Régulation de la stabilité du DeltaFosB par phosphorylation (2006)

J Neurosci. 2006 May 10;26(19):5131-42.

Ulery PG, Rudenko G, Nestler EJ.

Source

Département de psychiatrie, Center for Basic Neuroscience, Centre médical du sud-ouest de l'Université du Texas, Dallas, Texas 75390-9070, États-Unis.

Abstrait

Le facteur de transcription DeltaFosB (également appelé FosB2 ou FosB [forme abrégée]) est un médiateur important de la plasticité à long terme induite dans le cerveau par l'exposition chronique à plusieurs types de stimuli psychoactifs, y compris les drogues d'abus, le stress et les crises électroconvulsives. . Une caractéristique distincte de DeltaFosB est qu’une fois induite, elle persiste dans le cerveau pendant des périodes relativement longues en l’absence de stimulation supplémentaire. Les mécanismes sous-jacents à cette stabilité apparente restent toutefois inconnus. Ici, nous démontrons que DeltaFosB est un facteur de transcription relativement stable, avec une demi-vie d’environ 10 h en culture cellulaire. De plus, nous montrons que DeltaFosB est une phosphoprotéine dans le cerveau et que la phosphorylation d'un résidu de sérine hautement conservé (Ser27) dans DeltaFosB le protège de la dégradation du protéasome. Nous fournissons plusieurs sources de données suggérant que cette phosphorylation est médiée par la caséine kinase 2. Ces résultats constituent la première preuve de la phosphorylation de DeltaFosB et démontrent que la phosphorylation contribue à sa stabilité, qui est au cœur de sa capacité à assurer la médiation d'adaptations durables dans le cerveau.

Introduction

Le facteur de transcription ΔFosB, également appelé FosB2 ou FosB [forme abrégée], est un variant d'épissage tronqué par l'extrémité C-terminale du gène précoce immédiat fosb (Dobrazanski et al., 1991; Nakabeppu et Nathans, 1991; Yen et al., 1991). Comme FosB de pleine longueur, AFOSB possède un domaine basique de liaison à l'ADN et une fermeture éclair à la leucine à travers laquelle il se dimérise avec les protéines Jun pour former des complexes de facteurs de transcription activateurs-1 (AP-1), qui régulent l'expression de nombreux gènes (Morgan et Curran, 1995; Rylski et Kaczmarek, 2004). Malgré l'absence d'une partie du domaine de transactivation trouvé dans l'extrémité C de FosB, ΔFosB fonctionne à la fois comme un puissant activateur et répresseur de la transcription dans les cellules en culture et dans le cerveau (Dobrazanski et al., 1991; Nakabeppu et Nathans, 1991; Chen et al., 1997; McClung et Nestler, 2003; Kumar et al., 2005).

ΔFosB est induit à des niveaux élevés d'une manière spécifique à une région dans le cerveau après une exposition chronique, mais non aiguë, à divers stimuli psychoactifs, y compris le stress, certaines lésions, des médicaments antipsychotiques et antidépresseurs, des abus et des récompenses naturelles. (Hope et al., 1994b; Hiroi et Graybiel, 1996; Moratalla et al., 1996; Bing et al., 1997; Mandelzys et al., 1997; Kelz et al., 1999; Werme et al., 2002; Andersson et al., 2003; Colby et al., 2003; Peakman et al., 2003; Perrotti et al., 2004; Zachariou et al., 2006). L'induction de ΔFosB a été directement liée aux effets fonctionnels de plusieurs de ces stimuli sur le cerveau. La persistance de ΔFosB, même en l’absence de stimulation supplémentaire, le distingue de tous les autres facteurs de transcription de la famille Fos, qui sont induits rapidement en réponse à des stimuli aigus, retombent au niveau de base en quelques heures et manifestent généralement une désensibilisation après une stimulation chronique (Hope et al., 1992; Daunais et al., 1993; Persico et al., 1993; Hiroi et Graybiel, 1996; Perrotti et al., 2004). Cela fait de ΔFosB un candidat attrayant pour la médiation de certains des changements durables dans l’expression génique qui sous-tendent les adaptations neuronales stables causées par certains stimuli chroniques.

Parce que la présence prolongée de ΔFosB se produit en l’absence d’induction ultérieure de son ARNm (Chen et al., 1995), nous avons émis l’hypothèse que, contrairement à FosB pleine longueur et à toutes les autres protéines de la famille Fos, intrinsèquement instables, ΔFosB pourrait être un facteur de transcription inhabituellement stable (Hope et al., 1994b; Chen et al., 1997; Nestler et al., 2001; McClung et al., 2004). De plus, une analyse par immunoempreinte de tissu cérébral stimulé de manière aiguë par rapport à une stimulation chronique a suggéré que le ΔFosB Mr (masse moléculaire) de ∼33 kDa dans l’état aigu à ∼35 – 37 kDa au cours d’un traitement chronique (Hope et al., 1994a; Chen et al., 1995). Comme il n’existe aucune preuve de l’existence d’ARNm supplémentaires susceptibles de coder ces diverses isoformes, nous avons également supposé que ΔFosB est modifié après la traduction et que cela contribue peut-être à sa stabilité inhabituelle. À ce jour, toutefois, aucune analyse biochimique du chiffre d'affaires ou des modifications post-traductionnelles de ΔFosB n'a été rapportée. Le but de la présente étude était de déterminer si ΔFosB est une phosphoprotéine et si la phosphorylation joue un rôle dans sa stabilité.

Section précédenteSection suivante

Matériels et méthodes

Lignées cellulaires de mammifères et constructions d'ADN.

Des cellules PC12 (Clontech, Mountainview, Californie) ont été cultivées dans du DMEM à haute teneur en glucose contenant de la L-glutamine (L-Gln) et complétées avec du sérum de fœtus bovin 5%, de sérum de cheval 10% (tous deux d'Invitrogen, Carlsbad, CA) , 100 U / ml de pénicilline et 100, µg / ml de streptomycine (tous deux de Sigma-Aldrich, St. Louis, MO). Des cellules HeLa (American Type Culture Collection, Manassas, VA) ont été cultivées dans du DMEM à haute teneur en glucose contenant de la L-Gln et complétées par 10% FBS, de la pénicilline et de la streptomycine. Les deux lignées cellulaires ont été maintenues à 37 ° C dans une solution% 5 humide.2 atmosphère.

Pour les transfections transitoires avec l'ADN, les cellules PC12 ou HeLa ont été ensemencées sur des plaques à six puits (recouvertes de collagène I pour les cellules PC12) de manière à atteindre le confluent 90 – 100% le lendemain, puis ont été transfectées à l'aide de Lipofectamine 2000 (Invitrogen). Dans certaines expériences (voir Les figs. 1-7), ΔFosB a été exprimé de manière transitoire dans les cellules PC12 via une infection par le virus de l’herpès simplex recombinant (HSV).

Les ADNc ΔFosB et FosB ont été obtenus à partir de nos propres constructions pTetop (Chen et al., 1997) et sous-cloné dans un vecteur pcDNA3.1 (Invitrogen). Ces constructions pcDNA3.1-AFOSB / FosB ont été utilisées pour l'expression dans des cellules de mammifère et comme matrice pour la mutagenèse dirigée sur un site. Le HSV-ΔFosB recombinant a été préparé comme décrit précédemment (Neve et al., 1997), et la préparation avait un titre de ∼1 × 108 pfu / ml.

Expériences de chasse par impulsion.

Approximativement 24 h après l'infection / la transfection, les cellules (PC12 ou HeLa) dans des plaques à six puits ont été lavées deux à trois fois avec 2 ml de PBS et incubées à 37 ° C pendant environ 1 h dans 2 ml de DMEM sans Cys / Met. (Invitrogen) additionné de% de FBS dialysé 5 (Hyclone, Logan, UT) pour épuiser les pools intracellulaires de Met et Cys. À la fin de cette période de «famine», des médicaments (si les cellules devaient être traitées) ont été ajoutés et les cellules ont été marquées (par impulsion) avec 12 – 25 μCi de 35Mélange d'étiquetage des protéines S (PerkinElmer, Wellesley, MA) pour ∼1 h à 37 ° C pour marquer toutes les protéines nouvellement synthétisées. Le radiomarqueur a ensuite été éliminé en lavant les cellules deux à trois fois avec 2 ml de PBS et le 35Les protéines marquées S ont été suivies (poursuite) en remplaçant le milieu par du milieu «froid» (non radioactif) complété par 5% FBS et en récoltant les cellules à différents moments. Les traitements cellulaires ont été maintenus tout au long de la chasse. Toutes les figures de ces expériences montrent des quantités initiales similaires des différentes protéines pour optimiser les comparaisons de leurs taux de renouvellement.

Animaux et traitement des crises électroconvulsives chroniques.

Des rats mâles adultes Sprague Dawley (200 – 300 g; Charles River Laboratories, Kingston, RI) ont été traités une fois par jour par des convulsions électroconvulsives (ECS) contre 7 – 9 d. ECS a été réalisée comme décrit précédemment (Hope et al., 1994a) en utilisant un Ugo Basile (Comerio VA, Italie) Unité ECS avec les réglages suivants: fréquence, impulsions 100 / s; impulsion avec, 0.5 ms; durée du choc, 1.0 s; et courant, 75 mA. Les animaux témoins ont été traités en parallèle en appliquant les électrodes à clip d'oreille sans aucun courant électrique.

32 Marquage métabolique P.

Pour marquer les tranches de cerveau, les rats ont été décapités, les cerveaux ont été rapidement disséqués et des tranches de corticale frontale de 300, µm, ont été préparées avec un micro-suceur DSK (Ted Pella, Redding, CA). Les tranches ont été incubées dans des tubes en plastique dans 2 ml de CSF artificiel déficient en phosphate (ACSF) et maintenues à 30 ° C sous un barbotage doux constant avec un2/ CO2 mélange (Hemmings et al., 1989). Les coupes (deux coupes par tube) ont été marquées avec 1.3 mCi pour 8 – 10 h en présence ou en absence d'acide okadaïque (100 ng / ml). A la fin de cette incubation, les tranches ont été rincées au moins trois fois avec du ACSF froid, puis homogénéisées par sonication dans 250 µl de tampon de radioimmunoprécipitation à froid (RIPA) [PBS, pH 7.4, 150, mm NaCl, 1% (v / v ) Igepal, 0.5% (p / v) désoxycholate de sodium, 0.1% (p / v) SDS, 1 mm EDTA] supplémenté avant utilisation avec SDS jusqu’à 0.6%, cocktail d’inhibiteurs de protéase pour cellules de mammifère (utilisé à 5 μl / ml; Sigma-Aldrich), cocktails inhibiteurs de la phosphatase I et II (utilisés chez 1: 100; Sigma-Aldrich), 1 mm PMSF et 2% glycérol. Les homogénats ont ensuite été bouillis pendant 15 min et éliminés par centrifugation à 15,000 × g pour 15 min. La concentration en protéines dans les surnageants résultants a été évaluée en utilisant le test de protéines BCA (Pierce, Holmdel, NJ).

Pour le 32Marquage P des cellules en culture ~ 24 h après infection / transfection, les cellules ont été lavées deux à trois fois avec un milieu sans phosphate et incubées dans ce milieu pendant ~ 1 h. Après cette période de famine, 0.2 – 0.3 mCi de 32PH3PO4 (PerkinElmer) ont été ajoutés à chaque puits et les cellules ont été étiquetées pour 4 – 12 h en fonction du type d'expérience (voir les figures 1 – 7 pour les spécifications). Les cellules ont ensuite été lavées trois fois avec du PBS et lysées sur de la glace pendant 15 min avec 50 pi de tampon RIPA supplémenté. Les lysats ont été recueillis par grattage et passés 10 fois à travers une aiguille 25 ga pour cisailler l'ADN, bouillis pendant 10 min et centrifugés à 15,000 tr / min pour 15 – 30 min à 4 ° C. Les lysats clarifiés (surnageants) ont été transférés dans un nouveau tube et un dosage de la protéine BCA (Pierce) a été effectué. Toutes les figures de ces expériences montrent des quantités similaires de protéines totales de type sauvage (WT) et S27A AFFB afin d'optimiser les comparaisons de leurs niveaux de phosphorylation relatifs.

Produits chimiques et traitements de culture cellulaire.

L'acide okadaïque (OA; Sigma-Aldrich) a été dissous dans de l'éthanol et utilisé à une concentration finale de 100 ng / ml. 5,6-Dichloro-1-β-d-ribofuranosyl-benzimidazole (DRB; Biomol, Plymouth Meeting, PA) a été dissous dans du diméthylsulfoxyde (DMSO; Sigma-Aldrich) et utilisé en culture cellulaire à une concentration finale de 50 μm. La spermine (Sigma-Aldrich) a été dissoute dans de l'eau et utilisée à une concentration finale de 200 µm. La calphostine-C (Biomol) a été dissoute dans du DMSO et utilisée à 0.2 um, alors que le phorbol 12-myristate 13-acétate (PMA; Promega, Madison, WI) a été dissous dans du DMSO et utilisé à 0.1. Le peptide inhibiteur lié à 2 myristoylato-autocamtide (m-AIP; Biomol) a été dissous dans de l'eau et utilisé à une concentration finale de 1 et 10 µm. Les inhibiteurs de la protéine kinase à spectre large H-7 et H-8 (Biomol) ont été dissous dans de l'eau et utilisés à une concentration finale de 150 et 200 µm, respectivement. MG132 (Calbiochem, San Diego, Californie) et l'époxomicine (Peptides International, Louisville, Kentucky) ont été tous deux dissous dans du DMSO et utilisés à une concentration finale de 12.5 et de 7.5, respectivement. Dans toutes les expériences, du DMSO (véhicule) a été ajouté aux cellules si nécessaire pour maintenir une quantité constante de DMSO au cours des traitements. Pour 32Dans les expériences d’étiquetage P, les médicaments ont été ajoutés juste avant l’étiquette et conservés pendant le reste de la période d’étiquetage. Pour les expériences de chasse au pouls, les médicaments ont été ajoutés au moment de la «famine» Cys / Met, conservés pendant toute la période d'étiquetage, puis ajoutés au milieu de chasse. Les inhibiteurs du protéasome ont été dopés chaque fois par 3 – 4 h tout au long de la course afin de compenser le renouvellement rapide de ces peptides.

Immunoprécipitation, immunoblot et autoradiographie de ΔFosB.

Pour les immunoprécipitations, les lysats ont été dilués avec 1: 5 avec du RIPA ordinaire afin de ramener la concentration en SDS à 0.1% avant de procéder à l’immunoprécipitation (IP). Pour limiter la liaison non spécifique, les lysats ont d'abord été clarifiés par immunoprécipitation avec une IgG non immune et la protéine G-Sepharose (Sigma-Aldrich) pendant au moins 4h. AFSB a ensuite été immunoprécipité à partir des lysats clarifiés en utilisant un anticorps polyclonal de chèvre qui reconnaît un épitope interne présent à la fois dans FosB et AFSB (SC-48G; Santa Cruz Biotechnology, Santa Cruz, CA) à 0.5 – 1 µg IgG pour 10 protéine (50 – 300 μg de la protéine totale) dans un volume total de 0.5 ml. Les IP ont été mélangées doucement à 4 ° C sur un rotor pendant au moins 8 h, puis 15 ul de protéine G-Sepharose a été ajouté et les IP ont été mélangés pendant au moins un autre 4 h. Les IP ont été rassemblées par centrifugation à 3000 × g pour 3 – 5 min à 4 ° C, lavée trois fois avec 0.5 ml de RIPA ordinaire froid et deux fois avec du PBS froid contenant 0.1% Tween 20. Les IP ont ensuite été remises en suspension dans 0.5 ml de PBS froid, transférées, transformées en pastilles dans un nouveau tube et les protéines immunoprécipitées ont ensuite été éluées par addition de 15 – 25 μl du tampon d’échantillon protéique réducteur 2 × Laemmli. Ce protocole IP a entraîné la précipitation spécifique et efficace de pratiquement tout le ΔFosB dans le lysat. Les protéines immunoprécipitées ont été soumises à une SDS-PAGE en chargeant la totalité de l'IP sur un gel de critère 12.5% Tris-HCl (Bio-Rad, Hercules, CA), puis transférées sur du PVDF ou de la nitrocellulose. Après le transfert, la membrane a été séchée à l'air et 32P- et 35Des bandes de protéines radiomarquées en S ont été observées par autoradiographie en utilisant un film autoradiographique de Kodak (Rochester, NY), ainsi que par phosphorimagerie en utilisant un appareil PhosphorImager Storm (Amersham Biosciences, Piscataway, NJ). Le ΔFosB total (non phosphorylé et phosphorylé) dans des lysats cellulaires ou des homogénats de cerveau a été détecté par immunoempreinte de la protéine immunoprécipitée (en utilisant la même membrane que celle utilisée pour détecter le virus). 32P-marquée), ou de quantités égales de protéine lysat / homogénat soumise à SDS-PAGE et transférée sur du PVDF ou de la nitrocellulose. La membrane a d'abord été bloquée en la faisant incuber avec du lait sec écrémé 1% (p / v) (Bio-Rad) dans du PBS additionné de% 0.1 (v / v) Tween 20 (Sigma) pour 1 h à 25 ° C. La membrane a ensuite été immunoempotée pendant une nuit à 4 ° C avec notre propre anticorps polyclonal de lapin anti-FosB généré contre les acides aminés 1 – 16 de FosB / ΔFosB (utilisé chez 1: 10,000). Après une incubation primaire, les membranes ont été lavées à quatre reprises pendant 5 min avec un tampon de blocage, puis incubées à 25 ° C pendant ~ 1 h avec une IgG anti-lapin de chèvre conjuguée à la peroxydase de raifort (utilisée à 1: 5000 dans du tampon de blocage, de Vector Laboratories, Burlingame, CA). Les membranes ont ensuite été lavées trois fois pour 10 min avec du tampon de blocage et une fois pour 5 min avec du PBS. Les bandes de protéines ΔFosB totales ont été visualisées sur un film Kodak MR par chimiluminescence améliorée (Pierce) et / ou par détection de la fluorescence en utilisant les réactifs ECL-Plus (Amersham Biosciences) et Storm PhosphorImager.

Surexpression et purification de ΔFosB recombinant à partir de cellules d’insecte.

ΔFosB a été surexprimé dans les cellules d’insecte Sf9 sous la forme d’une protéine à étiquette hexa-His N-terminale (N-His (6) AFSB) en utilisant le système d’expression baculovirus Bac-à-Bac (Invitrogen) et en suivant les instructions du fabricant. En bref, l'ADNc de ΔFosB (résidus 2 – 237) précédé de l'étiquette d'affinité N-terminale MGHHHHHHAG a été sous-cloné dans le vecteur pFASTBacTM1, qui a été utilisé pour générer le baculovirus recombinant. Les cellules Sf9 ont été infectées avec le virus recombinant et le N-His (6) AFOSB a été purifié à partir de lysats cellulaires par plusieurs étapes chromatographiques, notamment la chromatographie par affinité utilisant une colonne de nickel (Qiagen, Valencia, CA), utilisant une colonne mono-Q (Amersham). Biosciences) et l’exclusion par la taille à l’aide d’une colonne de filtration sur gel (Amersham Biosciences).

In vitro études de phosphorylation.

In vitro Les réactions de phosphorylation pour les analyses temporelles et stœchiométriques ont été effectuées dans un volume de 30 µl contenant un substrat 10 µm (N-His (6) AFOSB ou un substrat témoin positif), 250 µm ATP et 1 µCi / µl [γ-32P] ATP, le tampon fourni par le fabricant de kinase et l'une des kinases suivantes: CK2 (20 ng / pl; Upstate, Charlottesville, VA), CaMKII (10 ng / pl; Upstate), PKC (1.6 ng / μl; Calbiochem) ou p70S6K (2.5 mU / µl; Upstate). Les réactions dans le temps ont été réalisées en éliminant des aliquotes de 5 de la solution réactionnelle aux moments indiqués et en ajoutant un volume égal de tampon d’échantillon de protéine réductrice de Laemmli 4 ×. Les paramètres cinétiques de Michaelis-Menten pour la réaction de CK2 ont été déterminés dans des conditions d'état stable linéaires définies de manière empirique. Ces réactions ont été effectuées pour 15 min dans un volume de 10 ul contenant 2 ng / ul d’enzyme, 250 μm ATP, 1 μCi / μl [γ-32P] ATP et concentrations de N-His (6) ΔFosB allant de 2.5 – 30 µm. Toutes les réactions ont été effectuées à 30 ° C dans un bain-marie. Après SDS-PAGE et coloration du gel avec Bio-Safe Coomassie (Bio-Rad), le gel a été séché et 32L'incorporation de P-phosphate a été évaluée par une analyse de phosphorimagerie (voir ci-dessous, Quantification des données, calculs et statistiques).

Carte bidimensionnelle des phosphopeptides et analyse des phosphoaminoacides.

Ces deux analyses ont été effectuées comme décrit par Ploegh et Dunn (2000). En bref, des fragments de gel secs contenant 32ΔFosB marqué par P (soit de in vitro réactions immunitaires ou à partir d’immunoprécipités de cellules marquées métaboliquement), ont été excisées, réhydratées, lavées et soumises à une digestion tryptique. Le surnageant contenant les produits de digestion tryptique a été lyophilisé et le lyophilate lavé plusieurs fois et remis en suspension dans 10 ul de tampon d'électrophorèse, pH 1.9. L'échantillon (3 ul) a été déposé sur une plaque de chromatographie sur couche mince de cellulose (CCM) (Analtech, Newark, DE) et séparé dans une dimension par électrophorèse et dans l'autre dimension par CCM ascendante. Les cartes de phosphopeptides résultantes ont été visualisées par autoradiographie et phosphorimagerie. Pour l’analyse des phosphoaminoacides, XµUM des digestes trypsiques remis en suspension dans du tampon d’électrophorèse ont été clivés par hydrolyse avec HCl à 2 ° C pendant 105 min dans 25 m. HCl sous N2 atmosphère. La réaction a été arrêtée par une dilution de six fois dans de l'eau et le mélange a été lyophilisé. Le lyophilisat a été remis en suspension dans 5 ul de tampon d'électrophorèse, pH 1.9, et déposé sur une plaque de CCM de cellulose avec des étalons phospho-Ser, Thr et -Tyr. L'électrophorèse a été réalisée sur la moitié de la longueur de la plaque de CCM en utilisant un tampon d'électrophorèse, pH 1.9, puis la plaque a été transférée dans le tampon pH 3.5, et l'électrophorèse a été réalisée jusqu'à son achèvement. Les standards de phosphoaminoacides ont été visualisés en pulvérisant sur la plaque de TLC une solution de 1% (v / v) ninhydrine dans de l'acétone. 32Les échantillons d'acides aminés marqués au P ont été visualisés à la fois par autoradiographie et par phosphorimagerie.

CK2a induit par le siRNA.

Nous avons utilisé une méthode d'interférence d'ARN pour réduire sélectivement les niveaux de CK2 (Di Maira et al., 2005). Les cellules PC12 ont été ensemencées sur des plaques à six puits recouvertes de collagène I pour atteindre la confluence 70 – 80% le lendemain, lorsqu'elles ont été transfectées de manière transitoire avec 20 nm (concentration finale) d'un ARNs non ciblé ou d'ARNsi dirigé vers l'ARNm de la catalyse. Sous-unité α de CK2 de rat, en utilisant 5 μl de l’agent de transfection SilentFectin (Bio-Rad) et en suivant les instructions du fabricant. Approximativement 24h plus tard, les cellules ont été transfectées de manière transitoire avec le plasmide AFOSB, comme indiqué ci-dessus. Environ 24 h plus tard (∼48 h après la transfection par siARN), les cellules ont été soumises à 32Marquage métabolique du phosphore ou analyse du pouls comme décrit ci-dessus. Les éléments suivants: CK2a ont été utilisés: En tant que contrôle négatif, nous avons utilisé Silencieux contrôle négatif #3 siRNA de Ambion (Austin, TX). L'étendue de l'inactivation de CK2 a été contrôlée par immunoempreinte à l'aide d'un anticorps polyclonal anti-CK2 (numéro de catalogue 06-873 de Upstate) pendant une nuit à une dilution 1: 1000. La β-tubuline a été utilisée comme contrôle de charge et détectée avec un anticorps monoclonal (numéro de catalogue: 05-661 de Upstate) pendant une nuit à une dilution de 1: 20,000.

Mutagenèse dirigée.

La mutation de Ser27 en Ala ou en Asp a été réalisée à l'aide d'un kit de mutagenèse dirigée sur site à changement rapide (Stratagene, La Jolla, CA) et en suivant les instructions du fabricant. Pour introduire les mutations Ser27 dans la protéine ΔFosB de souris, les amorces de mutagenèse suivantes ont été utilisées. Ser27 à Ala: (amorce inverse) 5′GCCGAAGAGAGAGAGCCCCGAAGCCAGGTACTGAGACTCGGCGGAGGGXXUMX '. Ser3 vers Asp (amorce directe) 27′CCCTCCGCCGAGTCTCAGTACCTGGATTCGGTGGACTCCTTCGGC3 '. Les bases mutées sont en gras et le codon Ser27 en italique.

Bioinformatique.

Les sites de phosphorylation potentiels et les kinases de ΔFosB ont été recherchés en soumettant la séquence de la protéine de souris à des bases de données spécialisées, notamment ProSite (http://www.expasy.org/prosite/), PredictProtein (Rost et al., 2004) et NetPhosK (Blom et al., 2004).

Quantification des données, calculs et statistiques.

La quantité de protéine présente dans la membrane de PVDF ou de nitrocellulose a été quantifiée à l'aide d'un Storm PhosphorImager et du logiciel ImageQuant associé (Amersham Biosciences / Molecular Dynamics). Dans les études de culture cellulaire et de phosphorylation de coupes de cerveau, les valeurs obtenues pour 32Les protéines marquées avec P ont ensuite été divisées par les valeurs obtenues pour le ΔFosB total et exprimées sous forme de rapport. dans le in vitro études de phosphorylation, la quantité de 32ΔFosB marqué par P par mole de ΔFosB (stœchiométrie) a été calculé comme décrit précédemment (Sahin et al., 2004). Toutes les mesures ont été prises dans la plage de linéarité de l'instrument utilisé. Les paramètres cinétiques ont été calculés à l'aide du modèle de Michaelis-Menten, dans lequel V = Vmax[S] / ([S]+KM) et Vmax = k2[ETotal]. La demi-vie (t1/2) de ΔFosB et FosB ont été estimés à partir des tracés de chasse au pouls (en utilisant la régression non linéaire qui correspond le mieux aux points de données) et correspondent au moment où la quantité de protéine restante est 50% du nombre initial. Sur toutes les figures, les résultats présentés sont représentatifs d'au moins deux à trois expériences indépendantes. Dans tous les graphiques, les données présentées sont des moyennes ± SEM (3 ≤ n ≤16). La signification statistique des différences a été évaluée à l'aide d'une méthode non appariée. t test, corrigé pour les comparaisons multiples, et les astérisques indiquent p ≤ 0.05.

Section précédenteSection suivante

Resultats

ΔFosB est un facteur de transcription exceptionnellement stable

Bien que nous ayons spéculé précédemment que ΔFosB est un facteur de transcription relativement stable (Nestler et al., 2001), une analyse directe du profil de chiffre d’affaires de la protéine n’a pas encore été réalisée. Pour répondre à cette question, nous avons mené des expériences pulsées avec des cellules PC12, largement utilisées comme lignée cellulaire de type neurone, dans lesquelles ΔFosB était exprimé de manière transitoire via une infection par un virus de l’herpès simplex recombinant (HSV-ΔFosB). Les protéines nouvellement synthétisées ont été marquées métaboliquement avec 35S-Met / Cys et le schéma de dégradation de 35ΔFosB (35On surveille S-AFOSB) en l'immunoprécipitant à partir de lysats de cellules obtenus à divers moments après l'élimination des acides aminés radiomarqués. L’analyse des immunoprécipités par SDS-PAGE et par autoradiographie a révélé que la demi-vie de ΔFosB dans les cellules PC12 est égale à ∼10 h (Fig. 1). Ces résultats montrent que la demi-vie de ΔFosB est supérieure à celle de la plupart des facteurs de transcription inductibles (voir la discussion), y compris le FosB de longueur complète, dont la demi-vie en culture cellulaire a été rapportée ∼90 min (Dobrazanski et al., 1991; Carle et al. 2004). En outre, il convient de noter que la dégradation de ΔFosB ne correspond pas à une courbe de décroissance exponentielle du premier degré, mais est plutôt biphasique, démarrant avec un taux de dégradation plus lent. Ceci suggère l'existence de plus d'une espèce de ΔFosB et / ou de plus d'une voie de dégradation.

Figure 1.

Voir la version plus grande:

Figure 1.

ΔFosB est un facteur de transcription exceptionnellement stable. La demi-vie de ΔFosB est ∼10 h en culture cellulaire. AFFB a été exprimé dans des cellules PC12 soit par infection avec HSV-AFOSB, soit par transfection transitoire avec un plasmide contenant AFOSB, et les cellules ont été soumises à des expériences de poursuite par impulsion, comme décrit dans Matériels et méthodes. Des résultats équivalents ont été obtenus quelle que soit la méthode utilisée pour surexprimer ΔFosB. La figure montre l'évolution dans le temps (et l'autoradiogramme représentatif) de la dégradation de ΔFosB. Les données tracées sont la moyenne ± SEM d'au moins cinq points de données individuels 15 obtenus à partir d'au moins cinq expériences indépendantes. À des fins de comparaison, la demi-vie déclarée du FosB de longueur complète est indiquée.

ΔFosB est une phosphoprotéine dans le cerveau

Nous avons émis l’hypothèse que la modification post-traductionnelle de ΔFosB pourrait contribuer à sa stabilité apparente. Comme il a été démontré que la phosphorylation modulait l’activité des facteurs de transcription de nombreuses façons, notamment en ce qui concerne leur stabilité Desterro et al., 2000; Whitmarsh et Davis, 2000), nous avons vérifié si ΔFosB était une phosphoprotéine. À cette fin, l’expression de ΔFosB a été induite dans le cerveau de rat à l’aide de l’ECS chronique, un traitement connu pour induire des taux élevés de ΔFosB, notamment dans le cortex frontalHope et al., 1994a). Un jour après le dernier traitement ECS, lorsque les niveaux de ΔFosB restent élevés, de fines tranches de corticale frontale ont été préparées et marquées métaboliquement avec 32P-orthophosphate. Un ensemble parallèle de tranches n'a pas été radiomarqué, et celles-ci ont été utilisées pour détecter les niveaux totaux de ΔFosB. Après immunoprécipitation avec un anticorps spécifique anti-FosB / ΔFosB et séparation des protéines immunoprécipitées par SDS-PAGE, phosphorylée 32Le ΔFosB marqué par P a été détecté par autoradiographie, alors que le ΔFosB total a été détecté par immunoblot. Cette analyse a révélé que ΔFosB est phosphorylé dans le cerveau, comme en témoigne un 32Bande marquée de ∼35 kDa marquée dans les échantillons de cerveau traités de manière chronique, mais pratiquement indétectable chez les témoins traités de manière fictive (Fig. 2A). Ceci est cohérent avec le fait qu'en l'absence de stimulation chronique, les taux basaux de ΔFosB sont très bas. La spécificité de la réaction d'immunoprécipitation est illustrée par le manque de signal dans le précipité d'IgG non immun.

Figure 2.

Voir la version plus grande:

Figure 2.

ΔFosB est une phosphoprotéine dans le cerveau. A, ΔFosB est phosphorylé dans le cerveau. ΔFosB endogène a été induit dans le cerveau de rat par un traitement chronique par ECS, comme décrit dans Matériels et méthodes. Les tranches corticales frontales ont été marquées métaboliquement avec 32PH3PO4 pendant plusieurs heures. Après homogénéisation des tranches, ΔFosB a été immunoprécipité et phosphorylé ΔFosB (32P-AFOSB) a été détecté par autoradiographie (panneau supérieur). Le ΔFosB total dans les immunoprécipités non radioactifs a été détecté par immunoblot (panneau inférieur). En tant que contrôles négatifs, l’immunoprécipité d’un animal traité avec un traitement simulé et des IgG non immunes est présenté. BLes sites de phosphorylation candidats et les kinases avec les scores de prédiction correspondants pour la séquence de la protéine ΔFosB de souris ont été obtenus par analyse bioinformatique. Les sites candidats présentant les scores de prédiction les plus élevés sont mis en évidence dans la séquence protéique et répertoriés dans le tableau. Le domaine de liaison à l'ADN (de base) et la fermeture éclair à la leucine sont en gras dans la séquence protéique. C, D, La phosphorylation de ΔFosB est augmentée par l’OA, inhibiteur de la phosphatase Ser / Thr. C, 32Les taux de P-AFOSB dans les immunoprécipités de coupes corticales frontales marquées en absence (Ctr) ou en présence de 100 ng / ml OA (graphique et panneau supérieur) ont été détectés par autoradiographie. Le panneau inférieur montre le ΔFosB total détecté dans des immunoprécipités provenant de tranches non marquées par immunoblot. D, Les cellules PC12 ont été infectées avec HSV-AFOSB ou HSV-LacZ (vecteur) et marquées métaboliquement avec 32PH3PO4 en l'absence (Ctr) ou en présence de 100 ng / ml OA. 32Les taux de P-AFOSB dans les immunoprécipités ont été détectés par autoradiographie (graphique, panneau supérieur). Le panneau inférieur montre le ΔFosB total détecté dans des lysats de cellules par immunoblot.

Dans un premier temps pour déterminer le (s) kinase (s) et le (s) site (s) impliqués dans la phosphorylation de ΔFosB, nous avons soumis sa séquence d'acides aminés à plusieurs analyses bioinformatiques. Ceci a révélé que, bien que ΔFosB ne contienne aucun site candidat à la phosphorylation Tyr, il contient plusieurs sites consensus Ser / Thr kinase, dont trois sites CaMKII, trois sites CK2 et deux sites PKC avec des scores de prédiction de phosphorylation très élevés (Fig. 2B). Si, comme le prévoit la bioinformatique, ΔFosB n'est phosphorylé que sur les résidus Ser ou Thr, sa phosphorylation doit alors être modulée de manière significative par l'activité des phosphatases Ser / Thr. Pour tester cette hypothèse, nous avons étiqueté les tranches corticales frontales avec 32P-orthophosphate en présence ou en l'absence de OA, un inhibiteur de la phosphatase des protéines Ser / Thr. Comme représenté sur la Figure 2C, L'arthrose a provoqué une augmentation importante (2.5-fold) 32P-AFOSB. Il a également provoqué une légère augmentation des taux totaux de ΔFosB, ce qui est conforme aux rapports précédents liant les effets cancérogènes de l'arthrose à sa capacité à induire plusieurs gènes précoces immédiats, notamment les protéines Fos (Miller et al., 1998; Choe et al., 2004). Le résultat net est une augmentation globale significative (60%) des taux de ΔFosB phosphorylés.

Nous avons ensuite examiné si, dans les cellules PC12, qui se prêtaient mieux à une manipulation expérimentale, ΔFosB présentait un schéma de phosphorylation similaire à celui observé dans le cerveau. Nous avons exprimé AFOSB dans les cellules PC12 par infection avec HSV-AFOSB et marqué métaboliquement les cellules avec 32P-orthophosphate en présence ou en l'absence de arthrose. L’expression réussie et l’immunoprécipitation de la protéine à partir de cellules infectées par HSV-AFOSB sont illustrées par la présence à la fois dans l’immunoblot (Fig. 2D, panneau inférieur) et l’autoradiographie (panneau supérieur) d’une bande ∼35 kDa, absente des cellules infectées par le vecteur. Comme observé dans le cerveau, l'arthrose a entraîné une légère augmentation des taux totaux de ΔFosB, mais une augmentation beaucoup plus élevée (environ deux fois plus importante) 32P-AFOSB, entraînant une augmentation nette significative (50%) de la phosphorylation de ΔFosB. En outre, conformément aux prévisions bioinformatiques, le traitement des cellules PC12 avec un inhibiteur de la Tyr phosphatase n’a pas entraîné de modifications significatives de la 32Niveaux P-ΔFosB (données non présentées). Ensemble, ces découvertes ont révélé que ΔFosB est phosphorylé sur les résidus Ser et / ou Thr dans le cerveau et dans les cellules PC12 et ont confirmé que ce dernier était un bon système de culture cellulaire dans lequel étudier de manière plus approfondie les profils de phosphorylation et de dégradation de ΔFosB.

CK2 mais pas les PKC ou CaMKII phosphorylées ΔFosB in vitro

Comme décrit ci-dessus, l'analyse de la séquence d'acides aminés ΔFosB a révélé des scores de prédiction élevés pour les sites de phosphorylation de CK2, PKC et CaMKII. Pour déterminer laquelle de ces kinases peut phosphoryler ΔFosB, nous avons effectué une série de in vitro réactions de phosphorylation utilisant des kinases purifiées et un recombinant purifié ΔFosB. Comme représenté sur la Figure 3A, parmi les trois kinases candidates, uniquement CK2 ΔFosB phosphorylé de manière significative. En outre, plusieurs autres kinases ont été testées (par exemple, GSK3 et p70S6K) mais n'ont pas réussi à phosphoryler significativement le ΔFosB (données non présentées). Une caractérisation supplémentaire de la réaction de CK2 par une analyse temporelle a révélé que cette kinase peut catalyser l'incorporation de ∼0.5 mol de phosphate par mole de ΔFosB (Fig. 3B). Le fait que CK2 puisse phosphoryler ΔFosB in vitro une stoechiométrie considérable (∼50%) suggère une réaction physiologiquement pertinente. Nous avons ensuite étudié la cinétique de cette réaction en incubant CK2 en présence de quantités croissantes de ΔFosB purifié, et nous avons déterminé que CK2 phosphorylait ΔFosB avec un Vmax de 5.8 pmol · min-1 · Μg-1 de l'enzyme, un KM de 18.4 µm, et un kcat de 0.2 / s (Fig. 3C). Les valeurs obtenues pour ces paramètres cinétiques confirment davantage la pertinence physiologique de cette réaction. Par exemple, le KM de CK2 pour DARPP32, l’un de ses substrats les plus connus, est 3.4 μm, et le kcat est ∼0.3 / s (Girault et al., 1989); la KM pour ATP va de 10 – 40 μm (Cochet et al., 1983; Silva-Neto et al., 2002) et que, pour la caséine, va de 10 – 50 μm (Meggio et al., 1977; Pyerin et al., 1987). Ensemble, ces données indiquent que ΔFosB est un véritable substrat pour CK2 in vitro.

Figure 3.

Voir la version plus grande:

Figure 3.

CK2 mais pas les PKC ou CaMKII phosphorylées ΔFosB in vitro. L'autoradiographie (panneau supérieur) montre le produit phosphorylé et le gel coloré à la Coomassie (panneau inférieur) indique le ΔFosB total présent dans la réaction. AΔFosB recombinant purifié a été soumis à in vitro phosphorylation par diverses kinases candidates (dont trois sont présentées). BLes analyses stoechiométriques et temporelles indiquent que CK2 peut phosphoryler ΔFosB in vitro avec une stoechiométrie de ∼50%. C, L’analyse cinétique de la réaction de CK2 a révélé que ΔFosB est un produit de bonne foi. in vitro substrat. La linéarisation de la réaction est présentée dans un graphique à double réciprocité (en bas), mais les paramètres cinétiques ont été dérivés de la courbe de Michaelis-Menten (en haut).

CK2 module la phosphorylation et la stabilité de ΔFosB dans des cellules intactes

Pour évaluer la pertinence physiologique de la phosphorylation de ΔFosB induite par CK2, nous avons effectué une cartographie comparative des phosphopeptides en utilisant in vitro AFOSB phosphorylé et PC12-cellules phosphorylées. Après SDS-PAGE et élution sur gel de 32P-ΔFosB (à partir de la in vitro réactions ou de l'immunoprécipité de 32Cellules marquées au P), la protéine a été digérée avec de la trypsine et les phosphopeptides résultants ont été soumis à une séparation bidimensionnelle. Cette analyse a révélé que le phosphopeptide principal de la réaction de CK2 co-migrait avec l’un des deux phosphopeptides majeurs de ΔFosB phosphorylé dans des cellules PC12 (Fig. 4A), alors que les phosphopeptides résultant de la réaction de la PKC ou de la CaMKII (données non présentées) ne l’avaient pas été. Il y avait un deuxième phosphopeptide ΔFosB présent dans la carte à partir de cellules PC12, mais en raison de l'incapacité de l'une des kinases, nous avons testé de générer un phosphopeptide similaire. in vitro, nous ne savons pas actuellement si ce second phosphopeptide contient un site de phosphorylation différent de l’autre phosphopeptide ou s’il représente un peptide tryptique distinct contenant le même site de phosphorylation.

Figure 4.

Voir la version plus grande:

Figure 4.

CK2 module la phosphorylation et la stabilité de ΔFosB dans les cellules intactes. A, CK2 mais pas la PKC semble phosphoryler ΔFosB dans les cellules. Cartes bidimensionnelles des phosphopeptides de ΔFosB phosphorylées par CK2 ou PKC in vitro ou par des cellules PC12 intactes. Les flèches indiquent la migration du peptide phosphorylé par CK2 mais pas du peptide phosphorylé par la PKC avec l'un des phosphopeptides ΔFosB obtenus à partir de cellules PC12. B, La phosphorylation de ΔFosB dans les cellules PC12 est augmentée par le traitement des cellules avec la puissante spermine de l'activateur CK2 (SP) et diminuée par le traitement avec l'inhibiteur de CK2, DRB. En revanche, le traitement avec un activateur de la PKC (PMA) ou l'inhibiteur spécifique de la PKC, la calphostine-C (Calph), n'a pas modifié la phosphorylation de ΔFosB dans les cellules PC12. Un autoradiogramme représentatif (panneau supérieur) et un immunoblot (panneau inférieur) sont présentés. C – F, Effet de l'activité de CK2 sur la stabilité de ΔFosB. Les figures montrent l'évolution dans le temps (et l'autoradiogramme représentatif) de la dégradation de ΔFosB. Les cellules PC12 exprimant de manière transitoire ΔFosB ont été soumises à des expériences de poursuite par impulsion conduites en absence ou en présence de l'inhibiteur de CK2, DRB (C), la spermine activatrice de CK2 (D), ou l'inhibiteur de kinase à large spectre H-8 (E), qui a été utilisé pour contrôler les effets non spécifiques de la DRB. F, Effet de l’assèchement de la sous-unité catalytique de CK2 sur la stabilité de ΔFosB. Les cellules PC12 ont été transfectées avec un gène siKrARN (Ctr) non ciblé ou CK2a de rat ciblant si et ensuite 24h transfecté plus tard avec un plasmide AFOSB. Le panneau du haut représente des immunoblots de lysats de cellules entières montrant l'effet du siRNA CK2 sur les taux de protéines CK2 et ΔFosB. L'immunoblot correspondant à la β-tubuline est présenté comme contrôle de charge.

Afin de mieux prendre en compte la pertinence physiologique de CK2 en tant que kinase ΔFosB, nous avons traité les cellules PC12 exprimant ΔFosB avec deux médicaments modulant l'activité de CK2. Comme représenté sur la Figure 4B, La phosphorylation de ΔFosB a été réduite par le traitement des cellules PC12 avec le DRB, un inhibiteur de la CK2 perméable aux cellules (Meggio et al., 1990; Szyszka et al., 1995), et augmentée par traitement avec la polyamine spermine, connue pour être un puissant activateur de CK2 (Cochet et Chambaz, 1983; Meggio et al., 1983). En revanche, le traitement des cellules PC12 par la calphostine C (un inhibiteur de la PKC)Kobayashi et al., 1989; Tamaoki et al., 1990) ou l’activateur PKC PMA (Schmidt et Hecker, 1975; Beh et al., 1989) n'a pas entraîné de changements significatifs dans la phosphorylation de ΔFosB. Dans le cas du PMA, la légère augmentation (et non significative) du 32P-AFOSB pourrait être expliqué par une augmentation des concentrations totales de AFosB causées par ce médicament; en fait, il a été rapporté que les esters de phorbol induisent l’expression de plusieurs protéines de la famille Fos, dont le FosB (Yoza et al., 1992; Suh et al., 2004). De plus, le traitement des cellules avec l'inhibiteur spécifique de la CaMKII, perméable aux cellules, m-AIP (Ishida et Fujisawa, 1995; Stevens et al., 1999) n'a pas non plus entraîné de diminution de la phosphorylation de ΔFosB (données non présentées). Ensemble, ces résultats sont cohérents avec notre in vitro découvertes et indiquent que, dans les cellules intactes, ΔFosB est probablement phosphorylé par CK2 mais pas par PKC ni CaMKII. Le fait que l'inhibition de CK2 n'empêche pas complètement la phosphorylation de ΔFosB indique l'existence de sites de phosphorylation supplémentaires dans la protéine.

Nous avons ensuite examiné si CK2 joue un rôle dans le chiffre d’affaires de ΔFosB et donc dans sa stabilité. À cette fin, nous avons mené des expériences par impulsion sur des cellules PC12 exprimant ΔFosB traitées avec l'inhibiteur CK2 ou l'activateur CK2 utilisé dans l'étude de phosphorylation. Comme représenté sur la Figure 4C, le traitement des cellules avec l'inhibiteur de CK2, DRB, a eu un effet significatif sur le taux de renouvellement du ΔFosB, comme en témoigne le changement de forme de sa courbe de dégradation, passant de biphasique à une courbe plus proche de celle d'une décroissance exponentielle. Inversement, la présence de la spermine activatrice de CK2 a entraîné une diminution significative du taux de dégradation de ΔFosB, ce qui a entraîné une accumulation de la protéine pendant les premières heures de la chasse (Fig. 4D).

Comme c'est le cas pour de nombreux activateurs et inhibiteurs de kinases, la spermine et la DRB peuvent avoir des effets métaboliques en dehors de la modulation de l'activité de CK2. En fait, il a été démontré que DRB inhibait la kinase associée au facteur de transcription IIH (TFIIH) (Yankulov et al., 1995), qui entraîne une inhibition de la transcription médiée par l'ARN polymérase II. Comme cet effet pourrait éventuellement affecter la stabilité de ΔFosB, nous avons analysé l’effet de H-8, inhibiteur de la kinase à large spectre (Hidaka et Kobayashi, 1992) sur le chiffre d'affaires ΔFosB à une concentration (200 µm) connue pour inhiber la kinase associée à TFIIH mais pas CK2 (Yankulov et al., 1995). Comme représenté sur la Figure 4E, le traitement par H-8 n’a pas eu d’incidence sur le taux de roulement de ΔFosB. Des résultats similaires ont été obtenus avec H-7, un autre inhibiteur de la kinase à large spectre, utilisé à une concentration qui inhibe la kinase associée à la TFIIH, mais pas CK2 (données non présentées). Ces données appuient en outre l'interprétation selon laquelle la réduction de la stabilité de ΔFosB causée par la DRB est très probablement imputable à l'inhibition de CK2.

Pour mieux définir le rôle de CK2 dans le chiffre d’affaires de ΔFosB, nous avons étudié les conséquences de la destruction de CK2 via un siRNA. Nous avons effectué ces expériences en utilisant des cellules PC12 qui avaient d'abord été transfectées avec un siARN non ciblé ou un ARNsi qui cible l'ARNm de la sous-unité catalytique de CK2 (CK2a) de rat et transfecté ultérieurement avec ΔFosB. Comme représenté sur la Figure 4F, la transfection avec le siRNA CK2a a efficacement et spécifiquement fait tomber les taux de protéine CK2a sans affecter les taux de ΔFosB (panneau supérieur). L'analyse par impulsion a révélé que la suppression de CK2 entraînait une augmentation significative du taux de renouvellement du ΔFosB, comme en témoigne la dégradation plus rapide de la protéine. Le fait que l'inhibition de l'activité de CK2 (via traitement DRB ou siARN) augmente le chiffre d'affaires de ΔFosB et entraîne la disparition de la composante à vitesse lente de la courbe biphasique, alors que l'activation de CK2 améliore la phase lente de la courbe, fournit un support important pour l’idée que CK2 joue un rôle dans la régulation de la stabilité de ΔFosB.

CK2 phosphoryle ΔFosB sur Ser27

Pour commencer à identifier le (s) site (s) sur ΔFosB phosphorylé par CK2, nous avons effectué une analyse phospho-aminoacide du recombinant ΔFosB phosphorylé par CK2. in vitro et de ΔFosB phosphorylé dans des cellules PC12. Ces expériences ont révélé que, dans les deux cas, le seul phosphoaminoacide détecté était le phospho-Ser (Fig. 5A). Cette découverte, ainsi que la stœchiométrie obtenue pour le CK2 in vitro réaction de phosphorylation (∼50%) (Fig. 3B) et la présence d’un seul point significatif sur la carte des phosphopeptides CK2 (Fig. 4A), suggère que la phosphorylation de ΔFosB par CK2 est probablement limitée à un seul résidu de sérine. Cette conclusion est conforme à l’analyse du site consensus de phosphorylation (Fig. 2B), qui ne prédit qu'une seule sérine candidate, à savoir Ser27, pour CK2. L’analyse taxonomique a révélé que Ser27 est hautement conservé grâce à l’évolution des membres de la famille Fos (Fig. 5B), suggérant qu'il pourrait avoir une fonction physiologique importante.

Figure 5.

Voir la version plus grande:

Figure 5.

CK2 Phosphorylates ΔFosB sur Ser27. A, Analyse des phosphoaminoacides de phosphorylés CK2 (in vitro) et ΔFosB phosphorylé sur des cellules PC12 montrant que, dans les deux cas, le résidu majeur phosphorylé est la sérine. BUne analyse interspécifique de la séquence d'acides aminés FosB / ΔFosB a révélé une haute conservation de Ser27 parmi les membres de la famille Fos, allant de l'homme au poisson zèbre (surbrillance foncée). Cependant, le résidu acide en position + 3, requis pour le site consensus CK2, n'est pas conservé (surbrillance légère). C, Les cellules HeLa ont été transfectées de manière transitoire soit avec AFOSB (WT) de type sauvage, soit avec AFosB contenant une mutation ponctuelle pour remplacer Ser27 par Ala (S27A). Les cellules ont été étiquetées métaboliquement avec 32PH3PO4 et traité avec un véhicule ou avec de la spermine (SP) pour activer CK2. Un autoradiogramme représentatif (panneau supérieur) et un immunoblot (panneau inférieur) des immunoprécipités de ΔFosB obtenus sont présentés. L'immunoprécipité de cellules transfectées à l'improviste (vecteur) est présenté.

Pour déterminer si Ser27 est phosphorylé dans ΔFosB, nous avons muté ce résidu en Ala et analysé les conséquences sur le statut de phosphorylation de la protéine. À cette fin, nous avons utilisé des cellules HeLa (qui peuvent être transfectées avec une plus grande efficacité) pour exprimer transitoirement le mutant ΔFosB de WT ou de S27A. Approximativement 24 h après la transfection, les cellules ont été marquées métaboliquement avec 32Du p-orthophosphate et des lysats de cellules entières ont été préparés. Après immunoprécipitation et SDS-PAGE, 32P-AFOSB a été détecté par autoradiographie et ΔFosB total par immunoblot. Comme représenté sur la Figure 5C (panneau inférieur), ΔFosB n'a pas été détecté dans les cellules transfectées par le vecteur, alors que les cellules transfectées avec le mutant WT ou S27A ΔFosB ont correctement exprimé la protéine. Nous avons constaté que la mutation S27A entraînait une réduction significative (30%) de la 32Niveaux de P-ΔFosB (Fig. 5C, graphique du haut) indiquant que, dans les cellules vivantes, ΔFosB est phosphorylé sur Ser27. Afin de déterminer si, dans les cellules, Ser27 est bien phosphorylé par CK2, nous avons comparé la capacité de la spermine activatrice de CK2 à moduler la phosphorylation de WT et de S27A AFSB. Comme nous l'avions déjà observé dans les cellules PC12 (Fig. 4B), le traitement des cellules HeLa avec de la spermine augmentait significativement la phosphorylation de la protéine WT. Le fait que cet effet ait été significativement diminué par la mutation S27A (Fig. 5C) soutient l'interprétation selon laquelle Ser27 dans ΔFosB est un substrat physiologique pour CK2.

La phosphorylation de Ser27 régule la stabilité de ΔFosB

Après avoir établi que la stabilité de ΔFosB est diminuée lorsque CK2 est inhibée et augmentée lorsque CK2 est activé (Fig. 4) et que CK2 phosphorylait ΔFosB sur Ser27 (Fig. 5), nous avons prédit que la prévention de la phosphorylation de ce site devrait déstabiliser la protéine. Des expériences de pouls menées avec des cellules HeLa exprimant de manière transitoire soit le mutant ΔFosB de WT, soit S27A, ont révélé que, comme prédit, la mutation S27A entraînait une augmentation significative du taux de dégradation de ΔFosB, ainsi qu'une diminution concomitante de la demi-vie de la protéine. (Fig. 6A). Nous avons ensuite examiné si ce mécanisme de régulation se produisait également dans la lignée cellulaire PC12, plus neuronale. Ces expériences ont révélé que, comme nous l'avions observé dans les cellules HeLa, la mutation ponctuelle S27A entraînait une diminution spectaculaire de la demi-vie de ΔFosB dans les cellules PC12 (de ∼11 à ∼4 h) (Fig. 6B). Le fait que cette déstabilisation soit similaire à celle provoquée par l’inhibition ou le knock-down de CK2 (Fig. 4) apporte un soutien supplémentaire à l’idée que la phosphorylation de Ser2 induite par CK27 régule la stabilité de ΔFosB. Des preuves supplémentaires du rôle régulateur de la phosphorylation de Ser27 sur le chiffre d'affaires de la protéine ΔFosB ont été obtenues à l'aide d'une mutation phosphomimétique de Ser27 en Asp (S27D). La mutation S27D est considérée comme phosphomimétique, car elle place un grand groupe (carboxyle) chargé négativement au niveau de l'acide aminé 27 et imite ainsi partiellement la phosphorylation de Ser27. Comme représenté sur la Figure 6C, la mutation S27D a provoqué l’effet opposé de la mutation S27A et a abouti à une protéine significativement plus stable que la protéine WT. De la même manière que pour l’effet obtenu après l’activation de CK2 (Fig. 4D), la mutation S27D a entraîné l’accumulation et donc l’augmentation des taux de ΔFosB au cours des premières heures de chasse.

Figure 6.

Voir la version plus grande:

Figure 6.

La phosphorylation de Ser27 régule la stabilité de ΔFosB. A, C, Analyse par impulsion montrant l’effet de la phosphorylation de Ser27 sur le taux de roulement de ΔFosB. Le profil de dégradation et les demi-vies estimées de ΔFosB (WT) de type sauvage, du mutant Ser27 à Ala (S27A) et du phosphomimétique Ser27 en mutant Asp (S27D) sont présentés. Les mêmes résultats ont été obtenus dans des cellules HeLa (A) et les cellules PC12 (B, C).

La phosphorylation de Ser27 stabilise ΔFosB en empêchant sa dégradation protéasomal

Pour commencer à élucider le mécanisme par lequel la phosphorylation de Ser27 stabilise ΔFosB, nous avons examiné la capacité des inhibiteurs du protéasome MG132 (Palombella et al., 1994; Tsubuki et al., 1996) et l’époxomicine (Hanada et al., 1992; Kim et al., 1999) pour moduler le taux de dégradation de ΔFosB du mutant WT et S27A. Les expériences d'impulsion-chase ont été menées en utilisant des cellules PC12 infectées avec un HSV recombinant exprimant WT ou S27A AFOSB et traitées avec du DMSO ou l'un des deux inhibiteurs du protéasome. Ces expériences ont révélé que, bien que le taux de dégradation de la protéine WT soit relativement insensible à la présence de l’un ou l’autre des deux inhibiteurs du protéasome (Fig. 7A), celle du mutant S27A est sensible à ces médicaments (Fig. 7B). Cela indique que, contrairement à la protéine WT, le mutant S27A est une cible de la dégradation protéasomale. En effet, le traitement de cellules avec MG132 ou l'époxomicine a complètement inversé l'effet de la mutation S27A sur le taux de dégradation de ΔFosB, mis en évidence par une augmentation de la demi-vie du mutant S27A de ∼4 à ∼9 h pour MG132 et à 12 h pour l'époxomicine (Fig. 7B). Ensemble, ces résultats indiquent que la phosphorylation de ΔFosB sur Ser27 protège la protéine de la dégradation protéasomale et est donc essentielle pour sa stabilité inhabituelle.

Figure 7.

Voir la version plus grande:

Figure 7.

La phosphorylation de Ser27 stabilise ΔFosB en empêchant sa dégradation protéasomale. A, B, Analyse par pouls avec des cellules PC12 infectées par le HSV montrant le profil de dégradation et la demi-vie estimée de ΔFosB de type sauvage (A) ou S27A ΔFosB (B) en l'absence ou en présence de l'un des deux inhibiteurs du protéasome [MG132 et l'époxomicine (Epoxo)]. Notez le fait qu’aucun médicament n’a d’effet significatif sur le chiffre d’affaires du ΔFosB de type sauvage, alors que le traitement de cellules avec un inhibiteur du protéasome a entraîné la stabilisation de S27A ΔFosB. C, Un modèle pour le rôle de la phosphorylation de Ser27 dans la capacité de AFOSB à médier une plasticité cérébrale à long terme. Une fois induite, une partie de ΔFosB est stabilisée dans le cerveau par la phosphorylation de S2 induite par CK27. Cela entraîne son accumulation, ce qui entraîne à son tour des modifications durables de l'expression des gènes. Ces changements stables dans l'expression des gènes contribuent à des adaptations comportementales stables. Inversement, la déphosphorylation de S27 par les phosphatases PP1 et / ou PP2A de Ser / Thr entraîne la déstabilisation de la protéine et son traitement par la machinerie protéasomique.

Section précédenteSection suivante

Discussion

Dans la présente étude, nous montrons que ΔFosB a une demi-vie de ∼10 h en culture cellulaire, ce qui la rend stable par rapport à FosB de longueur totale et à la plupart des autres facteurs de transcription inductibles, dont la demi-vie en culture cellulaire peut être aussi courte. en quelques minutes et dépasse rarement 3 h (Hann et Eisenman, 1984; Dobrazanski et al., 1991; Roberts et Whitelaw, 1999; Ferrara et al., 2003; Hirata et al., 2004). De plus, nous trouvons que ΔFosB est phosphorylé dans le cerveau et que sa phosphorylation est sensible à l’acide okadaïque, un inhibiteur de PP1 / PP2A. Nos études en culture cellulaire démontrent que la stabilité de ΔFosB est modulée par CK2, une activité plus élevée de CK2 stabilisant la protéine. Enfin, nos résultats suggèrent que CK2 phosphoryle le ΔFosB sur une sérine N-terminale hautement conservée (S27) et démontre que la phosphorylation de S27 protège le ΔFosB de la dégradation protéasomique. Nous proposons donc un modèle dans lequel la phosphorylation de ΔFosB sur S27 par CK2 est un mécanisme de régulation essentiel du chiffre d’affaires de ΔFosB (Fig. 7C). Une telle stabilisation à médiation par la phosphorylation de ΔFosB est importante du point de vue fonctionnel, car il a été démontré que des taux accrus de ΔFosB dans certaines régions du cerveau régulaient directement de nombreux gènes neuronaux. in vivo et d'exercer des effets comportementaux puissants dans des modèles animaux de plusieurs troubles neuropsychiatriques (voir Introduction).

Bien que la phosphorylation soit un moyen rapide et réversible de réguler l’activité de transcription de certains facteurs de transcription, tels que CREB (protéine de liaison aux éléments de réponse cAMP) (Bohmann, 1990), la modulation de la dégradation des facteurs de transcription fournit une forme de régulation encore plus puissante (moins facilement réversible) (Desterro et al., 2000). Les facteurs de transcription dont l’activité fonctionnelle est régulée au niveau de leur dégradation incluent NFKB (Desterro et al., 2000), c-Myc (Sears et al., 1999) et c-Fos (Ferrara et al., 2003), entre autres. Dans de nombreux cas, la phosphorylation est un régulateur clé de la stabilité d'un facteur de transcription, comme cela a été démontré pour le c-Fos (Okazaki et Sagata, 1995; Tsurumi et al., 1995), Antigène apparenté à Fos-1 (Fra-1) (Flacon et Marshall, 2003), Fra-2 (Manabe et al., 2001), c-juin (Fuchs et al., 1996), JunB (Fuchs et al., 1997), ATF2 (Fuchs et al., 2000) et p53 (Buschmann et al., 2001). Nos études ajoutent donc ΔFosB à cette liste de facteurs de transcription dont l’activité fonctionnelle est régulée par sa stabilité dépendant de phosphoryle.

CK2 est une Ser / Thr kinase omniprésente et constitutivement active qui a plus de 300 substrats présumés identifiés jusqu'à présent et est impliquée dans de multiples processus biologiques, y compris la mort et la survie des cellules (Litchfield, 2003; Unger et al., 2004), réponses au stress cellulaire (Yanagawa et al., 1997; Kato et al., 2003), et la réparation de l’ADN et le remodelage de la chromatine (Barz et al., 2003; Krohn et al., 2003). Plus d’un tiers des substrats présumés de CK2 sont des protéines impliquées dans la régulation de l’expression génique (Meggio et Pinna, 2003). CK2 s'est avéré être une kinase nucléaire importante (Krek et al., 1992) (pour examen, voir Yu et al., 2001) et d’interagir avec les domaines bZIP de plusieurs facteurs de transcription (Yamaguchi et al., 1998). Il a également été démontré que la phosphorylation induite par CK2 modulait la dégradation (en l’améliorant ou en la diminuant) de nombreuses protéines, notamment l’IkB (Schwarz et al., 1996), PTEN (Torres et Pulido, 2001), lentille connexine (Yin et al., 2000), la protéine HMG1 associée à la chromatine (Wisniewski et al., 1999) et plusieurs facteurs de transcription tels que HMGB (Stemmer et al., 2002), Myf-5 (Winter et al., 1997) et c-Myc (Channavajhala et Seldin, 2002). CK2 est le plus abondant dans le cerveau (Alcazar et al., 1988; Girault et al., 1990), et son activité a été impliquée dans de nombreux aspects du fonctionnement cérébral, y compris la survie neuronale (Boehning et al., 2003), différenciation (Nuthall et al., 2004), fonction de canal ionique (Jones et Yakel, 2003; Bildl et al., 2004), et la potentialisation à long terme et la plasticité neuronale (Diaz-Nido et al., 1992; Lieberman et Mody, 1999; Reikhardt et al., 2003).

Malgré les preuves de plus en plus nombreuses du rôle de CK2 dans la régulation de la fonction neuronale, on sait peu de choses sur ce qui contrôle son activité. CK2 est supposé être actif de manière constitutive, la régulation de sa capacité à phosphoryler des substrats spécifiques reposant principalement sur des modifications de sa localisation intracellulaire (par exemple, cytosol vs noyau) (Ahmed et Tawfic, 1994; Yu et al., 1999). Cette information soulève une question importante concernant les signaux nécessaires pour induire une accumulation de ΔFosB dans le cerveau après une stimulation chronique (Fig. 7C). Une exigence est l'activation répétée du FOSB gène et induction de l'ARNm de ΔFosB (Chen et al., 1995). Nos données indiquent que la phosphorylation de ΔFosB par CK2 est essentielle pour sa stabilité, ce qui suggère qu'un second signal pourrait être nécessaire pour les effets à long terme de ΔFosB sur l'expression des gènes, à savoir un signal qui stimule la phosphorylation de la protéine par CK2. Cela pourrait impliquer l'activation de CK2 par un mécanisme inconnu ou sa translocation vers le noyau. En variante, la phosphorylation de ΔFosB par CK2 peut être constitutive, de sorte que lorsque la protéine ΔFosB est traduite en réponse à chaque stimulus, une partie de celle-ci est phosphorylée et ainsi stabilisée, de sorte qu’elle s’accumule à des niveaux élevés dans les neurones affectés.

Nos résultats montrent que CK2 et S27 ne sont probablement pas les seuls kinases et sites responsables de la phosphorylation de ΔFosB, car ni l'inhibition de CK2 ni la mutation S27A n'ont été capables d'empêcher complètement la phosphorylation de ΔFosB. De même, le fait que la mutation S27A entraîne une réduction de 30% de la phospho-ΔFosB fait valoir que S27 est un site de phosphorylation majeur sur la protéine. Néanmoins, nous étudions d’autres kinases et sites de phosphorylation potentiels sur AFOSB. En fin de compte, il importera également d’analyser la phosphorylation de S27 et de tout autre site de phosphorylation de ΔFosB dans le cerveau. in vivo après divers types de stimulation chronique, par exemple, au moyen de la spectrométrie de masse ou d’anticorps phosphospécifiques.

Comme mentionné ci-dessus, S27 dans ΔFosB est hautement conservé au cours de l'évolution et parmi d'autres protéines de la famille Fos. Cependant, le site de consensus pour CK2 n’est pas: comme le montre Figure 5B, seuls FosB / ΔFosB (et le xenolog Zebrafish), mais pas c-Fos ou Fra-2, possèdent un résidu acide à + 3, déterminant de la phosphorylation de CK2 (Marin et al., 1986; Meggio et al., 1994). Ainsi, l'absence de phosphorylation de CK2 sur S27 peut expliquer pourquoi d'autres protéines de la famille Fos ne sont pas aussi stables que ΔFosB. Cependant, cela n'explique pas pourquoi FosB de longueur complète, qui a le même site consensus CK2 que ΔFosB, n'est pas stabilisé de la même façon. Nous ne savons pas si FosB de longueur complète est phosphorylé par CK2 sur ce résidu conservé. Les seuls rapports de FosB (Skinner et al., 1997) et c-Fos (Okazaki et Sagata, 1995; Chen et al., 1996) phosphorylation décrivent des sites dans la région C-terminale de ces protéines, qui est absente dans AFOSB. La phosphorylation potentielle de FKB de pleine longueur et d'autres protéines de la famille Fos par CK2 doit faire l'objet d'une enquête directe. Cependant, même si elles sont phosphorylées, on sait que les autres protéines de la famille Fos contiennent des motifs à leur extrémité C-terminale qui les ciblent pour une dégradation rapide (Papavassiliou et al., 1992; Jariel-Encontre et al., 1997; Acquaviva et al., 2002). Par exemple, il a été montré qu’une partie de résidus ∼21 présente dans l’extrémité C de toutes les protéines de la famille Fos, mais absente dans ΔFosB, agit comme un domaine de déstabilisation pour c-Fos (Acquaviva et al., 2001). Nous avons constaté que bien que cette séquence déstabilise de la même manière le FosB de pleine longueur (Carle et al., 2004), l’absence de ce domaine dans ΔFosB n’explique pas totalement sa stabilisation. Plutôt, la combinaison de l'absence de ce domaine C-terminal et de la phosphorylation de Ser27 semble expliquer pleinement la différence de stabilité environ cinq fois supérieure entre ΔFosB et FosB.

Bien que la dégradation des protéines de la famille Fos soit complexe et mal comprise, la dégradation protéasomique semble être la principale voie impliquée (Salvat et al., 1999; Acquaviva et al., 2002; Ferrara et al., 2003). Les données présentées ici, dans lesquelles les inhibiteurs protéasomiques ne modifient pas de manière significative le taux de dégradation de ΔFosB, font valoir que, contrairement aux autres protéines de la famille Fos, ΔFosB échappe au protéasome 26S, ce qui joue un rôle central dans sa stabilisation. Nous proposons donc un schéma dans lequel la stabilité accrue de ΔFosB est attribuable à la combinaison de deux facteurs principaux: (1), l’absence de domaine déstabilisant C-terminal et (2), la phosphorylation de S27 par CK2.

En résumé, la présente étude fournit un aperçu mécaniste sur la raison pour laquelle ΔFosB, un produit du gène précoce immédiat FOSB, contrairement à tous les autres membres de la famille Fos, est une protéine à vie relativement longue. Bien que l’on pense que d’autres protéines de la famille Fos interviennent dans le couplage rapide mais transitoire entre le stimulus et la transcription (Morgan et Curran, 1995), la stabilité relative de ΔFosB lui confère la capacité de médier des modifications transcriptionnelles plus durables induites par une stimulation chronique. Cela conforte l'idée selon laquelle ΔFosB fonctionne comme un commutateur moléculaire soutenu dans le cerveau, convertissant progressivement les réponses aiguës en adaptations chroniques. L'identification de la phosphorylation de Ser27 en tant que mécanisme central de la stabilité de ΔFosB ouvre de nouvelles perspectives pour le développement de moyens permettant de réguler la fonction de ΔFosB et de moduler ainsi ses effets à long terme sur la plasticité neuronale et comportementale.

Section précédenteSection suivante

Notes

  • Reçu en novembre 21, 2005.
  • Révision reçue en février 21, 2006.
  • Accepté en avril 2, 2006.
  • Ce travail a été soutenu par un prix du jeune chercheur de l'Alliance nationale pour la recherche sur la schizophrénie et la dépression attribué à PGU, un prix du service national de recherche de l'Institut national de lutte contre l'abus des drogues (NIDA) attribué à PGU, ainsi que des subventions de l'Institut national de la santé mentale et de NIDA attribuée au RJE. remercie le Dr James Bibb pour son aide avec le in vitro essais de phosphorylation, le Dr Ming-Hu Han pour son aide dans la préparation de tranches de cerveau utilisées pour le marquage métabolique, et le Dr Rachael Neve pour son aide dans le conditionnement des HSV recombinants.
  • Adresse actuelle de G. Rudenko: Institut des sciences de la vie et Département de pharmacologie, Université du Michigan, 210 Washtenaw Avenue # 3163A, Ann Arbor, MI 48109-2216.
  • La correspondance doit être adressée à Eric J. Nestler, 5323, boulevard Harry Hines, Dallas, TX 75390-9070. Email: [email protected]

Section précédente

 

Références

Acquaviva C, F Brockly, P Ferrara, Bossis G, C Salvat, Jariel-Encontre I, M Piechaczyk (2001) Identification d'un motif tripeptidique C-terminal impliqué dans le contrôle de la dégradation protéasale rapide de la proto-oncoprotéine c-Fos au cours de la transition de phase G (0) -S. Oncogène 20:7563-7572.

CrossRefMedline

Acquaviva C, Bossis G, Ferrara P, F Brockly, Jariel-Encontre I, Piechaczyk M (2002) Plusieurs voies de dégradation pour les protéines de la famille Fos. Ann NY Acad Sci 973:426-434.

Medline

Ahmed K, Tawfic S (1994) Mécanisme de régulation intracellulaire de la protéine kinase CK2: rôle de l'association subnucléaire à médiation par un stimulus. Cellule Mol Biol Res 40:539-545.

Medline

Alcazar A, Martin E, Lopez-Fando J, Salinas M (1988) Une procédure de purification améliorée et les propriétés de la caséine kinase II du cerveau. Neurochem Res 13:829-836.

CrossRefMedline

Andersson M, JE Westin, MA Cenci (2003) Évolution dans le temps de l'immunoréactivité striatale de type DeltaFosB et des niveaux d'ARNm de la prodynorphine après l'arrêt du traitement dopaminomimétique chronique. Eur J Neurosci 17:661-666.

CrossRefMedline

Barz T, Ackermann K, Dubois G, Eils R, Pyerin W (2003) Les écrans d'expression à l'échelle du génome indiquent un rôle global pour la protéine kinase CK2 dans le remodelage de la chromatine. J Cell Sci 116:1563-1577.

Résumé / Texte intégral GRATUIT

Beh I, R Schmidt, Hecker E (1989) Deux isoenzymes de PKC trouvées dans les cellules HL-60 montrent une différence d'activation par l'ester de phorbol, le TPA. FEBS Lett 249:264-266.

Medline

Bildl W, Strassmaier T, Thurm H, Andersen J, Eble S, Oliver D, Knipper M, Mann M, Schulte U, Adelman JP, Fakler B (2004) La protéine kinase CK2 est assemblée avec des canaux K + à conductance faible activés par le Ca (2 +) et régule le déclenchement du canal. Neuron 43:847-858.

CrossRefMedline

Bing G, Wang W, Qi Q, Feng Z, P Hudson, Jin L, Zhang W, R Bing, Hong JS (1997) Expression à long terme de l'antigène lié à Fos et expression transitoire de FosB delta associée à des convulsions dans l'hippocampe et le striatum de rat. J Neurochem 68:272-279.

Medline

Blom N, Sicheritz-Ponten T, Gupta R, Gammeltoft S, Brunak S (2004) Prédiction de la glycosylation et de la phosphorylation post-traductionnelles de protéines à partir de la séquence d'acides aminés. Proteomics 4:1633-1649.

CrossRefMedline

Boehning D, Lune C, Sharma S, Hurt KJ, Hester LD, Ronnett GV, Shugar D, Snyder SH (2003) Neurotransmission du monoxyde de carbone activée par la phosphorylation par CK2 de l'hème oxygénase-2. Neuron 40:129-137.

CrossRefMedline

Bohmann D (1990) Phosphorylation du facteur de transcription: lien entre la transduction du signal et la régulation de l'expression génique. Cellules cancéreuses 2:337-344.

Medline

Buschmann T, Potapova O, Barovira A, Ivanov VN, SY Fuchs, Henderson S, Fried VA, Minamoto T, Alarcon-Vargas D, Pincus MR, Gaarde WA, Holbrook NJ, Shiloh Y, Ronai Z (2001) Juin La phosphorylation de p2 sur Thr-53 par la kinase terminale NH81 est importante pour la stabilisation de p53 et les activités de transcription en réponse au stress. Mol Cell Biol 21:2743-2754.

Résumé / Texte intégral GRATUIT

Carle TL, Ulery PG, Nestler EJ (2004) L'absence d'un domaine C-terminal de la famille Fos conservé contribue à la stabilité unique de deltaFosB. Soc Neurosci Abstr 30: 692.2.

Channavajhala P, Seldin DC (2002) Interaction fonctionnelle de la protéine kinase CK2 et de c-Myc dans la lymphomagénèse. Oncogène 21:5280-5288.

CrossRefMedline

Chen J, Nye HE, Kelz MB, Hiroi N, Nakabeppu Y, Espoir BT, Nestler EJ (1995) Régulation des protéines delta FosB et de type FosB par des convulsions électroconvulsives et des traitements à la cocaïne. Mol Pharmacol 48:880-889.

Abstrait

Chen J, MB Kelz, Espoir BT, Nakabeppu Y, Nestler EJ (1997) Antigènes chroniques apparentés à Fos: variants stables de ΔFosB induits dans le cerveau par des traitements chroniques. J Neurosci 17:4933-4941.

Résumé / Texte intégral GRATUIT

Chen RH, Juo PC, Curran T, Blenis J (1996) La phosphorylation de c-Fos à l'extrémité C-terminale améliore son activité de transformation. Oncogène 12:1493-1502.

Medline

Choe ES, Parelkar NK, Kim JY, Cho HW, Kang HS, Mao L, Wang JQ (2004) L'acide okadaïque inhibiteur de la protéine phosphatase 1 / 2A augmente la phosphorylation de CREB et Elk-1 et l'expression de c-fos dans le striatum de rat in vivo. J Neurochem 89:383-390.

CrossRefMedline

Cochet C, EM Chambaz (1983) Phosphorylations de protéines à médiation polyamine: une cible possible pour l'action polyamine intracellulaire. Endocrinol de cellules de mol 30:247-266.

CrossRefMedline

Cochet C, Feige JJ, Chambaz EM (1983) Propriétés catalytiques et moléculaires d'une caséine kinase de type G hautement purifiée à partir de tissu pulmonaire bovin. Biochim Biophys Acta 743:1-12.

Medline

Colby CR, Whisler K, C Steffen, Nestler EJ, Self DW (2003) La surexpression de DeltaFosB spécifique au type de cellule striatale augmente l’incitation à la cocaïne. J Neurosci 23:2488-2493.

Résumé / Texte intégral GRATUIT

Daunais JB, Roberts DC, McGinty JF (1993) L’auto-administration de cocaïne augmente l’ARNm de la préprodynorphine, mais pas celle du c-fos, dans le striatum de rat. NeuroReport 4:543-546.

Medline

Desterro JM, MS Rodriguez, Hay RT (2000) Régulation des facteurs de transcription par dégradation des protéines. Cell Mol Life Sci 57:1207-1219.

CrossRefMedline

Diaz-Nido J, Armas-Portela R, Avila J (1992) L'augmentation de l'activité de type caséine kinase II cytoplasmique accompagne la croissance des neurites après l'inhibition de la synthèse de l'ADN dans les cellules de neuroblastome NIA-103. J Neurochem 58:1820-1828.

Medline

Di Maira G, Salvi M, Arrigoni G, Marin O, Sarno S, Brustolon F, Pinna LA, Ruzzene M (2005) La protéine kinase CK2 phosphoryle et régule à la hausse Akt / PKB. Différence de mort cellulaire 12:668-677.

CrossRefMedline

Dobrazanski P, T Noguchi, Kovary K, CA Rizzo, PS Lazo, Bravo R (1991) Les deux produits du gène fosB, FosB et de sa forme courte, FosB / SF, sont des activateurs de la transcription dans les fibroblastes. Mol Cell Biol 11:5470-5478.

Résumé / Texte intégral GRATUIT

Ferrara P, Andermarcher E, Bossis G, Acquaviva C, F Brockly, Jariel-Encontre I, Piechaczyk M (2003) Les déterminants structurels responsables de la dégradation protéasomal de la protéine c-Fos diffèrent selon les conditions d'expression. Oncogène 22:1461-1474.

CrossRefMedline

SY Fuchs, Dolan L, Davis RJ, Ronai Z (1996) Ciblage, dépendant de la phosphorylation, de l'ubiquitination de c-Jun par la N-kinase de Jun. Oncogène 13:1531-1535.

Medline

SY Fuchs, Xie B, Adler V, VA frit, Davis RJ, Ronai Z (1997) Les kinases terminales NH2 de c-Jun ciblent l'ubiquitination de leurs facteurs de transcription associés. J Biol Chem 272:32163-32168.

Résumé / Texte intégral GRATUIT

Fuchs SY, Tappin I, Ronai Z (2000) La stabilité du facteur de transcription ATF2 est régulée par la phosphorylation et la déphosphorylation. J Biol Chem 275:12560-12564.

Résumé / Texte intégral GRATUIT

Girault JA, Hemmings HC Jr, Williams KR, Nairn AC, Greengard P (1989) Phosphorylation de DARPP-32, une phosphoprotéine régulée par la dopamine et l'AMPc, par la caséine kinase II. J Biol Chem 264:21748-21759.

Résumé / Texte intégral GRATUIT

Girault JA, Hemmings HC Jr, Zorn SH, Gustafson EL, Greengard P (1990) Caractérisation dans le cerveau de mammifère d'une sérine kinase DARPP-32 identique à la caséine kinase II. J Neurochem 55:1772-1783.

Medline

Hanada M, Sugawara K, Kaneta K, Toda S, Nishiyama Y, Tomita K, Yamamoto H, Konishi M, Oki T (1992) L'époxomicine, un nouvel agent antitumoral d'origine microbienne. J Antibiot (Tokyo) 45:1746-1752.

Medline

Hann SR, RN Eisenman (1984) Protéines codées par l'oncogène c-myc humain: expression différentielle dans les cellules néoplasiques. Mol Cell Biol 4:2486-2497.

Résumé / Texte intégral GRATUIT

Hemmings HC Jr, Juge Girault, Williams KR, MB LoPresti, Greengard P (1989) ARPP-21, une phosphoprotéine régulée par l'AMP cyclique (Mr = 21,000) enrichie en régions cérébrales innervées par la dopamine. Séquence d'acides aminés du site phosphorylé par l'AMP cyclique dans des cellules intactes et études cinétiques de sa phosphorylation in vitro. J Biol Chem 264:7726-7733.

Hidaka H, ​​Kobayashi R (1992) Pharmacologie des inhibiteurs de la protéine kinase. Annu Rev Pharmacol Toxicol 32:377-397.

CrossRefMedline

Hirata H, Bessho Y, H Kokubu, Y Masamizu, Yamada S, Lewis J, Kageyama R (2004) L'instabilité de la protéine Hes7 est cruciale pour l'horloge de segmentation somite. Nat Genet 36:750-754.

CrossRefMedline

Hiroi N, Graybiel AM (1996) Les traitements neuroleptiques atypiques et typiques induisent des programmes distincts d'expression du facteur de transcription dans le striatum. J Comp Neurol 374:70-83.

CrossRefMedline

Hope B, Kosofsky B, Hyman SE, Nestler EJ (1992) Régulation de l'expression précoce précoce des gènes et de la liaison de AP-1 dans le noyau accumbens du rat par la cocaïne chronique. Proc Natl Acad Sci États-Unis 89:5764-5768.

Résumé / Texte intégral GRATUIT

Hope BT, MB Kelz, Duman RS, Nestler EJ (1994a) Le traitement des crises électroconvulsives chroniques (ECS) aboutit à l'expression d'un complexe AP-1 de longue durée dans le cerveau avec une composition et des caractéristiques altérées. J Neurosci 14:4318-4328.

Abstrait

Hope BT, Nye HE, Kelz MB, DW Self, Iadarola MJ, Y Nakabeppu, Duman RS, Nestler EJ (1994b) Induction d'un complexe AP-1 de longue durée composé de protéines modifiées de type Fos dans le cerveau par la cocaïne chronique et d'autres traitements chroniques. Neuron 13:1235-1244.

CrossRefMedline

Ishida A, Fujisawa H (1995) Stabilisation de la protéine kinase II dépendante de la calmoduline par le biais du domaine auto-inhibiteur. J Biol Chem 270:2163-2170.

Résumé / Texte intégral GRATUIT

Jariel-Encontre I, Salvat C, Steff AM, Pariat M, Acquaviva C, Furstoss O, Piechaczyk M (1997) Mécanismes complexes pour la dégradation de c-fos et c-jun. Mol Biol Rep 24:51-56.

CrossRefMedline

Jones S, Yakel JL (2003) La caséine kinase ii (protéine kinase ck2) régule la fonction du canal du récepteur de la sérotonine 5-ht (3) dans les cellules ng108 – 15. Neuroscience 119:629-634.

CrossRefMedline

Kato T Jr, Delhase M, Hoffmann A, Karin M (2003) CK2 est une kinase C-terminale IkappaB responsable de l'activation de NF-kappaB pendant la réponse UV. Mol Cell 12:829-839.

CrossRefMedline

Kelz MB, Chen J, Carlezon WA Jr, Whisler K, Gilden L, Beckmann AM, Steffen C, Zhang YJ, L Marotti, Self DW, Tkatch T, Baranauskas G, Surmeier DJ, Neve RL, Duman RS, Picciotto MR, Nestler EJ (1999) L'expression du facteur de transcription deltaFosB dans le cerveau contrôle la sensibilité à la cocaïne. Nature 401:272-276.

CrossRefMedline

Kim KB, Myung J, Sin N, équipages CM (1999) Inhibition du protéasome par les produits naturels époxomicine et dihydroéponémycine: aperçu de la spécificité et de la puissance. Bioorg Med Chem Lett 9:3335-3340.

CrossRefMedline

Kobayashi E, H Nakano, M Morimoto, Tamaoki T (1989) La calphostine C (UCN-1028C), un nouveau composé microbien, est un inhibiteur extrêmement puissant et spécifique de la protéine kinase C. Biochem Biophys Res Commun 159:548-553.

CrossRefMedline

Krek W, Maridor G, Nigg EA (1992) La caséine kinase II est une enzyme essentiellement nucléaire. J Cell Biol 116:43-55.

Résumé / Texte intégral GRATUIT

Krohn NM, Stemmer C, P Fojan, Grimm R, Grasser KD (2003) La protéine kinase CK2 phosphoryle la protéine de domaine de groupe de mobilité élevée SSRP1, induisant la reconnaissance de l'ADN endommagé par les rayons UV. J Biol Chem 278:12710-12715.

Résumé / Texte intégral GRATUIT

Kumar A, Choi KH, Renthal W, NM Tsankova, Theobald DEH, Truong HT, Russo SJ, LaPlant Q, Whistler K, Neve RL, Self DW, Nestler EJ (2005) Le remodelage de la chromatine est un mécanisme clé de la plasticité induite par la cocaïne dans le striatum. Neuron 48:303-314.

CrossRefMedline

Lieberman DN, Mody I (1999) La caséine kinase-II régule la fonction du canal NMDA dans les neurones de l'hippocampe. Nat Neurosci 2:125-132.

CrossRefMedline

Litchfield DW (2003) Protéine kinase CK2: structure, régulation et rôle dans les décisions cellulaires de vie et de mort. Biochem J 369:1-15.

CrossRefMedline

Manabe T, Kuramoto N, Nakamichi N, Aramachi K, Baba K, Hirai T, Yoneyama M, Yoneda Y (2001) Dégradation de la protéine c-Fos exprimée par N-méthyl-d-acide aspartique dans les fractions nucléaires d'hippocampe murin. Brain Res 905:34-43.

Medline

Mandelzys A, MA Gruda, Bravo R, Morgan JI (1997) Absence d'antigène apparenté à kDa kDa 37 élevé de manière persistante et activité de liaison à l'ADN apparentée à AP-1 dans le cerveau de souris fosB null traitées à l'acide kaïnique. J Neurosci 17:5407-5415.

Résumé / Texte intégral GRATUIT

Marin O, Meggio F, F Marchiori, Borin G, Pinna LA (1986) Spécificité de site de la caséine kinase-2 (TS) du cytosol de foie de rat. Une étude avec des substrats peptidiques modèles. Eur J Biochem 160:239-244.

McClung CA, Nestler EJ (2003) Régulation de l'expression des gènes et de la récompense de la cocaïne par CREB et DeltaFosB. Nat Neurosci 6:1208-1215.

CrossRefMedline

McClung CA, Ulery PG, Perrotti LI, Zachariou V, Berton O, Nestler EJ (2004) DeltaFosB: un commutateur moléculaire pour une adaptation à long terme dans le cerveau. Brain Res Mol Brain Res 132:146-154.

Medline

Meggio F, Pinna LA (2003) Mille et un substrats de la protéine kinase CK2? FASEB J 17:349-368.

Résumé / Texte intégral GRATUIT

Meggio F, Donella-Deana A, Pinna LA, Moret V (1977) Phosphorylation des fractions de caséine par la «phosvitine kinase» du foie de rat. FEBS Lett 75:192-196.

Medline

Meggio F, Brunati AM, Pinna LA (1983) Autophosphorylation de la caséine kinase TS de type 2 au niveau de ses sous-unités alpha et bêta. Influence de différents effecteurs. FEBS Lett 160:203-208.

CrossRefMedline

Meggio F, D Shugar, Pinna LA (1990) Dérivés de ribofuranosyl-benzimidazole en tant qu'inhibiteurs de la caséine kinase-2 et de la caséine kinase-1. Eur J Biochem 187:89-94.

Medline

Meggio F, Marin O, Pinna LA (1994) Spécificité de substrat de la protéine kinase CK2. Cellule Mol Biol Res 40:401-409.

Medline

Miller C, Zhang M, He Y, J Zhao, JP Pelletier, J Martel-Pelletier, J Di Battista (1998) Induction transcriptionnelle du gène cyclooxygénase-2 par inhibition de l’activité de la phosphatase par l’acide okadaïque dans les chondrocytes humains: co-stimulation des protéines de liaison nucléaire AP-1 et CRE. J Cell Biochem 69:392-413.

CrossRefMedline

Moratalla R, Elibol B, Vallejo M, Graybiel AM (1996) Changements au niveau du réseau dans l'expression des protéines Fos-Jun inductibles dans le striatum au cours du traitement et du sevrage chroniques de la cocaïne. Neuron 17:147-156.

CrossRefMedline

Morgan JI, Curran T (1995) Gènes immédiats: dix ans plus tard. Tendances Neurosci 18:66-67.

CrossRefMedline

Nakabeppu Y, Nathans D (1991) Une forme tronquée naturelle de FosB qui inhibe l'activité de transcription de Fos / Jun. Cellule 64:751-759.

CrossRefMedline

Nestler EJ, Barrot M, Self DW (2001) Delta FosB: un commutateur moléculaire durable pour la dépendance. Proc Natl Acad Sci États-Unis 98:11042-11046.

Résumé / Texte intégral GRATUIT

Neve RL, Howe JR, Hong S, Kalb RG (1997) Introduction de la sous-unité 1 du récepteur du glutamate dans les motoneurones in vitro et in vivo à l'aide d'un virus de l'herpès simplex recombinant. Neuroscience 79:435-447.

CrossRefMedline

Nuthall HN, Joachim K, Stifani S (2004) La phosphorylation de la sérine 239 de Groucho / TLE1 par la protéine kinase CK2 est importante pour l'inhibition de la différenciation neuronale. Mol Cell Biol 24:8395-8407.

Résumé / Texte intégral GRATUIT

Okazaki K, Sagata N (1995) La voie Mos / MAP kinase stabilise le c-Fos par phosphorylation et augmente son activité de transformation dans les cellules NIH 3T3. EMBO J 14:5048-5059.

Medline

Palombella VJ, Rando OJ, Goldberg AL, Maniatis T (1994) La voie ubiquitine-protéasome est nécessaire au traitement du précurseur de la protéine NF-kappa B1 et à l'activation de la NF-kappa B. Cellule 78:773-785.

CrossRefMedline

Papavassiliou AG, Treier M, Chavrier C, Bohmann D (1992) Dégradation ciblée de c-Fos, mais pas de v-Fos, par un signal dépendant de la phosphorylation sur c-Jun. Les sciences 258:1941-1944.

Résumé / Texte intégral GRATUIT

Peakman MC, Colby C, Perrotti LI, Tekumalla P, Carle T, Ulery P, Chao J, Duman C, Steffen C, Monteggia L, Allen MR, Stock JL, Duman RS, McNeish JD, Barrot M, Self DW, Nestler EJ , Schaeffer E (2003) L'expression inductible, spécifique à la région cérébrale, d'un mutant négatif dominant de c-Jun chez des souris transgéniques diminue la sensibilité à la cocaïne. Brain Res 970:73-86.

CrossRefMedline

Perrotti LI, Y Hadeishi, PG Ulery, M Barrot, L Monteggia, Duman RS, Nestler EJ (2004) Induction de DeltaFosB dans les structures cérébrales liées à la récompense après un stress chronique. J Neurosci 24:10594-10602.

Résumé / Texte intégral GRATUIT

Persico AM, Schindler CW, O'Hara BF, Brannock MT, Uhl GR (1993) Expression du facteur de transcription dans le cerveau: effets de l'amphétamine aiguë et chronique et du stress lié à l'injection. Brain Res Mol Brain Res 20:91-100.

Medline

Ploegh HL, Dunn BM (2000) Modification post-traductionnelle: phosphorylation et phosphatases. Dans: Protocoles actuels en science des protéines (Dunn BM, ed.) Pp. 13.01–13.02. New York: Wiley and Sons.

Pyerin W. Burow E. Michaely K. Kubler D. Kinzel V (1987) Propriétés catalytiques et moléculaires de la phosvitine / caséine kinase de type II hautement purifiée provenant de cellules épithéliales humaines en culture (HeLa) et relation avec l'ecto-protéine kinase. Biol Chem Hoppe Seyler 368:215-227.

Medline

Reikhardt BA, Kulikova OG, Borisova GY, Aleksandrova IY, Sapronov NS (2003) Etat du système «protéine kinase CK2-HMG14» dans l'amnésie liée à l'âge chez le rat. Neurosci Behav Physiol 33:799-804.

Medline

Roberts BJ, Whitelaw ML (1999) Dégradation du récepteur de dioxine du domaine d'homologie de base hélice-boucle-hélice / Per-ARNT-Sim via la voie ubiquitine / protéasome. J Biol Chem 274:36351-36356.

Résumé / Texte intégral GRATUIT

Rost B, Yachdav G, Liu J (2004) Le serveur PredictProtein. Acides Nucléiques Rés 32:W321–W326.

Résumé / Texte intégral GRATUIT

Rylski M, Kaczmarek L (2004) Ap-1 cible dans le cerveau. Biosci avant 9:8-23.

CrossRefMedline

Sahin B, Kansy JW, AC Nairn, J Spychala, Ealick SE, Fienberg AA, Greene RW, Bibb JA (2004) Caractérisation moléculaire de l'adénosine kinase de souris recombinante et évaluation en tant que cible de la phosphorylation des protéines. Eur J Biochem 271:3547-3555.

Medline

Salvat C, Aquaviva C, Jariel-Encontre I, P Ferrara, Pariat M, Steff AM, Carillo S, Piechaczyk M (1999) Existe-t-il de multiples voies protéolytiques contribuant à la dégradation de la protéine c-Fos, c-Jun et p53 in vivo? Mol Biol Rep 26:45-51.

CrossRefMedline

Schmidt R, Hecker E (1975) Autoxydation des esters de phorbol dans des conditions normales de stockage. Cancer Res 35:1375-1377.

Texte intégral GRATUIT

Schwarz EM, Van Anvers D, Verma IM (1996) La phosphorylation constitutive d'IkappaBalpha par la caséine kinase II se produit préférentiellement au niveau de la sérine 293: nécessité de la dégradation de l'IkappaBalpha libre. Mol Cell Biol 16:3554-3559.

Résumé / Texte intégral GRATUIT

Sears R, Leone G, DeGregori J, Nevins JR (1999) Ras améliore la stabilité de la protéine Myc. Mol Cell 3:169-179.

CrossRefMedline

Silva-Neto MA, Fialho E, MC Paes, Oliveira PL, Masuda H (2002) Phosphorylation cyclique, indépendante des nucléotides, de la vitelline par la caséine kinase II purifiée à partir d'ovocytes de Rhodnius prolixus. Insecte Biochem Mol Biol 32:847-857.

CrossRefMedline

Skinner M, Qu S, Moore C, Wisdom R (1997) L'activation transcriptionnelle et la transformation par la protéine FosB nécessitent la phosphorylation du domaine d'activation carboxyle terminal. Mol Cell Biol 17:2372-2380.

Résumé / Texte intégral GRATUIT

Stemmer C, Schwander A, Bauw G, P Fojan, Grasser KD (2002) La protéine kinase CK2 phosphoryle de manière différentielle les protéines du groupe B (HMGB) chromosomiques à mobilité élevée du maïs modulant leur stabilité et leurs interactions avec l'ADN. J Biol Chem 277:1092-1098.

Résumé / Texte intégral GRATUIT

Stevens I, Derua R, E Rondelez, Waelkens E, Merlevede W, Goris J (1999) Identification de cyk, une cycline B2 kinase, en tant que nouvelle protéine kinase II dépendante du calcium / calmoduline et son rôle lors de la maturation des ovocytes de Xenopus laevis. Exp Cell Res 252:303-318.

CrossRefMedline

Suh HW, SS Choi, Lee JK, Lee HK, Han EJ, Lee J (2004) Régulation de l'expression des gènes c-fos et c-jun par les lipopolysaccharides et les cytokines dans les astrocytes en culture primaire: effet des voies de la PKA et de la PKC. Arch Pharm Res 27:396-401.

Medline

Szyszka R, Boguszewska A, Grankowski N, Ballesta JP (1995) Phosphorylation différentielle de protéines acides ribosomales de cellules de levure par deux protéines kinases endogènes: caséine kinase-2 et 60S kinase. Acta Biochim Pol 42:357-362.

Medline

Tamaoki T, Takahashi Ier, Kobayashi E, Nakano H, Akinaga S, Suzuki K (1990) La calphostine (UCN1028) et des composés apparentés à la calphostine, une nouvelle classe d'inhibiteurs spécifiques et puissants de la protéine kinase C. Adv Second Messenger Phosphoprotein Res 24:497-501.

Medline

Torres J, Pulido R (2001) Le suppresseur de tumeur PTEN est phosphorylé par la protéine kinase CK2 à son extrémité C-terminale. Implications pour la stabilité du PTEN sur la dégradation induite par le protéasome. J Biol Chem 276:993-998.

Résumé / Texte intégral GRATUIT

Tsubuki S, Y Saito, Tomioka M, Ito H, Kawashima S (1996) Inhibition différentielle des activités de la calpaïne et du protéasome par les peptidyl aldéhydes de di-leucine et de tri-leucine. J Biochem (Tokyo) 119:572-576.

Résumé / Texte intégral GRATUIT

Tsurumi C, N Ishida, T Tamura, Kakizuka A, Nishida E, Okumura E, T Kishimoto, Inagaki M, Okazaki K, Sagata N (1995) La dégradation de c-Fos par le protéasome 26S est accélérée par c-Jun et de multiples protéines kinases. Mol Cell Biol 15:5682-5687.

Résumé / Texte intégral GRATUIT

Unger GM, Davis AT, Slaton JW, Ahmed K (2004) Protéine kinase CK2 en tant que régulateur de la survie cellulaire: implications pour le traitement du cancer. Curr Cancer Drug Targets 4:77-84.

CrossRefMedline

Vial E, juge Marshall (2003) L'activité élevée de la kinase ERK-MAP protège le membre de la famille FOS FRA-1 contre la dégradation protéasomale dans les cellules de carcinome du côlon. J Cell Sci 116:4957-4963.

Résumé / Texte intégral GRATUIT

Werme M, Messer C, Olson L, Gilden L, Thoren P, Nestler EJ, Brene S (2002) ΔFosB régule la roue. J Neurosci 22:8133-8138.

Résumé / Texte intégral GRATUIT

Whitmarsh AJ, Davis RJ (2000) Régulation de la fonction du facteur de transcription par phosphorylation. Cell Mol Life Sci 57:1172-1183.

CrossRefMedline

Hiver B, Kautzner I, Issinger OG, Arnold HH (1997) Deux sites de phosphorylation supposés de la protéine kinase CK2 sont importants pour l'activité de Myf-5. Biol Chem 378:1445-1456.

Medline

Wisniewski JR, Z Szewczuk, Petry I, R Schwanbeck, Renner U (1999) La phosphorylation constitutive des queues acides des protéines 1 du groupe à mobilité élevée par la caséine kinase II modifie leur conformation, leur stabilité et leur spécificité de liaison à l'ADN. J Biol Chem 274:20116-20122.

Résumé / Texte intégral GRATUIT

Y Yamaguchi, T Wada, F Suzuki, T Takagi, J Hasegawa, Handa H (1998) La caséine kinase II interagit avec les domaines bZIP de plusieurs facteurs de transcription. Acides Nucléiques Rés 26:3854-3861.

Résumé / Texte intégral GRATUIT

Yanagawa T, Yuki K, H Yoshida, Bannai S, Ishii T (1997) Phosphorylation de la protéine de stress A170 par l'activité de type caséine kinase II dans les macrophages. Biochem Biophys Res Commun 241:157-163.

CrossRefMedline

Yankulov K, K Yamashita, Roy R, Egly JM, Bentley DL (1995) L’inhibiteur d’élongation de la transcription 5,6-dichloro-1-bêtad-ribofuranosylbenzimidazole inhibe la protéine kinase associée au facteur de transcription IIH. J Biol Chem 270:23922-23925.

Résumé / Texte intégral GRATUIT

Yen J, Sagesse RM, Tratner I, Verma IM (1991) Une autre forme épissée de FosB est un régulateur négatif de l'activation de la transcription et de la transformation par les protéines Fos. Proc Natl Acad Sci États-Unis 88:5077-5081.

Résumé / Texte intégral GRATUIT

Yin X, Jedrzejewski PT, Jiang JX (2000) La caséine kinase II phosphoryle la connexine 45.6 de la lentille et participe à sa dégradation. J Biol Chem 275:6850-6856.

Résumé / Texte intégral GRATUIT

Yoza BK, JW Brooks, SB Mizel (1992) Induction de composants du facteur de transcription AP-1 au cours de l'activation des cellules T par l'interleukine 1 et les esters de phorbol. Différence de croissance cellulaire 3:677-684.

Abstrait

Yu S, Wang H, Davis A, Ahmed K (2001) Conséquences de la signalisation CK2 vers la matrice nucléaire. Mol Cell Biochem 227:67-71.

CrossRefMedline

Yu S, Davis AT, Guo C, JE vert, Ahmed K (1999) Ciblage différentiel de la protéine kinase CK2 sur la matrice nucléaire lors d'une surexpression transitoire de ses sous-unités. J Cell Biochem 74:127-134.

CrossRefMedline

Zachariou V, CA Bolanos, DE Selley, D. Theobald, député de Cassidy, Kelz MB, T Shaw-Lutchmann, Berton O, LJ Sim-Selley, RJ DiLeone, Kumar A, Nestler EJ (2006) ΔFosB: un rôle essentiel pour ΔFosB dans le noyau accumbens dans l’action de la morphine. Nat Neurosci 9:205-211.

CrossRefMedline

Articles citant cet article

  • Les réponses comportementales et structurelles à la cocaïne chronique nécessitent une boucle feedforward impliquant la protéine {Delta} FosB et la protéine dépendante du calcium / calmoduline dans la coquille du noyau d'Accumbens Journal of Neuroscience, 6 March 2013, 33(10):4295-4307
  • Surexpression striatale de {Delta} FosB reproduit des mouvements involontaires chroniques induits par la lévodopa Journal of Neuroscience, 26 mai 2010, 30(21):7335-7343
  • Abstrait
  • Texte intégral
  • Texte intégral (PDF)
  • Abstrait
  • Texte intégral
  • Texte intégral (PDF)
  • Abstrait
  • Texte intégral
  • Texte intégral (PDF)
  • Abstrait
  • Texte intégral
  • Texte intégral (PDF)
  • Mécanismes transcriptionnels de la dépendance: rôle de {Delta} FosB Transactions philosophiques de la Royal Society B: Sciences biologiques, 12 Octobre 2008, 363(1507):3245-3255
  • Vulnérabilité persistante au rétablissement du comportement de recherche de méthamphétamine chez des souris mutantes du facteur neurotrophique dérivé de lignées cellulaires gliales Le journal FASEB, 1 Juillet 2007, 21(9):1994-2004
  • Le Facteur De Transcription Activateur Protéine-1 Dans La Carcinogenèse De L'épithélium Respiratoire Recherche sur le cancer moléculaire, 1 Février 2007, 5(2):109-120