Le facteur de réponse sérique favorise la résilience au stress social chronique grâce à l'induction de DeltaFosB. (2010)

COMMENTAIRES: Bien que le stress, les drogues d'abus et certaines récompenses naturelles déclenchent une accumulation de DeltaFosB, le stress active différentes cellules en aval et, plus tard, différents récepteurs et gènes. En d’autres termes, la dépendance et la résistance au stress reposent sur des mécanismes fondamentalement différents

ÉTUDE COMPLETE

J Neurosci. 2010 oct. 27; 30 (43): 14585-92.

Vialou V, Maze I, Renthal W, LaPlant QC, Watts EL, Mouzon E, Ghose S, Tamminga CA, Nestler EJ.

Source

Fishberg Department of Neuroscience, École de médecine du Mont Sinaï, New York, New York 10029, États-Unis.

Abstrait

Les mécanismes moléculaires sous-jacents aux adaptations neuronales induites par le stress et les médicaments ne sont pas complètement compris. Une molécule impliquée dans de telles adaptations est ΔFosB, un facteur de transcription qui s’accumule dans le noyau du rongeur accumbens (NAc), une région clé de la récompense du cerveau, en réponse à un stress chronique ou à une exposition répétée à des drogues abusives. TLes mécanismes de transcription en amont contrôlant l'induction de ΔFosB par ces stimuli environnementaux restent insaisissables. Ici, nous identifions le facteur de transcription dépendant de l'activité, le facteur de réponse sérique (SRF), en tant que nouveau médiateur en amont du stress, mais pas de cocaïne-, ΔFosB induit. Le SRF est régulé négativement dans le NAc de patients humains déprimés et de souris exposées de manière chronique au stress de la défaite sociale. Cette régulation à la baisse de la SRF est absente chez les animaux résilients. Par l'utilisation de la mutagenèse inductible, nous montrons que l'induction de ΔFosB induite par le stress, qui survient principalement chez les souris résilientes, dépend de l'expression du SRF dans cette région du cerveau.. En outre, la suppression génétique spécifique de NAF de NAc favorise une variété de phénotypes prodepressants et analogues à l'anxiété et rend les animaux plus sensibles aux effets délétères du stress chronique. En revanche, nous démontrons que le SRF ne joue pas de rôle dans l'accumulation de ΔFosB dans le NAc en réponse à une exposition chronique à la cocaïne. En outre, l'inactivation spécifique de NAF spécifique au NAc n'a aucun effet sur les comportements induits par la cocaïne, ce qui indique que le stress de défaite sociale chronique et l'exposition répétée à la cocaïne régulent l'accumulation de ΔFosB et la sensibilité comportementale par le biais de mécanismes indépendants.

Introduction

Le noyau accumbens (NAc), une région clé de la récompense cérébrale, est important pour intégrer les entrées sensorielles et cognitives qui conduisent à des comportements pertinents sur le plan de la motivation en réponse à des stimuli environnementaux (Nestler et Carlezon, 2006; Sesack et Grace, 2010). Le NAc a également été impliqué dans des anomalies comportementales associées à la toxicomanie et à la dépression. En conséquence, il a été démontré que le ciblage de la NAc avec une stimulation cérébrale profonde atténue les comportements analogues à la dépression et à la dépendance chez l'homme et les rongeurs (Schlaepfer et al., 2008; Vassoler et al., 2008; Heinze et al., 2009, 2009 et Kuhn et al., XNUMX).

L'exposition répétée à des drogues d'abus ou de stress induit une modification des profils d'expression des gènes dans l'ANc, potentiellement à l'origine de la chronicité de la dépendance et de la dépression (Berton et coll., 2006; Krishnan et coll., 2007; Maze et coll., 2010; Vialou et coll. ., 2010). Fait intéressant, le facteur de transcription ΔFosB, un produit d’épissage du gène fosB, s’accumule dans le NAc en réponse à une exposition répétée à un médicament ou au stress (Nestler, 2008; Perrotti et al., 2008; Vialou et al., 2010). ΔFosB a été proposé comme commutateur moléculaire potentiel guidant la transition de la consommation de drogues à usage récréatif à un état de dépendance chronique (Nestler et al., 1999; McClung et al., 2004; Renthal et al., 2009), à mesure que son accumulation s'accroît. des réponses enrichissantes à plusieurs drogues d’abus. Plus récemment, le rôle de l'induction de ΔFosB dans l'ANc après un stress de défaite sociale chronique (Nikulina et al., 2008; Vialou et al., 2010) a été élucidé: ΔFosB favorise les réponses actives aux stimuli stressants et augmente la résilience. Bien que l'induction de ΔFosB se produise de manière dépendante du stimulus, les mécanismes responsables de l'accumulation de ΔFosB induite par le médicament et le stress dans NAc restent inconnus.

Le facteur de réponse sérique (SRF) est un facteur de transcription nécessaire à l'activation transcriptionnelle dépendante de l'activité de plusieurs gènes précoces immédiats, notamment c-fos, fosb, Egr1 et Arc (Knöll et Nordheim, 2009). Des études récentes ont démontré les effets de SRF sur les propriétés morphologiques et cytoarchitecturales des neurones, y compris la régulation de l'activité synaptique et la formation de circuits dans le cerveau adulte (Knöll et Nordheim, 2009). Ces résultats nous ont incités à rechercher si le SRF est fonctionnellement régulé par une exposition chronique à des drogues d'abus ou de stress, ainsi que l'impact potentiel d'une telle régulation sur l'induction de ΔFosB dans ces conditions.

Ici, nous décrivons un nouveau mécanisme par lequel la régulation à la baisse du SRF dans NAc favorise les phénotypes prodépresseurs et anxiogènes, augmentant finalement la vulnérabilité d'un animal aux effets délétères du stress chronique.. Ces effets sont médiés, en partie, par la perte de l'induction ΔFosB dans NAc des animaux stressés. Les diminutions observées de l'expression de SRF et ΔFosB dans les tissus NAc post-mortem obtenus de patients déprimés confirment la pertinence de nos résultats pour la dépression humaine. Il est intéressant de noter que ce mécanisme contrôlant l'accumulation de ΔFosB semble être spécifique au stress: l'exposition chronique à la cocaïne n'a aucun effet sur l'expression du SRF, la suppression du SRF du NAc n'a aucun impact sur l'accumulation de ΔFosB après une exposition chronique à la cocaïne, et une telle suppression du SRF n'a aucun effet sur la cocaïne. comportements induits. Cette nouvelle interaction entre SRF et ΔFosB, dans le contexte du stress, peut représenter un mécanisme homéostatique important régulant la sensibilité d'un individu au stress chronique.

Matériels et méthodes

Animaux

Des souris mâles C57BL / 6J âgées de huit semaines (laboratoire Jackson) ont été utilisées dans toutes les expériences comportementales et biochimiques. Tous les animaux ont été habitués à l'animalerie pendant au moins 1 semaine avant les manipulations expérimentales et ont été maintenus à 23 – 25 ° C selon un cycle lumière / obscurité 12 h (la lumière est allumée de 7 AM à 00: 7 PM) avec ad libitum. accès à la nourriture et à l'eau. Les expériences ont été menées conformément aux directives de la Society for Neuroscience et du comité institutionnel de protection et d'utilisation des animaux de la Mount Sinai School of Medicine.

Pour les expériences sur la cocaïne [Western blot et immunoprécipitation quantitative de la chromatine (ChIP)], des souris mâles C8BL / 10J âgées de 57 à 6 âgées de la semaine ont été utilisées. Les animaux ont reçu sept injections intrapéritonéales quotidiennes de solution saline ou de cocaïne (20 en mg / kg cocaïne-HCl; Sigma). Les souris ont été utilisées 24 h après le traitement final. Pour les expériences comportementales, les souris ont été hébergées séparément et ont été traitées par 10 en mg / kg (sensibilisation locomotrice) ou par 7.5 en mg / kg (préférence de lieu conditionné) cocaïne-HCl par voie intrapéritonéale, comme décrit ci-dessous.

Les souris Srffl / fl ont été générées comme décrit précédemment (Ramanan et al., 2005). L'inactivation stéréotaxique et la surexpression virale subséquente de la protéine recombinase Cre (Cre) fusionnée à la protéine fluorescente verte (GFP) utilisant des vecteurs du virus adéno-associé (AAV) ont permis de neutraliser spécifiquement la NAc de Srf. Un Cre non supprimant a été utilisé. L'AAV-GFP a été injecté à la place de l'AAV-Cre-GFP chez des souris Srffl / fl en tant que témoin. En bref, les souris ont été anesthésiées en utilisant un mélange de kétamine (10 mg / kg) et de xylazine (10 mg / kg), avec les coordonnées stéréotaxiques suivantes utilisées pour la délivrance virale: + 1.6 (antérieur / postérieur), + 1.5 (latéral), - 4.4 (dorsal / ventral) à un angle de 10 ° par rapport à la ligne médiane (par rapport au bregma). Un total de 0.5 μl de virus purifié a été administré bilatéralement sur une période 5 min (0.1 μl / min), suivi de 5 min de repos. Les souris ont été testées 2 plusieurs semaines après la chirurgie, lorsque l'expression virale était maximale, et les sites d'injection virale ont été confirmés pour tous les animaux à l'aide de méthodes histologiques standard. L'efficacité de l'expression de Cre à médiation virale a été validée par immunohistochimie et par PCR transcriptase inverse pour Srf réalisée sur des poinçons de NAc microdissectés provenant d'animaux ayant reçu AAV-Cre-GFP et AAV-GFP dans la NAc. Les virus AAV-GFP et AAV-Cre-GFP ont été générés comme décrit précédemment (Maze et al., 2010).

Procédures comportementales

Défaite sociale stress.

Les souris C57BL / 6J ont été soumises à un stress de défaite sociale chronique pendant 10 jours consécutifs, comme décrit précédemment (Berton et al., 2006; Krishnan et al., 2007; Vialou et al., 2010). En bref, chaque souris a été exposée à une souris reproductrice retraitée mâle CD1, agressive et inconnue, pendant 5 min par jour. Suite à une interaction directe avec l'agresseur CD1, les animaux ont ensuite été placés dans un compartiment adjacent de la même cage pour le prochain 24 h avec un contact sensoriel mais pas physique. Les animaux témoins ont été hébergés dans des cages équivalentes mais avec des membres de la même souche. Les tests d’interaction sociale ont été effectués 24 h après le dernier jour de la défaite.

L'évitement social d'une souris mâle CD1 inconnue a été évalué selon des protocoles publiés (Berton et al., 2006; Krishnan et al., 2007; Vialou et al., 2010). La souris expérimentale a d'abord été introduite dans un champ ouvert contenant une cage en treillis métallique vide pendant 2.5 min. Au cours d'une deuxième session, une souris mâle CD1 inconnue a été introduite dans la cage câblée. Le temps passé dans la zone d'interaction (un couloir de 8 cm de large entourant la cage) a été mesuré. La ségrégation des souris vaincues en sous-populations sensibles et résilientes a été réalisée comme décrit précédemment (Krishnan et al., 2007; Vialou et al., 2010). Étant donné que la majorité des souris témoins passaient plus de temps à interagir avec une cible sociale qu'avec une enceinte cible vide, un rapport d'interaction de 100 (temps égal passé dans la zone d'interaction en présence par rapport à l'absence d'une cible sociale) a été défini comme seuil. Les souris avec des scores <100 ont été étiquetées comme sensibles, et celles avec des scores ≥ 100 ont été étiquetées comme résilientes. Des analyses comportementales, biochimiques et électrophysiologiques approfondies appuient la validité de ces sous-populations distinctes sensibles et résilientes (Krishnan et al., 2007; Wilkinson et al., 2009; Vialou et al., 2010).

Pour examiner la vulnérabilité des souris Srffl / fl au stress de la défaite sociale, les souris, injectées bilatéralement avec AAV-GFP ou AAV-Cre-GFP, ont été soumises à trois défaites consécutives le même jour et ensuite testées pour une interaction sociale 24 h plus tard. Cette procédure de défaite sous-maximale a déjà été validée pour révéler des phénotypes de prosusceptibilité suite à des manipulations génétiques (Krishnan et al., 2007; Vialou et al., 2010).

Impuissance acquise.

Des souris Srffl / fl surexprimant AAV-GFP ou AAV-Cre-GFP ont été soumises à la procédure d’impuissance apprise comme décrit précédemment (Berton et al., 2007). En bref, les souris ont été exposées à des chocs intermittents et inévitables au niveau du pied pendant 1 h tous les jours consécutifs 2 (0.45 mA, durée de 5). Le jour du test, les souris ont été réintroduites dans la boîte pour des essais d'évasion consécutifs 15. Au cours de chaque essai, un choc continu a été administré et les souris ont eu la possibilité de s'échapper en pénétrant dans le compartiment adjacent non électrifié. Suite à une évasion réussie, la porte s'est automatiquement fermée et la latence d'évacuation a été enregistrée. Lorsque les souris ne se sont pas échappées à l’intérieur de 25, l’essai a pris fin et a été considéré comme un échec. Des études antérieures ont montré que l’expression virale dans NAc et d’autres régions n’a pas d’effet sur le comportement de fuite initial en l'absence de stress (Newton et coll., 2002; Berton et coll., 2007).

Sensibilisation locomotrice.

Deux semaines après les injections intra-NAc d'AAV-GFP ou d'AAV-Cre-GFP, des souris Srffl / fl ont été soumises à une sensibilisation locomotrice. Les souris ont été habituées à l'arène locomotrice pendant 30 minutes par jour pendant 4 jours. Après l'accoutumance, les animaux ont reçu une injection intrapéritonéale de 10 mg / kg de cocaïne-HCl et placés dans les boîtes locomotrices. Les activités locomotrices des animaux ont été enregistrées en utilisant un système de photobeam (San Diego Instruments) comme des pauses de faisceau ambulatoires pendant 30 minutes par jour. La sensibilisation locomotrice a été enregistrée sur une période de 6 jours.

Préférence de lieu conditionné.

La procédure de conditionnement des lieux a été réalisée comme décrit précédemment (Maze et al., 2010), avec les modifications suivantes. En bref, 18 jours après des perfusions intra-NAc d'AAV-GFP ou d'AAV-Cre-GFP chez des souris Srffl / fl, les animaux ont été placés dans les chambres de conditionnement, qui consistaient en trois environnements contextuellement distincts. Les souris affichant une préférence significative pour l'une ou l'autre des deux chambres de conditionnement ont été exclues de l'étude (<10% de tous les animaux). Les groupes de conditionnement ont été en outre équilibrés pour s'ajuster à tout biais de chambre qui pourrait encore exister. Les jours suivants, les animaux ont été injectés avec une solution saline et confinés dans une chambre l'après-midi pendant 30 min, puis injectés avec de la cocaïne (7.5 mg / kg, ip) et confinés pendant 30 min dans l'autre chambre le jour suivant, soit un total de deux cycles de formation d'association par traitement (deux appariements salins et deux cocaïne). Le jour du test, les souris ont été replacées dans l'appareil sans traitement pendant 20 min et testées pour évaluer la préférence latérale. Les réponses locomotrices à la cocaïne ont été évaluées via des interruptions de faisceau dans les chambres appariées à la cocaïne pour garantir l'efficacité du traitement médicamenteux. Pour tous les groupes, la locomotion de base en réponse à une solution saline a été évaluée pour s'assurer que la locomotion n'était pas affectée par le traitement viral.

Autres tests de comportement.

Les souris Srffl / fl ont été testées dans des tests en champ libre, en lumière / obscure et en natation forcée sur la base des protocoles publiés (Vialou et al., 2010). L'activité des souris en champ libre a été enregistrée pour 5 min à l'aide d'un système de suivi vidéo (Ethovision) dans des conditions de lumière rouge. Pour le test clair / sombre, les souris ont été autorisées à explorer librement une boîte à deux chambres composée d'une grande arène illuminée connectée à une plus petite arène fermée. Les souris ont été testées pendant une période de 5 min pour évaluer le temps passé dans l'une ou l'autre enceinte. Dans les tests en champ libre et en lumière / obscurité, le temps passé respectivement dans le centre et dans l’arène de lumière a été évalué en tant qu’indice inverse des réponses liées à l’anxiété. Un test de nage forcée 1 d a été réalisé pendant une période de 5 min. L'augmentation du temps d'immobilité au cours du test de nage forcée a été interprétée comme un comportement semblable à celui d'un prodepressant. Le test de nage forcée 1 d a été largement utilisé chez la souris et a été validé comme mesure de validité prédictive, dans la mesure où les traitements antidépresseurs réduisent les temps d'immobilité.

Immunohistochimie

Les souris Srffl / fl ont été anesthésiées et perfusées par voie intracardique avec 4% paraformaldéhyde / PBS. Les cerveaux ont été prélevés et cryoprotégés dans 30% saccharose / PBS. Des coupes coronales (30, um) ont été coupées sur un microtome de congélation et traitées pour des analyses immunohistochimiques. La validation de l'inhibition de Srffl / fl a été réalisée en utilisant un anticorps polyclonal dirigé contre le SRF (1 / 2000; Santa Cruz Biotechnology). L'expression de Cre a été confirmée via l'expression de GFP (poulet polyclonal, 1 / 8000, Aves Labs) dans des cerveaux disséqués, le Cre étant fusionné à la GFP. Pour quantifier l'induction de ΔFosB après le stress de la défaite sociale chez des souris Srffl / fl knock-out, ΔFosB a été détectée à l'aide d'un anticorps polyclonal de lapin dirigé contre la région N-terminale de la protéine (1 / 1000; Santa Cruz Biotechnology). Les images ont été prises avec un microscope confocal (grossissement 20 ×; Zeiss). Le nombre de cellules immuno-positives GFP comptées comme négatives et positives pour l'immunoréactivité à ΔFosB a été quantifié sur plusieurs images pour chaque animal, les valeurs moyennes étant ensuite calculées pour chaque animal. Chaque animal était considéré comme une observation individuelle pour l'analyse statistique.

Tissu NAc humain post mortem

Le tissu cérébral post-mortem humain a été obtenu à partir de la Dallas Brain Collection, où le tissu est collecté auprès du Dallas Medical Examiner's Office et du programme de greffe de tissus de l'Université du Texas (UT) Southwestern après le consentement du plus proche parent. Le tissu a été analysé à la fois chez les hommes et les femmes appariés pour l'âge, l'intervalle post-mortem, le nombre d'intégrité de l'ARN (RIN) et le pH. Des facteurs agonaux spécifiques, notamment le coma, l'hypoxie, la pyrexie, les convulsions, la déshydratation, l'hypoglycémie, la défaillance de plusieurs organes et l'ingestion de substances neurotoxiques au moment du décès influencent l'intégrité de l'ARN dans les tissus cérébraux post-mortem (Tomita et al., 2004). Nous avons utilisé une échelle de facteur agonal (AFS) pour caractériser les échantillons de tissus sur chacune de ces huit conditions. L'absence d'un facteur agonal a reçu un score de 0 et sa présence a été notée comme 1 pour fournir un score AFS total entre 0 et 8. Le tissu avec des scores agonaux de 0 ou 1 reflète des échantillons de bonne qualité; les données démographiques des cas sont présentées dans le tableau 1. La qualité exceptionnelle des tissus a été confirmée par des valeurs RIN élevées. Les cas ont été soumis à une dissection standard avant la congélation instantanée dans l'isopentane -40 ° C et le stockage à -80 ° C; une dissection supplémentaire de NAc a été réalisée sur du tissu congelé. Le comité d'examen institutionnel de l'UT Southwestern a examiné et approuvé la collecte de ce tissu à des fins de recherche. Une entrevue directe avec un informateur a été réalisée pour chaque cas de dépression à une date ultérieure, où les informations concernant la maladie du cas ont été documentées; un diagnostic consensuel de trouble dépressif majeur a été posé en utilisant les critères du DSM-IV par deux psychiatres de recherche. Aucun des cas inclus dans cette étude ne présentait de tests de toxicologie sanguine positifs pour les drogues abusives, l'alcool ou les médicaments sur ordonnance autres que les antidépresseurs. Malgré un traitement antidépresseur, tous les sujets étaient cliniquement déprimés au moment du décès. Des échantillons de tissus ont été distribués en aveugle pour analyse.

Tableau 1.

Données démographiques pour l'étude de l'homme post mortem

Western blot

Les échantillons d'anticorps humains et de souris ont été traités comme décrit précédemment (Maze et al., 2010). Le tissu congelé a été traité par ultrasons dans un tampon de lyse 5 mM HEPES contenant 1% SDS avec protéase (Roche) et inhibiteurs de la phosphatase (Sigma). Les concentrations de protéines ont été déterminées par le dosage de protéines Dc (Bio-Rad). Des quantités égales d'échantillons de protéines ont été soumises à SDS-PAGE et Western blot. Les transferts Western ont été sondés en utilisant un anticorps anti-SRF (1 / 2000; Santa Cruz Biotechnology) ou GAPDH (1 / 1500; Abcam), puis ont été scannés et quantifiés à l'aide du système d'imagerie Odyssey (Licor).

Isolement de l'ARN et PCR quantitative

L'isolement de l'ARN, la PCR quantitative (qPCR) et l'analyse des données ont été effectués comme décrit précédemment (Maze et al., 2010; Vialou et al., 2010). En bref, l'ARN a été isolé avec le réactif TriZol (Invitrogen) et a été ensuite purifié avec les micro-kits RNAeasy de Qiagen. Il a été déterminé que tous les échantillons d’ARN avaient des valeurs 260 / 280 et 260 / 230 ≥1.8. La transcription inverse a été réalisée avec iScript (Bio-Rad). La qPCR en utilisant SYBR green (Quanta) a été réalisée avec un système PCR PCR 7900HT Applied Biosystems avec les paramètres de cycle suivants: 2 min à 95 ° C; Cycles 40 de 95 ° C pour 15, 59 ° C pour 30, 72 ° C pour 33; et le chauffage gradué à 95 ° C pour générer des courbes de dissociation pour la confirmation de produits PCR simples. Les données ont été analysées en comparant les valeurs C (t) de la condition de traitement (souris contrôlées vs souris sensibles ou résilientes, ou contrôles humains vs patients déprimés) avec la méthode ΔΔC (t) (Tsankova et al., 2006). Amorces ΔFosB qPCR: avant, AGGCAGAGCTGGAGTCGGAGAT et inverse, GCCGAGGACTTGAACTTCACTCG.

Puce

La puce a été réalisée comme décrit précédemment (Maze et al., 2010) sur des poinçons NAAC bilatéraux groupés provenant de souris témoins, sensibles et résilientes (quatre poinçons 14 / souris) 1 h après la dernière expérience de défaite et de solutions salines et cocaïne. animaux traités 24 h après le traitement final. Le tissu était réticulé dans 1% formaldéhyde. La fixation a ensuite été interrompue par une application de glycine et le tissu a été lavé et conservé à -80 ° C jusqu'à son utilisation. La chromatine cisaillée a été incubée pendant une nuit avec un anticorps anti-SRF (Santa Cruz Biotechnology) préalablement lié à des billes magnétiques (Dynabeads M-280; Invitrogen). Après réticulation inverse et purification de l'ADN, la liaison de SRF au promoteur de fosb a été déterminée par qPCR en utilisant des amorces couvrant une région du promoteur de fosb contenant deux sites de liaison d'élément de réponse sérique. Les pulldowns de SRF étaient significativement enrichis comparés aux contrôles sans anticorps. Amorces promotrices du gène fosb de souris: avant, CCCTCTGACGTAATTGCTAGG et inverse, ACCTCCCAAACTCTCCCTTC.

analyses statistiques

Des ANOVA à un facteur ont été utilisés pour comparer les moyennes entre les souris témoins, sensibles et résilientes dans les analyses biochimiques et comportementales. Les ANOVA bidirectionnels ont été utilisés pour comparer l'induction de ΔFosB par la défaite sociale chez des souris knock-out locales Srf, ainsi que pour comparer l'effet de knock-out Srf dans les protocoles d'impuissance apprise et de sensibilisation locomotrice. Les tests t de Student ont été utilisés pour comparer les moyennes de l'effet de knock-out Srf sur l'induction ΔFosB, et entre les groupes dans le tissu post mortem humain et l'analyse ChIP de souris. Les différences entre les conditions expérimentales ont été considérées comme statistiquement significatives lorsque p ≤ 0.05.

Resultats

Expression de SRF et ΔFosB dans la dépression humaine et chez des souris socialement vaincues

Pour explorer un rôle potentiel de SRF dans le développement de comportements dépressifs, nous avons d'abord évalué l'expression de la protéine SRF dans NAc de patients humains dépressifs post-mortem. Les sujets déprimés présentaient des niveaux de SRF significativement réduits dans NAc par rapport à leurs témoins de même âge (t (19) = 1.9; p <0.05) (Fig. 1A). Compte tenu du rôle de SRF dans la régulation de l'expression génique précoce immédiate dépendante de l'activité (Ramanan et al., 2005), nous avons émis l'hypothèse que la SRF pourrait être impliquée dans le contrôle de l'expression de ΔFosB dans cette région du cerveau. À l'appui de cette hypothèse, nous avons observé que les niveaux d'ARNm de Δfosb étaient également significativement réduits dans NAc des humains déprimés (t (16) = 1.8; p <0.05) (Fig. 1B). Ceci est cohérent avec les découvertes récentes de diminution des niveaux de protéine ΔFosB dans ces conditions également (Vialou et al., 2010).

Figure 1.

La répression de SRF induite par le stress chronique est en corrélation avec une diminution de la transcription de ΔFosB dans NAc. Les patients déprimés humains A, B, post-mortem présentent des niveaux réduits de protéine SRF (n = 10 / groupe; A) et d'expression d'ARNm de Δfosb dans NAc (n = 8 / groupe; B). C, Les souris soumises à un stress de défaite sociale chronique (10 jours) ont été regroupées en sous-populations sensibles et résilientes. D, Le stress de défaite sociale chronique réduit les niveaux de protéines SRF dans NAc des souris sensibles, mais pas des souris résilientes, par rapport aux témoins 24 h après le test d'interaction sociale montré dans C.E, les niveaux d'ARNm d'ΔfosB dans NAc sont inchangés chez les souris sensibles, mais de manière significative régulée à la hausse chez les animaux résilients (n = 7–15 / groupe). La protéine F, SRF affiche une liaison accrue au promoteur du gène fosb après un stress de défaite sociale chronique uniquement chez les souris résilientes et non sensibles (n = 5 / groupe). Les données affichées sont exprimées en moyenne ± SEM (représentées sous forme de barres d'erreur). Con., Contrôle; Dep., Déprimé; Sus., Sensible; Rés., Résilient. * p <0.05 par rapport au contrôle; *** p <0.001 par rapport au contrôle; #p <0.05 versus sensible; ## p <0.01 versus sensible; ### p <0.001 versus sensible.

Pour étendre ces résultats, nous avons utilisé le protocole de stress de défaite sociale chronique chez la souris. Deux groupes distincts de souris vaincues, sensibles et résilientes, étaient apparents (Krishnan et al., 2007) sur la base d'une mesure d'évitement social, dans laquelle les animaux sensibles présentaient une interaction sociale significativement réduite par rapport aux animaux témoins et résilients (F (2,23, 157.2) = 0.001; p <0.001; tests t avec une correction de Bonferroni, sensible vs contrôle, p <0.05; résilient vs contrôle, p <0.01; résilient vs sensible, p <1) (Fig.2,32C). Deux jours après le dernier épisode de défaite, des souris témoins sensibles, résilientes et non défaites ont été analysées pour l'expression de SRF dans NAc. À l'instar des résultats dans la dépression humaine, les niveaux de protéines SRF étaient significativement réduits dans NAc des souris sensibles par rapport aux témoins, tandis que les niveaux de SRF n'étaient pas affectés dans NAc des souris résilientes (F (4.7) = 0.05; p <0.05; tests t avec un Correction de Bonferroni, sensible vs témoin, p <0.05; résilient vs sensible, p <1) (Fig.XNUMXD).

Ensuite, nous avons examiné l'expression de l'ARNm de Δfosb dans NAc de ces trois groupes d'animaux et observé une augmentation significative de l'expression de Δfosb chez les animaux résilients uniquement, avec une tendance mais pas d'augmentation significative observée chez les souris sensibles (t (14) = 2.1; p <0.05 ) (Fig. 1E). Pour étudier davantage les interactions possibles entre les niveaux de SRF et la transcription Δfosb, nous avons utilisé ChIP pour examiner si la liaison de SRF au promoteur du gène fosb était modifiée après un stress de défaite sociale chronique dans des cohortes distinctes de souris sensibles et résilientes. Les animaux résilients présentaient une liaison SRF significativement améliorée au promoteur fosb dans NAc par rapport aux témoins (t (8) = 2.1; p <0.05) ainsi que par rapport aux souris sensibles (t (8) = 2.0; p <0.05). Aucune différence n'a été observée entre les contrôles et les souris sensibles, reflétant probablement le manque d'induction de SRF chez les souris sensibles (Fig. 1F).

Pour confirmer le rôle de SRF dans la régulation de ΔFosB suite à un stress de défaite sociale chronique, des souris Srffl / fl ont été utilisées pour examiner l'effet d'une délétion sélective de SRF du NAc sur l'induction de stress de ΔFosB. Des souris Srffl / fl ont reçu une injection stéréotaxique intra-NAc avec des vecteurs AAV exprimant la GFP ou Cre-GFP. Un knock-out spécifique de NAc de SRF induit par AAV-Cre-GFP a été confirmé par immunohistochimie (figure 2A). En effet, il n'y avait pas de chevauchement entre la coloration SRF et l'expression de Cre, démontrant l'efficacité du knock-out. Dans les poinçons NAc microdissectés, nous avons détecté une diminution significative de 50% des niveaux de protéines SRF (t (11) = 4.3; p <0.001). L'ampleur reflète probablement le fait qu'une fraction de tissu dans de telles microdissections n'est pas infectée par un virus.

Figure 2.

SRF médie l'induction ΔFosB par le stress chronique de défaite sociale. A, l'injection d'AAV-Cre-GFP dans le NAc de souris Srffl / fl entraîne le knock-out de la protéine SRF dans les neurones exprimant Cre. L'injection d'AAV-GFP était sans effet discernable. B, Un tel knock-out sélectif de SRF de la NAc bloque complètement l'induction de ΔFosB dans NAc suite à un stress chronique de défaite sociale (n = 4 / groupe). Les données affichées sont exprimées en moyenne ± SEM (représentées sous forme de barres d'erreur). * p <0.05 par rapport au contrôle AAV-GFP; ** p <0.01 par rapport à la défaite AAV-GFP.

Nous avons ensuite effectué une immunohistochimie quantitative pour ΔFosB dans NAc de souris Srffl / fl défaites injectées intra-NAc avec AAV-Cre-GFP ou AAV-GFP. Suite à un stress chronique de défaite sociale, l'expression de ΔFosB a été induite de manière significative dans NAc des animaux ayant reçu une injection d'AAV-GFP (virus × interaction traitement, F (1,12) = 6.4; tests t avec une correction de Bonferroni, contrôle vs défaite, p <0.05; AAV-Cre vs AAV-GFP, p <0.01). Cependant, cette induction n'a pas été observée chez les souris Srffl / fl recevant AAV-Cre-GFP (figure 2B), démontrant que l'induction ΔFosB dans NAc par un stress chronique nécessite SRF.

Le knock-out SRF dans NAc favorise des phénotypes analogues à la prodepression et à l'anxiété

Étant donné que l'induction de ΔFosB par un stress de défaite sociale chronique s'est avérée auparavant une médiation de la résilience (Vialou et al., 2010), nous avons émis l'hypothèse que la régulation à la baisse du SRF, et la perte résultante de l'induction de ΔFosB, chez les animaux sensibles peuvent représenter une adaptation négative qui rend finalement les animaux sont plus vulnérables aux effets délétères du stress. Pour tester cette hypothèse, nous avons induit une délétion locale spécifique à NAc du gène Srf chez des souris adultes Srffl / fl comme décrit ci-dessus, et les souris résultantes et leurs contrôles ont été testés dans une batterie de paradigmes comportementaux pour évaluer la dépression et l'anxiété de base. comme un comportement. La suppression locale de NAc de SRF a favorisé un effet de type prodépression tel que mesuré par le test de nage forcée (t (30) = 2.5; p <0.05), ainsi qu'un effet anxiogène mesuré en champ libre (t (38) = 1.9; p <0.05) et tests lumière / obscurité (t (8) = 1.9; p <0.05). Ainsi, les souris Srffl / fl recevant AAV-Cre-GFP dans le NAc ont présenté une latence réduite à l'immobilité dans le test de nage forcée, moins de temps au centre d'un champ ouvert et moins de temps dans le compartiment clair d'une boîte claire / sombre. par rapport aux animaux ayant reçu une injection d'AAV-GFP (Fig. 3A – C). Cependant, la suppression intra-NAc de SRF n'a pas modifié les niveaux de base de la locomotion, ce qui suggère que les effets comportementaux observés chez les animaux knock-out SRF n'étaient pas dus à des anomalies de l'activité locomotrice générale (Fig. 3D). Ces données sont intéressantes à la lumière des rapports précédents suggérant que, bien que ΔFosB dans NAc régule les comportements dépressifs, il ne semble pas être impliqué dans les réponses liées à l'anxiété (Vialou et al., 2010). Nos découvertes actuelles selon lesquelles la perte de SRF induit des réponses anxiogènes suggèrent qu'elle le fait via des cibles autres que ΔFosB.

Figure 3.

Le knock-out SRF de la NAc favorise les phénotypes de type prodépression et pro-anxiété. A – C, Knock-out sélectif de SRF à partir de la NAc, obtenu via l'injection d'AAV-Cre-GFP dans la NAc de souris Srffl / fl, réduit la latence à l'immobilité dans le test de nage forcée (n = 14-18 / groupe; A) et réduit le temps passé au centre et le temps passé dans le compartiment lumineux dans les tests en champ ouvert (B) et clair / sombre (C), respectivement (n = 5-15 / groupe). D, aucune différence dans l'activité locomotrice basale n'a été observée dans le champ ouvert des souris qui ont reçu des injections intra-NAc d'AAV-GFP ou d'AAV-Cre-GFP. E, F, susceptibilité accrue à l'impuissance acquise (n = 7–8 / groupe; E) et au stress de défaite sociale (n = 5–6 / groupe; F), mesurées respectivement par la latence pour s'échapper et le temps d'interaction sociale . Les données affichées sont exprimées en moyenne ± SEM (représentées sous forme de barres d'erreur). * p <0.05 contre GFP ou contre cible absent; ** p <0.01 par rapport à GFP; *** p <0.001 par rapport à la GFP.

Nous avons ensuite étudié si la suppression de SRF dans NAc augmente également la vulnérabilité d'un animal aux effets néfastes d'un stress répété. Des souris Srffl / fl, injectées avec soit AAV-Cre-GFP ou AAV-GFP dans le NAc, ont été examinées dans deux modèles de dépression, l'impuissance apprise et le stress de défaite sociale chronique. Dans l'impuissance apprise, les animaux Srffl / fl recevant AAV-Cre-GFP ont montré une latence accrue pour échapper à un choc du pied après une exposition préalable à un stress de choc inéluctable du pied (interaction traitement × essais, F (14,180) = 10.2; tests t avec une correction de Bonferroni, p <0.001; AAV-Cre vs AAV-GFP, p <0.01), indiquant une sensibilité accrue aux déficits comportementaux induits par le stress (Fig. 3E). De même, la suppression locale de SRF de NAc a également augmenté l'aversion sociale (t (10) = 1.8; p <0.05) par rapport aux animaux témoins injectés par AAV-GFP après un stress de défaite sociale chronique (figure 3F), un effet de type prodepression.

Absence d'implication du SRF dans l'induction du ΔFosB et dans les réponses comportementales à la cocaïne

Etant donné que le ΔFosB est également induit dans NAc en réponse à des drogues d'abus comme la cocaïne, il était intéressant d'examiner un rôle potentiel de la SRF dans l'action de la cocaïne. Contrairement au stress de défaite sociale chronique, une exposition répétée à la cocaïne n'a pas modifié l'expression de la protéine SRF dans NAc (t (14) = 0.8; p> 0.05) (Fig.4A) et n'a eu aucun effet sur la liaison de SRF au promoteur du gène fosB dans cette région du cerveau (t (4) = 0.7; p> 0.05) (figure 4B). Ceci suggère que, contrairement au stress, l'induction de ΔFosB après la cocaïne chronique n'est pas médiée par SRF. Nous avons testé cela directement en examinant si l'accumulation de ΔFosB après la cocaïne chronique est modifiée chez les animaux Srffl / fl recevant AAV-Cre-GFP par rapport à AAV-GFP dans NAc. Nous avons constaté que la délétion de SRF n'avait aucun effet sur l'accumulation de ΔFosB induite par la cocaïne dans cette région du cerveau (figure 4C).

Figure 4.

La perte de SRF n'a eu aucun effet sur l'induction par la cocaïne de comportements ΔFosB ou régulés par la cocaïne. L’exposition répétée à la cocaïne (7 d, 20 mg / kg cocaïne-HCl) n’a aucun effet sur l’expression de la protéine SRF dans NAc (A) ni sur la liaison du SRF au promoteur du gène fosB dans cette région du cerveau (B) 24 h après exposition au médicament (n = 5 / groupe). L'accumulation de C, ΔFosB, mesurée par immunocytochimie, à la suite d'une exposition chronique à la cocaïne n'est pas affectée par l'inactivation de SRF spécifique du NAc. D, E, suppression locale de SRF de la NAc n'a également aucun effet sur l'activité locomotrice après une injection de solution saline (d 1) sur l'activité locomotrice induite par la cocaïne et la sensibilisation (n = 8 / groupe) (d 1 – 7; D) ou sur la préférence de place conditionnée pour la cocaïne (n = 8 / groupe; E). Les données affichées sont exprimées en moyenne ± SEM (représentées par des barres d'erreur).

Pour faire suite à cette découverte surprenante, nous avons examiné si un knock-out sélectif de SRF de NAc modifie les réponses comportementales à la cocaïne. Conformément au manque de régulation de l'induction du ΔFosB par la cocaïne par le SRF, le knock-out spécifique aux NAc du SRF n'a eu aucun effet sur l'activité locomotrice induite par la cocaïne aiguë ou la sensibilisation locomotrice observée après des expositions répétées à la cocaïne (interaction traitement × temps, F (4,80) = 0.3; p> 0.05) (Fig.4D). De même, le knock-out spécifique aux NAc de SRF n'a eu aucun effet sur la préférence de place conditionnée à la cocaïne (t (14) = 0.1; p> 0.05) (figure 4E), ce qui fournit une mesure indirecte de la récompense de la cocaïne.

Discussion

Cette étude a identifié la SRF comme un nouveau médiateur en amont de ΔFosB dans le NAc après un stress de défaite sociale chronique, et implique la SRF dans le développement de comportements dépressifs et analogues à ceux de l’anxiété. Nous fournissons des preuves directes que le stress de défaite sociale chronique diminue les niveaux de PRS dans les animaux non susceptibles, mais non résilients, et que cette régulation à la baisse empêche l'induction de ΔFosB dans cette région du cerveau, ce qui est nécessaire pour lutter efficacement contre le stress chronique. c'est-à-dire la résilience (Vialou et al., 2010). Une réduction similaire de l’expression du SRF a été constatée dans le NAc d’êtres humains déprimés, l’expression de l’ARNm et de la protéine ΔFosB étant également réduite. En revanche, les niveaux de ΔFosB n'étaient pas réduits dans le NAc des souris sensibles, malgré une régulation à la baisse de SRF, ce qui implique d'autres mécanismes de transcription encore inconnus dans le contrôle de l'expression de ΔFosB. Un rôle causal pour le SRF dans la médiation de l'induction du ΔFosB dans le NAc après un stress chronique a été établi par l'utilisation d'une délétion génétique inductible du SRF de cette région du cerveau. L'analyse comportementale de souris avec cette désactivation de SRF spécifique à NAc implique également que SRF joue un rôle clé dans le développement de comportements à la fois basiques et de type anxiété induits par le stress. En revanche, la suppression des CRS n’a eu aucun effet sur l’induction du ΔFosB en réponse à l’administration chronique de cocaïne ou sur les effets comportementaux de la cocaïne. Ces résultats confirment le nouveau rôle spécifique du stimulus de la SRF dans la régulation de l'induction de ΔFosB et des réponses comportementales à des perturbations environnementales distinctes.

Il a déjà été démontré que la transcription médiée par le SRF répond à l’activité synaptique, largement déclenchée par une augmentation de l’afflux de calcium, ainsi qu’au renforcement de l’activité neurotrophique, en particulier dans le cas du facteur neurotrophique dérivé du cerveau (BDNF) (Bading et al., 1993; Xia et al., 1996; Johnson et al., 1997; Chang et al., 2004; Kalita et al., 2006; Knöll et Nordheim, 2009). Cela soulève la question intéressante de savoir pourquoi la SRF est régulée négativement chez les souris sensibles mais non résilientes après un stress de défaite sociale chronique. Cette régulation différentielle n’est probablement pas liée à la signalisation par la dopamine ou le BDNF, car les souris sensibles présentent des niveaux accrus de protéine BDNF et une signalisation en aval du BDNF dans la NAc, ainsi que des tirs en rafale améliorés des neurones dopaminergiques de la région tentralmentaire ventral (VTA), qui innervent la NAc. les animaux résilients présentent des niveaux normaux de signalisation par BDNF et de taux de déclenchement de la VTA (Krishnan et al., 2007). Une autre possibilité est que l'expression de SRF soit supprimée dans NAc en réponse à l'innervation glutamatergique modifiée de cette région cérébrale, ce qui, nous l'avons montré, est régulée de manière différenciée chez les souris sensibles par rapport aux souris résilientes (Vialou et al., 2010). Des travaux supplémentaires sont nécessaires pour étudier directement ce mécanisme et d’autres mécanismes possibles.

Des études récentes utilisant des méthodes à l'échelle du génome et d'autres méthodes suggèrent que ∼5 – 10% des gènes cibles de SRF dans les neurones sont des gènes précoces immédiats (Philippar et al., 2004; Ramanan et al., 2005; Etkin et al., 2006, 2009; Knöll et Nordheim, 2005). Ceci est cohérent avec nos données démontrant un rôle critique pour le SRF dans l'induction de ΔFosB, un produit tronqué du gène fosb immédiat précoce, par le stress chronique. De manière intéressante, de nombreux gènes cibles de SRF identifiés dans ces différentes études représentent également des cibles connues de ΔFosB dans NAc (Kumar et al., 2008; Renthal et al., 2009, 2010; Maze et al., 5). Parmi ces gènes couramment régulés, plusieurs sont connus pour réguler le cytosquelette neuronal (par exemple, Cdk2005, Arc et Actb). Ceci, à son tour, est cohérent avec les informations selon lesquelles la SRF influence la dynamique de l'actine et la motilité neuronale dans plusieurs types de cellules neuronales (Alberti et al., 2005; Ramanan et al., 2006; Knöll et al., 2010), alors que ΔFosB est connu pour affecter la croissance de la colonne vertébrale dendritique des neurones NAc (Maze et al., XNUMX). Ces paramètres fonctionnels communs peuvent refléter les effets concertés de la SRF, combinée à son induction de ΔFosB, agissant sur une série de gènes cibles communs pour influencer la morphologie neuronale et, finalement, le comportement complexe.

Il a également été démontré que le FRS joue un rôle crucial dans la régulation de la plasticité synaptique et de l’expression et du comportement des gènes dépendants de l’activité neuronale. Par exemple, la perte d'induction dépendante du SRF de gènes précoces immédiats en réponse à l'exploration volontaire d'un nouvel environnement ou à l'activation neuronale par convulsions électroconvulsives a été associée à une potentialisation altérée à long terme dans l'hippocampe de mutants Srf (Ramanan et autres). , 2005; Etkin et al., 2006). En outre, il a été prouvé que l'épuisement des CRS dans l'hippocampe provoque des déficits en dépression synaptique à long terme, une expression précoce immédiate des gènes induite par un contexte nouveau et une altération de l'accoutumance lors de l'exploration d'un nouvel environnement (Etkin et al., 2006). Ces données établissent l'importance du SRF dans la capacité d'un animal à s'adapter de manière appropriée aux perturbations environnementales, comme dans le cas précité de l'apprentissage de l'habituation à un nouvel environnement, ou, dans le cas de l'adaptation à des stimuli stressants négatifs, pour empêcher la propagation du stress. - des déficits comportementaux induits, comme dans notre présente étude. Ainsi, nous observons que les animaux présentant des déficits dans l'expression de SRF, soit en réponse au stress de défaite sociale chez les individus sensibles ou par renversement direct de SRF, présentent des comportements dépressifs et anxieux accrus. Étant donné que les sujets humains déprimés présentent également une diminution des niveaux de SRF dans la NAc, il est concevable que la SRF joue un rôle fondamental dans la régulation de la capacité d'un individu à s'adapter positivement aux stimuli environnementaux négatifs, en partie grâce à la régulation de l'expression de ΔFosB dans la NAc.

MÉCANISMES DIFFÉRENTS: ADDICTION VS RÉSISTANCE AU STRESS

Une découverte surprenante de la présente étude est que, bien que le SRF soit requis pour l’accumulation de ΔFosB dans le NAc en réponse à un stress chronique, il n’est pas nécessaire pour l’induction de ΔFosB dans la même région du cerveau en réponse à la cocaïne chronique. De même, le FRS n'est pas requis pour les réponses comportementales normales au médicament. Ces données montrent que, malgré le fait que ΔFosB soit induit dans NAc en réponse à de nombreux types de stimuli (Nestler et al., 1999; Nestler, 2008), il semble exister des voies moléculaires distinctes menant à l’induction de ΔFosB. Une explication possible de ces résultats est le fait que certains types de cellules présentent partiellement une accumulation de ΔFosB en réponse au stress par rapport à la cocaïne. Le stress chronique induit ΔFosB à peu près également au sein des deux principales sous-populations de neurones épineux du milieu NAc, ceux exprimant principalement les récepteurs dopaminergiques D1 versus D2, tandis que la cocaïne chronique induit ΔFosB principalement dans les neurones D1 + (Kelz et al., 1999 et autres). . Ainsi, il est possible que les voies dépendantes du SRF soient importantes pour l’induction de ΔFosB dans les neurones D2004 +.. Toutefois, cela n’expliquerait pas la perte complète de l’induction du ΔFosB chez les souris à élimination du gène SRF après un stress chronique, car l’induction se produit dans les deux sous-types de neurones. Une explication alternative est que le stress chronique et la cocaïne chronique empiètent sur des cascades de signalisation intracellulaires distinctes, en raison de leurs modes d'action distincts sur les neurones NAc, le stress chronique fonctionnant peut-être par une modification de la transmission glutamatergique, comme indiqué précédemment, et une cocaïne chronique agissant principalement par le biais de D1. signalisation du récepteur (Nestler, 2008). Une autre possibilité est que l'induction de ΔFosB par le stress chronique versus la cocaïne chronique dépende de mécanismes de transcription distincts contrôlés de manière différenciée par des entrées neurales distinctes innervant la NAc de diverses régions de projection glutamatergique, par exemple plusieurs régions de cortex préfrontal, d'hippocampe et d'amygdala. Il reste encore beaucoup à faire pour explorer ces possibilités et d’autres possibilités.

Ensemble, nos résultats identifient un nouveau mécanisme de transcription par lequel ΔFosB est induit dans NAc pour induire des réponses proresilience à des stimuli stressants. Cette étude fournit également de nouvelles informations importantes sur le rôle joué par la SRF au niveau de l'ANc dans la régulation des comportements de type dépression et anxiété. Mieux comprendre le rôle transcriptionnel de SRF dans la régulation de ces comportements aidera à l'identification de nouvelles cibles génétiques impliquées dans la résilience aux troubles liés au stress, et pourrait faciliter le développement futur de thérapies antidépressives plus efficaces.

Ce travail a été financé par des subventions de l'Institut national de la santé mentale et de l'Institut national de lutte contre l'abus des drogues et par une alliance de recherche avec AstraZeneca. Nous remercions David D. Ginty d’avoir fourni les souris Srffl / fl.

La correspondance doit être adressée à Eric J. Nestler, Département des neurosciences de Fishberg, École de médecine du Mont Sinaï, Place Gustave L. Levy, Box 1065, New York, NY 10029-6574. [email protected]

Copyright © 2010 les auteurs 0270-6474 / 10 / 3014585-08 $ 15.00 / 0

Références

1. ↵

1. Alberti S,

2. Krause SM,

3. Kretz O,

4. Philippar U,

5. Lemberger T,

6. Casanova E,

7. Wiebel FF,

8. Schwarz H,

9. Frotscher M,

10. Schütz G,

11. Nordheim A

(2005) La migration neuronale dans le flux migratoire rostral murin nécessite un facteur de réponse sérique. Proc Natl Acad Sci USA 102: 6148 – 6153.

Résumé / Texte intégral GRATUIT

2. ↵

1. Bading H,

2. Ginty DD,

3. Greenberg ME

(1993) Régulation de l'expression des gènes dans les neurones de l'hippocampe par des voies de signalisation du calcium distinctes. Science 260: 181 – 186.

Résumé / Texte intégral GRATUIT

3. ↵

1. Berton O,

2. McClung CA,

3. Dileone RJ,

4. Krishnan V,

5. Renthal W,

6. Russo SJ,

7. Graham D,

8. Tsankova NM,

9. Bolanos CA,

10. Rios M,

11. Monteggia LM,

12. Self DW,

13. Nestler EJ

(2006b) Rôle essentiel du BDNF dans la voie de la dopamine mésolimbique dans le stress de la défaite sociale. Science 311: 864 – 868.

Résumé / Texte intégral GRATUIT

4. ↵

1. Berton O,

2. Covington HE 3rd.,

3. Ebner K,

4. Tsankova NM,

5. Carle TL,

6. Ulery P,

7. Bhonsle A,

8. Barrot M,

9. Krishnan V,

10. Singewald GM,

11. Singewald N,

12. Birnbaum S,

13. Neve RL,

14. Nestler EJ

(2007) L'induction de ΔFosB dans le gris périaqueducal par le stress favorise les réponses d'adaptation actives. Neuron 55: 289 – 300.

CrossRefMedline

5. ↵

1. Chang SH,

2. Poser S,

3. Xia Z

(2004) Un nouveau rôle du facteur de réponse sérique dans la survie neuronale. J Neurosci 24: 2277 – 2285.

Résumé / Texte intégral GRATUIT

6. ↵

1. Etkin A,

2. Alarcón JM,

3. Weisberg SP,

4. Touzani K,

5. Huang YY,

6. Nordheim A,

7. Kandel ER

(2006) Un rôle dans l'apprentissage de la SRF: la suppression chez le cerveau antérieur adulte perturbe l'invalidité à long terme et la formation d'une mémoire immédiate d'un nouveau contexte. Neuron 50: 127 – 143.

CrossRefMedline

7. ↵

1. Heinze HJ,

2. Heldmann M,

3. Voges J,

4. Hinrichs H,

5. Marco Pallares J,

6. Hopf JM,

7. Müller UJ,

8. Galazky I,

9. Sturm V,

10. Bogerts B,

11. Münte TF

(2009) Contrer la sensibilisation incitative à la dépendance sévère à l’alcool en utilisant la stimulation cérébrale profonde du noyau accumbens: aspects cliniques et scientifiques de base. Front Hum Neurosci 3: 22.

Medline

8. ↵

1. Johnson CM,

2. Hill CS,

3. Chawla S,

4. Treisman R,

5. Bading H

(1997) Le calcium contrôle l’expression des gènes par trois voies distinctes pouvant fonctionner indépendamment de la cascade de signalisation de la protéine kinase activée par le mitogène (ERK). J Neurosci 17: 6189 – 6202.

Résumé / Texte intégral GRATUIT

9. ↵

1. Kalita K,

2. Kharebava G,

3. Zheng JJ,

4. Hetman M

(2006) Rôle de la leucémie aiguë mégacaryoblastique-1 dans la stimulation dépendante d'ERK1 / 2 de la transcription induite par le facteur de réponse sérique par BDNF ou d'une activité synaptique accrue. J Neurosci 26: 10020 – 10032.

Résumé / Texte intégral GRATUIT

10. ↵

1. Kelz MB,

2. Chen J,

3. Carlezon WA Jr.,

4. Whisler K,

5. Gilden L,

6. Beckmann AM,

7. Steffen C,

8. Zhang YJ,

9. Marotti L,

10. Self DW,

11. Tkatch T,

12. Baranauskas G,

13. DJ Surmeier,

14. Neve RL,

15. Duman RS,

16. Picciotto MR,

17. Nestler EJ

(1999) L'expression du facteur de transcription ΔFosB dans le cerveau contrôle la sensibilité à la cocaïne. Nature 401: 272 – 276.

CrossRefMedline

11. ↵

1. Knöll B,

2. Nordheim A

(2009) Polyvalence fonctionnelle des facteurs de transcription dans le système nerveux: le paradigme de la SRF. Tendances Neurosci 32: 432 – 442.

CrossRefMedline

12. ↵

1. Knöll B,

2. Kretz O,

3. Fiedler C,

4. Alberti S,

5. Schütz G,

6. Frotscher M,

7. Nordheim A

(2006) Le facteur de réponse sérique contrôle l'assemblage du circuit neuronal dans l'hippocampe. Nat Neurosci 9: 195 – 204.

CrossRefMedline

13. ↵

1. Krishnan V,

2. Han MH,

3. Graham DL,

4. Berton O,

5. Renthal W,

6. Russo SJ,

7. Laplant Q,

8. Graham A,

9. Lutter M,

10. Lagace DC,

11. Ghose S,

12. Reister R,

13. Tannous P,

14. Green TA,

15. Neve RL,

16. Chakravarty S,

17. Kumar A,

18. Eisch AJ,

19. Self DW,

20. Lee FS,

21. et al.

(2007) Adaptations moléculaires sous-jacentes à la susceptibilité et à la résistance à la défaite sociale dans les régions de récompense du cerveau. Cellule 131: 391 – 404.

CrossRefMedline

14. ↵

1. Kuhn J,

2. Bauer R,

3. Pohl S,

4. Lenartz D,

5. Huff W,

6. Kim EH,

7. Klosterkoetter J,

8. Sturm V

(2009) Observations sur l'abandon du tabac sans aide après stimulation cérébrale profonde du noyau accumbens. Eur Addict Res 15: 196 – 201.

CrossRefMedline

15. ↵

1. Kumar A,

2. Choi KH,

3. Renthal W,

4. Tsankova NM,

5. Theobald DE,

6. Truong HT,

7. Russo SJ,

8. Laplant Q,

9. Sasaki TS,

10. Whistler KN,

11. Neve RL,

12. Self DW,

13. Nestler EJ

(2005) Le remodelage de la chromatine est un mécanisme clé de la plasticité induite par la cocaïne dans le striatum. Neuron 48: 303 – 314.

CrossRefMedline

16. ↵

1. Maze I,

2. Covington HE 3rd.,

3. Dietz DM,

4. LaPlant Q,

5. Renthal W,

6. Russo SJ,

7. Mécanicien M,

8. Mouzon E,

9. Neve RL,

10. Haggarty SJ,

11. Ren Y,

12. Sampath SC,

13. Hurd YL,

14. Greengard P,

15. Tarakhovsky A,

16. Schaefer A,

17. Nestler EJ

(2010) Rôle essentiel de l'histone méthyltransférase G9a dans la plasticité induite par la cocaïne. Science 327: 213 – 216.

Résumé / Texte intégral GRATUIT

17. ↵

1. McClung CA,

2. Ulery PG,

3. Perrotti LI,

4. Zachariou V,

5. Berton O,

6. Nestler EJ

(2004) DeltaFosB: un commutateur moléculaire pour une adaptation à long terme dans le cerveau. Résolution de cerveau Mol Résolution de cerveau 132: 146 – 154.

Medline

18. ↵

1. Nestler EJ

(2008) Mécanismes transcriptionnels de la dépendance: rôle de deltaFosB. Philos Trans R Soc Lond B Biol Sci 363: 3245 – 3255.

Résumé / Texte intégral GRATUIT

19. ↵

1. Nestler EJ,

2. Carlezon WA Jr.

(2006) Le circuit de récompense dopaminergique mésolimbique dans la dépression. Psychiatrie biologique 59: 1151 – 1159.

CrossRefMedline

20. ↵

1. Nestler EJ,

2. Kelz MB,

3. Chen J

(1999) ΔFosB: un médiateur moléculaire de plasticité neuronale et comportementale à long terme. Brain Res 835: 10 – 17.

CrossRefMedline

21. ↵

1. Newton SS,

2. Thome J,

3. Wallace TL,

4. Shirayama Y,

5. Schlesinger L,

6. Sakai N,

7. Chen J,

8. Jamais,

9. Nestler EJ,

10. Duman RS

(2002) L'inhibition de la protéine ou de la dynorphine liant l'élément à la réponse à l'AMPc dans le noyau accumbens produit un effet de type antidépresseur. J Neurosci 22: 10883 – 10890.

Résumé / Texte intégral GRATUIT

22. ↵

1. Nikulina EM,

2. Arrillaga-Romany I,

3. Miczek KA,

4. Hammer RP Jr.

(2008) Altération durable des structures mésocorticolimbiques après stress répété de défaites sociales chez le rat: évolution temporelle de l'ARNm du récepteur mu-opioïde et de l'immunoréactivité de FosB / DeltaFosB. Eur J Neurosci 27: 2272 – 2284.

CrossRefMedline

23. ↵

1. Perrotti LI,

2. Hadeishi Y,

3. Ulery PG,

4. Barrot M,

5. Monteggia L,

6. Duman RS,

7. Nestler EJ

(2004) Induction de ΔFosB dans les structures cérébrales liées à la récompense après un stress chronique. J Neurosci 24: 10594 – 10602.

Résumé / Texte intégral GRATUIT

24. ↵

1. Perrotti LI,

2. Weaver RR,

3. Robison B,

4. Renthal W,

5. Maze I,

6. Yazdani S,

7. Elmore RG,

8. Knapp DJ,

9. Selley DE,

10. Martin BR,

11. Sim-Selley L,

12. Bachtell RK,

13. Self DW,

14. Nestler EJ

(2008) Schémas distincts d’induction de DeltaFosB dans le cerveau par la toxicomanie. Synapse 62: 358 – 369.

CrossRefMedline

25. ↵

1. Philippar U,

2. Schratt G,

3. Dieterich C,

4. Müller JM,

5. Galgóczy P,

6. Engel FB,

7. Keating MT,

8. Gertler F,

9. Schüle R,

10. Vingron M,

11. Nordheim A

(2004) Le gène cible de SRF, Fhl2, antagonise l'activation de SRF dépendante de RhoA / MAL. Mol Cell 16: 867 – 880.

CrossRefMedline

26. ↵

1. Ramanan N,

2. Shen Y,

3. Sarsfield S,

4. Lemberger T,

5. Schütz G,

6. DJ Linden,

7. Ginty DD

(2005) SRF intervient dans l'expression des gènes induite par l'activité et la plasticité synaptique, mais pas la viabilité neuronale. Nat Neurosci 8: 759 – 767.

CrossRefMedline

27. ↵

1. Renthal W,

2. Carle TL,

3. Maze I,

4. Covington HE 3rd.,

5. Truong HT,

6. Alibhai I,

7. Kumar A,

8. Montgomery RL,

9. Olson EN,

10. Nestler EJ

(2008) Delta FosB intervient dans la désensibilisation épigénétique du gène c-fos après une exposition chronique à l'amphétamine. J Neurosci 28: 7344 – 7349.

Résumé / Texte intégral GRATUIT

28. ↵

1. Renthal W,

2. Kumar A,

3. Xiao G,

4. Wilkinson M,

5. Covington HE 3rd.,

6. Maze I,

7. Sikder D,

8. Robison AJ,

9. LaPlant Q,

10. Dietz DM,

11. Russo SJ,

12. Vialou V,

13. Chakravarty S,

14. Kodadek TJ,

15. La pile A,

16. Kabbaj M,

17. Nestler EJ

(2009) L'analyse du génome de la régulation de la chromatine par la cocaïne révèle le rôle des sirtuines. Neuron 62: 335 – 348.

CrossRefMedline

29. ↵

1. Schlaepfer TE,

2. Cohen MX,

3. Frick C,

4. Kosel M,

5. Brodeur D,

6. Axmacher N,

7. Joe AY,

8. Kreft M,

9. Lenartz D,

10. Sturm V

(2008) Une stimulation cérébrale profonde pour récompenser les circuits atténue l'anhédonie dans une dépression majeure réfractaire. Neuropsychopharmacologie 33: 368 – 377.

CrossRefMedline

30. ↵

1. Sesack SR,

2. Grace AA

(2010) Réseau de récompense des noyaux cortico-basaux: microcircuit. Neuropsychopharmacologie 35: 27 – 47.

CrossRefMedline

31. ↵

1. Tomita H,

2. Vawter MP,

3. Walsh DM,

4. Evans SJ,

5. Choudary PV,

6. Li J,

7. Overman KM,

8. Atz ME

9. Myers RM,

10. Jones EG,

11. Watson SJ,

12. Akil H,

13. Bunney WE Jr.

(2004) Effet des facteurs agonaux et post mortem sur le profil d'expression génique: contrôle de la qualité dans les analyses par micropuce ou le cerveau humain post mortem. Biol Psychiatry 55: 346 – 352.

CrossRefMedline

32. ↵

1. Tsankova NM,

2. Berton O,

3. Renthal W,

4. Kumar A,

5. Neve RL,

6. Nestler EJ

(2006) Régulation soutenue de la chromatine hippocampique dans un modèle murin de dépression et d’action antidépressive. Nat Neurosci 9: 519 – 525.

CrossRefMedline

33. ↵

1. Vassoler FM,

2. Schmidt HD,

3. Gérard ME,

4. KR célèbre,

5. Ciraulo DA,

6. Kornetsky C,

7. Knapp CM,

8. Pierce RC

(2008) La stimulation cérébrale profonde de la coque du noyau accumbens atténue le rétablissement induit par la cocaïne de la recherche de drogue chez le rat. J Neurosci 28: 8735 – 8739.

Résumé / Texte intégral GRATUIT

34. ↵

1. Vialou V,

2. Robison AJ,

3. Laplant QC,

4. Covington HE 3rd.,

5. Dietz DM,

6. Ohnishi YN,

7. Mouzon E,

8. Rush AJ 3rd.,

9. Watts EL,

10. Wallace DL,

11. Iñiguez SD,

12. Ohnishi YH,

13. Steiner MA,

14. Warren BL,

15. Krishnan V,

16. Bolaños CA,

17. Neve RL,

18. Ghose S,

19. Berton O,

20. Tamminga CA,

21. Nestler EJ

(2010) ΔFosB dans les circuits de récompense du cerveau assure la résilience au stress et aux réponses des antidépresseurs. Nat Neurosci 13: 745 – 752.

CrossRefMedline

35. ↵

1. Wilkinson MB,

2. Xiao G,

3. Kumar A,

4. LaPlant Q,

5. Renthal W,

6. Sikder D,

7. Kodadek TJ,

8. Nestler EJ

(2009) Le traitement à l'imipramine et la résilience présentent une régulation de la chromatine similaire dans une région clé de la récompense du cerveau. J Neurosci 29: 7820 – 7832.

Résumé / Texte intégral GRATUIT

36. ↵

1. Xia Z,

2. Dudek H,

3. Miranti CK,

4. Greenberg ME

(1996) L'afflux de calcium via le récepteur NMDA induit une transcription précoce immédiate du gène par un mécanisme dépendant de la MAP kinase / ERK. J Neurosci 16: 5425 – 5436.

Résumé / Texte intégral GRATUIT