImmunoResearch, PA, USA) et du 0.3% triton et avidine D (Vector Laboratories, CA, USA). Les coupes de NAc ont été incubées avec l'anticorps primaire FosB pendant la nuit (1: 1000, Santa Cruz Biotechnology, Dallas, TX, USA) avec 3% sérum de chèvre, 0.3% triton, 1xPBS et une solution de biotine (Vector Laboratories, CA, USA). Bien que cet anticorps reconnaisse à la fois FosB et ΔFosB, des études antérieures de transfert Western ont montré qu'à 24 h post-stimulation, la grande majorité du signal immunohistochimique est composée de ΔFosB car FosB se dégrade bien avant 24 h (Perrotti et al., 1991). 2008). Après lavage, les tranches ont été incubées avec un anticorps secondaire IgG anti-lapin de chèvre biotinylé (Vector Laboratories, CA, USA), du sérum de chèvre et du 1xPBS. Ensuite, les tranches ont été incubées avec une coloration à la peroxydase du complexe avidine-biotine (ABC) pour 15 min (Thermo Scientific, IL, USA). Enfin, les tranches ont été montées, déshydratées à l'aide d'éthanol et de CitriSolv (Fischer Scientific, MA, USA) et couvertes de DPX (Fisher Scientific). Pour le comptage cellulaire, des sections ont été échantillonnées de Bregma + 1.80 à + 1.44 de chaque animal. Le nombre total de cellules immuno-positives ΔFosB a été compté à partir de quatre sections NAc du noyau et de la coquille de chaque rat.

Figure 1  

Le stress et [incrément]FosB chez les rats EC et IC. (UN D) Coloration DAB par immunohistochimie représentative de ΔFosB dans l’enveloppe et le noyau de NAc de la CI (A et B) et CE (C et D) rats avec (B et D) Et sans (A et C) stress répété (N = 3). (E) Quantification ...

Surexpression du virus adéno-associé [incrément]FosB

Un vecteur basé sur AAV2 qui exprime ΔFosB et la GFP de la renilla humanisée (hrGFP; Winstanley et al., 2007, 2009,b) ou vecteur de contrôle hrGFP (N = 10 chacun) a été injecté bilatéralement dans le NAc de rat. Comme il n’existe aucun humain IC, des rats logés en binôme ont été utilisés à la place de rats IC pour cette étude afin de renforcer la pertinence pour la communauté scientifique en démontrant les effets de ΔFosB. indépendant du paradigme CE / CI. Un AAV exprimant hrGFP mais qui ne surexprime pas AFOSB a été utilisé comme contrôle. L'expression de ΔFosB in vivo a été validée par coloration par immunofluorescence avec l'anticorps primaire FosB (1: 200, Rabbit, Cell Signaling Technology, MA, USA). Les vecteurs AAV ont été injectés dans l’enveloppe NAc bilatéralement (1 μl / side over 10 min) à l’aide de coordonnées (AP = 1.7, L = 2.0, D = −6.5). Les tests comportementaux ont débuté 3 quelques semaines après la chirurgie stéréotaxique. Le placement exact a été déterminé par immunohistochimie après la conclusion des tests comportementaux.

Néophobie du saccharose

Rat surexprimant ΔFosB (N = 10) et les rats témoins (N = 8) ont été traités pour la semaine 1 avant le début des tests de comportement. Pour tester le comportement de type anxiété, les rats ont été évalués pour la néophobie à un nouveau goût (saccharose). Les rats ont été séparés dans des cages individuelles et l'eau a été retirée à 1600 h. Les bouteilles d'eau standard pour rats ont été remplies d'une solution de saccharose 1% p / v dans l'eau du robinet normale des rats et pesées avant d'être placées sur chaque cage à 1800 h. Après 30 min, les bouteilles ont été retirées et pesées à nouveau, et la différence de poids des bouteilles de saccharose avant et après le test a été calculée. Ensuite, le saccharose a été replacé sur les cages pendant 2 jours supplémentaires pour permettre aux rats de se familiariser avec le goût du saccharose avant le test de préférence pour le saccharose.

Surélevé et labyrinthe

Un autre test de comportement de type anxiété, le labyrinthe élevé (EPM), a été testé plusieurs jours 2 après la néophobie du saccharose. L’EPM mesure le comportement exploratoire modifié par un vecteur dans un nouvel environnement générateur d’anxiété (Green et al., 2008). Deux bras fermés et deux bras ouverts (Med Associates Inc., Vermont, États-Unis) mesurant 12 × 50 cm mesuraient 75 cm au-dessus du sol et disposaient de faisceaux photographiques à l'entrée de chaque bras. Le temps passé sur les bras ouverts a été contrôlé pour détecter 5 min à l'aide de cassures de photobeam à l'aide du logiciel Med-PC.

Défécation induite par le stress dû au froid

Le lendemain de l'EPM, un troisième test d'anxiété a été utilisé: la défécation en réponse à un environnement légèrement stressant (froid). Les cages de souris en polycarbonate (33 × 17 × 13 cm) ont été pré-refroidies sur de la glace pendant 10 min. Les rats ont été placés dans des cages sur de la glace pendant 30 min et le nombre de bolioles fécales a été enregistré à chaque 5 min.

Contact social

Le lendemain, le comportement de type dépression a été mesuré à l'aide d'un test d'interaction sociale. Les rats ont été séparés pour le 24 h avant les tests. Le jour du test, les rats ont été placés dans un nouvel environnement (récipient en plastique, 45 × 40 × 45 cm) avec leur compagnon de cage et leur comportement a été enregistré sur vidéo pour 30 min. Le temps que la paire de rats a passé à se toiletter a été mesuré par un enquêteur aveugle à l’état du rat.

Saccharose de préférence

Après un contact social, le test de préférence pour le saccharose a été utilisé comme modèle d'anhédonie. Des rats logés en paires ont été séparés à 1600 h avec de la nourriture, mais l'accès à l'eau n'a pas été autorisé pour 2 h. À 1800, deux bouteilles d’eau pré-pesées ont été placées sur chaque cage, l’une contenant de l’eau, l’autre une solution 1% saccharose dans de l’eau. Les bouteilles d'eau ont été placées dans la position normale tandis que le saccharose a été placé à environ 10 cm. Les bouteilles ont été retirées et pesées à nouveau après 15 min.

Activité locomotrice

Trois jours après la préférence pour le saccharose, l'activité locomotrice a été évaluée dans des conditions de lumière normales en plaçant les rats dans des chambres en plexiglas transparent (40 × 40 × 40 cm) avec une mince couche de litière, entourée de deux matrices de photobeam 4 × 4, une 4 cm ci-dessus. le sol et un cm 16 au-dessus du sol pour enregistrer une activité de déambulation horizontale et verticale (élevage). Les ruptures de photobeam ont été contrôlées pour 2 h par un système d'activité à champ ouvert modifié (San Diego Instruments, CA, USA).

Test de natation forcée

Le dernier test comportemental spontané était le FST, un modèle sensible aux antidépresseurs. Les rats ont été placés dans un cylindre en plexiglas rempli d'environ 14 L d'eau à la température ambiante (24 ± 0.5 °) pendant un minimum de 15 lors de la session 1, et 5 min lors de la session 2 le jour suivant. Les rats ont été séchés et replacés dans leurs cages d'origine. Les activités de natation ont été enregistrées sur vidéo et le temps de latence jusqu’à la première période d’immobilité (1) et le temps total d'immobilité ont été déterminés pour la session 2 par un enquêteur aveugle aux conditions.

Saccharose intervenant répondant

Les rats de contrôle AAV et les rats surexprimant ΔFosB ont été régulés à 85% du poids de l'alimentation libre en jours 7. Tous les rats ont été entraînés à presser les pastilles de saccharose (Bio-Serv, NJ, USA) selon un programme de renforcement FR1 pour les sessions 15 min les jours consécutifs 5. Les rats ont ensuite eu libre accès à la nourriture pendant 3 jours et ont ensuite été autorisés à presser les pastilles de saccharose sur des pellets de saccharose selon un calendrier FR1 pour 15 min, cette fois à 100% du poids du régime consommé.

Auto-administration de cocaïne

Acquisition

Une semaine après la chirurgie au cathéter (comme décrit ci-dessus), tous les rats (rats contrôles 7 et 10 AFSB surexprimant, un rat contrôle a été perdu de la chirurgie du cathéter) ont été placés dans des chambres opérantes 30 × 24 × 21 cm Albans, VT) et autorisé à s'auto-administrer une dose unitaire de cocaïne en mg / kg / perfusion de 0.2 pour 2 h par séance pendant les 4 jours; puis 0.5 en mg / kg / perfusion pour les jours 3 selon un calendrier FR1. Chaque perfusion était administrée par voie intraveineuse dans un volume de 0.01 ml par rapport à 5.8. La perfusion était signalée par l’éclairage de deux signaux lumineux pour 20, ce qui signalait une période de temporisation au cours de laquelle aucune autre perfusion ne pouvait être atteinte.

Extinction

Étant donné que l'exposition chronique à la cocaïne induirait probablement une accumulation de ΔFosB chez les rats témoins, ce qui ferait que les rats dans les deux conditions vectorielles présentent des niveaux élevés de ΔFosB dans le cerveau, ils ont été confinés dans leur cage d'origine pendant des jours 4 sans auto-administration afin de permettre Taux de protéine ΔFosB pour diminuer chez les rats vecteurs témoins. Après une abstinence de jours 4, les rats ont été placés dans la chambre opérante et autorisés à s’auto-administrer une solution saline à la place de cocaïne selon un calendrier FR1 pour les séances de 1 h pendant X jours consécutifs.

Rapport dose-réponse fixe

Chaque rat (contrôle et ΔFosB surexprimant) a été autorisé à auto-administrer de la cocaïne 0.00325, 0.0075, 0.015, 0.03, 0.06, 0.125, 0.25 mg / kg / perfusion, chaque jour pendant des jours consécutifs 0.5. Les rats ont auto-administré chaque dose de cocaïne pour 1 min.

Réintégration induite par la cocaïne

Les rats ont subi une procédure de rétablissement au sein de la session. Les rats ont reçu 0.5 en mg / kg / perfusion selon un calendrier FR1 pour 60 min suivi de 3 h en extinction (avec indices de cocaïne éventuels). Ensuite, ils ont reçu une injection IP (Green et al., 2010) de cocaïne en une des cinq doses (0, 2.5, 5, 10 ou 20 mg / kg) dans un ordre aléatoire pour chaque rat au cours des séances de réintégration 5. La dernière phase 3 h de la session a été la réintégration, toujours avec des signaux de cocaïne mais toujours sans perfusion de cocaïne. Après chaque session de rétablissement induite par la cocaïne, les rats ont reçu 2 pendant plusieurs jours sous forme de cocaïne à forte dose (0.5 en mg / kg / perfusion) selon un calendrier FR1 pour 2 h afin de maintenir des taux de réponse élevés entre les sessions. Au cours du processus d’auto-administration de la cocaïne, les cathéters de certains rats ont progressivement perdu leur perméabilité; par conséquent, les données des rats témoins 6 et des rats surexprimant 7 ΔFosB ont été utilisées dans cette analyse.

analyses statistiques

Des analyses de variance bidirectionnelles (ANOVA) et des ANOVA à mesures répétées bidirectionnelles ont été effectuées pour comparer les quatre groupes de traitement et des comparaisons planifiées ont été utilisées pour comparer les différences entre les conditions. La signification entre seulement deux conditions a été analysée à l'aide d'un test de Student. t-tester. Tout tLes données du test ont réussi le test de normalité de Shapiro-Wilk. Toutes les données sont exprimées en moyenne ± SEM. La signification statistique a été fixée à p <0.05. Tous les rats enrichis pour une seule expérience ont été logés dans une cage mais traités comme des sujets séparés, ce qui a des implications concernant la question de la pseudo-réplication potentielle.

Resultats

Les rats CE présentent des niveaux basaux de [incrément]FosB dans NAc que les rats IC

Comparés aux rats IC, les rats EC ont un nombre significativement plus élevé de cellules positives au ΔFosB dans les deux noyaux NAc (t(4) = −3.31, p <0.05) et coque (t(4) = −6.84, p <0.05) (chiffres 1A, C, E, F), suggérant que le ton de base de ΔFosB est plus élevé chez les rats CE que chez les rats IC. De plus, les résultats du Western Blot ont montré une forte tendance chez les rats salins EC ayant un taux de base plus bas de la protéine ΔFosB dans le NAc par rapport aux rats salins IC (t(6) = −2.03, p = 0.089; Figure Figure2A) 2A) en utilisant un test bilatéral. Cependant, étant donné l’expression accrue des figures 1A – F et les augmentations observées dans d'autres articles (Solinas et al., 2009), nous sommes confiants dans cet effet. Les résultats du Western Blot ont également permis de vérifier que la quasi-totalité de l'immunoréactivité de type FosB détectée par immunohistochimie était AFOSB et non FosB, qui n'était pas détectable à 24h.

Figure 2  

La cocaïne et [incrément]FosB chez les rats EC et IC. (UN B) Protéine moyenne ΔFosB (A) et l'ARNm (B) niveau (± SEM) dans NAc après 14 jours d’auto-administration de solution saline ou de cocaïne chez des rats IC et EC (N = 7 – 8). Les bandes rouges dans le panneau désignent ...

[incrément]Le FosB est induit différentiellement chez les rats EC et IC par le stress

Les contraintes répétées de contrainte dans les deux coquilles ont eu un effet principal significatif (F(1, 8) = 16.6, P <0.005) et noyau (F(1, 8) = 7.9, P <0.05) du NAc et un effet principal de l'enrichissement environnemental en coquille (F(1, 8) = 22.3, P <0.005; Les figures 1A – F) Plus important encore, l’interaction entre le stress et l’enrichissement de l’environnement était également significative dans les deux types de coquilles (F(1, 8) = 25.6, P <0.01) et noyau (F(1, 8) = 6.7, P <0.05). L'interaction était telle qu'après un stress de contention répété, le nombre de cellules positives ΔFosB augmentait significativement chez les rats IC, alors que ce nombre ne changeait pas chez les rats EC après un stress répété.

Pour étudier plus en détail comment ΔFosB est régulé dynamiquement par un stress aigu versus un stress répété et pour permettre la comparaison avec des recherches antérieures (Alibhai et al. 2007), induction de ΔFosB ARNm a été étudié avec des contraintes de contention aiguës et répétées (Figure (Figure1G) .1G) Il y avait un effet principal significatif du stress (F(2, 24) = 31.9, P <0.001) et l'enrichissement environnemental (F(1, 24) = 5.1, P <0.05). Chez les rats IC, l'ARNm de ΔFosB a été fortement induit après un stress de contention aigu. Cependant, avec un stress répété, l'induction de l'ARNm de ΔFosB était significativement atténuée par rapport à l'induction aiguë. Il y avait également une interaction significative (F(2, 24) = 4.6, P <0.05), démontrant que l'induction aiguë de l'ARNm de ΔFosB était moindre chez les rats EC que chez les rats IC. Ainsi, les rats EC présentent des taux basaux de ΔFosB protéines dans le NAc, mais moins de ΔFosB ARNm induction en réponse à un stresseur aigu.

[incrément]La fosB est induite différentiellement par la cocaïne dans le NAc de rats EC et IC

Pour déterminer si les rats EC et IC répondent différemment à la cocaïne, nous avons étudié la régulation de la protéine ΔFosB et de l'ARNm dans la NAc de rat après l'auto-administration de cocaïne (Figures 2A, B respectivement). Un Western blot a révélé un effet principal significatif de la cocaïne (F(1, 12) = 24.9, P <0.001) et une interaction significative (F(1,12) = 5.5, P <0.05). L'interaction était telle que ΔFosB augmentait davantage chez les rats IC que chez les rats EC (Figure (Figure2A) .2A). En fait, après l’auto-administration de cocaïne, les taux de protéine ΔFosB étaient significativement élevés uniquement. chez les rats IC. En ce qui concerne les niveaux d’ARNm, les résultats de la qPCR ont également révélé un effet principal significatif de la cocaïne (F(1, 26) = 47.1, P <0.001) et effet principal de l'enrichissement environnemental (F(1, 26) = 13.8, P <0.005). Bien que les niveaux globaux soient plus faibles chez les rats EC, les deux groupes ont augmenté l'ARNm de ΔFosB (Figure (Figure2B2B).

Bien que les données sur les protéines soutiennent l’hypothèse initiale, elle a été émise à partir de la Figure Figure1G1G que les rats CE montreraient moins ARNm l'induction que les rats isolés dans l'expérience de la cocaïne ci-dessus, ce qui n'a pas eu lieu, probablement parce que la figure Figure1G1G utilisé un point temporel 30 min et l’expérience sur la cocaïne a utilisé un point temporel 3 h. Afin d’interroger davantage l’hypothèse de l’ARNm, un point de temps minimal 30 a été utilisé pour explorer à la fois le traitement de la cocaïne aigu et répété en tant que meilleure comparaison avec la Figure. Figure1G.1G. Étant donné que l'auto-administration aiguë de cocaïne est par nature problématique (c.-à-d. Apprentissage par l'acquisition), des rats aigus ou IC ont reçu des injections aiguës ou 9 de cocaïne IP répétée non contingentes (20 mg / kg). Comme supposé, l’enrichissement de l’environnement a eu un effet principal important (F(1, 17) = 14.3, P <0.005), mais l'effet principal du traitement à la cocaïne (F(2, 17) = 3.4, P = 0.057) et l'interaction (F(2, 17) = 3.4, P = 0.055) n'a montré que de fortes tendances avec un test bilatéral. Cependant, étant donné que nous avions des hypothèses directionnelles de la figure Figure1G, 1G, nous sommes extrêmement à l'aise à notre avis que les rats EC présentent moins d'induction que les rats IC (Figure (Figure2C2C).

Surexpression de [incrément]Le FosB dans la coque de NAc imite le phénotype de dépendance induit par l'enrichissement protecteur

Pour étudier l’effet de ΔFosB sur le comportement du rat indépendamment de l’enrichissement / isolement de l’environnement (pour rendre ces résultats plus pertinents pour les études non-CE / IC), le virus adéno-associé (AAV) a été utilisé pour surexprimer bilatéralement ΔFosB dans le NAc dans rats logés par paires non enrichis. Selon nos études précédentes, la coquille NAc était plus sensible au contrôle du comportement lié à la dépression et à la consommation de drogue; les vecteurs AAV ont donc été injectés dans la coquille NAc dans cette étude (Green et al., 1997). 2006, 2008, 2010). Les chiffres 3A, B montrent l'immunohistofluorescence représentative de AFOSB avec le vecteur de contrôle (panneau A; c'est-à-dire l'expression AFFB endogène) et le vecteur surexprimant AFOSB (panneau B) dans la coquille de NAc.

Figure 3  

Surexpression de [incrément]FosB dans sa coquille de NAC imite le phénotype de protection de l'enrichissement environnemental. (UN B) Immunohistochimie représentative de ΔFosB pour le contrôle du hrGFP (A) et ΔFosB-surexprimant (B) Vecteurs AAV. ...

Après avoir validé le titre, in vivo expression et placement général du vecteur viral, nous avons d’abord étudié l’effet de la surexpression de ΔFosB dans les modèles d’anxiété. La surexpression de ΔFosB dans la coquille de NAc n’était pas suffisante pour reproduire l’effet anxiogène de l’enrichissement environnemental dans les paradigmes de défécation induits par la néophobie du saccharose et le stress dû au froid (données non présentées). De plus, il n'y avait aucun effet sur l'EPM (données non présentées). Étant donné que l'enrichissement de l'environnement produit un effet de type antidépresseur chez le rat, nous avons ensuite effectué des tests liés à la dépression chez le rat surexprimant ΔFosB. De manière similaire aux modèles d'anxiété, les résultats ont montré qu'une surexpression de ΔFosB dans la coquille de NAc n'était pas suffisante pour réduire les comportements de type dépression dans le test de préférence pour le saccharose, le test d'interaction sociale ou le FST. (données non présentées).

Dans le paradigme de l'enrichissement de l'environnement, les rats EC présentent une activité locomotrice basale inférieure à celle des rats IC (Bowling et al., 2003). 1993; Bowling et Bardo, 1994; Smith et al., 1997; Green et al., 2003, 2010). Pour étudier l'effet de la surexpression de ΔFosB dans la coquille de NAc, l'activité locomotrice spontanée a été testée pour 120 min. À l’aide d’un test bilatéral, les résultats ont révélé qu’une surexpression de ΔFosB dans la coquille de NAc avait entraîné une forte tendance à la baisse de l’activité locomotrice basale chez le rat (Figure 3). (Figure3C; 3C; t(16) = 1.84, p = 0.084). Bien qu'elles ne soient pas statistiquement significatives avec un test bilatéral, ces données intriguent toujours étant donné qu'elles sont conformes à notre hypothèse directionnelle explicite basée sur Green et al. (2010), ce qui est compatible avec l'effet de l'enrichissement de l'environnement.

IContrairement aux modèles de dépression et d’anxiété, la surexpression de ΔFosB dans l’enveloppe de NAC a permis de produire un phénotype de type EC dans de multiples paradigmes addiction / renforcement. jeDans le test d’auto-administration opérant sur des pastilles de saccharose, il existait une interaction significative entre la surexpression de ΔFosB et la motivation des rats pour la faim (F(1, 16) = 7.4, P <0.01). Les rats surexprimant ΔFosB dans la coquille NAc ont pris PLUS granulés de saccharose dans des conditions motivées par la faim (par exemple, 85% de poids vif), mais moins de pellets dans des conditions peu motivées (c.-à-d. 100% en poids de nourriture non consommable; Figure Figure3D), 3D), qui imite parfaitement le phénotype de la CE (Green et al., 2010).

Dans le paradigme de l'enrichissement de l'environnement, les rats EC ont montré un comportement réduit de recherche de cocaïne en voie d'extinction et une réintégration induite par la cocaïne (Green et al., 2010). Ainsi, le comportement de prise et de recherche de cocaïne a été mesuré chez des rats exprimant ΔFosB en utilisant le paradigme d’auto-administration de cocaïne par voie intraveineuse. En tant que modèle de besoin, le paradigme de l'extinction de la cocaïne a révélé que la surexpression de ΔFosB dans la coquille de NAc diminuait le comportement de recherche de drogue.r (F(1, 15) = 6.7, P <0.05; Figure Figure3E) .3E). Il y avait aussi un effet principal significatif de la session (F(2, 30) = 74.0, P <0.001). Pour l'entretien répondant dans le cadre d'un calendrier FR1, il y avait un effet principal significatif de la dose (F(7, 105) = 222.6, P <0.001) et une interaction significative (F(7, 105) = 2.3, P <0.05) de la consommation cumulée de cocaïne. La nature de l'interaction était telle que les différences n'étaient apparentes qu'à des doses plus élevées de cocaïne (Figure (Figure3F) .3F). Enfin, lors de la réintégration induite par la cocaïne, il existait un effet principal significatif de la dose (F(4, 44) = 15.5, P <0.001) et une tendance pour un effet principal de la surexpression de ΔFosB en utilisant un test bilatéral (F(1, 11) = 4.1, P = 0.067). Cependant, étant donné l’hypothèse directionnelle de Green et al. (2010) et les résultats statistiquement significatifs et cohérents des figures 3D, E, F, il est probable que ΔFosB diminue la réintégration (Figure (Figure3G) .3G). La réponse à la dose de 10 en mg / kg était significativement inférieure chez les rats exprimant ΔFosB. Les résultats dans leur ensemble indiquent que la surexpression de ΔFosB dans la coquille de NAc de rat réduit la prise et le comportement de cocaïne, ce qui correspond aux effets comportementaux de l’enrichissement de l’environnement.

Discussion

La vulnérabilité des individus à la dépendance et à la dépression est fortement affectée par les facteurs environnementaux. L'enrichissement de l'environnement est un paradigme qui manipule le cadre de vie des animaux, produisant des effets protecteurs contre de nombreuses conditions psychiatriques. ΔFosB joue un rôle clé dans la régulation de la fonction de récompense dans plusieurs régions du cerveau, y compris le NAc et le striatum dorsal (Koob et al., 1998; Sage, 1998; Wallace et al., 2008; Grueter et al., 2013; Pitchers et al., 2013). Dans ce projet, nous avons étudié la régulation dynamique de ΔFosB par le stress de contention et la cocaïne chez des rats enrichis et isolés. Les principales conclusions de ce projet sont:

(Les rats 1) EC ont des taux de ΔFosB élevés dans le NAc au départ comparés aux rats IC;

(2) seuls les rats IC accumulent une protéine ΔFosB supplémentaire en cas de stress répété;

(3) Les rats EC présentent une induction atténuée de l'ARNm de ΔFosB à la suite d'un stress ou de la cocaïne; et

(4) surexprimant ΔFosB dans le NAc de rats logés par paires imite le phénotype protecteur de la dépendance, mais pas le phénotype protecteur de la dépression.

On peut s’attendre à la littérature publiée, qui montre que les souris transgéniques ΔFosB surexprimant montrent une sensibilité accrue à la cocaïne et s’auto-administrent à de faibles doses de médicament (Kelz et al., 1999; Colby et al., 2003; Vialou et al., 2010; Robison et al., 2013), dans l'expérience actuelle, les rats surexprimant ΔFosB montreraient une propension accrue à l'auto-administration et à la recherche de cocaïne. ICependant, dans les expériences en cours, la surexpression de ΔFosB dans l’enveloppe de l’acide nitrique a diminué la consommation de cocaïne et la recherche de cocaïne lors de l’extinction et de la réintégration, indiquant une diminution de la motivation pour la cocaïne. La divergence pourrait être due au fait que les souris transgéniques ont exprimé ΔFosB dans tout le striatum, mais uniquement dans les cellules dynorphines +. (Colby et al., 2003). Dans l'expérience actuelle, ΔFosB a été surexprimé via un vecteur AAV qui infecte les neurones de la dynorphine + et de l'enképhaline +. Deuxièmement, l’étude actuelle s’est concentrée sur la coquille de NAc plutôt que sur l’ensemble de la région striatale.

En plus du phénotype de dépendance, l’enrichissement de l’environnement produit des profils analogues aux antidépresseurs et aux anxiogènes chez le rat. (Green et al., 2010; Vialou et al., 2010). Dans la présente étude, la surexpression de ΔFosB dans le NAc n’a produit d’effets dans aucun des trois tests de dépression ou des trois tests d’anxiété.. Bien que de nombreux facteurs puissent contribuer à ΔFosB imitant la dépendance à l’enrichissement mais pas au phénotype de la dépression, il est possible que la coquille de NAC soit plus dominante en ce qui concerne le comportement lié à la toxicomanie, alors que le comportement lié à la dépression peut être transmis de manière plus robuste par d’autres régions. Les présents résultats sont en contradiction avec les études dans souris où la surexpression de ΔFosB dans la NAc (où l’on ne peut pas distinguer de manière fiable shell et noyau) produisait des effets analogues à ceux d’un antidépresseur dans plusieurs essais comportementaux (Vialou et al., 2010). L'une des raisons possibles est qu'il est peut-être plus facile de voir l'effet de ΔFosB sur des modèles comportementaux soumis à un stress grave, comme le stress de défaite sociale. L’étude actuelle sur la surexpression a examiné le comportement de type dépressif en l’absence d’un facteur de stress grave.

De manière constante tout au long de cette étude, les niveaux basaux élevés de ΔFosB (provenant par exemple d'enrichissement, de stress répété ou de cocaïne) étaient en corrélation avec une induction ultérieure plus faible de ΔFosB. Cela peut représenter un effet de plafond, sans autre induction possible au-dessus de niveaux basaux élevés de la protéine. Il est également possible que les niveaux accumulés de ΔFosB puissent être réinjectés pour inhiber la poursuite de l'induction de l'ARNm de ΔFosB après un stress ou de la cocaïne sous forme de boucle de rétroaction négative. Par exemple, ELes rats C avaient des taux élevés de ΔFosB et présentaient une induction atténuée de ΔFosB après un stress ou de la cocaïne. Ceci souligne la corrélation négative entre les niveaux de protéine ΔFosB et son induction d'ARNm. Le retour négatif de ΔFosB accumulé explique également l'induction atténuée de ΔFosB avec stress répété chez les rats IC.

Pour être clair, nous ne prétendons pas que le paradigme de l'enrichissement de l'environnement a une pertinence directe en termes de traduction, car très peu d'enfants ont été élevés dans un dénuement véritable (il convient de noter que le dénuement socio-économique n'équivaut pas au dénuement). L’utilité de ce paradigme est qu’il s’agit d’une manipulation non médicamenteuse, non chirurgicale ni génétique qui produit des phénotypes comportementaux protecteurs de la dépendance et de la dépression pouvant être exploités dans un environnement contrôlé par un laboratoire en tant qu’outil scientifique fondamental pour l’identification de mécanismes moléculaires. résilience sous-jacente aux conditions psychiatriques. Des recherches antérieures ont décrit les phénotypes comportementaux en détail (Bowling et al., 1993; Bowling et Bardo, 1994; Bardo et al., 1995; Green et al., 2002, 2003; El Rawas et al., 2009) et des études plus récentes (Solinas et al., 2009; Green et al., 2010; Lobo et al., 2013), ainsi que de la présente étude, fournissent des indices sur les mécanismes de transcription sous-jacents à ces phénotypes comportementaux. Les gènes / protéines cibles de la transcription en aval produisant les phénotypes protecteurs sont actuellement à l’étude (Fan et al., 2013,b; Lichti et al., 2014).

Notre conceptualisation de l'enrichissement de l'environnement est que l'enrichissement est un continuum avec isolement du bas et enrichissement complet du haut. “Dans ce cas, «enrichissement complet» est défini comme un environnement dans lequel les sujets sont exposés à la nouveauté, au contact social non menaçant avec des congénères, et disposent d'un espace et d'objets pour l'exercice. TCes trois facteurs représentent tous la condition composite de «l'enrichissement», car ils sont chacun valorisants et chaque émission de dopamine dans le NAc, et à ce titre, activent un circuit neurobiologique commun. (Louilot et al., 1986; Calcagnetti et Schechter, 1992; Crowder et Hutto, 1992; Rebec et al., 1997; Bevins et al., 2002). Dans cette conceptualisation, l'isolement est considéré comme le groupe de contrôle car il représente l'absence de manipulation (c'est-à-dire l'enrichissement; Crofton et al., En revue). Cependant, d'autres conceptualisations sont possibles. Dans une autre conceptualisation, le continuum est le même, mais le groupe d'isolation est le groupe expérimental et le groupe enrichi est le contrôle. jen ce modèle, privant les sujets de l'enrichissement normal is la manipulation réelle. IDans ce cas, au lieu de dire que l'enrichissement est protecteur, on dirait que l'isolement confère une susceptibilité. Encore une troisième conceptualisation postule qu'il n'y a pas de continuum et que l'enrichissement et l'isolement sont deux manipulations fondamentalement différentes. Dans cette perspective, l'enrichissement et l'isolement doivent être séparés et les deux comparés à un contrôle hébergé par paire. L'absence de consensus universel sur la nature de l'enrichissement représente une limitation du paradigme, tout en fournissant une orientation pour les études futures. Quoi qu’il en soit, les résultats de ces expériences restent fermes, quelle que soit leur interprétation.

L’environnement et les expériences de vie ont une forte influence sur le développement et l’expression de nombreuses maladies psychiatriques. Comprendre le mécanisme des phénotypes protecteurs de dépendance et de dépression de l'enrichissement de l'environnement répond à une question fondamentale dans la recherche sur les troubles mentaux, à savoir la contribution environnementale à la susceptibilité ou à la résilience aux conditions psychiatriques. Cette étude souligne l’importance de ΔFosB dans la régulation des comportements liés à la dépendance. Dans les études futures, l'action du ΔFosB et ses effets activateurs et inhibiteurs sur des gènes cibles spécifiques doit être explorée plus avant dans le modèle d'enrichissement environnemental.

Financement et divulgation

Yafang Zhang, aucun; Elizabeth J. Crofton, aucune; Dingge Li, aucun; Mary Kay Lobo, aucune; Xiuzhen Fan, aucun; Eric J. Nestler, R37DA007359; Thomas A. Green, DA029091D.

Déclaration de conflit d'intérêts

Les auteurs déclarent que la recherche a été menée en l'absence de toute relation commerciale ou financière pouvant être interprétée comme un conflit d'intérêts potentiel.

Remerciements

Ces expériences ont été financées par une subvention de l'Institut national de lutte contre l'abus des drogues, DA029091 et R37DA007359. Cocaïne fournie par l'Institut national de lutte contre l'abus des drogues.

Références

  1. Akdeniz C., H. Tost, A. Meyer-Lindenberg (2014). La neurobiologie du risque social de schizophrénie dans l'environnement: un domaine de recherche en évolution. Soc. Psychiatrie Psychiatr. Épidémiol. 49, 507 – 517 10.1007 / s00127-014-0858-4 [PubMed] [Croix Ref]
  2. Alibhai IN, TA verte, Potashkin JA, Nestler EJ (2007). Régulation de l'expression des ARNm de fosB et DeltafosB: études in vivo et in vitro. Brain Res. 1143, 22 – 33 10.1016 / j.brainres.2007.01.069 [Article gratuit PMC] [PubMed] [Croix Ref]
  3. Bardo MT, Bowling SL, Rowlett JK, Manderscheid P., Buxton ST et Dwoskin LP (1995). L'enrichissement environnemental atténue la sensibilisation locomotrice, mais pas la libération in vitro de dopamine, induite par l'amphétamine. Pharmacol. Biochem. Comportement 51, 397 – 405 10.1016 / 0091-3057 (94) 00413-d [PubMed] [Croix Ref]
  4. Bevins RA, Besheer J., MI Palmatier, Jensen HC, Pickett KS, Eurek S. (2002). Conditionnement de nouveaux objets: processus comportementaux et dopaminergiques dans l'expression de la récompense de nouveauté. Comportement Brain Res. 129, 41 – 50 10.1016 / s0166-4328 (01) 00326-6 [PubMed] [Croix Ref]
  5. Bowling SL, Bardo MT (1994). Effets locomoteurs et gratifiants de l’amphétamine chez des rats à enrichissement social, social et isolé. Pharmacol. Biochem. Comportement 48, 459 – 464 10.1016 / 0091-3057 (94) 90553-3 [PubMed] [Croix Ref]
  6. Bowling SL, Rowlett JK, Bardo MT (1993). Effet de l'enrichissement de l'environnement sur l'activité locomotrice, la synthèse et la libération de dopamine stimulées par l'amphétamine. Neuropharmacologie 32, 885 – 893 10.1016 / 0028-3908 (93) 90144-r [PubMed] [Croix Ref]
  7. Calcagnetti DJ, Schechter MD (1992). Le conditionnement de la place révèle l'aspect enrichissant de l'interaction sociale chez les rats juvéniles. Physiol. Comportement 51, 667 – 672 10.1016 / 0031-9384 (92) 90101-7 [PubMed] [Croix Ref]
  8. Chen J., Nye HE, Kelz MB, Hiroi N., Nakabeppu Y., Hope BT et al. (1995). Régulation des protéines delta FosB et de type FosB par des convulsions électroconvulsives et des traitements à la cocaïne. Mol. Pharmacol. 48, 880 – 889 [PubMed]
  9. Colby CR, Whisler K., Steffen C., Nestler EJ, Self DW (2003). La surexpression de DeltaFosB spécifique au type de cellule striatale renforce l’incitation à la cocaïne. J. Neurosci. 23, 2488 – 2493 [PubMed]
  10. Crowder WF, Hutto CW (1992). Les mesures de conditionnement en place des opérateurs ont été examinées à l'aide de deux agents de renforcement non médicamenteux. Pharmacol. Biochem. Comportement 41, 817 – 824 10.1016 / 0091-3057 (92) 90233-6 [PubMed] [Croix Ref]
  11. Elisei S., Sciarma T., Verdolini N., Anastasi S. (2013). Résilience et troubles dépressifs. Psychiatr. Danub. 25 (Suppl. 2), S263 – S267 [PubMed]
  12. R. El Rawas, N. Thiriet, V. Lardeux, M. Jaber, M. Solinas (2009). L'enrichissement de l'environnement diminue les effets bénéfiques mais non activants de l'héroïne. Psychopharmacologie (Berl) 203, 561 – 570 10.1007 / s00213-008-1402-6 [PubMed] [Croix Ref]
  13. Fan X., Li D., CF Lichti, Green TA (2013a). Protéomique dynamique du noyau accumbens en réponse à un stress psychologique aigu chez des rats enrichis et isolés sur le plan environnemental. PLoS One 8: e73689 10.1371 / journal.pone.0073689 [Article gratuit PMC] [PubMed] [Croix Ref]
  14. Fan X., Li D., Zhang Y., TA verte (2013b). Régulation différentielle des phosphoprotéomes du noyau accumbens chez des rats enrichis et isolés du point de vue environnemental en réponse à un stress aigu. PLoS One 8: e79893 10.1371 / journal.pone.0079893 [Article gratuit PMC] [PubMed] [Croix Ref]
  15. Green TA, Alibhai IN, Hommel JD, RJ Dileone, Kumar A., ​​Theobald DE, et al. (2006). L'induction de l'expression inductible du répresseur précoce de l'AMPc dans le noyau accumbens par le stress ou l'amphétamine augmente les réactions comportementales aux stimuli émotionnels. J. Neurosci. 26, 8235 – 8242 10.1523 / jneurosci.0880-06.2006 [PubMed] [Croix Ref]
  16. Green TA, Alibhai IN, Roybal CN, CA Winstanley, Theobald DE, Birnbaum SG, et al. (2010). L'enrichissement environnemental produit un phénotype comportemental induit par une faible activité de liaison de l'élément de réponse à l'adénosine monophosphate (CREB) dans le noyau accumbens. Biol. Psychiatrie 67, 28 – 35 10.1016 / j.biopsych.2009.06.022 [Article gratuit PMC] [PubMed] [Croix Ref]
  17. Green TA, Alibhai IN, Unterberg S., Neve RL, Ghose S., Tamminga CA, et al. (2008). Induction de facteurs de transcription activant (ATF) ATF2, ATF3 et ATF4 dans le noyau accumbens et leur régulation du comportement émotionnel. J. Neurosci. 28, 2025 – 2032 10.1523 / jneurosci.5273-07.2008 [PubMed] [Croix Ref]
  18. Green TA, ME Cain, Thompson M. et Bardo MT (2003). L'enrichissement de l'environnement diminue l'hyperactivité induite par la nicotine chez le rat. Psychopharmacologie (Berl) 170, 235 – 241 10.1007 / s00213-003-1538-3 [PubMed] [Croix Ref]
  19. Green TA, BJ Gehrke, Bardo MT (2002). L'enrichissement de l'environnement diminue l'auto-administration par voie intraveineuse d'amphétamine chez le rat: fonctions dose-réponse pour les schémas à rapport fixe et progressif. Psychopharmacologie (Berl) 162, 373 – 378 10.1007 / s00213-002-1134-y [PubMed] [Croix Ref]
  20. Grueter BA, AJ Robison, Neve RL, Nestler EJ, Malenka RC (2013). ΔFosB module différentiellement la fonction de voie directe et indirecte du noyau accumbens. Proc. Natl. Acad. Sci. États-Unis 110, 1923 – 1928 10.1073 / pnas.1221742110 [Article gratuit PMC] [PubMed] [Croix Ref]
  21. Hope B., Kosofsky B., Hyman SE, Nestler EJ (1992). Régulation de l'expression précoce précoce des gènes et de la liaison de AP-1 dans le noyau accumbens du rat par la cocaïne chronique. Proc. Natl. Acad. Sci. États-Unis 89, 5764 – 5768 10.1073 / pnas.89.13.5764 [Article gratuit PMC] [PubMed] [Croix Ref]
  22. Hope BT, Nye HE, Kelz MB, Self DW, Iadarola MJ, Nakabeppu Y., et al. (1994). Induction d'un complexe AP-1 de longue durée composé de protéines modifiées de type Fos dans le cerveau par la cocaïne chronique et d'autres traitements chroniques. Neuron 13, 1235 – 1244 / 10.1016-0896 (6273) 94-90061 [PubMed] [Croix Ref]
  23. Jha S., Dong B., Sakata K. (2011). Le traitement en milieu enrichi renverse le comportement de type dépressif et restaure la neurogenèse hippocampique réduite et les niveaux protéiques du facteur neurotrophique dérivé du cerveau chez les souris dépourvues de son expression via le promoteur IV. Trad. Psychiatrie 1: e40 10.1038 / tp.2011.33 [Article gratuit PMC] [PubMed] [Croix Ref]
  24. Kato T., K. Iwamoto (2014). Analyse complète de la méthylation et de l'hydroxyméthylation de l'ADN dans le cerveau humain et son implication dans les troubles mentaux. Neuropharmacologie 80, 133 – 139 10.1016 / j.neuropharm.2013.12.019 [PubMed] [Croix Ref]
  25. Kelz MB, Chen J., Carlezon WA, Whisler K., Gilden L., Beckmann AM et al. (1999). L'expression du facteur de transcription deltaFosB dans le cerveau contrôle la sensibilité à la cocaïne. Nature 401, 272 – 276 10.1038 / 45790 [PubMed] [Croix Ref]
  26. Kelz MB, Nestler EJ (2000). deltaFosB: un commutateur moléculaire à la base de la plasticité neuronale à long terme. Curr. Opin. Neurol. 13, 715 – 720 10.1097 / 00019052-200012000-00017 [PubMed] [Croix Ref]
  27. Koob GF, Sanna PP, Bloom FE (1998). Neuroscience de la dépendance. Neuron 21, 467 – 476 [PubMed]
  28. Larson EB, Graham DL, Arzaga RR, Buzin N., Webb J., Green TA et al. (2011). La surexpression de CREB dans la coque du noyau accumbens augmente le renforcement de la cocaïne chez les rats auto-administrés. J. Neurosci. 31, 16447 – 16457 10.1523 / JNEUROSCI.3070-11.2011 [Article gratuit PMC] [PubMed] [Croix Ref]
  29. Laviola G., Hannan AJ, Macrì S., Solinas M., Jaber M. (2008). Effets de l'environnement enrichi sur des modèles animaux de maladies neurodégénératives et de troubles psychiatriques. Neurobiol. Dis. 31, 159 – 168 10.1016 / j.nbd.2008.05.001 [PubMed] [Croix Ref]
  30. Lichti CF, Fan X., DR anglais, Zhang Y., Li D., Kong F., et al. (2014). L'enrichissement environnemental modifie l'expression des protéines ainsi que la réponse protéomique à la cocaïne dans le noyau accumbens du rat. De face. Comportement Neurosci. 8: 246 10.3389 / fnbeh.2014.00246 [Article gratuit PMC] [PubMed] [Croix Ref]
  31. Lobo MK, Zaman S., DM Damez-Werno, Koo JW, RC Bagot, Dinieri JA, et al. (2013). Induction de ΔFosB dans les sous-types de neurones épineux striataux moyens en réponse à des stimuli pharmacologiques, émotionnels et optogénétiques chroniques. J. Neurosci. 33, 18381 – 18395 10.1523 / JNEUROSCI.1875-13.2013 [Article gratuit PMC] [PubMed] [Croix Ref]
  32. Louilot A., Le Moal M., Simon H. (1986). Réactivité différentielle des neurones dopaminergiques du noyau accumbens en réponse à différentes situations comportementales. Une étude voltampérométrique in vivo chez des rats en mouvement libre. Brain Res. 397, 395 – 400 10.1016 / 0006-8993 (86) 90646-3 [PubMed] [Croix Ref]
  33. McBride WJ, Kimpel MW, Mcclintick JN, Ding ZM, Edenberg HJ, Liang T., et al. (2014). Modifications de l'expression des gènes au sein de l'amygdale étendue suite à une consommation excessive d'alcool par des rats (P) préférant l'alcool. Pharmacol. Biochem. Comportement 117, 52 – 60 10.1016 / j.pbb.2013.12.009 [Article gratuit PMC] [PubMed] [Croix Ref]
  34. Mlynarik M., Johansson BB, Jezova D. (2004). L'environnement enrichi influence la réponse corticosurrénalienne au défi immunitaire et à l'expression du gène du récepteur du glutamate dans l'hippocampe de rat. Ann. NY Acad. Sci. 1018, 273 – 280 10.1196 / annals.1296.032 [PubMed] [Croix Ref]
  35. Nestler EJ (2001). Neurobiologie moléculaire de la toxicomanie. Un m. J. Addict. 10, 201 – 217 10.1080 / 105504901750532094 [PubMed] [Croix Ref]
  36. Nestler EJ (2008). La revue. Mécanismes transcriptionnels de la dépendance: rôle de DeltaFosB. Philos. Trans. R. Soc. Lond. B Biol. Sci. 363, 3245 – 3255 10.1098 / rstb.2008.0067 [Article gratuit PMC] [PubMed] [Croix Ref]
  37. Nestler EJ, Barrot M., Self DW (2001). DeltaFosB: un commutateur moléculaire durable pour la dépendance. Proc. Natl. Acad. Sci. États-Unis 98, 11042 – 11046 10.1073 / pnas.191352698 [Article gratuit PMC] [PubMed] [Croix Ref]
  38. Perrotti LI, Hadeishi Y., Ulery PG, Barrot M., Monteggia L., Duman RS, et al. (2004). Induction de deltaFosB dans les structures cérébrales liées aux récompenses après un stress chronique. J. Neurosci. 24, 10594 – 10602 10.1523 / jneurosci.2542-04.2004 [PubMed] [Croix Ref]
  39. Perrotti LI, RR tisserand, Robison B., Renthal W., Maze I., Yazdani S., et al. (2008). Schémas distincts d’induction de DeltaFosB dans le cerveau par des drogues d’abus. Synapse 62, 358 – 369 10.1002 / syn.20500 [Article gratuit PMC] [PubMed] [Croix Ref]
  40. Pichets KK, V. Vialou, EJ Nestler, SR Laviolette, Lehman MN, Coolen LM (2013). Les récompenses naturelles et médicamenteuses agissent sur les mécanismes de plasticité neuronale courants avec ΔFosB en tant que médiateur clé. J. Neurosci. 33, 3434 – 3442 10.1523 / jneurosci.4881-12.2013 [Article gratuit PMC] [PubMed] [Croix Ref]
  41. Rebec GV, Christensen JR, Guerra C., Bardo MT (1997). Différences régionales et temporelles dans l'efflux de dopamine en temps réel dans le noyau accumbens au cours de la nouveauté en libre choix. Brain Res. 776, 61 – 67 10.1016 / s0006-8993 (97) 01004-4 [PubMed] [Croix Ref]
  42. AJ Robison, V. Vialou, M. Mazei-Robison, Feng J., Kourrich S., Collins M., et al. (2013). Les réponses comportementales et structurelles à la cocaïne chronique nécessitent une boucle de liaison directe impliquant ΔFosB et la protéine kinase II dépendante du calcium / calmoduline dans la coque du noyau accumbens. J. Neurosci. 33, 4295 – 4307 10.1523 / jneurosci.5192-12.2013 [Article gratuit PMC] [PubMed] [Croix Ref]
  43. Smith JK, Neill JC, Costall B. (1997). Les conditions de logement après le sevrage influencent les effets comportementaux de la cocaïne et de la d-amphétamine. Psychopharmacologie (Berl) 131, 23 – 33 10.1007 / s002130050261 [PubMed] [Croix Ref]
  44. M. Solinas, C. Chauvet, N. Thiriet, R. El Rawas, M. Jaber (2008). Renversement de la dépendance à la cocaïne par enrichissement de l'environnement. Proc. Natl. Acad. Sci. États-Unis 105, 17145 – 17150 10.1073 / pnas.0806889105 [Article gratuit PMC] [PubMed] [Croix Ref]
  45. M. Solinas, N. Thiriet, R. El Rawas, V. Lardeux, M. Jaber (2009). L'enrichissement de l'environnement au cours des premières étapes de la vie réduit les effets comportementaux, neurochimiques et moléculaires de la cocaïne. Neuropsychopharmacologie 34, 1102 – 1111 10.1038 / npp.2008.51 [PubMed] [Croix Ref]
  46. Escalier DJ, Prendergast MA, Bardo MT (2011). Différences induites par l'environnement sur le blocage de l'auto-administration d'amphétamine par les récepteurs de la corticostérone et des glucocorticoïdes chez le rat. Psychopharmacologie (Berl) 218, 293 – 301 10.1007 / s00213-011-2448-4 [Article gratuit PMC] [PubMed] [Croix Ref]
  47. Thiel KJ, NS Pentkowski, Peartree NA, MR Peintre, Neisewander JL (2010). Les conditions de vie dans l'environnement introduites pendant l'abstinence forcée modifient le comportement de recherche de cocaïne et l'expression de la protéine Fos. Neuroscience 171, 1187 – 1196 10.1016 / j.neuroscience.2010.10.001 [Article gratuit PMC] [PubMed] [Croix Ref]
  48. Thiel KJ, Sanabria F., Pentkowski NS, Neisewander JL (2009). Effets anti-envie de l'enrichissement de l'environnement. Int. J. Neuropsychopharmacol. 12, 1151 – 1156 10.1017 / s1461145709990472 [Article gratuit PMC] [PubMed] [Croix Ref]
  49. van Winkel M., Peeters F., Van Winkel R., Kenis G., Collip D., Geschwind N., et al. (2014). Impact de la variation du gène BDNF sur la sensibilité au stress social et l'impact tampon des émotions positives: réplication et extension d'une interaction gène-environnement. EUR. Neuropsychopharmacol. 24, 930 – 938 10.1016 / j.euroneuro.2014.02.005 [PubMed] [Croix Ref]
  50. Venebra-Muñoz A., A. Corona-Morales, J. J. Santiago-García, M. Melgarejo-Gutiérrez, M. Caba, F. F. García-García (2014). L'environnement enrichi atténue l'auto-administration de nicotine et induit des modifications de l'expression de ΔFosB dans le cortex préfrontal et le noyau accumbens du rat. Neuroreport 25, 694 – 698 10.1097 / wnr.0000000000000157 [PubMed] [Croix Ref]
  51. Vialou V., AJ Robison, Laplant QC, SE Covington, DM Dietz, Ohnishi YN, et al. (2010). DeltaFosB dans les circuits de récompense du cerveau assure la résilience au stress et aux réponses des antidépresseurs. Nat. Neurosci. 13, 745 – 752 10.1038 / nn.2551 [Article gratuit PMC] [PubMed] [Croix Ref]
  52. Wallace DL, Vialou V., Rios L., TL Carle-Florence, S. Chakravarty, Kumar A., ​​et al. (2008). L'influence de DeltaFosB dans le noyau accumbens sur le comportement naturel lié à la récompense. J. Neurosci. 28, 10272 – 10277 10.1523 / jneurosci.1531-08.2008 [Article gratuit PMC] [PubMed] [Croix Ref]
  53. Wang Y., Cesena TI, Y Ohnishi, Burger-Caplan R., Lam V., PD Kirchhoff, et al. (2012). Le criblage de petites molécules identifie les régulateurs du facteur de transcription ΔFosB. ACS Chem. Neurosci. 3, 546 – 556 10.1021 / cn3000235 [Article gratuit PMC] [PubMed] [Croix Ref]
  54. Werme M., Messer C., Olson L., Gilden L., Thorén P., Nestler EJ et al. (2002). Delta FosB régule la roue. J. Neurosci. 22, 8133 – 8138 [PubMed]
  55. Winstanley CA, Bachtell RK, Theobald DE, Laali S., Green TA, Kumar A., ​​et al. (2009a). Impulsivité accrue lors de l'arrêt de l'auto-administration de cocaïne: rôle de DeltaFosB dans le cortex orbitofrontal. Cereb. Cortex 19, 435 – 444 10.1093 / cercor / bhn094 [Article gratuit PMC] [PubMed] [Croix Ref]
  56. Winstanley CA, Green TA, Theobald DE, Renthal W., LaPlant Q., DiLeone RJ, et al. (2009b). L'induction de DeltaFosB dans le cortex orbitofrontal potentialise la sensibilisation locomotrice malgré l'atténuation du dysfonctionnement cognitif causé par la cocaïne. Pharmacol. Biochem. Comportement 93, 278 – 284 10.1016 / j.pbb.2008.12.007 [Article gratuit PMC] [PubMed] [Croix Ref]
  57. Winstanley CA, LaPlant Q., Theobald DE, Green TA, Bachtell RK, Perrotti LI, et al. (2007). L'induction de DeltaFosB dans le cortex orbitofrontal induit une tolérance au dysfonctionnement cognitif induit par la cocaïne. J. Neurosci. 27, 10497 – 10507 10.1523 / jneurosci.2566-07.2007 [PubMed] [Croix Ref]
  • Wise RA (1998). Activation médicamenteuse des voies de récompense du cerveau. La drogue dépend de l'alcool. 51, 13 – 22 10.1016 / s0376-8716 (98) 00063-5 [PubMed] [Croix Ref]