Riaghladh seasmhachd DeltaFosB le fosphorylation (2006)

J Neurosci. 2006 May 10;26(19):5131-42.

Ulery PG, Rudenko G, Nestler EJ.

Stòr

Roinn Eòlas-inntinn, Ionad airson Neuroscience Bunaiteach, Oilthigh Ionad Meidigeach Southwestern Texas, Dallas, Texas 75390-9070, SA.

Abstract

Tha am feart tar-chuir DeltaFosB (ris an canar cuideachd FosB2 no FosB [foirm goirid]) na eadar-mheadhanair cudromach den bhlasachd fhad-ùine a dh'adhbhraich e san eanchainn le bhith a ’nochdadh gu ìreil ri grunn sheòrsachan de bhrosnachadh brosnaigeach, drogaichean, cuideam, agus glacaidhean electroconvulsive . Is e feart sònraichte de DeltaFosB gu bheil, aon uair a tha e air a thàladh, a ’leantainn ann an eanchainn airson ùine gu math fada a dh’ fhaodadh a bhith às aonais brosnachadh eile. Chan eil fios fhathast dè na h-innleachdan a tha air cùl na seasmhachd seo. An seo, tha sinn a ’sealltainn gu bheil DeltaFosB na fhactair tar-sgrìobhaidh cuibheasach seasmhach, le leth-beatha de timcheall air 10 h ann an cultar cealla. A bharrachd air sin, tha sinn a ’sealltainn gu bheil DeltaFosB na fhosphoprotein san eanchainn agus gu bheil phosphorylation de dh’ fhuigheall seunta a tha air a ghlèidheadh ​​gu mòr (Ser27) ann an DeltaFosB ga dhìon bho dhroch-dhìon proteasomal. Tha sinn a ’toirt seachad grunn loidhnichean fianais a tha a’ nochdadh gu bheil am phosphorylation seo air a mheadhanachadh le casein kinase 2. Tha na toraidhean sin mar a ’chiad fhianais gu bheil DeltaFosB air a dh’ fhuasgladh agus a ’sealltainn gu bheil phosphory a’ cur ri seasmhachd, a tha aig cridhe a chomas air atharrachaidhean fad-ùine a ghabhail a-steach ann an eanchainn.

Ro-ràdh

Is e am feart tar-sgrìobhaidh ΔFosB, a tha cuideachd air a chomharrachadh mar FosB2 no FosB [foirm goirid], eadar-dhealachadh ann an sgoltadh C aig an ceann as tràithe den ghine dhìreach luath. altram (Dobrazanski et al., 1991; Nakabeppu agus Nathans, 1991; Yen et al., 1991). Coltach ri FosB fad-ùine, tha àrainn bhunaiteach DNA-osFosB agus zipper leucine trom bi e a ’dèanamh ceangal le Jun proteins gus iom-fhuaimneachan factaraidh tar-chur pròtain-1 (AP-1) a chruthachadh, a bhios a’ riaghladh an abairt de dh'iomadh ginte (Morgan agus Curran, 1995; Rylski agus Kaczmarek, 2004). A dh'aindeoin 's nach robh pàirt den àrainn tar-ghluasaid aige a chaidh a lorg ann an C terminus FosB, tha ΔFosB ag obair mar an dà chuid gnìomhaiche làidir agus tar-chuir ann an ceallan saothraichte agus san eanchainn (Dobrazanski et al., 1991; Nakabeppu agus Nathans, 1991; Chen et al., 1997; McClung agus Nestler, 2003; Kumar et al., 2005).

ΔTha FosB air a bhrosnachadh gu ìrean àrda ann an dòigh roinn-shònraichte san eanchainn às deidh dha a bhith faisg air a ’gabhail thairis le diofar bheothachaidhean inntinn-inntinn, a’ gabhail a-steach uallach, laigsean sònraichte, drugaichean antipsychotic agus dhrogaichean de dhrogaichean, drogaichean de dhroch dhìol, agus duaisean nàdarra. (Hope et al., 1994b; Hiroi agus Graybiel, 1996; Moratalla et al., 1996; Bing et al., 1997; Mandelzys et al., 1997; Kelz et al., 1999; Werme et al., 2002; Andersson et al., 2003; Colby et al., 2003; Peakman et al., 2003; Perrotti et al., 2004; Zachariou et al., 2006). Tha inntrigeadh ofFosB air a bhith càirdeach gu dìreach ri buaidhean gnìomhachaidh grunn de na brosnachadh seo air an eanchainn. Tha seasmhachd ΔFosB fiù 's mura h-eil brosnachadh eile ga dh ’a-mach bho fheartan tar-chuir eile ann an Fosgailte, a tha air am brosnachadh gu luath mar thoradh air brosnachadh brosnachail, milleadh air ais gu ìrean basail taobh a-staigh beagan uairean a-thìde, agus mar as trice a’ nochdadh desensitization às deidh brosnachadh leantainneach (Hope et al., 1992; Daunais et al., 1993; Persico et al., 1993; Hiroi agus Graybiel, 1996; Perrotti et al., 2004). Tha seo a ’dèanamh ΔFosB na thagraiche tarraingeach gus cuid de na h-atharrachaidhean fad-ùine ann an sloinneadh gine a rèiteachadh a tha a’ dèanamh cuingeachadh air na h-atharrachaidhean staoin ìre neo-bhuanach a tha air an adhbhrachadh le brosnachadh brosnach sònraichte.

Seach gu bheil làthaireachd fhada ΔFosB a ’tachairt mura h-eil barrachd inntrigidh ann am mRNA (Chen et al., 1995,, thug sinn tuairmeas gu bheil, ann an eu-coltach ri FosB fad-ùine agus gach pròtain eile ann an fosgail teaghlaich, a tha neo-sheasmhach ann an dòigh neo-sheasmhach, ΔFosB gu bheil e na fhactar tar-chomharraichte neo-àbhaisteach.Hope et al., 1994b; Chen et al., 1997; Nestler et al., 2001; McClung et al., 2004). A bharrachd, mhol sgrùdadh immunoblotting de dhith an-aghaidh eanchainn a ’toirt gu buil gun robh ΔFosB shifts a-rèir coltais Mr (tomad moilecular) bho ∼33 kDa anns an t-suidheachadh dhuilich gu ∼35 – 37 kDa ri linn làimhseachadh leantainneach (Hope et al., 1994a; Chen et al., 1995). Seach nach eil fianais ann gu bheil mRNAs a bharrachd ann a dh ’fhaodadh còdachadh dha na diofar isoforms seo, thug sinn tuairmeas air a-rithist gu bheil ΔFosB air atharrachadh gu h-obann agus gu bheil seo a’ cur ri seasmhachd neo-àbhaisteach. Gu ruige seo, ge-tà, cha deach aithris a dhèanamh air mion-sgrùdadh bith-cheimigeach air atharrachaidhean an eadar-mhalairt no atharrachadh postachd ΔFosB. B 'e amas an rannsachaidh seo faighinn a-mach an e ΔFosB a tha na phosphoprotein agus am bheil phosphory-pailte a ’seasamh ann an seasmhachd.

Earrann roimhe seoAn ath earrann

Stuthan agus Dòighean-obrach

Loidhnichean cealla mamalan agus structaran DNA.

Bha ceallan PC12 (Clontech, Mountainview, CA) air an àrach ann an àrd-ghlucose DMEM anns a bheil l-glutamine (L-Gln) agus chaidh cur ris le 5% serum bovine fhéin (FBS), serum each 10 (an dà chuid bho Invitrogen, Carlsbad, CA) , 100 U / ml penicillin, agus 100 μg / ml streptomycin (an dà chuid bho Sigma-Aldrich, St Louis, MO). Bha ceallan HeLa (Cruinneachadh Cultar Ameireaganach, Manassas, VA) air an saothrachadh ann an àrd-glùcois DMEM anns a bheil L-Gln agus le taic bho 10% FBS, penicillin, agus streptomycin. Chaidh an dà loidhne cealla a chumail aig 37 ° C ann an 5% CO tais2 àile.

Airson an gluasad eadar-ghluasadach le ceallan DNA, PC12 no HeLa chaidh an sìol air plàighean sia-tobair (air an còmhdach le collagen I airson ceallan PC12) gus faighinn a-mach mu cho-thuigse 90-100 an ath latha agus an uair sin gan gluasad le Lipofectamine 2000 (Invitrogen). Ann an cuid de dheuchainnean (faic Figsichean. 1-7), Chaidh ΔFosB a chuir an cèill gu h-eadar-ghluasadach ann an ceallan PC12 tro ghalair le víreas Herpes simplex am-ath-thoirt (HSV).

Chaidh ΔFosB agus FosB cDNAs fhaighinn bhon pTetop-constructs againn fhèin (Chen et al., 1997), agus air an toirt a-steach ann am vector pcDNA3.1 (Invitrogen). Chaidh na pcDNA3.1-ΔFosB / FosB seo a chleachdadh airson an nochdadh ann an ceallan mamànach agus mar theamplaid airson mutagenesis a tha air an stiùireadh le làraich. Chaidh ath-iomlaid HSV-ΔFosB ullachadh mar a chaidh a mhìneachadh roimhe (Neve et al., 1997), agus gun robh an t-ullachadh a ’faighinn titer de ∼1 × 108 pfu / ml.

Deuchainnean a ’lorg Pulse-chase.

Mu timcheall air 24 h an dèidh gabhaltas / tar-ghabhaltas, chaidh ceallan (PC12 no HeLa) ann an truinnsearan sia-tobair a nighe dà no trì tursan le 2 ml de PBS agus chaidh an àrach aig 37 ° C airson ∼1 h ann an 2 ml de DMM Cys / Met-saor. (Invitrogen) le taic bho 5% FBS (Hyclone, Logan, UT) gus luathaichean in-mheadhanach Met agus Cys a lùghdachadh. Aig deireadh na h-ùine seo, chaidh drugaichean (ma bha ceallan gu bhith air an leigheas) a chur ris, agus chaidh ceallan (biùbhlan) a dhèanamh air ceallan le 12-25 μCi bho 35S Measgachadh Ag Làimhseachadh Pròtain (PerkinElmer, Wellesley, MA) airson ∼1 h aig 37 ° C gus na pròtainean air fad a tha air an ùr-chur a chomharrachadh. Chaidh an radiolabel an uairsin a thoirt air falbh le bhith a ’nighe nan ceallan eadar dà is trì tursan le 2 ml de PBS, agus an 35Leanadh pròtainean le suaicheantas-l (leantainn orra) le meur “fuar” (nonradioactive) an àite na meadhain le bhith a ’cur taic ri 5% FBS agus a’ toirt na ceallan gu ìre aig diofar amannan-tìm. Bha làimhseachadh calla air a chumail fad na h-ùine. Tha figearan uile nan deuchainnean seo a ’sealltainn sùimean ceudna coltach ris na pròtainean eadar-dhealaichte gus an coimeas a dhèanamh eadar na h-ìrean atharrachaidh aca.

Ainmhidhean agus làimhseachadh glacaidh cronach electroconvulsive.

Chaidh radain fireann Sprague Dawley (200 – 300 g; Charles River Laboratories, Kingston, RI) a làimhseachadh aon uair sa latha le glacaidhean electroconvulsive (ECS) airson 7 – 9 d. Chaidh ECS a choileanadh mar a chaidh a mhìneachadh roimhe (Hope et al., 1994a) a ’cleachdadh le Ugo Basile (Comerio VA, an Eadailt) aonad ECS leis na suidheachaidhean a leanas: tricead, 100 pulsan / s; cuislean le, 0.5 ms; duration blàths, 1.0 s; agus an-dràsta, 75 mA. Bhathar a ’dèiligeadh ri beathaichean smachd Sham co-shìnte le bhith a’ cleachdadh an dealan-cluaise cluaise gun sruth dealain.

32 P labeladh metabolic.

Airson a bhith a ’comharrachadh sliseagan na h-eanchainn, chaidh radain a thoirt air falbh, chaidh na h-eanchainnean a sgaradh a-mach gu luath, agus chaidh sliseagan cortal bhon taobh a-muigh a dheasachadh le microslicer DSK (Ted Pella, Redding, CA). Chaidh na sliseagan a ghintinn am broinn pìoban plastaig ann an 300 ml de CSF fuadain a bha gann de fhiaclag (ACSF) agus air an cumail aig 2 ° C fo bhrùthadh socair cunbhalach le O2/ CO2 measgachadh (Hemmings et al., 1989). Bha na sliseagan (dà sliseag gach tiùb) air an ainmeachadh le 1.3 mCi airson 8 – 10 h ann an làthaireachd no neo-shearbhag okadaic (100 ng / ml). Aig deireadh a ’ghintinn, chaidh na sliseagan a sgoladh air ais co-dhiù trì tursan le ACSF fuar agus an uairsin gu bhith air an toirt còmhla le bhith a’ co-èigneachadh ann an 250 ofl de dh ay as-rabaidh radioimmunopreciating (RIPA) bufair [PBS, pH 7.4, 150 mm NaCl, 1% (v / v ) Igepal, 0.5% (w / v) sodium deoxycholate, 0.1% (w / v) SDS, 1 mm EDTA] air a chuir ris mus deach a chleachdadh le SDS suas gu 0.6%, cocktail dìonadair pròtain do cheallan mamach (a chleachdadh aig 5 μl / ml; Sigma-Aldrich), coileach cosail phosphatase I agus II (a chleachdar aig 1: 100; Sigma-Aldrich), 1 mm PMSF, agus 2% glycerol. Chaidh homogenates an uair sin a ghoil airson min 15 agus an glanadh le bhith a ’toirt air falbh le mealladh aig 15,000 × g airson 15 min. Chaidh measadh pròtain anns na mòr-chumhachdan a thàinig às a mheasadh le bhith a ’cleachdadh assay pròtain BCA (Pierce, Holmdel, NJ).

airson a ' 32P le bhith a ’dèanamh ainmean air ceallan saothraichte, X24 h an dèidh galair / tar-ghabhaltas, bhithear a’ glanadh cheallan dà no trì tursan le inneal gun phosphate agus gan giùlain sa mheadhan seo airson ∼1 h. Às dèidh an t-acras seo, 0.2 – 0.3 mCi de 32PH3PO4 (PerkinElmer) a chuir ri gach tobar, agus le ceallan air an ainmeachadh airson 4 – 12 h a ’rèir an seòrsa deuchainn (faic Figs. 1 – 7 airson sònrachaidhean). An uair sin chaidh ceallan a ghlanadh trì tursan le PBS agus an lobhadh air deigh airson 15 min le 50 μl de bufair RIPA a bharrachd. Chaidh Lysates a chruinneachadh le sgrìobadh agus chaidh an toirt seachad tro 10 tro inneal-snàthaid 25 gu DNA lomadh, air a bhruich airson min 10, agus air a chriathradh aig 15,000 rpm airson 15 – 30 mionaid aig 4 ° C. Chaidh na lysates (supernatants) a chaidh a ghlanadh a ghluasad gu tiùb ùr agus chaidh measaidh pròtain BCA (Pierce) a dhèanamh. Tha figearan uile nan deuchainnean seo a ’sealltainn an aon ìre de phròtainean làn-fhiadhaich (WT) agus S27A ΔFosB gus coimeas a dhèanamh eadar na h-ìrean anns a bheil dà-ìre gnèitheach.

Ceimigean agus làimhseachadh cultair cealla.

Chaidh searbhag Okadaic (OA; Sigma-Aldrich) a sgaoileadh ann an ethanol agus chaidh a chleachdadh aig an ìre mu dheireadh de 100 ng / ml. Chaidh 5,6-Dichloro-1-β-d-ribofuranosyl-benzimidazole (DRB; Biomol, Plymouth Meeting, PA) a sgaoileadh ann am dimethyl sulfoxide (DMSO; Sigma-Aldrich) agus a chleachdadh ann an cultar cealla aig an ìre mu dheireadh de 50 μm. Chaidh spermine (Sigma-Aldrich) a sgaoileadh ann an uisge agus a chleachdadh aig an ìre mu dheireadh de 200 μm. Chaidh Calphostin-C (Biomol) a sgaoileadh ann an DMSO agus chaidh a chleachdadh aig 0.2 μm, ach chaidh phorbol 12-myristate 13-acetate (PMA; Promega, Madison, WI) a sgaoileadh ann an DMSO agus a chleachdadh aig 0.1 μm. peptide toirmisgte myristoylated-autocamtide-2 (m-AIP; Biomol) air a sgaoileadh ann an uisge agus air a chleachdadh aig an ìre mu dheireadh de 1 agus 10 μm. Chaidh na h-inhibitors kinase pròtain farsaing-H-7 agus H-8 (Biomol) a sgaoileadh ann an uisge agus gan cleachdadh aig an ìre mu dheireadh de 150 agus 200 μm, fa leth. Chaidh MG132 (Calbiochem, San Diego, CA) agus epoxomicin (Peptides International, Louisville, KY) an dà chuid ann an DMSO agus chaidh an cleachdadh aig an ìre mu dheireadh de 12.5 agus 7.5 μm, fa leth. Anns a h-uile deuchainn, chaidh DMSO (carbad) a chur ri ceallan mar a dh ’fheumar suim seasmhach de DMSO a chumail thairis air leigheasan. Airson 32P deuchainnean le bileagan, chaidh na drogaichean a chur ris a ’bhad air thoiseach air a’ bhratach agus an glèidheadh ​​airson an còrr den ùine leòdachadh. Airson deuchainnean ann an cuislean, chaidh drogaichean a chur ris aig àm "acras" Cys / Met air a chumail tron ​​ùine bhrathaidh, agus an uair sin air a chur air ais don mheadhan ruaig. Chaidh na h-innealan dìon pròtainteach a thasgadh anns a h-uile 3 – 4 h air feadh an t-seilg gus airgead-dìolaidh nan peptides seo a thoirt seachad.

ΔFosB immunoprecovery, in-dhìonadh, agus fèin-eòlas.

Airson neo-chnàmhan, chaidh an dath a lagachadh 1: 5 le RIPA plèana gus an dùmhlachd SDS a thoirt sìos gu 0.1% mus deigheadh ​​iad air adhart le deadh banachdach (IP). Gus casg a chuir air nonspecific ceangaltach, chaidh na lysates a ghlanadh an toiseach le dìon a chuir a-mach le nonimmune IgG agus pròtain G-Sepharose (Sigma-Aldrich) airson co-dhiù 4 h. An uairsin chaidh BFosB a thoirt a-mach às na lysates a chaidh a ghlanadh a ’cleachdadh ana-ghoirt polyclonal gobhar a dh’ aithnicheas epitope taobh a-staigh an dà chuid aig FosB agus ΔFosB (SC-48G; Biteicneolaíocht Santa Cruz, Santa Cruz, CA) ag 0.5-1 Ig IgG an 10 μg de phróitéin lysate (50 – 300 μg de phròtain iomlan) ann an tomad iomlan de 0.5 ml. Chaidh IPs a mheasgachadh gu socair aig 4 ° C air rotor airson co-dhiù 8 h agus an uairsin chaidh 15 μl de phròtain G-Sepharose a chur ris agus chaidh IPs a mheasgachadh airson co-dhiù 4 h eile. Chaidh IPs a thilgeil a-mach le bhith a ’snìomh aig 3000 × g airson 3 – 5 mionaid aig 4 ° C, air a nighe trì tursan le 0.5 ml de RIPA fuar còmhnard agus dà uair le PBS fuar le 0.1% Tween 20. Chaidh IPs an uair sin an ath-fhastadh ann an 0.5 ml de PBS fhuar, air an gluasad, air am peilear ann an tiùb ùr, agus an uair sin chaidh pròtainean dìonachd às an dèidh a shlugadh le bhith a ’cur 15 – 25 μl à 2 × a’ lùghdachadh bufair samhla pròifil Laemmli. Mar thoradh air a ’phròtacal IP seo bha gluasad sònraichte agus èifeachdach de cha mhòr a h-uile gin den BFosB anns an lysate. Chaidh na pròtainean dìonachd a chuir an aghaidh SDS-PAGE le bhith a ’luchdachadh an IP gu lèir air gliteria-ìre 12.5% Tris-HCl (Bio-Rad, Hercules, CA), agus an uair sin gan gluasad gu PVDF no nitrocellulose. An dèidh a ghluasad, bha an membrane air a thiormachadh san adhair agus 32P- agus 35Chunnacas autoradiography le còmhlain pròtain S-radiolabeled a ’cleachdadh film autoradiographic Kodak (Rochester, NY), a bharrachd air le phosphorimaging le Storm (Biorsham Biosciences, Piscataway, NJ) PhosphorImager. Iomlan (unphosphorylated and phosphorylated) ΔFhear sin lorgadh Bbos ann an liosan cealla no homogenates an eanchainn le bhith a ’toirt a-mach às a’ phoit anns a bheil ath-bhanachdach (a ’cleachdadh an aon mheamran a chaidh a chleachdadh gus na 32Pròtain le ainm-p), no de mhodailean co-ionann de phrotaig lysate / homogenate a dh ’ort ri SDS-PAGE agus air an gluasad gu PVDF no nitrocellulose. Chaidh am membrane a bhacadh a ’chiad turas le a bhith a’ fàs le 1% (w / v) bainne tioram nonfat (Bio-Rad) ann am PBS le 0.1% (v / v) Tween 20 (Sigma) airson 1 h aig 25 ° C. An uairsin chaidh an membrane a thoirt a-steach gu dìonadh air an oidhche aig 4 ° C leis a ’antibodal polyclonal againn an aghaidh na coineanaich a tha air a ghineadh mu thimcheall amino-amino 1 – 16 de FosB / ΔFosB (a’ cleachdadh aig 1: 10,000). An dèidh a ’ghintinn bunasach, chaidh meamranan a nighe ceithir tursan airson 5 min le bufair casg, agus an uair sin chaidh an adhlacadh ann an 25 ° C airson ∼1 h le geòidh an-aghaidh rabbit IgG co-dhèante ri peroxidase horseradish (a’ cleachdadh aig 1: 5000 ann am bacadh bufair, bho Vector Laboratories, Burlingame, CA). An uair sin chaidh na seicichean a ghlanadh trì tursan airson 10 mionaid le bufair a bhacadh agus aon àm airson min 5 le PBS. Chaidh na bannan pròta ΔFosB iomlan a shamhlachadh air fiolm Kodak MR le feabhas a chur air chemiluminescence (Pierce) agus / no le bhith a ’lorg flùraidheachd le bhith a’ cleachdadh reachdan ECL-Plus (Amersham Biosciences) agus an Storm PhosphorImager.

Os-èathachadh agus glanadh ath-cho-phàirteach BFosB bho cheallan bhiastagan.

Chaidh ΔFosB a chur fo throm-inntinn ann an ceallan meanbh-fhrìdean Sf9 mar phròm Nx hexa-His-tagaichte (N-His (6) ΔFosB) a ’cleachdadh an siostam baculovirus Bac-to-Bac (Invitrogen) agus a’ leantainn stiùireadh an neach-dèanaidh. Gu h-aithghearr, chaidh an ΔFosB cDNA (fuigheall 2 – 237) ro làimh leis an dàimh ceangaltas N-chrìochnachaidh MGHHHHHHAG air a chuir ann an vector pFASTBacTM1, a chaidh a chleachdadh gus bagulovirus ath-bian-ghinealach a chruthachadh. Bha ceallan Sf9 air an gabhail le bhìoras ath-choimeasgaichte, agus N-His (6) ΔFo chaidh burraidheachd a ghlanadh à cealla le grunn cheuman cromatographic a ’toirt a-steach cròmatagrafaidheachd ceangailte le colbh nicil (Qiagen, Valencia, CA), iomlaid anion le bhith a’ cleachdadh mono-Q column (Amersham Na saidheansan bith-eòlais), agus às-dùnadh meud le bhith a ’cleachdadh col-gel-filtration column (Amersham Biosciences).

In vitro eòlas fosfachadh.

In vitro chaidh ath-bheòthachadh fosphorylation airson cùrsa ùine agus sgrùdadh stoichiometry a dhèanamh ann an leabhar de 30 μl anns a bheil fo-fhilleadh 10 μm (N-His (6) ΔFosB no fo-fhiaclan smachd deimhinneach), 250 μm ATP, agus 1 μCi / μl [γ-32P] ATP, am bufair a tha ga thoirt seachad leis a ’chompanaidh kinase, agus aon de na kinases a leanas: CK2 (20 ng / μl; Upstate, Charlottesville, VA), CaMKII (10 ng / μl; Upstate), PKC (1.6 ng / μl; Calbiochem) no p70S6K (2.5 mU / μl; Upstate). Chaidh na h-ath-bhualaidhean ann an tìm a dhèanamh le bhith a ’toirt às na h-uighean à 5 μl bhon fhreagairt freagairt aig na h-amannan comharraichte agus a’ cur àireamh co-ionann de 4 × a ’lùghdachadh bufair samhla pròifil Laemmli. Bha paramadairean ciniteach Michaelis-Menten airson freagairt CK2 air an dearbhadh fo chumhachan staitistigeil mean air mhean. Chaidh na h-ath-bhualaidhean sin a thaisbeanadh airson 15 min ann an leabhar de 10 μl anns a bheil enmear 2 ng / μl, 250 μm ATP, 1 μCi / μl [γ-32P] ATP, agus N-A (6) rations Co-chruinneachaidhean Bàrr bho 2.5 – 30 μm. Chaidh a h-uile ath-aithris a dhèanamh aig 30 ° C ann am amar uisge. An dèidh SDS-PAGE agus sàthadh an glùin le Bio-Safe Coomassie (Bio-Rad), bha an fhoirm air a thiormachadh, agus 32Chaidh corp-p-phosphate a mheasadh le sgrùdadh phosphorimaging (faic gu h-ìosal, tomhas dàta, àireamhachadh, agus staitistig).

Mapa phosphopeptide dà-thaobhach agus anailis searbhagatosfain.

Chaidh an dà sgrùdadh seo a choileanadh mar a chaidh a mhìneachadh le Ploegh agus Dunn (2000). Gu h-aithghearr, tha blàthan tioram tioram anns a bheil 32P-leònadh ΔFosB (bho ann vitro gun deidheadh ​​ath-bhualaidhean no bho immunoprecipitates ann an ceallan meamo-mholaichte, air an spreidheadh, air ath-sruthadh, air an nighe, agus air an cur gu cnàmh tryptic. Chaidh am supernatant anns a bheil na stuthan tryptic a chuir a-steach lyophilized agus ghlan an lyophilate grunn thursan agus fhuaradh e às ùr ann an 10 μl de bufair de electrophoresis, pH 1.9. Chaidh ball-sampaill (3 μl) fhaicinn air truinnsear cromatography tana-ceallaisgte (TLC) (Analtech, Newark, DE) agus air an sgaradh ann an aon taobh le electrophoresis agus an taobh eile le bhith ag èirigh suas TLC. Chaidh na mapaichean phosphopeptide a thàinig às a thoirt am follais le autogradiography agus sgaoileadh stuthan. Airson mion-sgrùdadh de sheòrsa phosphosamino, chaidh 2 μl de na cluainidhean tryptic a bha air an ath-chur ann am bufair electrophoresis a ghlanadh a-rithist le hidreachaidh HCl aig 105 ° C airson min 25 ann an HCN m HCl fo N2 àile. Chaidh stad a chur air a ’fhreagairt le bhith a’ caolachadh sia sgillinn ann an uisge, agus bha am measgachadh air a dhèanamh loma-làn. Chaidh an lyophilate ath-fhastadh ann an 5 μl de bufair de electrophoresis, pH 1.9, agus chaidh fhaicinn air pláta TLC ceallalós còmhla ri inbhean phospho-Ser, -Thr, agus -Tyr. Chaidh electrophoresis a dhèanamh thairis air leth den phleit TLC a ’cleachdadh bufair electrophoresis, pH 1.9, agus an uairsin chaidh am plèan a ghluasad a-steach don bhufair pH 3.5, agus chaidh electrophoresis a choileanadh gu crìoch. Chaidh na h-ìrean searbhagach phosphosamino a shamhlachadh le bhith a ’sparradh a’ phleit TLC le fuasgladh 1 (v / v) ninhydrin ann an ascetone, agus an 32Bha sampallan searbhag amino le comharraidhean-p air an samhlachadh le gach cuid autoradiography agus sgaoileadh stuthan.

briseadh sìos CK2α bho siRNA.

Chleachd sinn dòigh tar-chuir RNA gus ìrean CK2 a thoirt sìos gu roghnach (Di Maira et al., 2005). Chaidh ceallan PC12 a shìoladh air truinnsearan sia-togte le collagen I-gu gus faighinn a-steach gu ence70-80% an ath latha, nuair a chaidh an gluasad thairis le gluasad 20 nm (dlùth-shealladh) de seRNA nontargeting no siRNA a chaidh a stiùireadh gu mRNA an catalytic α fo-dh ’ramh C CX2, a’ cleachdadh 5 μl an riochdaire gluasaid SilentFectin (Bio-Rad) agus a ’leantainn stiùireadh an luchd-saothrachaidh. Mu 24 h nas fhaide air adhart, bha ceallan air an toirt a-null le ΔFosB plasmid mar a chaidh aithris gu h-àrd. Timcheall air 24 h an dèidh sin (∼48 h an dèidh tar-chuir siRNA), bha ceallan an dàrna cuid 32P lipéadú metabolic no mion-sgrùdadh pulse mar a tha air a mhìneachadh gu h-àrd. Chaidh na ceithir cROs CK2α a leanas a chleachdadh le toraidhean coltach ris: 5′P-CAAACUAUAAUCGUACAUCUU3 ′, 5′P-UCAAUCAU-GACAUUAUGCGUU3 ′, 5′P-UAGUCAUAUAAAUCUUCCGUU3 ′, 5′P-AAAUCCCUG ACAUCAUAUUUU3 ′ (Dharmacon, Lafayette, CO). Mar smachd àicheil, chleachd sinn Sàmhchair smachd àicheil #3 siRNA bho Ambion (Austin, TX). Chaidh meud CK2 sìos a sgrùdadh le casg dìon le bhith a ’cleachdadh antibody polyclonal anti-CK2 (catalog # 06-873 bho Upstate) thar oidhche aig caolú 1: 1000. Chaidh β-Tubulin a chleachdadh mar smachd luchdachaidh agus chaidh a lorg le antibod monoclonaigeach (catalog # 05-661 bho Upstate) thar oidhche aig caolachadh 1: 20,000.

Mì-rian air stiùireadh làraich.

Chaidh briseadh a-steach Ser27 gu Ala no gu Asp a choileanadh a ’cleachdadh uidheam atharraichte mutagenesis air atharrachadh atharrachadh làrach (Stratagene, La Jolla, CA) agus a’ leantainn stiùireadh an t-saothraiche. Gus na mùthaidhean Ser27 a thoirt a-steach don luchag ΔFosB protein, chaidh na prìomh phreasaichean mutagenesis a leanas a chleachdadh. Ser27 gu Ala: (prionnsabal cùil) 5′GCCGAAGGAGTCCACCGAAGCCAGGTACTGAGACTCGGCGGAGGG3 ′. Ser27 gu Asp (prionnsapal air adhart) 5′CCCTCCGCCGAGTCTCAGTACCTGGATTCGGTGGACTCCTTCGGC3 ′. Tha na bunan dùinte ann an clò trom, agus tha an codon Ser27 air a ’eadailteach.

Bith-eòlas.

Chaidh coimhead air làraichean agus kinases a dh ’fhaodadh a bhith ann airson BFosB le sreath pròtain lucha a chur gu stòran-dàta sònraichte, a’ gabhail a-steach ProSite (http://www.expasy.org/prosite/), PredictProtein (Rost et al., 2004), agus NetPhosK (Blom et al., 2004).

Tomhasadh dàta, àireamhachadh, agus staitistig.

Chaidh tomhas a dhèanamh air an ìre de phròtain a tha anns an PVDF no nitrocellulose meamran a ’cleachdadh Storm PhosphorImager agus an bathar-bog ImageQuant a tha na chois (Amersham Biosciences / Molecular Dynamics). Anns a ’chultar cealla agus rannsachaidhean fosfaffrais eanchainn na h-eanchainn, na luachan a gheibhear airson 32An uair sin chaidh pròtain le le P-label a roinn leis na luachan a fhuaireadh airson ΔFosB iomlan, agus an cur an cèill mar cho-mheas. Anns a ann vitro eòlas air a ’phosphorylation, meud na 32Chaidh an ainmeachadh mar P perFosB gach ball-dòrainn ΔFosB (stoichiometry) a thomhas mar a chaidh a mhìneachadh roimhe seo (Sahin et al., 2004). Chaidh gach tomhas a ghabhail taobh a-staigh raon líneachd na h-ionnsramaid a chaidh a chleachdadh. Chaidh paramadairean cinéiteach a thomhas a ’cleachdadh modal Michaelis-Menten, far an robh V = VMax[S] / ([S]+KM) agus VMax = k2[Eiomlan]. An leth-beatha (t1 / 2) de ΔFosB agus FosB air a thuairmse bho na plocan-slabhraidh (a ’cleachdadh an at-a-mach neo-loidhneach ab 'fheàrr a chuir na puingean dàta a-steach) agus a bhiodh a’ freagairt aig an àm a tha an pròtaran a tha air fhàgail a ’dèanamh 50% den bhun-stuth. Anns na figearan uile, tha na toraidhean a tha air an sealltainn nan riochdachadh air co-dhiù dà no trì deuchainnean neo-eisimeileach. Anns a h-uile graf, tha an dàta a th ’air a thaisbeanadh na cuibheasachd ± SEMan (3 ≤ n ≤16). Chaidh brìgh staitistigeil eadar-dhealachaidhean a mheas a ’cleachdadh inneal nach robh coltach ris t deuchainn, air a cheartachadh airson ioma choimeas, agus bidh na h-rionnagan a ’nochdadh p ≤ 0.05.

Earrann roimhe seoAn ath earrann

toraidhean

Tha BFosB na fhactar tarraingeach a tha gu math seasmhach

Ged a tha sinn air tuairmse a dhèanamh roimhe seo gur e transcriptionFosB a th ’ann am factar tar-sgrìobhaidh cuimseach seasmhach (Nestler et al., 2001, gu ruige seo cha deach mion-sgrùdadh dìreach a dhèanamh air pròifil malairt-thairis a ’phròtain. Gus dèiligeadh ris a ’cheist seo, rinn sinn deuchainnean cuisle-ruithe a’ cleachdadh PC12 ceallaichean, a chaidh a chleachdadh gu mòr mar loidhne cealla coltach ri neuron, anns an deach ΔFosB a chuir an cèill le gluasad tro ghalair le víreas ath-nochdadh herpes simplex (HSV-ΔFosB). Bha pròtainean ùra air an ath-shàthadh air an comharrachadh le meatabol 35S-Met / Cys, agus am pàtran truaillidh 35LedFosB air a chomharrachadh le sS (35Chaidh S-ΔFosB) a sgrùdadh le bhith a ’toirt a-steach a bhith a’ toirt a-steach e bho lysates cealla a fhuaireadh aig diofar amannan tìme às deidh toirt air falbh na h-aimneachan amino as radiolabeled. Sheall sgrùdadh air na neo-chnàmhan aig SDS-PAGE agus autoradiography gu bheil leth-beatha ΔFosB ann an ceallan PC12 ∼10 h (Fig. 1). Tha na toraidhean seo a ’sealltainn gu bheil leth-beatha ΔFosB nas àirde na na leth-fhactaran tar-chuir as fhasa (faic Deasbad), a’ gabhail a-steach FosB làn-ùine, a chaidh aithris gu bheil a leth-beatha ann an cultar cealla ∼90 min (Dobrazanski et al., 1991; Carle et al. 2004). A thuilleadh air an sin, is fhiach toirt fa-near nach eil am milleadh air BFosB a ’fighe a-steach cuim searbhasach ciad-ìre, ach an àite sin tha e biphasic, a’ tòiseachadh le ìre crìonaidh nas slaodaiche. Tha seo a ’comharrachadh gu bheil barrachd air aon ghnè ΔFosB agus / no barrachd air aon slighe dì-ghalachaidh.

Figear 1.

Seall dreach nas motha:

Figear 1.

Tha BFosB na fhactar tarraingeach a tha gu math seasmhach. Tha leth-beatha ΔFosB ∼10 h ann an cultar cealla. Chaidh ΔFosB a chur an cèill ann an ceallan PC12 le bhith a ’gabhail a-steach galair le HSV-ΔFosB no gluasaid gluasadach le plasmid anns a bheil ΔFosB-a-mach, agus chaidh deuchainnean a dhèanamh air na ceallan mar a chaidh a mhìneachadh ann an Stuthan agus Modhan. Chaidh toraidhean co-ionann fhaighinn ge bith dè an dòigh a chaidh a chleachdadh airson cus a bharrachd a chuir air ΔFosB. Tha an àireamh a ’sealltainn an cùrsa tìm (agus fèin-riaghailteach riochdachaidh) de ΔFosB degradation. Is e an dàta a tha air a chlàradh na cuibheasachd EM SEM de phuingean dàta fa leth fa leth a gheibhear bho co-dhiù còig deuchainnean neo-eisimeileach. Gus coimeas a dhèanamh, tha an leth-beatha aig a bheil aithisg air fad aig an neach-obrach làn-ùine air a chomharrachadh.

Tha ΔFosB na fhosphoprotein san eanchainn

Tha sinn air beachd a thoirt air gum faod atharrachadh alFosB thar-dh ’atharrachadh gu bhith a’ seasmhachd. Seach gu bheil e air a dhearbhadh gu bheil phosphorying ag atharrachadh fheartan tar-chuir ann an iomadh dòigh, a ’toirt a-steach an seasmhachd aca (airson ath-sgrùdadh, faic Desterro et al., 2000; Whitmarsh and Davis, 2000), rannsaich sinn an e ΔFosB a tha na phosphoprotein. Chun na h-ìre seo, chaidh expressionFosB express a ghluasad gu eanchainn radain a ’cleachdadh ECS abhaisteach, làimhseachadh a dh’ aithnichear gu ìrean àrda ΔFosB, gu h-àraidh ann an cortex aghaidh (Hope et al., 1994a). Aon latha às deidh an làimhseachadh ECS mu dheireadh, nuair a tha levels ìrean Bàrr fhathast a ’seasamh àrd, chaidh sliseagan tana searbh a dheasachadh agus a bhith air an comharrachadh le metabolically le 32P-orthophosphate. Cha deach seata co-shìnte de sliseagan a dhèanamh a-mach, agus chaidh iad sin a chleachdadh gus ìrean levelsFosB iomlan a lorg. An dèidh dha banachdach a thoirt a-mach le antibodadh sònraichte anti-FosB / ΔFosB agus sgaradh a dhèanamh eadar na pròtainean dìonachd le SDS-PAGE, phosphorylated 32Chaidh ledFosB a chomharrachadh le p-p le autoradiography, ach chaidh BFosB iomlan a lorg le casg dìon. Dh'fhoillsich am mion-sgrùdadh seo gu bheil ΔFosB air a fhillteadh ann an eanchainn, mar a chithear bho dhuine sònraichte 32Bann de P led35 kDa le leubailean P a ’nochdadh anns na sampaill eanchainn le làimhseachadh eanchainn, ach tha e cha mhòr neo-dhèanta anns na smachdan air an làimhseachadh leis an t-seòrsa (Fig. 2A). Tha seo co-chòrdail ris an t-suidheachadh gu bheil, às aonais brosnachaidh leantainneach, ìrean ìosal de BFosB gu math ìosal. Tha cho sònraichte sa tha an gluasad bho bhanachdachadh air a shealltainn leis an dìth chomharra sa ghnìomag nonimmune IgG.

Figear 2.

Seall dreach nas motha:

Figear 2.

Tha ΔFosB na fhosphoprotein san eanchainn. A, ΔFosB air a fhlosgadh anns an eanchainn. Bha ousFosB dùthchasach a ’adhbharachadh ann an eanchainn radain le làimhseachadh ECS cronail mar a chaidh a mhìneachadh ann an Stuthan is Dòighean. Bha sliseagan cortail ris an robh iad air an comharrachadh le meuran feallsanachd 32PH3PO4 airson grunn uairean a thìde. An dèidh a bhith a ’co-aonadh na sliseagan, chaidh BFosB a thoirt a-steach, agus phFosB a’ phosphorylated (32Chaidh P-ΔFosB) a lorg le autoradiography (prìomh phannal). Chaidh ΔFosB iomlan ann an neo-immunoprecipitates nonradioactive a lorg le bhith a ’toirt a-steach casg-dìon (am pannal aig a’ bhonn). Mar smachdan àicheil, chìthear dìon neo-phuntaig beathach air a chòmhdachadh le sam agus IGG nonimmune. B, Fhuaireadh làraich fosfachadh tagraichean agus kinases le comharran fàisneachd co-fhreagarrach airson sreath pròtain ΔFosB le bhith a ’sgrùdadh bith-chruth-eòlais. Tha na làraich tagraidh leis na sgòran ro-innse nas àirde air an comharrachadh ann an sreath pròtain agus air an liostadh sa chlàr. Tha an àrainn DNA-ceangail (bunaiteach) agus zipper leucine ann an clò trom ann an sreath pròtain. C, D, Tha ΔFosB phosphorylation air àrdachadh leis an t-seirbheisiche a tha an-sàs sa t-seirbheis / Thr phosphatase OA. C, 32Chaidh ìrean P-ΔFosB ann an neo-chuairteachadh a ’fàs bho sliseagan cortal bhon taobh a-muigh a tha air an ainmeachadh ann an dìth (Ctr) no làthaireachd 100 ng / ml OA (graf agus panal gu h-àrd) a lorg le autoradiography. Tha am pannal aig a ’bhonn a’ sealltainn ΔFosB iomlan a lorgar ann an dìonachd a ’chasg bho sliseagan nach deach an rùsgadh le bhith a’ toirt a-steach casg. D, Bha ceallan PC12 air an gabhail a-steach le HSV-ΔFosB no HSV-LacZ (feadan) agus le bhith air an comharrachadh le metabolically le 32PH3PO4 Le bhith an làthair (Ctr) no làthaireachd 100 ng / ml OA. 32Chaidh ìrean P-ΔFosB ann an in-imrichean a lorg le autoradiography (graf, pannal àrd). Tha am pannal aig a ’bhonn a’ sealltainn gu bheil ΔFosB iomlan a lorgar anns a ’chealla a’ nochdadh le bhith a ’toirt a-steach lagachadh.

Mar chiad cheum gu bhith a ’soilleireachadh dè an kinase (ean) agus an làrach (na) a tha an sàs ann an ΔFosB phosphorylation, chuir sinn na h-òrdughan amino searbhagach againn gu grunn anailis bith-eòlasach. Sheall seo, ged a tha sitesFosB anns nach eil làraichean tagraiche Tyr phosphorylation, tha e a ’gabhail a-steach grunn làraichean co-aonta Ser / Thr kinase, a’ gabhail a-steach trì làraich CaMKII, trì làraich CK2, agus dà làrach PKC le sgòran ro-innseadh glos-frìth àrd (Fig. 2B). Ma tha e, mar a chaidh a ràdh le bith-chruth-eòlas, ΔFosB air a dh ’fhuasgladh a-mhàin air fuigheall Ser no Thr, bu chòir dhan phosphorylacadh atharrachadh gu mòr le gnìomhachd phosphatases Ser / Thrust. Gus am beachd-bharail seo a dhearbhadh, chomharraich sinn sliseagan cortical aghaidh ris 32P-orthophosphate ann an làthair no gun a bhith OA, neach-cumail phosphatase pròtain pròtain. Mar a chithear ann Figear 2C, Dh'adhbhraich OA àrdachadh mòr (∼2.5)) 32P-ΔFosB. Dh'adhbhraich e cuideachd àrdachadh beag ann an ìrean ΔFosB iomlan, a tha co-chòrdail ri aithisgean roimhe sin a tha a ’ceangal buaidhean carcanaigineach a rèir comas a bhith a’ toirt a-steach grunn ginean tràth sa chiad, nam measg pròtainean Fostain (Miller et al., 1998; Choe et al., 2004). Is e an toradh lom gun robh àrdachadh mòr san fharsaingeachd (N60%) ann an ìrean ΔFosB 'a ’fho-mheas.

Rinn sinn rannsachadh an uairsin, an robh, ann an ceallan PC12, a tha nas fhasa cothrom obrachadh a dhèanamh le deuchainnean, showedFoB a ’nochdadh pàtran fosfònadh coltach ris an fheadhainn a chithear san eanchainn. Chuir sinn ΔFosB an cèill ann an ceallan PC12 tro ghalair le HSV-ΔFosB agus le bhith air an comharrachadh le meuran a bhith air an ainmeachadh anns na ceallan. 32P-orthophosphate an làthair no gun robh OA ann. Tha an abairt shoirbheachail agus dìleabadh pròtain bho cheallan HSV-ΔFosB-nochdadh air an làthaireachd anns an dà chuid anns an dìonachd (Fig. 2D, pannal aig a ’bhonn, agus an autoradiograph (panal aig a’ àrd-ìre) de chòmhlan ∼35 kDa, às-làthair anns na ceallan làn ghalaran. Mar a chaidh fhaicinn san eanchainn, dh'adhbhraich OA àrdachadh beag anns na h-ìrean ΔFosB ach tha àrdachadh mòr (mu dhà uiread) ann. 32P-ΔFosB, ag adhbharachadh àrdachadh mòr (∼50%) ann an ΔFosB phosphorylation. A bharrachd air sin, co-chòrdail ris na ro-mheasaidhean bith-eòlasach, cha robh atharrachaidhean mòra ann an làimhseachadh cheallan PC12 le bacadair Tyr phosphatase. 32Ìrean P-ΔFosB (chan eil dàta air a shealltainn). Còmhla, sheall na toraidhean sin gu bheil ΔFosB air a fhlosadh air fuigheall Seirbheis agus / no Thr an eanchainn agus ann an ceallan PC12 agus dhearbh iad gu bheil an fheadhainn mu dheireadh na shiostam cultar math cealla anns am faod iad tuilleadh rannsachaidh a dhèanamh air pròifilean pronnain agus truaillidh ΔFosB.

CK2 ach chan eil PKC no CaMKII phosphorylates ΔFosB ann vitro

Mar a chaidh a mhìneachadh gu h-àrd, nochd anailis air sequenceFosB de shearbhag searbhag amino le comharran fàisneachd àrd airson làraichean phosphorylation CK2, PKC, agus CaMKII. Gus co-dhùnadh dè am fear de na kinases sin a dh ’fhaodadh a bhith air a sparradh ΔRosB, rinn sinn sreath de ann vitro ath-bhualaidhean phosphorylation le bhith a ’cleachdadh kinases glante agus ath-shnàmh ath-shuidhichte ΔFosB. Mar a chithear ann Figear 3A, de na trì kinases tagraiche, chan eil ann ach CK2 a ’fosadh gu ìre mhòr. A thuilleadh air an sin, chaidh grunn kinases eile a dhearbhadh (me, GSK3 agus p70S6K) ach dh ’fhàillig iad gu mòr fosbhallasadh ΔFosB (cha deach dàta a shealltainn). Sheall caractar a bharrachd den fhreagairt CK2 a rèir sgrùdadh cùrsa ùine gu bheil an kinase seo a ’toirt cothrom air ∼0.5 mol de phosphate a’ chasg a dhèanamh anns a ’mhullach ΔFosB (Fig. 3B). Seach gum faod CK2 phosphorylate ΔFosB ann vitro gu ìre mhòr de stoichiometry (∼50%) a dh'innseas à freagairt a tha buntainneach gu physiologically. Chaidh sinn an uairsin an sgrùdadh a dhèanamh air cinèitig na h-ath-bhualaidh seo le bhith a ’guir CK2 ann an làthaireachd meud nas motha de ifiedFosB glanadh, agus cho-dhùin sinn gu bheil CK2 phosphorylates ΔFosB le Vmax de 5.8 pmol · min-1 · .G-1 de einsím, a KM de 18.4 μm, agus a kcat de 0.2 / s (Fig. 3C). Tha na luachan a gheibhear airson na crìochan gluasaid sin a ’toirt taic a bharrachd do bhuntanas fios-eòlasach an iom-freagairt seo. Mar eisimpleir, an KM de CK2 airson DARPP32, aon de na fo-fhillidhean as aithnichte, tha 3.4 μm, agus an kcat tha ∼0.3 / s (Girault et al., 1989); an KM airson raointean ATP bho ∼10-40 μm (Cochet et al., 1983; Silva-Neto et al., 2002), agus sin airson raointean casein bho ∼10 – 50 μm (Meggio et al., 1977; Pyerin et al., 1987). Le chèile, tha an dàta sin a ’sealltainn gu bheil ΔFosB na fo-fhilleadh bona fide airson CK2 ann vitro.

Figear 3.

Seall dreach nas motha:

Figear 3.

CK2 ach chan eil PKC no CaMKII phosphorylates ΔFosB ann vitro. Tha an autoradiograph (am panal aig a ’mhullach) a’ sealltainn an toradh phosphorylated, agus tha an deilbheadh ​​dathte Coomassie (am pannal aig a ’bhonn) a’ sealltainn ΔFosB iomlan san fhreagairt. A, Ath-choimeasadh ified ified to os B B B B B B B B B B B B B B B B B ’ ann vitro a ’coireachadh le iomadh kinases tagraiche (tha trì dhiubh a’ nochdadh). B, Tha anailis cùrsa ùine agus stoichiometrig a ’sealltainn gun urrainn do CK2 phosphorylate ΔFosB ann vitro le stoichiometry de ∼50%. C, Nochd sgrùdadh cinetach air an fhreagairt CK2 gu bheil ΔFosB na bona fide ann vitro fo-fhilleadh. Tha lìnigeadh a ’fhreagairt air a shealltainn ann am plota dà-thaobhach (bun), ach bha na paramadairean cinetach a’ tighinn bhon lùb Michaelis-Menten (mullach).

Tha CK2 a ’atharrachadh an phosphorylation agus seasmhachd ΔFosB ann an ceallan iomlan

Gus measadh a dhèanamh air iomchaidheachd fios-eòlasach phosphorylation CK2-mediated de tedFosB, rinn sinn mapadh phosphopeptide coimeasach a ’cleachdadh ann vitro phFosB. air a ’phosrachadh agus PC12-cell-phosphorylated ΔFosB. An dèidh SDS-PAGE agus glùin de thruailleadh 32P-ΔFosB (bhon ann vitro ath-bhualaidhean no bhon chnàmh-droma de 32Ceallaichean le le P-P), chaidh am pròtain a chnàmh le trypsin, agus bha sgaradh dà-thaobhach air na phosphopeptides a thàinig às. Dh'fhoillsich am mion-sgrùdadh seo gun deach a ’phrìomh bhratphopeptide bhon fhreagairt CK2 còmhla le aon de dhà mhòr phosphopeptides bho ΔFosB a tha air a dh’ fhulang le ceallan PC12 (Fig. 4A), ach nach do rinn am phosphopeptides a bha a ’tighinn bhon PKC no CaMKII (dàta a chaidh a shealltainn) freagairt. Bha dara phosFosB phosphopeptide ri fhaicinn anns a ’mhapa bho cheallan PC12, ach air sgàth 's nach robh gin de na kinases a rinn sinn sgrùdadh gus gin-eanchainn coltach ris a chruthachadh ann vitro, chan eil fios againn an-dràsta a bheil làrach phosphoryptide eadar-dhealaichte bhon phosphopeptide eile anns an dàrna phosphopeptide seo no co-dhiù a tha e a ’riochdachadh peptide tryptic sònraichte anns a bheil an aon làrach phosphorying.

Figear 4.

Seall dreach nas motha:

Figear 4.

Tha CK2 a ’atharrachadh an phosphorylation agus seasmhachd ΔFosB ann an ceallan iomlan. A, CK2 ach chan eil PKC a ’nochdadh gu bheil e a’ tionndadh ΔFosB ann an ceallan. Mapaichean phosphopeptide dà-thaobhach de ΔFosB a dh ’fhosgailte le CK2 no PKC ann vitro no le ceallan PC12 iomlan. Tha na saigheadan a ’sealltainn an in-imrich an peptide CK2-phosphorylated ach chan ann am fear PKC-phosphoryrated le aon de na phFosB phosphopeptides a gheibhear bho cheallan PC12. B, Thèid increasedFosB phosphorylation ann an ceallan PC12 a mheudachadh le bhith a ’làimhseachadh cheallan le spermine (SP) an gnìomhaiche neartmhor CK2 agus a lùghdachadh le làimhseachadh leis an CK2 inhibitor DRB. Ann an coimeas ri sin, cha robh buaidh air a bhith aig phFosB phosphorylation ann an ceallan PC12 le leigheas le gnìomhaiche PKC (PMA) no le inhibitor PKC-C (Cph). Tha autoradiogram riochdaire (panail àrd) agus immunoblot (panal aig a ’bhonn) air an sealltainn. C – F, Buaidh gnìomh CK2 air seasmhachd osFosB. Tha na figearan a ’sealltainn an cùrsa tìm (agus autoradiogram riochdachaidh) de ationFosB degradation. Ceallan PC12 a ’cur an cèill lyFosB air a bhith an sàs ann an deuchainnean cùbhraidh a chaidh a dhèanamh nuair a bha an CK2 inhibitor DRB ann no nach robh.C), an cleasaiche spermine CK2 (D), no an speactram farsaing kinase inhibitor H-8 (E), a chaidh a chleachdadh airson smachd a chumail air buaidhean neo-shònraichte DRB. F, A ’toirt buaidh air a’ toirt air falbh fo-bhuidheann cataigeach CK2 air seasmhachd ΔFosB. Chaidh ceallan PC12 a ghluasad a-steach le seRNA nontargeting (Ctr) no siRNA a bha ag amas air radan CK2α agus 24 h a chaidh a ghluasad a-rithist le ΔFosB plasmid. Tha am pannal gu h-àrd a ’nochdadh in-imrichean lys-cell làn a tha a’ sealltainn buaidh an CR2 siRNA air CK2 agus ìrean pròtain ΔFosB. Tha an immunoblot a tha co-fhreagarrach airson β-tubulin air a shealltainn mar smachd luchdaidh.

Gus dèiligeadh a-rithist ri buntanas fios-eòlasach CK2 mar ΔFosB kinase, làimhsich sinn ΔFosB-a ’nochdadh cheallan PC12 le dà dhruga a tha ag atharrachadh gnìomh CK2. Mar a chithear ann Figear 4B, Chaidh phFosB phosphorylation a lùghdachadh le bhith a ’làimhseachadh cheallan PC12 leis an neach-dìon CK2 cealla-lùbach DRB (Meggio et al., 1990; Szyszka et al., 1995), agus àrdachadh le leigheas leis an spermine polyamine, aithnichte mar gnìomhaiche neartmhor CK2 (Cochet agus Chambaz, 1983; Meggio et al., 1983). Ann an coimeas ri sin, làimhseachadh ceallan PC12 leis an neach-dìon PKC calphostin-C (Kobayashi et al., 1989; Tamaoki et al., 1990) no PMA gnìomhaiche PKC (Schmidt agus Hecker, 1975; Beh et al., 1989) nach do dh'atharraich e gu mòr ann am ΔFosB phosphorylation. Ann an cùis PMA, tha an àrdachadh beag (agus neo-chudromach) ann 32Dh'fhaodte cunntas a dhèanamh air P-byFosB mar àrdachadh anns na h-ìrean ΔFosB iomlan air an adhbhrachadh leis an druga seo; gu dearbh, tha e air aithris gu bheil phorbol a ’toirt a-steach dreach de phròtainean teaghlaich Fostain, a’ gabhail a-steach FosB (Yoza et al., 1992; Suh et al., 2004). A bharrachd air sin, làimhseachadh cheallan le m-AIP an neach-dìon sònraichte cealla-permeableIshida agus Fujisawa, 1995; Stevens et al., 1999) nach do bhuilich e cuideachd lùghdachadh air ΔFosB phosphorylation (chan eil dàta air a shealltainn). Còmhla, tha na toraidhean sin co-chòrdail ri ar n-obair ann vitro toraidhean agus a ’nochdadh gu bheil e coltach gu bheil CK2 a’ cur às do osFosB ach nach eil PKC no CaMKII. Seach nach eil CK2 casg air gu tur a ’cuir casg air ΔFosB phosphorylation tha seo a’ sealltainn gu bheil làraichean fosfair anns a ’phroit.

Rinn sinn sgrùdadh a-rithist an robh pàirt aig CK2 ann an luach-malairt ΔFosB agus mar sin na sheasmhachd. Chun na h-ìre seo, rinn sinn deuchainnean 'buille-cùil' a ’cleachdadh ΔFosB-in-bhith a’ sealltainn cheallan PC12 air an làimhseachadh le an neach-dìon CK2 no an gnìomhaiche CK2 a chaidh a chleachdadh anns an sgrùdadh phosphorylation. Mar a chithear ann Figear 4C, gun robh buaidh chudromach aig làimhseachadh cheallan le innsear CK2 DRB air ìre atharrachaidh ΔFosB, mar a chithear leis an atharrachadh ann an cumadh a lùb mhì-dhiadhaidh, bho biphasic gu lùb a tha nas fhaisge air sin le ìsleachadh sgaoilteach. Air an làimh eile, dh'adhbhraich làthaireachd spermine an gnìomhaiche CK2 gun robh lùghdachadh mòr ann an ìre dì-of osFosB, a dh'adhbhraich cruinneachadh pròtain aig toiseach uairean a ’chase (Fig. 4D).

Mar a tha le mòran de dhaoine a tha a ’dèanamh kinase agus a’ toirt buaidh air, is urrainn do spermine agus DRB buaidh meataigeach a thoirt a-mach air taobh a-muigh cruth-atharrachadh gnìomhachd CK2. Gu dearbh, chaidh a dhearbhadh gun robh DRB a ’bacadh a’ chùis tar-chuir IIH (TFIIH) -associated kinase (Yankulov et al., 1995), a tha ag adhbharachadh casg air tar-sgrìobhadh RNA polymerase II. Leis gum faodadh seo buaidh buaidh a thoirt air seasmhachd ΔFosB, rinn sinn anailis air buaidh an speactraim fharsaing kinase inhibitor H-8 (Hidaka agus Kobayashi, 1992) air ΔFosB malairteach aig dùmhlachd (200 μm) a tha fios gu bheil e a ’cur casg air kinase a tha co-cheangailte ri TFIIH ach nach eil CK2 (Yankulov et al., 1995). Mar a chithear ann Figear 4E, cha tug leigheas le H-8 buaidh air ìre atharrachaidh ΔFosB. Chaidh toraidhean coltach ri seo fhaighinn le H-7, neach-glèidhidh speactram eile kinase, a bha air a chleachdadh aig dùmhlachd a tha a ’bacadh kinase a tha ceangailte ri TFIIH ach nach eil CK2 (dàta gun nochdadh). Tha an dàta sin a ’toirt taic a bharrachd dhan eadar-mhìneachadh gu bheil e coltach gu bheil an lùghdachadh ann an seasmhachd BFosB air adhbharachadh le DRB ri linn casg air CK2.

Gus an tuilleadh leasachaidh a dhèanamh air àite CK2 ann an ΔFosB turnadh, rinn sinn sgrùdadh air a ’bhuaidh a bha aig cur sìos CK2 tro siRNA. Choilean sinn na deuchainnean seo le bhith a ’cleachdadh cheallan PC12 a chaidh a thar-chur an toiseach le smachd (nontargeting) siRNA no siRNA a tha ag amas air mRNA fo-bhroinn cataigeach radain CK2 (CK2α) agus 24 h an uair sin air an gluasad le ΔFosB. Mar a chithear ann Figear 4F, tar-chuir leis an CK2α siRNA gu h-èifeachdach agus gu sònraichte a ’leagail ìrean pròtain CK2α gun buaidh a thoirt air levelsFosB ìrean (prìomh phannal). Sheall sgrùdadh Pulse-chase gun do chuir leagail CK2 às gu meudachadh mòr ann an ìre atharrachaidh ΔFosB mar a chithear le truailleadh pròtain nas luaithe. Seach gu bheil àrdachadh CK2 (co-dhiù tro DRB làimhseachaidh no siRNA) a ’meudachadh an teachd-a-steach de ΔFosB agus a’ toirt às gu bhith a ’toirt às don phàirt reata mall den lùb biphasic, fhad's a tha CK2 a’ cur ris an astar slaodach den lùb, a ’toirt taic làidir dha am beachd gu bheil CK2 a ’cluich pàirt ann a bhith a’ riaghladh seasmhachd ΔFosB.

CK2 phosphorylates ΔFosB air Ser27

Gus tòiseachadh a ’comharrachadh an làraich / na làraich air osFosB a tha air a chuartachadh le CK2, rinn sinn sgrùdadh searbhagach phosphos-amino air ath-cho-cheangal ΔFosB phosphorylated le CK2 ann vitro agus de ΔFosB a tha air a fhilleadh ann an ceallan PC12. Nochd na deuchainnean sin gun robh, anns an dà chùis, an t-aon sheòrsa searbhag-amino a chaidh a lorg na phospho-Ser (Fig. 5A). An toradh seo, còmhla ris an stoichiometry a fhuaireadh airson an CK2 ann vitro (cxXXUM%) (Fig. 3B) agus gun robh ach aon àite sònraichte ann air mapa CK2 phosphopeptide (Fig. 4A, tha e coltach gu bheil CK2 phosphorylation de lationFosB air a chuingealachadh gu aon iar-sheat. Tha an co-dhùnadh seo co-chòrdail ri mion-sgrùdadh làrach co-aonta fosfraidh (Fig. 2B), a bha a ’sùileachadh dìreach aon shearbhadair de thagraiche, ie Ser27, airson CK2. Sheall sgrùdadh tagsonamach gu bheil Ser27 air a ghleidheil gu h-àrd tro ath-bheothachadh am measg buill teaghlaich Fosaidh (Fig. 5B), a 'moladh gur dòcha gu bheil gnìomh cudromach eòlas-inntinn air.

Figear 5.

Seall dreach nas motha:

Figear 5.

CK2 Phosphorylates ΔFosB air Ser27. A, Sgrùdadh searbhachd Phosphoamino air CK2-phosphorylated (ann vitroagus) agus PC12 cealla-phosphorylated ΔFosB a ’sealltainn, anns an dà chùis, gur e searmon a tha anns a’ mhòr-chuid de dh'fhiodh-fosgach. B, Sheall anailis thar-ghnè de rian searbhag amino FosB / ΔFosB gu bheil glèidhteachas àrd ann do Ser27 am measg buill teaghlaich Fosaidh bho dhuine gu zebrafish (aire dorcha). Ach, chan eil an còrr searbh aig suidheachadh + 3, a tha riatanach airson làrach co-aonta CK2, air a ghlèidheadh ​​(soilleireachadh aotrom). C, Bha ceallan HeLa air an toirt thairis le bhith a ’aon de na seòrsaichean ΔFosB (WT) no ΔFosB anns a bheil treòrachadh puing gus Ser27 le Ala (S27A) a chur an àite. Chaidh an ainm a chuir a-steach le ceallan ann an samhla 32PH3PO4 agus a ’làimhseachadh le carbad no le spermine (SP) gus CK2 a chur an gnìomh. Tha autoradiogram riochdaire (pannal àrd) agus immunoblot (pannal aig ìre ìosal) den ΔFosB immunoprecipitates a fhuaireadh air a shealltainn. Tha an dìonachd a tha a ’toirt air ceallan breug-transfected (vector) air a shealltainn.

Gus faighinn a-mach a bheil Ser27 air a phosphorylated ann an ΔFosB, chuir sinn sìos an còrr seo gu Ala, agus rinn sinn anailis air na buaidhean air inbhe phosphorylation anns a ’phroit. Chun na h-ìre seo, chleachd sinn ceallan HeLa (a dh ’fhaodar a ghluasad le èifeachdachd nas àirde) gus an aon rud WT no S27A antFosB a chur an cèill. Mu 24 h an dèidh tar-chuir, bha ainm sgrìobhte le meuran a-mach air na ceallan 32Chaidh p-orthophosptete, agus liosan cealla slàn a dheasachadh. An dèidh banachdach leantail agus SDS-DUILLEAG, 32Chaidh P-ΔFosB a lorg le autoradiography agus ΔFosB gu h-iomlan le bhith a ’toirt a-steach lagachadh. Mar a chithear ann Figear 5C (am pannal aig a ’bhun), cha deach ΔFosB a lorg anns na ceallan tar-ghluasadach vector, ach chaidh na pròtain a thaisbeanadh gu soirbheachail le ceallan a chaidh an gluasad le WT no S27A mutant ΔFosB. Fhuair sinn a-mach gun do dh'adhbhraich gluasad S27A lùghdachadh mòr (∼30%) ann 32Ìrean P-ΔFosB (Fig. 5C, panail is graf gu h-àrd, a ’comharrachadh gu bheil ΔFosB air a sheachnadh air Ser27 ann an ceallan beò. Ann an oidhirp gus faighinn a-mach a bheil CK27 gu dearbh air a chuir às a chèile ann an ceallan Ser2, rinn sinn coimeas eadar comas spermine an CK2 a bhith a ’atharrachadh fosfair le WT agus S27A ΔFosB. Mar a bha sinn air fhaicinn roimhe seo ann an ceallan PC12 (Fig. 4B), làimhseachadh cheallan HeLa le pronnas-spor mòr a tha a ’fàs gu mòr ann am pròtain WT. Leis gun robh a ’bhuaidh seo air a lùghdachadh gu mòr leis an treòrachadh S27A (Fig. 5C) a tha a ’toirt taic don eadar-mhìneachadh gu bheil Ser27 ann an ΔFosB na fho-ionad fios-eòlasach airson CK2.

Tha phosphorylation de Ser27 a ’riaghladh seasmhachd ΔFosB

An dèidh dearbhadh gu bheil seasmhachd ΔFosB air lùghdachadh nuair a tha CK2 air a bhacadh agus air àrdachadh nuair a tha CK2 air a ghnìomhachadh (Fig. 4), agus gu bheil CK2 a ’co-èigneachadh XFosB air Ser27 (Fig. 5), bha sinn a ’sùileachadh gum bu chòir casg a chur air a bhith a’ cuir casg air a ’phoit anns an àite seo. Tha deuchainnean Pulse-chase air an dèanamh le ceallan HeLa ag innse an dara cuid WT no S27A mutant ΔFosB air nochdadh, mar a chaidh a ro-innse, gun do lean treòrachadh S27A gu meudachadh mòr anns an ìre de truagh ΔFosB, agus lùghdachadh ann an leth-beatha an pròtain. (Fig. 6A). An uair sin rannsaich sinn an robh an dòigh riaghlaidh seo cuideachd a ’tachairt air an loidhne cealla PC12 a tha nas coltaiche ri nuron. Nochd na deuchainnean sin, mar a bha sinn a ’faicinn ann an ceallan HeLa, gun adhbharaich mùthadh puing S27A leths mòr ann an leth-beatha ΔFosB ann an ceallan PC12 (bho ∼11 gu ∼4 h) (Fig. 6B). Seach gu bheil an gluasad seo coltach ris an fhear seo a dh ’adhbharaicheas CK2 casg no cnagadh sìos (Fig. 4) a ’toirt taic a bharrachd don bheachd gu bheil phosphorylation le CK2-mediated de Ser27 a’ riaghladh seasmhachd ΔFosB. Chaidh fianais a bharrachd airson dreuchd riaghlaidh Ser27 phosphorylation air protein atharrachadh-pròta prìosain ΔFosB a chleachdadh le bhith a ’cleachdadh phosphomimetic Ser27 gu bhith a’ dèanamh sgudal asp (S27D). Thathas a ’beachdachadh air sopaidh S27D mar phosphomimetic, oir tha e a’ cur buidheann mòr (càrboxyl) le prìsean àicheil air a chuir aig searbhag amino 27 agus mar sin a bhith ag atharrais pàirt de dh'fhosfarachd Ser27. Mar a chithear ann Figear 6C, dh'adhbharaich a ’chaochnadh S27D a’ bhuaidh mu choinneamh an treurachaidh S27A agus dh'adhbhraich e gu robh pròtain mòran nas seasmhaiche na am pròta WT. Coltach ris a ’bhuaidh a fhuaireadh às deidh gnìomhachadh CK2 (Fig. 4D), lean an treòrachadh S27D anns a ’chruinneachadh agus mar sin mheudaich e osFosB ìrean rè a’ chiad uairean a thìde de ruaig.

Figear 6.

Seall dreach nas motha:

Figear 6.

Tha Phosphorylation de Ser27 a ’riaghladh seasmhachd ΔFosB. A, C, Mion-sgrùdadh Pulse-chase a ’sealltainn buaidh fàireadaireachd Ser27 air ìre atharrachaidh rateFosB. Tha am pròifil dì-mheasgaichte agus tuairmse de leth-beatha de seòrsa fiadhaich ΔFosB (WT), an Ser27 gu Ala mutant (S27A), agus an phosphomimetic Ser27 gu Asp mutant (S27D) air an sealltainn. Fhuaireadh na h-aon cho-dhùnaidhean anns na ceallan HeLa (Aagus) ceallan PC12 (B, C).

Tha Ser27 phosphorylation a ’cumail suas ΔFosB le bhith a’ cuir casg air a mhilleadh proteasomal

Gus tòiseachadh a ’glanadh a-mach an dòigh anns a bheil sìol-sgaoileadh Ser27 a’ suidheachadh BFosB, rinn sinn sgrùdadh air comas nan in-dhìonadairean dìonach MG132 (Palombella et al., 1994; Tsubuki et al., 1996) agus epoxomicin (Hanada et al., 1992; Kim et al., 1999) a bhith ag atharrachadh ìre lughdachaidh WT agus S27A mutant ΔFosB. Chaidh deuchainnean Pulse-chase a dhèanamh le bhith a ’cleachdadh cheallan PC12 air an robh an eanchainn le HSV ath-cho-chuingichte a chuir an cèill WT no S27A ΔFosB agus a chaidh a làimhseachadh le DMSO no aon de na dhà in-dìon. Nochd na deuchainnean sin gu bheil ìre dì-phrothaid a ’phròg WT an ìre mhath neo-mhothachail ri làthaireachd an dà chuid de na bacadairean dìonach (Fig. 7A), tha an S27A mutant mothachail air na drugaichean seo (Fig. 7B). Tha seo a ’sealltainn gu bheil, eu-coltach ris a’ phroit WT, gu bheil an mutant S27A mar thargaid de mhilleadh pròstanach. Gu dearbh, chaidh làimhseachadh cealla le MG132 no epoxomicin a thionndadh gu h-iomlan buaidh an treurachaidh S27A air ìre dì-Δ osFosB, le fianais bho àrdachadh ann an leth-beatha an S27A mutant bho ∼4 gu ∼9 h airson MG132 agus ∼ 12 h airson epoxomicin (Fig. 7B). Le chèile, tha na toraidhean seo a ’sealltainn gu bheil fos-lus osFosB air Ser27 a’ dìon a ’phroitinn bho dhroch-phròtain pròtainteach agus mar sin tha e riatanach airson a stèidhealachd neo-àbhaisteach.

Figear 7.

Seall dreach nas motha:

Figear 7.

Tha phosphorylation de Ser27 a ’suidheachadh ΔFosB a’ stàlachadh le bhith a ’cuir casg air a mhilleadh pròbhailteach. A, B, Mion-sgrùdadh Pulse-chase le ceallan PC12 le HSV a tha a ’nochdadh pròifil dì-measail agus leth-beatha measta de seòrsa fiadhaich typeFosB (Ano no S27A ΔFosB (B) a thaobh an dàrna cuid de na bacadairean dìon-dìon [MG132 agus epoxomicin (Epoxo)] no a bhith an làthair. Thoir fa-near gu bheil buaidh mhòr aig an dara cuid de dhrogaichean air gluasad a-steach seòrsa-fiadhaich ΔFosB, ach gun do chuir làimhseachadh cheallan le teannaiche dìonas air bun-stèidh S27A ΔFosB. C, Modail airson dreuchd Ser27 phosphorylation ann an comas ΔFosB airson plaidearachd eanchainn fad-ùine a thoirt seachad. Aon uair is gu bheil iad air an toirt a-steach, tha cuibhreann de ΔFosB air a bhunailteadh ann an eanchainn leis a ’phosphorylation le CK2-mediated de S27. Tha seo a ’toradh gu bheil e a’ cruinneachadh, agus bidh seo an uair sin a ’toirt atharrachaidhean fad-ùine ann an sloinneadh gine. Tha na h-atharrachaidhean seasmhach sin ann an taisbeanadh gine a ’cur ri atharrachaidhean giùlain seasmhach. Air an làimh eile, tha dephosphorylation de S27 leis an Ser / Thr phosphatases PP1 agus / no PP2A a ’toirt gu buil a bhith a’ suidheachadh an pròtain agus a ghiollachd leis an t-innealradh dìon.

Earrann roimhe seoAn ath earrann

Deasbaireachd

Anns an sgrùdadh a th ’ann an-dràsta, tha sinn a’ sealltainn gu bheil lifeFosB aig leth-beatha de ∼10 h ann an cultar cealla, a tha ga dhèanamh seasmhach ann an coimeas ri FosB fad-ùine agus a ’eile a dh’ fhaodadh a bhith ag atharrachadh. mar bheagan mhionaidean agus is ann ainneamh a thèid iad seachad air 3 h (Hann agus Eisenman, 1984; Dobrazanski et al., 1991; Roberts agus Whitelaw, 1999; Ferrara et al., 2003; Hirata et al., 2004). A bharrachd air sin, bidh sinn a ’lorg gu bheil ΔFosB air a fhlosgadh anns an eanchainn agus gu bheil a phosphorylation mothachail do shearbhag okadaic an PP1 / PP2A. Tha na sgrùdaidhean air cultar cealla againn a ’sealltainn gu bheil seasmhachd ΔFosB air atharrachadh le CK2, le gnìomhachd CK2 nas àirde a’ suidheachadh an pròtain. Mu dheireadh, tha na co-dhùnaidhean againn a ’moladh gu bheil CK2 phosphorylates tesFosB air serine N terminus air a ghlèidheadh ​​gu mòr (S27) agus a’ taisbeanadh gu bheil phosphorylation de S27 a ’dìon ΔFosB bho dhroch-phròtain proteasomal. Mar sin tha sinn a ’moladh modail far a bheil fosfònadh ΔFosB air S27 le CK2 mar mheadhan riaghlaidh breithneachail de FosB (Fig. 7C). Tha stèidheachadh ΔFosB mar mheadhan air a bhith a ’cosg seo a’ ciallachadh, oir chaidh sealltainn gu bheil ìrean ΔFosB gu sònraichte de roinnean eanchainn air an dearbhadh gu bheil iad a ’riaghladh gu leòr gineachan neuronal. ann am vivo agus a bhith a ’toirt buaidh làidir air gluasadan ann am modalan bheathaichean de ghrunn de dhroch dhuilgheadasan neuropsychiatric (faic Ro-ràdh).

Ged is e dòigh luath agus ath-dhèanta a th ’ann am phosphorylation airson gnìomh ath-òrdachaidh ann an cuid de fheartan tar-sgrìobhaidh sònraichte, leithid CREB (pròtain ceangailte ri freagairt cAMP) a riaghladh (Bohmann, 1990), tha a bhith a ’atharrachadh dh’ fhalamhachadh ann an factaran tar-chuir a ’toirt cruth riaghailteach nas cumhachdaiche (nach gabh ath-dhèanamh gu furasta)Desterro et al., 2000). Am measg nam factaran tar-sgrìobhaidh a tha a ’dèanamh gnìomhachd obrachail air an riaghladh aig ìre an truaillidh tha NFκB (Desterro et al., 2000), c-Myc (Sears et al., 1999), agus c-Fos (Ferrara et al., 2003), am measg feadhainn eile. Ann am mòran shuidheachaidhean, tha fosflaidean na phrìomh riaghailt air seasmhachd inneal tar-chuir, mar a chaidh a shealltainn dha c-Fos (Okazaki agus Sagata, 1995; Tsurumi et al., 1995), Antigen-co-cheangailte ri Fostain-1 (Fra-1) (Vial agus Marshall, 2003), Fra-2 (Manabe et al., 2001), c-Jun (Fuchs et al., 1996), JunB (Fuchs et al., 1997), ATF2 (Fuchs et al., 2000), agus p53 (Buschmann et al., 2001). Mar sin bidh na sgrùdaidhean againn a ’cur BFosB ris an liosta seo de fhactaran tar-chuir anns a bheil an gnìomh gnìomhachail air an riaghladh tron ​​stàit a tha an eisimeil phosphoryled.

Tha CK2 na Ser / Thr kinase uile-ghnìomhach agus gu gnìomhach gnìomhach anns a bheil> 300 substrathan dearbhte air an comharrachadh gu ruige seo agus tha e an sàs ann an grunn phròiseasan bith-eòlasach, a ’toirt a-steach bàs cealla agus mairsinn beò (Litchfield, 2003; Unger et al., 2004), freagairtean cuideam craicinn (Yanagawa et al., 1997; Kato et al., 2003), agus càradh DNA agus ath-dhealbhadh chromatin (Barz et al., 2003; Krohn et al., 2003). Is e barrachd air trian de na fo-shruthan cuirp de CK2 pròtainean a tha an sàs ann an riaghladh sloinneadh gine (Meggio agus Pinna, 2003). Gu dearbh, chaidh a dhearbhadh gu bheil CK2 air a bhith na kinase niùclasach follaiseach (Krek et al., 1992) (airson ath-sgrùdadh, faic Yu et al., 2001) agus a bhith ag eadar-obrachadh le àrainnean bZIP de dh'iomadh feart-tar-chuir (Yamaguchi et al., 1998). Chaidh sealltainn cuideachd gu bheil phosphorylation le CK2-mediated air a ’mhùchadh (gu bhith ag àrdachadh no a’ lughdachadh) de dh'iomadh pròtain, a ’gabhail a-steach IkBSchwarz et al., 1996), PTEN (Torres agus Pulido, 2001), co-cheangal lionsa (Yin et al., 2000), pròtain co-cheangailte ri cromatin HMG1 (Wisniewski et al., 1999), agus grunn fhactaran tar-sgrìobhaidh leithid HMGB (Stemmer et al., 2002), Myf-5 (Winter et al., 1997), agus c-Myc (Channavajhala agus Seldin, 2002). Tha CK2 as pailte ann an eanchainn (Alcazar et al., 1988; Girault et al., 1990), agus tha a ghnìomh air a bhith co-cheangailte ri mòran taobhan de obair na h-eanchainn, a ’toirt a-steach seasmhachd neuronal (Boehning et al., 2003), eadar-dhealachadh (Nuthall et al., 2004), gnìomh an t-sianail ian (Jones agus Yakel, 2003; Bildl et al., 2004), agus neartachadh fad-ùine agus plasticity neuronal (Diaz-Nido et al., 1992; Lieberman and Mody, 1999; Reikhardt et al., 2003).

A dh'aindeoin na fianais fhàsmhor sin airson àite CK2 ann an riaghladh gnìomh neuronal, tha glè bheag de dh'fhiosrachadh mu dè a tha a ’riaghladh a ghnìomhachd. Thathas den bheachd gu bheil CK2 gnìomhach gu h-obrachail, le riaghladh a chomas air fosglaidhean sònraichte a sgaoileadh a tha gu mòr an urra ri atharrachaidhean sa chuain ionadail (me, cytosol vs nucleus) (Ahmed agus Tawfic, 1994; Yu et al., 1999). Tha am fiosrachadh seo a ’togail ceist chudromach a thaobh na comharran a dh’ fheumas gus ΔFosB a chruinneachadh ann an eanchainn às deidh brosnachadh leantainneach (Fig. 7C). Is e aon riatanas a bhith a ’cur air adhart an ath-aithris altram gine agus inntrigeadh ΔFosB mRNA (Chen et al., 1995). Tha ar dàta a ’sealltainn gu bheil CK2 phosphorylation de ΔFosB riatanach airson a sheasmhachd, a’ moladh gum feumar dàrna comharra airson buaidhean fad-ùine ΔFosB air abairt gine, is e sin, comharra a tha a ’brosnachadh cnà-mheas pròtain le CK2. Dh'fhaodadh seo a bhith a ’toirt a-steach CK2 a chur an gnìomh le beagan dòigh neo-aithnichte no an gluasad gu an niùclas. Air an taobh eile, dh ’fhaodadh gum bi CK2 phosphorylation de ΔFosB bunaiteach, mar a bhios proteinFosB protein air eadar-theangachadh mar fhreagairt do gach brosnachadh, bidh cuibhreann dheth ga fhilleadh agus mar sin air a shocrachadh, gus am bi ath-bhrosnachadh a’ toirt gu ìre àrd ann an neurons buaidh.

Tha na toraidhean againn a ’sealltainn gur dòcha nach e CK2 agus S27 an aon kinase agus làrach a tha an urra ri ΔFosB phosphorylation, oir cha robh casg air CK2 no air an mutation S27A comasach air casg iomlan a chuir air lationFosB phosphorylation. Air an aon dòigh, tha an fhìrinn gu bheil an gluasad S27A a ’toradh lùghdachadh 30% ann am phospho-ΔFosB ag argamaid gu bheil S27 na làrach mòr phosphorylation air a’ phroit. Tha sinn, ge-tà, a ’sgrùdadh làraich kinases putanaich eile agus làraichean phosphorylation air ΔFosB. Aig a ’cheann thall, bidh e cudromach sgrùdadh a dhèanamh air fosglan S27 agus làraichean fosfair sam bith eile ann an ΔFosB ann an eanchainn ann am vivo às dèidh diofar sheòrsaichean brosnachadh cràbhach, mar eisimpleir, tro bhith a ’cleachdadh anti-spectrometry no antibodies gnèitheach.

Mar a chaidh a luaidh gu h-àrd, tha S27 ann an ΔFosB air a ghleidheil gu mòr tro leasachadh agus am measg pròtainean teaghlaich teaghlaich eile. Ach, chan eil an làrach aonta airson CK2: mar a chithear ann Figear 5B, chan eil fuigheall searbh aig + 2 aig ach FosB / ΔFosB (agus an xenolog Seabhag-mhara), ach chan e c-Fos no Fra-3, prìomh cho-dhùnadh air CK2 fosphorylation (Marin et al., 1986; Meggio et al., 1994). Mar sin, dh'fhaodadh dìth CK2 phosphorylation air S27 mìneachadh carson nach eil pròtainean teaghlaich Fos eile cho seasmhach ri ΔFosB. Ach, chan eil seo a ’mìneachadh carson nach eil FosB làn-ùine, aig a bheil an làrach co-aonta CK2 mar ΔFosB, air a bhunailteachadh mar an ceudna. Chan eil fios againn a bheil CK2 a ’fosrachadh thairis air FosB fad-ùine air an stuth glèidhte seo. Na h-aon aithisgean mu FosB (Skinner et al., 1997) agus c-Fos (Okazaki agus Sagata, 1995; Chen et al., 1996) a bheil phosphorylation a ’mìneachadh làraich anns na sgìrean C-terminal de na protainean sin, a tha neo-làthaireach ann an ΔFosB. Tha feum air sgrùdadh dìreach mar thoradh air a ’chomas a bhith a’ frithealadh fosb fad-ùine agus pròtainean eile ann an teaghlach teaghlaich le CK2. Ach, fiù's ged a tha iad fo-dhuilleagach, tha fios gu bheil protastan anns na pròtainean teaghlaich eile Fosglaidh anns an teirm C aca a dh ’amas air na pròtainean airson truailleadh luath (Papavassiliou et al., 1992; Jariel-Encontre et al., 1997; Acquaviva et al., 2002). Mar eisimpleir, chaidh a shealltainn gu bheil pìos de ∼21 fuigheall a tha an làthair aig ceann-uidhe C de phròtainean teaghlaich Fos, ach nach eil ann an osFosB, ag obrachadh mar àrainn de-sheasmhach airson c-Fos (Acquaviva et al., 2001). Fhuair sinn a-mach ged a tha an t-sreath seo a ’gearradh an ìre mhath làn-altraim fad-ùine (Carle et al., 2004), chan eil cion an raoin seo ann an ΔFosB a ’toirt làn chunntas air a stèidhealachd. An àite sin, tha e coltach gu bheil an cothlamadh de dh ’aonais an àrainn C terminus seo agus Ser27 phosphorylation làn cunntas air an eadar-dhealachadh timcheall air còig uiread ann an seasmhachd eadar ΔFosB agus FosB.

Ged a tha a ’briseadh sìos pròtainean teaghlach Fosgail iom-fhillte agus nach eilear a’ tuigsinn gu h-iomlan, tha e coltach gu bheil truailleadh pròtainteach na phrìomh shlighe a tha an sàs (Salvat et al., 1999; Acquaviva et al., 2002; Ferrara et al., 2003). Tha dàta a tha air a thaisbeanadh an seo, far nach eil luchd-dìon proteasomal ag atharrachadh reata ΔFosB degradh gu mòr, ag argamaid gu bheil unlikeFosB a ’toirt dìon don dìon-dìon 26S, agus tha seo gu mòr aig teis-meadhan a neartachadh. Mar sin tha sinn a ’moladh sgeama far a bheil seasmhachd nas àirde ΔFosB ceangailte ris a’ chothlamadh de dhà phrìomh adhbhar: (1) dìth raon à-sgaraidh C-crìche agus (2) fosfachadh s27 le CK2.

Ann an geàrr-chunntas, tha an rannsachadh a th ’ann an-dràsta a’ toirt seachad sealladh meacanaigeach air carson a tha ΔFosB, toradh a ’gine a dh’ fhalbh sa bhad altram, a tha, eu-coltach ris a h-uile neach-obrach eile ann an Fosgladh, pròtain caran fada beò. Ged a thathas den bheachd gu bheil pròtainean coimhearsnachd teaghlaich Fos eile a ’gineadh eadar-ghluasad luath no gluasadach (a’ ceangal ri chèile) (Morgan agus Curran, 1995), tha seasmhachd choimeasach ΔFosB a ’toirt a-steach dha a bhith comasach air atharrachaidhean tar-sgrìobhaidh fad-ùine a dh'adhbhraich gluasad brosnachail a thoirt seachad. Tha seo a ’toirt taic don bheachd gu bheil BFosB ag obair mar shiostam mùlamaich leantaileach san eanchainn, ag atharrachadh a-mach gu mall gu bhith a’ gabhail ri atharrachaidhean gnàthach. A ’comharrachadh sorbheireachas Ser27 mar mheadhan bunaiteach airson seasmhachd ΔFosB a’ fosgladh sligheichean ùra airson dòigh a leasachadh airson obair ΔFosB a riaghladh agus mar sin a bhith ag atharrachadh a bhuaidh fhad-ùine air plasticity giùlan agus giùlan.

Earrann roimhe seoAn ath earrann

Footnotes

  • Fhuair mi 21 Samhain, 2005.
  • Ath-bhreithneachadh a fhuaireadh a thàinig sa Ghearran 21, 2006.
  • Gabhadh ris a ’Ghiblean 2, 2006.
  • Chaidh taic a thoirt don obair seo le Duais Caidreachas Nàiseanta airson Rannsachadh air Schizophrenia agus Neach-sgrùdaidh Ìsleachadh Òga do PGU, Duais Seirbheis Rannsachaidh Nàiseanta airson Institiùd Dhrogaichean (NIDA) do PGU, agus tabhartasan bhon Institiud Nàiseanta airson Slàinte Inntinn agus NIDA gu EJN taing don Dr. James Bibb airson a chuideachaidh leis ann vitro measgachaidhean fosfair, an Dotair Ming-Hu Han airson a bhith a ’cuideachadh le bhith a’ ullachadh sliseagan na h-eanchainn airson lipéadú metabolig, agus an Dr Rachael Neve airson a cuideachaidh le pacadh nam HSVan ath-bhoghach.
  • Seòladh gnàthach G. Rudenko: Institiud Saidheansan Beatha agus Roinn Pharmacology, Oilthigh Michigan, 210 Washtenaw Avenue # 3163A, Ann Arbor, MI 48109-2216.
  • Bu chòir litrichean a chur gu Eric J. Nestler, 5323 Harry Hines Boulevard, Dallas, TX 75390-9070. Post-d: [post-d fo dhìon]

Earrann roimhe seo

 

iomraidhean

Acquaviva C, Brockly F, P Ferrara, Bossis G, Salvat C, Jariel-Encontre I, Piechaczyk M (2001) Aithneachadh suaicheantas trìpeptide C-terminal a tha an sàs ann an smachd le truailleadh luath pròtainteach de c-Fos proto-oncoprotein rè atharrachadh ìre G (0)-gu-S. Oncogene 20:7563–7572.

SgaoileadhMedline

Acquaviva C, Bossis G, Ferrara P, Brockly F (2002) Slighean lughdachaidh ioma-dhèante airson pròtainean teaghlaich Fostain. Ann NY Acad Sci 973:426–434.

Medline

Ahmed K, Tawfic S (1994) Slat-tomhais riaghladh in-smachd a dhèanamh air kinase pròtain CK2: dreuchd comann fo-eanail brosnachail. Cell Mol Biol Res 40:539–545.

Medline

Alcazar A, Martin E, Lopez-Fando J, Salinas M (1988) Dòigh glanadh leasaichte agus feartan casein kinase II bhon eanchainn. Res Neurochem 13:829–836.

SgaoileadhMedline

Andersson M, Westin JE, Cenci MA (2003) C Time rsa ama de im-d act itealachd d ta s sònraichte DeltaFosB agus m NA R R od od prodynorphin after s an d s a bhith a ’toirt stad air làimhseachadh dopaminomimetic cronach. Eur J Neurosci 17:661–666.

SgaoileadhMedline

Barz T, K Ackermann, Dubois G, Eils R, Pyerin W (2003) Tha sgàthan-deasachaidh air feadh ginealach a ’nochdadh dreuchd dhomhanta airson pròtain kinase CK2 ann an ath-dhealbhadh chromatin. J Cell Sci 116:1563–1577.

Geàrr-chunntas / Teacs an-asgaidh

Beh I, Schmidt R, Hecker E (1989) Tha dà isoths de PKC a lorgar ann an ceallan HL-60 a ’sealltainn eadar-dhealachadh ann an gnìomhachadh leis a’ phorbol ester TPA. Ceanglaichean taic 249:264–266.

Medline

Bildl W, Strassmaier T, Thurm H, Andersen J, Eble S, Oliver D, Knipper M, Mann M, Schulte U, Adelman JP, Fakler B (2004) Tha Protein kinase CK2 air a cho-fholladh le giùlan beag Ca (2 +) - sianalan K + air an gnìomhachadh agus a ’riaghladh geatadh seanail. Neuron 43:847–858.

SgaoileadhMedline

Bing G, Wang W, Qi Q, Feng Z, P Hudson, Jin L, Zhang W, Bing R, Hong JS (1997) Cur an cèill fad-ùine de antigen a tha ceangailte ri Fos agus abairt gluasadach de delta FosB co-cheangailte ri glacaidhean anns an radan hippocampus agus striatum. J Neurochem 68:272–279.

Medline

T N N, Sicheritz-Ponten T, Gupta R, Gammeltoft S, Brunak S (2004) A ’nochdadh ro-innse glycosylation iar-eadar-dhèanta agus fosphoryleadh pròtainean bhon t-sìol searbhagach amino. Proteomics 4:1633–1649.

SgaoileadhMedline

Boehning D, Moon C, Sharma S, Hurt KJ, Hester LD, Ronnett GV, Shugar D, Snyder SH (2003) Neurotransmission carbon monocsid air a chur an gnìomh le CK2 phosphorylation de omegengenase-2. Neuron 40:129–137.

SgaoileadhMedline

Bohmann D (1990) Fosfilidh bho fhactaraidh tar-chuir: ceangal eadar tar-chuir chomharran agus riaghladh abairtean gine. Cealla Aillse 2:337–344.

Medline

T Bus (2001) Tha an t-Òg-mhios NH2-terminal kinase phosphorylation de p53 air Thr-81 cudromach a thaobh bunailteadh p53 agus gnìomhan tar-sgrìobhaidh mar fhreagairt air cuideam. Mol Cealla Biol 21:2743–2754.

Geàrr-chunntas / Teacs an-asgaidh

Carle TL, Ulery PG, Nestler EJ (2004) Tha neo-làthaireachd fearann ​​C-terminal teaghlach Fos glèidhte a ’cur ri seasmhachd sònraichte deltaFosB. Soc Neurosci Abstr 30: 692.2.

Channavajhala P, Seldin DC (2002) Eadar-obrachadh gnìomhach air pròtain kinase CK2 agus c-Myc ann an lymphomagenesis. Oncogene 21:5280–5288.

SgaoileadhMedline

Chen J, Nye HE, Kelz MB, Hiroi N, Nakabeppu Y, Hope BT, Nestler EJ (1995) Riaghladh air delta FosB agus pròtainean FosB-coltach ri glacaidhean electroconvulsive agus làimhseachadh chocain. Mol Pharmacol 48:880–889.

Abstract

Chen J, Kelz MB, Hope BT, Nakabeppu Y, Nestler EJ (1997) Antigens co-cheangailte ri àiteachas leantainneach: caochlaidhean seasmhach de ΔFosB air an toirt a-steach san eanchainn le làimhseachadh leantainneach. J Neurosci 17:4933–4941.

Geàrr-chunntas / Teacs an-asgaidh

Chen RH, Juo PC, Curran T, Blenis J (1996) Tha phosphorylation de c-Fos aig an C-terminus a ’leasachadh a ghnìomhachd cruth-atharrachaidh. Oncogene 12:1493–1502.

Medline

Choe ES, Parelkar NK, Kim JY, Cho HW, Kang HS, Mao L, Wang JQ (2004) Tha an t-searbhag oceadaic phosphatase pròtain 1 / 2A a ’fàs nas motha agus a’ cuir a-steach siongaraidh anns an reithe striatum in vivo. J Neurochem 89:383–390.

SgaoileadhMedline

Cochet C, EM Chambaz (1983) Phosphorylations pròtain polyamine-mheadhanaichte: targaid a dh'fhaodadh a bhith ann airson gnìomh polyamine ion-ghlasach. Mol Cell Endocrinol 30:247–266.

SgaoileadhMedline

Cochet C, Feige JJ, Chambaz EM (1983) Làraichean catalaíoch agus mhoilecular de kinase casein air a ghlanadh gu mòr bho maothran sgamhain nam measg. Buidheann sam bith Biophys Acta 743:1–12.

Medline

Colby CR, Whisler K, Steffen C, Nestler EJ, Self DW (2003) Tha ro-dhuilgheadas sònraichte air seòrsa de chill de DeltaFosB a ’toirt piseach air brosnachadh a’ chocain. J Neurosci 23:2488–2493.

Geàrr-chunntas / Teacs an-asgaidh

Daunais JB, Roberts DC, McGinty JF (1993) Bidh fèin-rianachd Cocaine a ’fàs preprodynorphin, ach chan e c-fos, mRNA ann an striatum radain. NeuroReport 4:543–546.

Medline

Desterro JM, Rodriguez MS, Hay RT (2000) Riaghladh nam factaran tar-sgrìobhaidh le milleadh pròtain. Cell Mol Life Sci 57:1207–1219.

SgaoileadhMedline

Diaz-Nido J, Armas-Portela R, Avila J (1992) Àrdachadh ann an gnìomhachd de chnàmh-chnàmh sa chnàmh-chopach II-II a ’dol còmhla ri cuairt-uisge neurite às deidh casg ann an synthesis DNA ann an ceallan neuroblastoma NIA-103. J Neurochem 58:1820–1828.

Medline

Di Maira, Salvi M, Arrigoni G, Marin O, Sarno S, Brustolon F, Pinna LA, Ruzzene M (2005) Protein kinase CK2 phosphorylates agus a ’cur an àirde Akt / PKB. Bàs Cell Dìreach 12:668–677.

SgaoileadhMedline

P, A ’, Kovary K, Rizzo CA, Lazo PS, Bravo R (1991) Tha an dà chuid toradh na gine altrama, FosB agus a chruth goirid, FosB / SF, nam gnìomhadairean tar-sgrìobhaidh ann an fibroblasts. Mol Cealla Biol 11:5470–5478.

Geàrr-chunntas / Teacs an-asgaidh

Ferrara P, Andermarcher E, Bossis G, Acquaviva C, Brockly F, Jariel-Encontre I, Piechaczyk M (2003) Tha an fheadhainn a tha a ’dèanamh uallach airson truailleadh prasomal pr-pr protein prò-àma eadar-dhealaichte a rèir na h-abairtean taisbeanaidh. Oncogene 22:1461–1474.

SgaoileadhMedline

Fuchs SY, Dolan L, Davis RJ, Ronai Z (1996) Targaid airson a bhith a ’èigneachadh le bhith ag èiseachadh le c-Jun anns a’ bhacadh le Jun N-kinase. Oncogene 13:1531–1535.

Medline

Fuchs SY, Xie B, Adler V, Fried VA, Davis RJ, Ronai Z (1997) c-Jun NH2-terminal kinases ag amas air ath-chomharrachadh de na h-adhbharan tar-sgrìobhaidh co-cheangailte riutha. J Biol Chem 272:32163–32168.

Geàrr-chunntas / Teacs an-asgaidh

Fuchs SY, Tappin I, Ronai Z (2000) Tha seasmhachd na h-inneal tar-chuir ATF2 air a riaghladh le phosphorylation agus dephosphorylation. J Biol Chem 275:12560–12564.

Geàrr-chunntas / Teacs an-asgaidh

JA Girault, Hemmings HC Jr, Williams KR, AC AC, Greengard P (1989) Phosphorylation de DARPP-32, fosphoprotein air a riaghladh le dopamine agus cAMP, le casein kinase II. J Biol Chem 264:21748–21759.

Geàrr-chunntas / Teacs an-asgaidh

JA Girault, Hemmings HC Jr, Zorn SH, Gustafson EL, Greengard P (1990) Comharrachadh ann an eanchainn mamailteach kinase DARPP-32 a tha co-ionann ri casein kinase II. J Neurochem 55:1772–1783.

Medline

Kanata K, Kaneta K, Tana S, Nishiyama Y, Tomita K, Yamamoto H, Konishi M, Oki T (1992) Epoxomicin, fear eile a tha an aghaidh antitumor de thùs miocro-eòlach. J Antibiot (Tokyo) 45:1746–1752.

Medline

Hann SR, Eisenman RN (1984) Pròtainean air an còdachadh leis an c-myc oncogene: eadar-dhealachadh eadar-dhealaichte ann an ceallan neoplastic. Mol Cealla Biol 4:2486–2497.

Geàrr-chunntas / Teacs an-asgaidh

Hemmings HC Jr, JA Girault, Williams KR, LoPresti MB, Greengard P (1989) ARPP-21, fear-fo-losgaidh AMP-riaghlaidh (Mgr = 21,000) a tha air a riaghladh le cuid de roinnean na h-eanchainn dopamine-a-staigh. Sreath searbhag amino den làrach a dh ’fhalbh le AMP cuairteach ann an ceallan iomlan agus sgrùdaidhean cinetach air a phosphicelation in vitro. J Biol Chem 264:7726–7733.

Hidaka H, ​​Kobayashi R (1992) Leòg-eòlas de inhibitors kinase pròtain. Annu Rev Pharmacol Toxicol 32:377–397.

SgaoileadhMedline

Hira H, Bessho Y, Deasaich an tùs, Yam, S, Lewis J, Kageyama R (2004) Tha neo-chomas pròtain Hes7 deatamach airson a ’chloc sgaradh rudeigin. Nat Genet 36:750–754.

SgaoileadhMedline

Hiroi N, Graybiel AM (1996) Bidh leigheasan neodoleptic agus àbhaisteach neuroleptic a ’toirt a-mach prògraman eadar-dhealaichte de fhaireachdainn thar-chuideam sa striatum. J Comp Neurol 374:70–83.

SgaoileadhMedline

Hope B, Kosofsky B, Hyman SE, Nestler EJ (1992) A ’riaghladh an ciad abairt gineil luath agus AP-1 a tha a’ ceangal sa chnàmh muice raidhc leis a ’chocag dhiadhaidh. Proc Natl Acad Sci SA 89:5764–5768.

Geàrr-chunntas / Teacs an-asgaidh

Hope BT, Kelz MB, Duman RS, Nestler EJ (1994a) Tha an glacadh leigheas electroconvulsive (ECS) a ’toirt a-steach a bhith a’ taisbeanadh toinnte AP-1 fad-ùine ann an eanchainn le buill agus feartan atharraichte. J Neurosci 14:4318–4328.

Abstract

Dòchas BT, Nye HE, Kelz MB, Self DW, Iadarola MJ, Nakabeppu Y, Duman RS, Nestler EJ (1994b) Inntrigeadh do chruinneachadh AP-1 fad-ùine a tha air a dhèanamh suas de phròtainean altraim a tha atharraichte ann an eanchainn le cocaine ainnealach agus leigheasan cronach eile. Neuron 13:1235–1244.

SgaoileadhMedline

Ishida A, Fujisawa H (1995) Tha a bhith a ’coimeasgadh pròtain calmodulin-crochadh an crochadh air tro àrainn neo-thaobhach. J Biol Chem 270:2163–2170.

Geàrr-chunntas / Teacs an-asgaidh

Jariel-Encontre I, Salvat C, Steff AM, Pariat M, Acquaviva C, Furstoss O, Piechaczyk M (1997) Innealan iom-fhillte airson truailleadh c-altra agus c-anns a ’mhìos. Mol Biol Rep 24:51–56.

SgaoileadhMedline

Jones S, Yakel JL (2003) Bidh casein kinase ii (pròifil kinase ck2) a ’riaghladh seirbheis seanal craolaidh serotonin 5-ht (3) ann an ceallan ng108 – 15. Neuroscience 119:629–634.

SgaoileadhMedline

Kato T Jr, Delhase M, Hoffmann A, Karin M (2003) Tha CK2 na C-terminal IkappaB kinase le uallach airson gnìomhachadh NF-kappaB aig àm freagairt UV. Mol Cell 12:829–839.

SgaoileadhMedline

Kelz MB, Chen J, Carlezon WA Jr, Whisler K, Gilden L, Beckmann AM, Steffen C, Zhang YJ, Marotti L, Self DW, Tkatch T, Baranauskas G, Surmeier DJ, Neve RL, Duman RS, Picciotto MR, Nestler EJ (1999) Mìneachadh air a ’bhàillidh tar-sgrìobhaidh deltaFosB anns an eanchainn a’ cumail smachd air cugallachd gu cocaine. Nature 401:272–276.

SgaoileadhMedline

Kim KB, Myung J, Sin N, Crews CM (1999) Toirmeasg dìona le stuthan nàdarrach epoxomicin agus dihydroeponemycin: lèirsinn air sònrachas agus cumhachd. Bioorg Med Chem Lett 9:3335–3340.

SgaoileadhMedline

Kobayashi E, Nakano H, Morimoto M, Tamaoki T (1989) Tha Calphostin C (UCN-1028C), companach microbial ùr, na neach-dìon làidir agus sònraichte airson pròtain kinase C. Biochem Biophys Stòrasan Commun 159:548–553.

SgaoileadhMedline

Krek W, Maridor G, DC Eig (1992) Tha Casein kinase II na h-eabar niùclasach sa mhòr-chuid. J Cell Biol 116:43–55.

Geàrr-chunntas / Teacs an-asgaidh

Krohn NM, Stemmer C, Fojan P, Grimm R, Grasser KD (2003) Bidh Protein kinase CK2 a ’coireachadh am proifeasair àrd inbhe aig a’ bhuidheann gluasadach SSRP1, a ’toirt a-mach an aithne airson DNA air a mhilleadh le UV. J Biol Chem 278:12710–12715.

Geàrr-chunntas / Teacs an-asgaidh

Kumar A, Choi KH, Renthal W, Tsankova NM, Theobald DEH, Truong HT, Russo SJ, LaPlant Q, Whistler K, Neve RL, Fèin-DW, Nestler EJ (2005) Tha ath-dhealbhadh chromatin na phrìomh inneal a tha bun-stèidh air plasticity ann an striatum a tha air a bhrosnachadh. Neuron 48:303–314.

SgaoileadhMedline

Lieberman DN, Mody I (1999) Tha Casein kinase-II a ’riaghladh obair NMDA ann an neurraichean hippocampal. Nat Neurosci 2:125–132.

SgaoileadhMedline

Litchfield DW (2003) Protein kinase CK2: structar, riaghladh agus dreuchd ann an co-dhùnaidhean ceallach beatha agus bàis. Biochem J 369:1–15.

SgaoileadhMedline

A ’T’ I be,, (2001) Milleadh pròtain c-Fos air a chur an cèill le N-methyl-d-aspartic acid ann am bloighean niùclasach de murine hippocampus. Brain Res 905:34–43.

Medline

Mandelzys A, MA Gruda, Bravo R, Morgan JI (1997) Neo-làthaireachd antigen a tha ceangailte ri beathachadh 37 kDa gu cunbhalach agus gnìomhachd DNA-coltach ri AP-1 ann an eanchainn luchag kainic air an làimhseachadh le searbhag. J Neurosci 17:5407–5415.

Geàrr-chunntas / Teacs an-asgaidh

Marin O, Meggio F, Marchiori F, Borin G, Pinna LA (1986) Feart sònraichte na làraich airson casein kinase-2 (TS) bho chrososol grùthan radain. Rannsachadh le fo-fhillidhean peptide modail. Eur J Biochem 160:239–244.

McClung CA, Nestler EJ (2003) Riaghladh air riochdachadh gine agus duais cocaine le CREB agus DeltaFosB. Nat Neurosci 6:1208–1215.

SgaoileadhMedline

McClung CA, Ulery PG, LI Perrotti, Zachariou V, Berton O, Nestler EJ (2004) DeltaFosB: gluasad moileciuil airson atharrachadh ùine-fhada san eanchainn. Res Brain Res Brain Res 132:146–154.

Medline

Meggio F, Pinna LA (2003) Fosglaidhean aon-mìle-agus-aon de phròtain kinase CK2? FASEB J 17:349–368.

Geàrr-chunntas / Teacs an-asgaidh

Meggio F, Donella-Deana A, Pinna LA, Moret V (1977) Phosphorylation de bhloighean casein le grùthan radan ‘phosvitin kinase.’. Ceanglaichean taic 75:192–196.

Medline

Meggio F, Brunati AM, Pinna LA (1983) Bidh autophosphorylation de sheòrsa 2 casein a ’kinase TS aig an dà chuid subphaits alpha- agus beta. Buaidh luchd-buaidh eadar-dhealaichte. Ceanglaichean taic 160:203–208.

SgaoileadhMedline

Meggio F, Shugar D, LA Pinna (1990) Dí-fhilleadh ribofuranosyl-benzimidazole mar innealan-toisich de casein kinase-2 agus casein kinase-1. Eur J Biochem 187:89–94.

Medline

Meggio F, Marin O, Pinna LA (1994) Sònrachas fo-fhillteachd kinase pròtain CK2. Cell Mol Biol Res 40:401–409.

Medline

Miller C, Zhang M, T B, S e J, Pelletier JP, Martel-Pelletier J, Di Battista JA (1998) Inntrigeadh tar-sgr gene nteach gine cyclooxygenase-2 le toirmeasg air searbha okadaic de ghnìomhachd phosphatase ann an chondrocytes daonna: co-bhrosnachadh pròtainean ceangailteach niùclasach AP-1 agus CRE. J Cell Biochem 69:392–413.

SgaoileadhMedline

Moratalla R, Elibol B, Vallejo M, Graybiel AM (1996) Atharrachaidhean aig ìre a ’lìonraidh ann am cur an cèill pròtainean inducible Fos-Jun anns an striatum ri linn làimhseachadh cnòg a tha faisg orra agus tarraing air ais. Neuron 17:147–156.

SgaoileadhMedline

Morgan JI, Curran T (1995) Ginean tràth sa bhad: deich bliadhna air adhart. Trends Neurosci 18:66–67.

SgaoileadhMedline

Nakabeppu Y, Nathans D (1991) Foirm dhearg de FosB a tha gu nàdarra a ’tachairt a tha a’ cur casg air gnìomhachd tras-sgrìobhaidh Fos / Jun. Cell 64:751–759.

SgaoileadhMedline

Nestler EJ, Barrot M, Self DW (2001) Delta FosB: gluasad maireannach eadar-amail airson tràilleachd. Proc Natl Acad Sci SA 98:11042–11046.

Geàrr-chunntas / Teacs an-asgaidh

Neve RL, Howe JR, Hong S, Kalb RG (1997) A ’toirt a-steach an inneal gabhaltach glutamate cuir a-steach 1 a-steach do neurons motair ann an vitro agus ann am vivo a’ cleachdadh bhìoras Herpes simplex ath-bhuain. Neuroscience 79:435–447.

SgaoileadhMedline

Nuthall HN, Joachim K, Stifani S (2004) Tha phosphorylation de serine 239 à Groucho / TLE1 le pròtain kinase CK2 cudromach airson toirmeasg air eadar-dhealachadh neuronal. Mol Cealla Biol 24:8395–8407.

Geàrr-chunntas / Teacs an-asgaidh

Okazaki K, Sagata N (1995) Tha slighe kinase Mos / MAP a ’dèanamh seasmhach de c-Fos le fosfònadh agus a’ cur ris a ghnìomhachd cruth-atharrachaidh ann an ceallan NIH 3T3. EMBO J 14:5048–5059.

Medline

Palombella VJ, Rando OJ, Goldberg AL, Maniatis T (1994) Tha feum air slighe ubiquitin-proteasome airson pròifil ro-ruithear NF-kappa B1 a ghiullachd agus gnìomhachadh NF-kappa B. Cell 78:773–785.

SgaoileadhMedline

Papavassiliou AG, Treier M, Chavrier C, Bohmann D (1992) Ìsleachadh cuimsichte air c-Fos, ach chan eil v-Fos, le comharra a tha an eisimeil pronn-fhosgailte air c-Jun. saidheans 258:1941–1944.

Geàrr-chunntas / Teacs an-asgaidh

Peakman MC, Colby C, LTS Perrotti, PK, C, C, Ulery P, Chao J, Duman C, Steffen C, Monteggia L, Allen MR, Stoc JL, Duman RS, McNeish JD, Barrot M, Self DW, Nestler EJ , Cunnartach E (2003) Le bhith a ’faireachdainn gu bheil an sealladh neo-fhaicsinneach, a’ roinn na h-eanchainn de chainnt mì-àicheil c-Jun ann an luchachan transgenic a ’lùghdachadh mothachadh do chocàin. Brain Res 970:73–86.

SgaoileadhMedline

Perrotti LI, Hadeishi Y, Ulery PG, Bàrr-bacaidh, Monteggia L, Duman RS, Nestler EJ (2004) Inntrigeadh DeltaFosB ann an structaran eanchainn co-cheangailte ri duaisean às deidh uallach dàna. J Neurosci 24:10594–10602.

Geàrr-chunntas / Teacs an-asgaidh

Persico AM, Schindler CW, O'Hara BF, Brannock MT, Uhl GR (1993) Facal air bàgh tar-chuir Brain: buaidhean amphetamine gruamach agus aithriseach agus cuideam bruthadh. Res Brain Res Brain Res 20:91–100.

Medline

Ploegh HL, Dunn BM (2000) Atharrachadh air an eadar-theangachadh: phosphorylation agus phosphatases. Ann an: Pròtalan làithreach ann an saidheans pròtain (Dunn BM, ed.) Pp. 13.01–13.02. New York: Wiley and Sons.

Pyerin W, Burow E, Michaely K, Kubler D, Kinzel V (1987) Togalaichean catalataigeach agus molecular de chnothan-gineadain / cèis-ghlainne fìor-ghlaichte seòrsa II bho cheallan epithelial daonna ann an cultar (HeLa) agus an dàimh ri ecto protein protein. Biol Chem Hoppe Seyler 368:215–227.

Medline

Reikhardt BA, KGikova OG, Borisova GY, Aleksandrova IY, Sapronov NS (2003) Inbhe ris an t-siostam “kinase próitne CK2-HMG14” ann an amnesia a tha co-cheangailte ri aois ann an radain. Neurosci Behav Physiol 33:799–804.

Medline

Roberts BJ, Whitelaw ML (1999) A ’crìonadh anns an gabhaltachd de dhiog-sòn a tha gu h-ìosal leis an Helix-loop-Helix / Per-ARNT-Sim tro shlighe ubiquitin / proteasome. J Biol Chem 274:36351–36356.

Geàrr-chunntas / Teacs an-asgaidh

Rost B, IX G, Liu J (2004) An fhrithealaiche PredictProtein. Res Acid niùclasach 32:W321–W326.

Geàrr-chunntas / Teacs an-asgaidh

Rylski M, Kaczmarek L (2004) Targaidean Ap-1 san eanchainn. Aghaidh Biosci 9:8–23.

SgaoileadhMedline

Shin B, Kansy JW, AC AC, Spychala J, Ealick SE, Fienberg AA, Greene RW, Bibb JA (2004) Caractar moileciuil de luch ath-mheasgaichte adenosine kinase agus measadh mar thargaid airson a bhith a ’caitheamh pròtain. Eur J Biochem 271:3547–3555.

Medline

Salvat C, Aquaviva C, Jariel-Encontre I, Ferrara P, Pariat M, Steff AM, Carillo S, Piechaczyk M (1999) A bheil mòran slighean dìon pròtainteach a ’cur ri c-Fos, c-Jun agus truailleadh pròtain p53 ann an vivo? Mol Biol Rep 26:45–51.

SgaoileadhMedline

Schmidt R, Hecker E (1975) Gluasad dearga phorbol a ’tighinn à bith fo chumhaichean stòraidh àbhaisteach. Taic mu Ruigsinneachd 35:1375–1377.

Teacs làn-theacsa an-asgaidh

Schwarz EM, Van Antwerp D, Verma IM (1996) Bidh foscadh bunasach de IkappaBalpha le casein kinase II a ’leantainn nas fheàrr aig serine 293: riatanas airson truailleadh IkappaBalpha an-asgaidh. Mol Cealla Biol 16:3554–3559.

Geàrr-chunntas / Teacs an-asgaidh

Sears R, Leone G, DeGregori J, Nevins JR (1999) Tha Ras a ’cur ri seasmhachd pròta Myc. Mol Cell 3:169–179.

SgaoileadhMedline

MA MA-RIS, Fialho E, Paes MC, Oliveira PL, Masuda H (2002) A ’toirt air falbh bho bhàrr-chnàimh nucleotide-neo-eisimeileach le cneasgaid kinase II air a ghlanadh bho Rhodnius prolixus oocytes. Biastag Biochem Mol Biol 32:847–857.

SgaoileadhMedline

Skinner M, Qu S, Moore C, Wisdom R (1997) Tha gnìomhachadh agus cruth-atharrachadh tar-sgrìobhadh le pròifil FosB feumach air fosfachadh anns a ’raointean gnìomh-gnìomha bocs-bog-àrd. Mol Cealla Biol 17:2372–2380.

Geàrr-chunntas / Teacs an-asgaidh

Stemmer C, Schwander A, Bauw G, Fojan P, Grasser KD (2002) Pròtain kinase CK2 gu h-eadar-dhealaichte a ’phosphorylates pròtain chromosomal àrd-ghluasaid buidhnean B (HMGB) ag atharrachadh an seasmhachd agus eadar-obrachaidhean DNA. J Biol Chem 277:1092–1098.

Geàrr-chunntas / Teacs an-asgaidh

Stevens I, Derua R, Rondelez E, E Waelkens, Merlevede W, Goris J (1999) Comharrachadh air cyk, cyclin B2 kinase, mar pròtain kinase II calcium / calmodulin-eisimeileach, agus an dleastanas aige tro abachadh Xenopus laevis oocyte. Res Cell Exp 252:303–318.

SgaoileadhMedline

Suh HW, Choi SS, Lee JK, Lee HK, Han EJ, Lee J (2004) Riaghladh air c-fos agus cainnt g-jun gine le lipopolysaccharide agus cytokines ann am prìomh astrocytes saothraichte: buaidh slighean PKA agus PKC. Arch Pharm Res 27:396–401.

Medline

Szyszka R, Boguszewska A, Grankowski N, Ballesta JP (1995) Pronnas eadar-dhealaichte de phròtainean searbhagach ruadh-droma bho chealla bruich le dà kinases pròtain endogenous: casein kinase-2 agus 60S kinase. Acta Biochim Pol 42:357–362.

Medline

Tanay T, Tadhail I, Kobayashi E, Na h-Eileanan Siar, Na h-Eileanan Siar, Suzuki K (1990) Calpostin (UCN1028) agus co-cheanglaichean co-cheangailte ri calphostin, clas ùr de luchd-dìon sònraichte is neartach de phròtain kinase C. Adv Second Messenger Phosphoprotein Res 24:497–501.

Medline

Torres J, Pulido R (2001) Thathas a ’dèanamh a’ phoitin kinase CK2 aig a chneas-f. Na buaidhean airson seasmhachd PTEN airson truailleadh le dìonadh. J Biol Chem 276:993–998.

Geàrr-chunntas / Teacs an-asgaidh

Tsubuki S, Yito Y, Tomioka M, Ito H, Kawashima S (1996) Casg eadar-dhealaichte air gnìomhan calpain agus proteasome le aldehydes peptidyl de di-leucine agus trì-leucine. J Biochem (Tokyo) 119:572–576.

Geàrr-chunntas / Teacs an-asgaidh

T ha na C ’r, C’ ’, Tamura T, Tadhal A h-À, A, E, T na h-Uain, T naim, M Igazaki K, Sagata N (1995) Tha milleadh c-Fos leis an 26S proteasome air a luathachadh le c-Jun agus iomadh kinases pròtain. Mol Cealla Biol 15:5682–5687.

Geàrr-chunntas / Teacs an-asgaidh

Unger GM, Davis AT, Slaton JW, Ahmed K (2004) Protein kinase CK2 mar riaghlaiche de bhith-beò cealla: buaidh air leigheas aillse. Targaidean Dhrugaichean Aillse Curr 4:77–84.

SgaoileadhMedline

Vial E, Marshall CJ (2003) Bidh gnìomhachd àrdaichte ERK-MAP kinase a ’dìon ball den teaghlach FOS FRA-1 an aghaidh truailleadh proteasomal ann an ceallan carcinoma a-mach. J Cell Sci 116:4957–4963.

Geàrr-chunntas / Teacs an-asgaidh

Werme M, Messer C, Olson L, Gilden L, Thoren P, Nestler EJ, Brene S (2002) BFosB a ’riaghladh a’ ruith le cuibhle. J Neurosci 22:8133–8138.

Geàrr-chunntas / Teacs an-asgaidh

A ’Whitmarsh AJ, Davis RJ (2000) Riaghladh gnìomh fheartan tar-sgrìobhaidh le phosphorylation. Cell Mol Life Sci 57:1172–1183.

SgaoileadhMedline

Geamhradh B, Kautzner I, Issinger OG, Arnold HH (1997) Tha dà làrach pròtaraidh pròtachan kinase pronnach cudromach airson gnìomhachd Myf-2. Biol Chem 378:1445–1456.

Medline

Wisniewski JR, Szewczuk Z, Petry I, Schwanbeck R, Renner U (1999) Le bhith a ’dèanamh an aonadh searbhagach de earbaill searbhagach de bhuidheann gluasadachd àrd 1 pròtain le casein kinase II, bidh an atharrachadh, seasmhachd agus an teòmachd ceangailte DNA aca. J Biol Chem 274:20116–20122.

Geàrr-chunntas / Teacs an-asgaidh

Yamaguchi Y, Wada T, Air F, Ag Obair, T na h-Àirde, Handa H (1998) Tha Casein kinase II ag eadar-obrachadh le na h-àrainnean bZIP a tha ann an grunn fhactaran tar-sgrìobhaidh. Res Acid niùclasach 26:3854–3861.

Geàrr-chunntas / Teacs an-asgaidh

Yanagawa T, Yuki K, Yoshida H, Bannai S, Ishii T (1997) A ’phosphorylation de dhrugaichean cuideam A170 le gnìomhachd coltach ri casein kinase II ann an macrophages. Biochem Biophys Stòrasan Commun 241:157–163.

SgaoileadhMedline

Yankulov K, Yamashita K, Roy R, Egly JM, Bentley DL (1995) An neach-gleidhidh Elongation Elongation 5,6-dichloro-1-beta-da ’toirt buaidh air an kinase pròtain pròbhail IIH a tha co-cheangailte ri tar-sgrìobhadh. J Biol Chem 270:23922–23925.

Geàrr-chunntas / Teacs an-asgaidh

Yen J, Wisdom RM, Tratner I, Verma IM (1991) Tha seòrsa eile de FosB na riaghladair àicheil air gnìomhachadh tar-sgrìobhaidh agus cruth-atharrachadh le pròtainean Fos. Proc Natl Acad Sci SA 88:5077–5081.

Geàrr-chunntas / Teacs an-asgaidh

Ceann X, Jedrzejewski PT, Jiang JX (2000) Casein kinase II phosphorylates lens lioncsin 45.6 agus tha e an sàs anns a ’sprùilleach. J Biol Chem 275:6850–6856.

Geàrr-chunntas / Teacs an-asgaidh

Yoza BK, Brooks JW, Mizel SB (1992) Inntrigeadh de na h-eileamaidean tar-chuir AP-1 ri linn gnìomh T-cell le interleukin 1 agus ester phorbol. Fàs Cell Doirbh 3:677–684.

Abstract

Yu S, Wang H, Davis A, Ahmed K (2001) Buaidh CK2 a ’comharrachadh don mhaitreit niùclasach. Bith-chreagan Moireabh 227:67–71.

SgaoileadhMedline

Yu S, Davis AT, Guo C, Green JE, Ahmed K (1999) Targaid eadar-dhealaichte air pròtain kinase CK2 ris a ’mheatran niùclasach air thar-sparradh eadar-ghluasadach de na fo-raointean aige. J Cell Biochem 74:127–134.

SgaoileadhMedline

Zachariou V, Bolanos CA, Selley DE, Theobald D, MP Cassidy, Kelz MB, Shaw-Lutchmann T, Berton O, Sim-Selley LJ, DiLeone RJ, Kumar A, Nestler EJ (2006) ΔFosB: dreuchd riatanach dha ΔFosB anns an niùclas accumbens ann an gnìomhachd mara. Nat Neurosci 9:205–211.

SgaoileadhMedline

Artaigilean a ’toirt iomradh air an artaigil seo

  • Freagairtean Giùlain agus Structarail air Cocaine Ainsealach Iarraidh air Loop For-mhalairt Bithear a ’toirt a-steach {Delta} Pròsas Calb agus Calcium / Calmodulin-Dìleas ann an Kinase II ann an Suil Bhogna na Nucleus Iris Ghnothaich Nàdarra, 6 Màrt 2013, 33(10):4295-4307
  • Striatal Overexpression of {Delta} Ath-chruthachadh Biùgha airson Gluasadan Goirt air a Bhrosnachadh Levodopa. Iris Ghnothaich Nàdarra, 26 May 2010, 30(21):7335-7343
  • Abstract
  • Teacsa slàn
  • An teacsa slàn (PDF)
  • Abstract
  • Teacsa slàn
  • An teacsa slàn (PDF)
  • Abstract
  • Teacsa slàn
  • An teacsa slàn (PDF)
  • Abstract
  • Teacsa slàn
  • An teacsa slàn (PDF)
  • Modhan tar-sgrìobhaidh a thaobh tràilleadh: dreuchd {Delta} FosB Gnìomhan Feallsanachd na Comann Rìoghail B: Saidheansan bith-eòlais, 12 Dàmhair 2008, 363(1507):3245-3255
  • So-leòntachd leantainneach air ath-thòiseachadh giùlan meathamphetamine ann am bàillidh glùinteach glùinteach na h-earraich An FASEB Journal, 1 Iuchar 2007, 21(9):1994-2004
  • Am Factair Tar-chuir Protein-1 Activator ann an Epithelium Charbinogenesis analach Rannsachadh Aillse Molecular, 1 Gearran 2007, 5(2):109-120