Drogen Experienz Epigenetesch Primen Fusb Gen Inducibilitéit an Ruttenkären Accumbens (2012)

COMMENTAIREN: Beweiser datt Deltafosb Spure hannerléisst no der Erhuelung vun der Sucht. Speziell Sucht verursaacht epigenetesch Verännerungen, déi zu vill méi séier Induktioun vum Deltafosb resultéieren wann Réckfall geschitt. Dëst erkläert wéi relapsing, och no Joeren ka séier an e vollblosen Suchtfaart Staat eskaléieren.



J Neurosci. Autor Manuskript; verfügbar am PMC 2013 Januar 25.

 

mythologesch

ΔFosB, a Fosb geneprodukt, gëtt an nucleus accumbens (NAc) a caudate putamen (CPu) induzéiert duerch widderholl Belaaschtung op Drogen vu Mëssbrauch wéi Kokain. Dës Induktioun bäidréit zu aberrant Mustere vum Genausdrock a Verhalensabnormalitéiten, déi mat widderholl Drogenbelaaschtung gesinn.

Hei hu mir bewäert ob eng Ferngeschicht vun der Medikamentekspositioun bei Ratten d'Indizibilitéit vun der ka veränneren Fosb gen entzunn duerch spéider Kokain Expositioun. Mir weisen datt virdru chronesch Kokainadministratioun, gefollegt vun engem verlängerten Réckzuch, erhéicht d'Indizibilitéit vu Fosb an NAc wéi bewisen duerch méi grousser akuter Induktioun vun ΔFosB mRNA a méi séier Akkumulation vun ΔFosB Protein no widderholl Kokain-ExpositiounAn. Keng sou priméiert Fosb Induktioun gouf am CPu observéiert, tatsächlech, spéider akut Induktioun vun ΔFosB mRNA war am CPu verdréckt.

Dës anormal Mustere vum Fosb Ausdrock si mat Kromatinmodifikatiounen an der Fosb gen Promoteur. Virun chronescher Kokainadministratioun induzéiert eng laang dauerhafter Erhéijung vun der RNA Polymerase II (Pol II) Bindung an der Fosb Promoteur an der NAc nëmmen, suggeréiert datt de Pol II "stalling" Primes Fosb fir Induktioun an dëser Regioun bei der Belaaschtung vu KokainAn. Eng Kokain-Fuerderung ausléist dann d'Verëffentlechung vum Pol II vum Genpromotor, wat méi séier erlaabt Fosb Transkriptiouns. Eng Kokain-Fuerderung reduzéiert och repressiv Histon Ännerungen an der Fosb Promoteur am NAc, awer erhéicht esou repressiv Marken a reduzéiert d'Aktivéierungsmarken am CPu.

Dës Resultater bidden nei Abléck an d'Cromatin Dynamik an der Fosb Promoteur a verroden e Roman Mechanismus fir primed Fosb Induktioun am NAc bei der Expositioun vu Kokain.

Aféierung

Drogenofhängeger ass charakteriséiert vun compulsive Drogen Sich an huelen trotz schwéieren negativ Konsequenzen (Kalivas et al., 2005; Hyman et al., 2006). Chronesch Medikamentbelaaschtung verursaacht persistent Verännerungen am Genausdrock am ventrale Striatum (oder nucleus accumbens; NAc) an dorsal Striatum (oder caudate Putamen; CPu), striatal Strukturen agebonnen an Drogenbelounung an Sucht. (Freeman et al., 2001; Robinson a Kolb, 2004; Shaham an Hoffnung, 2005; Maze an Nestler, 2011). ΔFosB, e gekierzt a stabilt Protein dat vun der direkt-fréi Gen kodéiert ass Fosb, ass e gutt charakteriséierten Transkriptiounsfaktor, deen am NAc a CPu induzéiert gëtt duerch chronesch Belaaschtung op quasi all Medikamenter vu Mëssbrauch, wou et sensibiliséiert Verhalensreaktiounen op widderholl Drogenverwaltung meditéiert. (Nestler, 2008). Egal ob fréier chronesch Belaaschtung op e Medikament vu Mëssbrauch déi spéider Induktioun vun ΔFosB ännert bleift onbekannt.

Mir hypothéiren viru kuerzem datt Chromatin Modifikatiounen an Äntwert op chronesch Medikamentbelaaschtung d'Inducibilitéit vu spezifesche Genen an Ziler Gehirregiounen verännere kënnen (Robison an Nestler, 2011). D'Erhéijung vun de Beweiser huet gewisen datt Drogen vu Mëssbrauch no chronescher Administratioun d'Struktur an d'transcriptional Accessibilitéit vu Chromatin duerch vill Aarte vu Modifikatioune veränneren, dorënner Phosforylatioun, Acetyléierung, a Methyléierung vun Histoneschwanz. Méi rezent Aarbecht an Zellkultur Systemer huet sech op d'Rekrutéierung vun RNA Polymerase II (Pol II) op de Promoteur vun "induzéierbaren" Genen konzentréiert ier hir Ausdrock, mat Pol II bleift persistent zu proximal Promoterregiounen a ronderëm d'Transkriptiouns Startplaz (TSS ) an engem "festgehalenen" Staat (Kär a Lis, 2008; Nechaev an Adelman, 2008). Aktivéierung vum stall Pol II gëtt dann als verantwortlech geduecht fir seng Flucht aus Promoteur an TSS Regiounen a seng Transkriptioun vun dësen "priméierten" Genen (Zeitlinger et al., 2007; Saha et al., 2011; Bataille et al., 2012).

Hei weise mer datt eng fréier chronesch Belaaschtung fir Kokain, gefollegt vun enger verlängerter Réckzuchsperiod, der Inklibitéit vun der Fosb gen fir spéider Kokainadministratioun, mat NAc priméiert fir Induktioun wärend CPu net ass. Mir identifizéiere dann ënnerschiddlech Kromatin Ënnerschrëften an der Fosb Genpromotor am NAc a CPu déi mat sou enger aberrant Induktibilitéit vun der verbonne sinn Fosb gen, mat abegraff d 'Rekrutéierung vum stall Pol II an der Fosb proximale Promoteur am NAc nëmmen sou wéi Ännerungen a verschiddenen aktivéierend oder repressive Histonmodifikatiounen a béide Gehirregiounen. Dës Resultater liwweren neie Abléck an d'Cromatin Dynamik an der Fosb Gen Promoteur an uginn fir déi éischte Kéier e Mechanismus duerch dee Stalling vum Pol II priméiert Fosb fir méi Aktivatioun am NAc bei der Expositioun vu Kokain.

Materialien an Methoden

Déieren

Männlech Sprague Dawley Ratten (250 – 275 g; Charles River Laboratories), déi an all Experimenter benotzt goufen, goufen an engem klimakontrolléierte Raum an engem 12 h Liicht / donkel Zyklus (Liicht op 7 AM) gepaart mat Zougang zu Iessen a Waasser ad libitumAn. All Déieren goufen zweemol am Dag fir zéng Deeg mat Kokain (15 mg / kg, ip) oder Salz (ip) an hir Heembarge injizéiert. Déier Experimenter goufe vum Institutional Animal Care and Use Committee (IACUC) um Mount Sinai guttgeheescht.

Lokomotor Miessunge

Déieren goufen den éischten Dag fir 1 h an der Lokomotorekammer gewunnt, an duerno fir eng Lokomotoraktivitéit no enger Salzsaierinjektioun mat Hëllef vum Photobeam Activity System (San Diego Instruments) iwwerwaacht. No 1 hr Habituatioun an de Lokomotor-Chambers all Dag, Kokain (15 mg / kg, ip) gouf all Dag fir 2 Deeg verwalt an Déieren goufen erëm op Lokomotor Aktivitéit fir 1 h iwwerwaacht.

Immunhistochemie

Déieren goufe 24 Stonnen no hirer leschter Medikamentekspositioun perfuséiert. ΔFosB / FosB Immunreaktivitéit war festgestallt wéi beschriwwen (Perrotti et al., 2004). Western Blotting bestätegt datt all ΔFosB / FosB-ähnlech Immunoreaktivitéit 24 h oder méi laang beobachtet huet no Kokaininjektiounen reflektéiert ΔFosB, mat FosB war ondetektéierbar (net gewisen).

RNA Isolatioun, Récktranscriptioun, a PCR

Bilaterale 12-Jauge Stongen vum NAc an dorsolateral / dorsomedial CPu goufen kritt wéi beschriwwen (Perrotti et al., 2004), op dréchen Äis gefruer a verschafft no verëffentlechte Protokoller (Covington et al., 2011). ΔFosB a FosB mRNA gouf mat quantitativer PCR (qPCR) mat isoform spezifescher ΔFosB a FosB Primer gemooss (Alibhai et al., 2007). ΔFosB a FosB mRNA Niveauen goufe normaliséiert op GAPDH mRNA Niveauen, déi net vu Kokainekspositioun betraff waren (net gewisen).

Western blotting

NAc a CPu Stämme goufen uewe gesammelt a verschafft fir Western blotting wéi beschriwwen (Covington et al., 2011), andeems Antikörper géint ERK44 / 42 [extrazellulär Signal geregelter Kinase-44 / 42] a PhosphoERK44 / 42 (pERK), AKT [thymoma virale proto-oncogenen] a p-AKT, SRF (Serum Äntwert Faktor), an pSRF, CRE [cAMP Äntwert Element verbindlech Protein], an pCREB. D'Quantitéit u Protein deen op all Bunn gesprëtzt gouf normaliséiert op Niveauen vun Aktin oder Tubulin, déi net duerch Kokainbelaaschtung beaflosst goufen.

Chromatin Immunopfällung (ChIP)

Frësch dissected NAc a CPu Stämme goufen fir ChIP virbereet wéi beschriwwen (Maze et al., 2010). All experimentell Conditioun gouf an Triplikat vun onofhängege Gruppe vun Déieren analyséiert. Fir all ChIP Probe goufen bilateral NAc a CPu Stämme aus fënnef Ratten (10 Punch) gesammelt. Déi Antikörper, déi fir spezifesch Histonmodifikatioune benotzt gi sinn, sinn d'selwecht wéi déi publizéiert (Maze et al., 2010); antibodies zu Pol II phosphorylated an Ser5 vu sengem carboxyl terminaler Domain (CTD) Widderhuelungsregioun (Pol II-pSer5) gouf aus der Abcam 5131 kritt. Véier Sette ChIP Primer ware fir entworf Fosb (Lazo et al., 1992; Mandelzys et al., 1997): 1F: GTACAGCGGAGGTCTGAAGG, 1R: GAGTGGGATGAGATGCGAGT; 2F: CATCCCACTCGGCCATAG, 2R: CCACCGAAGACAGGTACTGAG; 3F: GCTGCCTTTAGCCAATCAAC, 3R: CCAGGTCCAAAGAAAGTCCTC; 4F: GGGTGTTTGTGTGTGAGTGG, 4R: AGAGGAGGCTGGACAGAACC. Niveauen vun Chromatin Modifikatioune ginn verglach mat deene fir Input DNA wéi beschriwwen (Maze et al., 2010).

Statistesch Analyse

All berichtete Wäerter si mëttler ± Sem Daten fir Bewegungsaktivitéit an Zellzählung goufen duerch Zwee-Wee ANOVAs mat Behandlung an Injektioun als Faktore analyséiert. qPCR Experimenter goufen pro Zäitpunkt vun engem Wee ANOVAs mat der Behandlung als Faktor analyséiert. Wa bedeitend Haapteffekter observéiert goufen (p <0.05), goufen d'Bonferroni post-hoc Tester gemaach fir Vergläicher mat Drogen-naive Salzléisung behandelt Déieren (^ an Zuelen) an Drogen-naiv Kokain-behandelt Déieren (* an Zuelen). Onpaart zwee-tailed Student T-Tester goufen fir Western Blotting an ChIP Daten benotzt, mat Korrektioune fir verschidde Vergläicher.

Resultater

Grouss Fosb Induktivitéit am NAc, awer net CPu, vu Kokain erfuerene Rat

Den Afloss vun engem fréiere chronesche Kokainkurs ze ënnersichen, gefollegt vun enger längerer Réckzuchsperiod, op Induktivitéit vun Fosb gen an Äntwert op eng spéider Kokainentfuerderung, Ratten, déi virdru ip zweemol am Dag mat Salz oder Kokain (15 mg / kg) fir 10 Deeg injektéiert goufen, kruten Challenge Dosë vun der Medikament no 28 Deeg Réckzuch (Figur 1A). Mir hunn d'éischt Lokomotorreaktiounen an enger Grupp vun Déieren gemooss fir d'Induktioun vun der Lokomotor Sensibiliséierung duerch virdru Kokain Expositioun ze bestätegen, eng erwaart dauerhafter Konsequenz vun der Drogenverwaltung. Kokain erfuerscht an net entgéintgesinn Ratten hunn eng gläichwäerteg baseline Lokomotor Aktivitéit gewisen, mat enger Kokain-Fuerderung fir Drogen-naiv Déieren hir Lokomotioun ze erhéijen (Figur 1BAn. Widderholl Mesuren zwee-Manéier ANOVA, Behandlung: F1,66 = 30.42, p <0.0001; Kokain Erausfuerderung: F2,66= 58.39, p <0.0001; Behandlung x Kokain Erausfuerderung: F2,66= 8.56, p = 0.0005, Bonferroni Post-Tester ^p <0.001). Dës Kokain Erausfuerderung induzéiert wesentlech méi Bewegungsaktivitéit, dh Sensibiliséierung, bei Kokain erfuerene Ratten (Bonferroni Post-Tester * p <0.001).

Figure 1  

Effekt vu vireran chronescher Kokain Expositioun op Lokomotor Aktivitéit an Fosb Induktioun an NAc a CPu bei der Expositioun vum Medikament

Fir d'Auswierkunge vun dësem Kokain-Virbehandlungsregime op ΔFosB Ausdrock an NAc a CPu ze bewäerten, hu mir ΔFosB Protein mat immunohistochemesche Methoden gemooss 24 h nodeems Kokain-naiv a Kokain-erfuerene Déieren goufen mat 0, 1, 3, oder 6 deeglech Kokain-Challenge behandelt Injektiounen (15 mg / kg; kuckt Figur 1A). Wéi virdru etabléiert (Nye et al., 1995), 3 Kokaininjektiounen ware genuch fir signifikant ΔFosB Protein am NAc a CPu vun Drogen naiv Déieren ze induzéieren a seng Akkumulation bleift bedeitend no 6 Deeg Kokaininjektiounen (Figur 1CAn. Widderholl misst zwee-Manéier ANOVA, NAc Kär, Behandlung: F1,28= 23.5, p <0.0001; Kokain Erausfuerderung: F3,28= 49.16, p <0.0001; Behandlung x Kokain Erausfuerderung: F3,28= 6.83, p = 0.0014; NAc Schuel, Behandlung: F1,28= 18.69, p <0.0001; Kokain Erausfuerderung: F3,28= 31.52, p <0.0001; Behandlung x Kokain Erausfuerderung: F3,28= 3.21, p <0.05; CPu, Behandlung: F1,28= 9.47, p <0.001; Kokain Erausfuerderung: F3,28= 19.74, p <0.0001; Behandlung x Kokain Erausfuerderung: F3,28= 0.94, p> 0.05. Am NAc Kär, Schuel a CPu, Bonferroni Post-Tester ^p <0.05). Bei Kokain erfahrenen Déieren gouf et keng Beweiser fir eng ΔFosB Induktioun an NAc oder CPu no 28 Deeg Ofzuch ze bestännegen, konsequent mat fréiere Rapporten datt den ΔFosB Signal voll ofleeft vun dësem Zäitpunkt (Nye et al., 1995), de Grond firwat dësen Zäitpunkt an dëser Etude benotzt gouf. Opfallend, awer, Kokain-erlieft Ratten déi 3 oder 6 Kokain-Challenge-Injektiounen kruten, hunn däitlech méi grouss ΔFosB Protein Induktioun am NAc gewisen, en Effekt visuell a béid Kär- a Schuel-Subregiounen (Figur 1C. Bonferroni Post-Tester * p <0.05). Am Géigesaz, gouf keng sou méi grouss Induktioun vum ΔFosB Protein am CPu observéiert; Amplaz gouf d'Äquivalent ΔFosB Induktioun an dëser Regioun no 3 oder 6 Deeg Kokain Erausfuerderung Injektiounen a Kokain-naiven an erfuerene Ratten gesinn (Figur 1C).

Fir Asiicht an d'Transkriptiounsännerungen ze kréien, déi am NAc a CPu geschéien an Äntwert op eng Kokain-Fuerderung, hu mir den Zäitcours (45, 90, an 180 min) vun der Inducibilitéit vun ΔFosB a FosB mRNA Transkripter op eng eenzeg Kokain oder Salzinsprëtzung kritt. zu Kokain-naiv an -experiente Ratten no 28 Deeg Réckzuch (kuckt Figur 1A). Relativ zu enger salzeger Erausfuerderung huet eng Kokainentfuerderung eng séier Erhéijung vun osFosB a FosB mRNA Niveauen op allen dräi Zäitpunkten a béid NAc a CPu vu Kokain-naiv Déieren induzéiert (Fig 1DAn. Widderholl Moossnamen e Wee ANOVA pro Zäitpunkt; Bonferroni Post-Tester ^p <0.05). An NAc hu mir méi grouss ΔFosB a FosB mRNA Induktioun bei Kokain erfuere Déieren am Verglach mat Kokain-naiven Déieren no der Kokain Erausfuerderung beobachtet, den Effekt war bedeitend bei 90 min wärend am Géigesaz d'Induktibilitéit vun ΔFosB a FosB mRNA am CPu wesentlech war ofgeholl bei Kokain erfuerden Déieren (Fig 1DAn. Bonferroni Post-Tester %p = 0.08, * p <0.05).

Charakteriséierung vu Upstream Signaliséierungsweeër am NAc a CPu vu Kokain erfuerene Rat

Eng méiglech Erklärung fir déi verännert Indizibilitéit vum Fosb gen am NAc a CPu no engem viregte chronesche Kokainkurs ass datt eng Ferngeschicht vu Kokainekspositioun dauernd Ännerungen an Signaliséierungsweeër induzéiere kënnen déi upstream vun Fosb Gen-Induktioun sou datt eng Kokain-Fuerderung dann den Gen an en aberrant Grad induzéiert. Fir dës Hypothese ze studéieren, analyséiere mir déi zwee Transkriptiounsfaktoren, SRF an CREB, déi viru kuerzem gewisen goufen fir Kokain Induktioun vun ΔFosB an dëse Gehirregiounen (Vialou et al., 2012) zesumme mat Upstream Proteinkinasen, ERK an AKT, och implizéiert a Kokainaktioun (Valjent et al., 2000; Lu et al., 2006; Boudreau et al., 2009). Mir hu keng Ännerunge bei der Gesamt- oder phosphoryleréierter Niveaue vun dëse verschiddene Proteine ​​festgestallt déi d'geännert Induktibilitéit vu Fosb observéiert, inklusiv keng Ännerunge bei SRF, CREB oder AKT (Fig 2B, C). De Mangel u Verännerung vun pSRF an pCREB am NAc an Äntwert op eng Kokain-Fuerderung ass konsequent mat engem rezente Bericht, deen souwuel wesentlech induzéiert vu chronescher Kokain fonnt huet (Vialou et al., 2012).

Figure 2  

Effekt vun der viregter chronescher Kokain Expositioun op Upstream molekulare Signaliséierung Kaskaden an NAc a CPu

In NAc a CPu vun Drogen naiv Déieren, 20 min no enger initialer Medikamentbelaaschtung (Figur 2A), eng eenzeg Kokainentfuerderung huet Niveauen vun pERK42 / 44 erofgeholl (Fig 2B, C. Zwee tailed Student T-Test: * p <0.05). Et gi fréier Berichter iwwer erhéicht PERK Niveauen an dëse Regiounen no akuter Kokainverwaltung (Valjent et al., 2000). Dëst ass schwiereg ze vergläichen mat aner Pabeieren, déi d'ErK Phosphorylatioun am NAc iwwerpréifen wärend Réckzuch vu widderholl Kokaininjektiounen (Boudreau et al., 2007; Shen et al., 2009), wéi an eiser Studie pERK war nom 28 Deeg Réckzuch an no enger Kokain- oder Salzsaugfuerderung quantifizéiert. Relativ zu medikamenteschen naiven Déieren, déi fir d'éischt Kéier Kokain erliewen, nei Belaaschtung fir Kokain bei Kokain-erlieft Ratten, no 28 Deeg Réckzuch, huet eng bedeitend Erhéijung vun der pERK42 / 44 Niveauen am CPu verursaacht (Fig 2B, C. Zwee Schwanz Student T-Test: * p <0.05).

Chromatin Landschaft an der Fosb Gen Promoteur am NAc a CPu vu Kokain erfuerene Rat

Mir ënnersicht nächst ob Ännerungen an Fosb Gen-Induktibilitéit gi mat Verännerunge a senger Kromatinstruktur verbonnen. ChIP gouf op NAc a CPu duerch Antikörper gemaach géint dräi gutt charakteriséiert Formen vun Histonmodifikatiounen ausgefouert: Trimethylation vu Lys4 vun Histon H3 (H3K4me3) verbonne mat der Genaktivéierung, an H3K27me3 an H3K9meXNX. Mir analyséiere Kokain-naiv an -experiente Ratten no 2 Deeg Réckzuch entweder ouni oder mat enger Challenge-Injektioun vu Kokain, mat Déiere iwwerpréift 28 Stonnen méi spéit (Figur 3A). Am NAc hu mir keng bedeitend Ännerungen an der Bindung vun enger vun dësen dräi Histon Modifikatioune fir de Fosb Genpromotor an der Verontreiung vu Kokainentfuerderung, obwuel et en Trend war fir reduzéiert Niveauen vun H3K9me2 (Fig 3B-DAn. Zwee tailed Student T-Test. #p = 0.2 am Verglach mam respektiven Drug Naïve Kontrollen). Dësen Effekt gouf bedeitend no enger Kokainentfuerderung a war spezifesch fir d'proximal Promoteur Regioun vum Gen (Figur 3C. * p <0.05). Wärend d'Niveaue vun H3K9me2 bei e puer Genen niddereg sinn, ass de Fosb Gen Promoteur weist schätzbar Niveauen vun dëser Mark am NAc ënner Kontrollbedéngungen (Maze et al., 2010, Donnéeën net gewisen). Am Géigesaz, am CPu hu mir kleng awer bedeitend Ofsenkunge vun H3K4me3 Bindung fonnt, an Erhéijunge vun H3K27me3 Bindung, an der Fosb Promoteur an der Verontreiung vu Kokainentwécklung, Auswierkunge verluer no der Erausfuerderung (Fig 3D. * p <0.05).

Figure 3  

Effekt vun der fréierer chronescher Kokain Expositioun op der epigenetescher Priming vun der Fosb gen am NAc a CPu

Mir hunn duerno de Pol II bindend zum Fosb gen, baséiert op rezente Befunde an der Zellkultur déi Stalling vum Pol II bei TSSs, déi sech duerch seng Phosphorylatioun am Ser 5 a senger CTD Widderhuelungsregioun charakteriséiert ass, ass mat der Priming vun Genen assoziéiert (kuckt Introduktioun). Mir analyséiert also de Pol II-pSer5 verbindlech op Fosb a véier ënnerschiddleche Regiounen vum Gen (Figur 3B). Dës Analyse huet e wesentleche Beräicherung vum Pol II-pSer5 op der Fosb gen bei senger proximale Promoterregioun a ronderëm säin TSS am NAc vu Kokain erfuerscht Déieren, no längerem Réckzuch, an der Verontreiung vu Kokainentwécklung am Verglach mat Kontrollen (Fig 3E. * p <0.05). Dës Beräicherung war net evident op zwou Genkierperregiounen vun Fosb, konsequent mam Pol II Stalling an einfachen experimentellen Systemer beschriwwen. Interessanterweis no enger Kokainentfuerderung huet de Pol II-pSer5-Bindung ëmmer nach Zeeche vun der Beräicherung, awer net méi bedeitend, op der Fosb proximal Promoteur Regioun (Fig 3E. %p = 0.1), awer zréck op d'Kontrollniveauen am TSS. Befunde am CPu ware méi variabel, ouni kloer Muster vum Pol II-pSer5 Bindung observéiert.

Diskussioun

Déi aktuell Etude liwwert nei Abléck an déi nohalteg Reguléierung vun Fosb Woche no der Stéierung vun der widderhuelter Belaaschtung fir Kokain. Mir weisen datt virdrun chronesch Kokainadministratioun de Fosb gen méi induzéierbar am NAc, wat zu enger schneller Akkumulatioun vun ΔFosB bei der Expositioun vum Medikament resultéiert. Uginn der Iwwerleeung vu Beweiser datt ΔFosB Induktioun am NAc medizinesch Verhalensreaktiounen op Kokain meditéiert (Nestler, 2008), entdeckt eis Resultater e neie Mechanismus fir dee méi séieren Erhuelung vun esou sensibiliséierten Äntwerte nom längerem Réckzuch.

Mir demonstréieren datt d'verstäerkte Induktioun vun ΔFosB am NAc mat Chromatin Verännerungen an der Fosb gen dat erwaart géif et zu méi grousser Induktioun priméieren. Also weise mer erhéicht Pol II Bindung un de proximale Promoteur an TSS Regiounen vum Gen, déi no 4 Woche vum Réckzuch vu fréier chronescher Kokainverwaltung präsent sinn. Esou Pol II Beräicherung am TSS gëtt séier verluer beim Kokainentwécklung an Fosb Induktioun, konsequent mat engem Modell an der Zellkultur, déi de Pol II ofhält, ass aus TSSs bei der Genaktivatioun entlooss (kuckt Aféierung). Eng Kokain-Fuerderung induzéiert och eng séier Ofsenkung vun der Bindung vun H3K9me2 - e Zeeche vun der Gen Repressioun - un den Fosb Promoteur. Am Géigesaz, hu mir keng dauerhaft Induktioun vu verschiddenen Transkriptiounsfaktoren festgestallt, oder vun hiren Upstream Kinasen, déi bekannt sinn ze vermëttelen Fosb Induktioun duerch Kokain. Dës Resultater ënnerstëtzen eis Hypothese datt déi verstäerkte Induktioun vun ΔFosB am NAc duerch Epigenetesch Priming vun der Fosb gen an net iwwer Upreguléierung vun Upstream Eventer.

Ganz verschidde Resultater goufen fir CPu kritt. Et gouf keng Beweiser fir de Pol II ze stierzen Fosb bei Kokain erfuerene Ratten virun enger Kokainentfuerderung, obwuel et kleng awer bedeitend Histonmodifikatioune konsequent mat der Gentrepressioun waren: verstäerkt H3K27me3 bindend an ofgeholl H3K4me3 Bindung. Et war och keng Ännerung vun Upstream Transkriptiounsfaktoren oder Kinasen konsequent mat reduzéierter Fosb Induktioun. Dës Befindunge suggeréieren datt no chronescher Kokainadministratioun, epigenetesch Modifikatioune déngen Fosb Genen Inducibilitéit am CPu, am Géigesaz zu der Priming, déi am NAc gesi gouf. Wéi och ëmmer, während dës Effekter ΔFosB mRNA Induktioun bei der Expositioun vu Kokain represséieren, gëtt et kee Verloscht vun der Akkumulation vum ΔFosB Protein. De Mechanismus, deen dëse Paradox ënnerläit, erfuerdert elo weider Ënnersichung.

Méi allgemeng ënnerstëtzen eis Resultater e Modell wou Verännerungen an der Kromatinlandschaft bei spezifesche Genen an Äntwert op chronesch Kokainverwaltung déngen dës Genen fir spéider Induktioun no der Expositioun vum Medikament ze priméieren oder ze stompelen. Esou Verännerunge vun der Chromatin, déi als "epigenetesch Narben" bezeechent kënne ginn, géife bei Analysë vu stännegen Zoustand-mRNA Niveauen vun de Genen vermësst ginn. Op dës Manéier, Charakteriséierung vum Epigenom vun der Sucht versprécht frësch Informatioun iwwer d'molekulär Pathogenese vun der Stéierung ze weisen, wat fir d'Entwécklung vun neie Behandlungen minéiert ka ginn.

Dankbarkeet

Dës Aarbecht gouf ënnerstëtzt vu Stipendien vum Nationalen Institut fir Drogenmëssbrauch.

Referenze

  • Alibhai IN, gréng TA, Potashkin JA, Nestler EJ. Reglement vum FosB a DeltafosB mRNA Expression: In vivo a in vitro Studien. Brain Res. 2007;1143: 22-33. [PMC gratis Artikel] [PubMed]
  • Bataille AR, Jeronimo C, Jacques PE, Laramee L, Fortin ME, Forest A, Bergeron M, Hanes SD, Robert F. A Universal RNA Polymerase II CTD Cycle Is Orchestrated by Complex Interplays between Kinase, Phosphatase, and Isomerase Enzyme along Genes. Mol Zell. 2012;45: 158-170. [PubMed]
  • Boudreau AC, Reimers JM, Milovanovic M, Wolf ME. D'Zell Uewer AMPA-Rezeptoren am Rassement Nukleus Accumbens erhéijen während de Kokain-Entzug, awer an der Kokainfuerderung an der Verknüpfung mat geännerten Aktivatioun vu mitogener aktivéiert Protein-Kinasen. J Neurosci. 2007;27: 10621-10635. [PMC gratis Artikel] [PubMed]
  • Boudreau AC, Ferrario CR, Glucksman MJ, Wolf ME. Signalverhalen vun der Pathway an der neierer Proteinkinase A Substrate mat der Verhalenssensibilisatioun fir Kokain. J Neurochem. 2009;110: 363-377. [PMC gratis Artikel] [PubMed]
  • Kär LJ, Lis JT. Transkriptiounsreguléierung duerch Promoter-proximal Paus vun der RNA Polymerase II. Wëssenschaft. 2008;319: 1791-1792. [PMC gratis Artikel] [PubMed]
  • Covington HE, 3rd, Maze I, Sonn H, Bomze HM, DeMaio KD, Wu EY, Dietz DM, Lobo MK, Ghose S, Mouzon E, Neve RL, Tamminga CA, Nestler EJ. Eng Roll fir repressiv Histon-Methyléierung bei Kokain-induzéierter Schwachstelle vu Stress. Neuron. 2011;71: 656-670. [PMC gratis Artikel] [PubMed]
  • Freeman WM, Nader MA, Nader SH, Robertson DJ, Gioia L, Mitchell SM, Daunais JB, Porrino LJ, Friedman DP, Vrana KE. Chronesch Kokain-mediéiert Verännerungen am net-mënschleche Primat-Nukleus accumbens Gen Ausdrock. J Neurochem. 2001;77: 542-549. [PubMed]
  • Hyman SE, Malenka RC, Nestler EJ. Neural Mechanismen vu Sucht: d'Roll vun der Belounung léiert a Gedächtnis. Annu Rev Neurosci. 2006;29: 565-598. [PubMed]
  • Kalivas PW, Volkow N, Seamans J. Unmanageable Motivatioun an Sucht: eng Pathologie an der prefrontal-accumbens Glutamate. Neuron. 2005;45: 647-650. [PubMed]
  • Lazo PS, Dorfman K, Noguchi T, Mattei MG, Bravo R. Struktur a Kartéierung vum FosB Gen. FosB reguléiert d'Aktivitéit vum fosB Promoteur. Nukleinsäuren Res. 1992;20: 343-350. [PMC gratis Artikel] [PubMed]
  • Lu L, Koya E, Zhai H, Hope BT, Shaham Y. Roll vun ERK an der Kokaingesellschaft. Trends Neurosci. 2006;29: 695-703. [PubMed]
  • Mandelzys A, Gruda MA, Bravo R, Morgan JI. Absence vun enger persistent erhéijen 37 kDa fos-relatéierten Antigen an AP-1-ähnlech DNA-verbindlech Aktivitéit an de Gehirer vu kaininsäure-behandelte fosB Null-Mais. J Neurosci. 1997;17: 5407-5415. [PubMed]
  • Maze ech, Nestler EJ. Déi epigenetesch Landschaft vun der Sucht. Ann NY Acad Sci. 2011;1216: 99-113. [PMC gratis Artikel] [PubMed]
  • De Muhammad I, Covington HE, 3rd, Dietz DM, LaPlant Q, Renthal W, Russo SJ, Mechanic M, Mouzon E, Neve RL, Haggarty SJ, Ren Y, Sampath SC, Hurd YL, Greengard P, Tarakhovsky A, Schaefer A, Nestler EJ. Wesentlech Roll vun der Histone Methyltransferase G9a bei der Kokain-induzéierter Plastizitéit. Wëssenschaft. 2010;327: 213-216. [PMC gratis Artikel] [PubMed]
  • Nechaev S, Adelman K. Promoter-proximal Pol II: wann de Stalling d'Saache séier beschleeft. Zell Zyklus. 2008;7: 1539-1544. [PubMed]
  • Nestler EJ. Iwwerpréiwung. Transkriptional Mechanik vu Sucht: D'Roll vun DeltaFosB. Philos Trans R Soc Lond B Biol Sci. 2008;363: 3245-3255. [PMC gratis Artikel] [PubMed]
  • Nye HE, Hope BT, Kelz MB, Iadarola M, Nestler EJ. Pharmakologesch Studien iwwer d'Reguléierung vun chronescher FOS-bezogenen Antigen-Induktioun vum Kokain am Striatum an dem Nukleus accumbens. J Pharmacol Exp Ther. 1995;275: 1671-1680. [PubMed]
  • Perrotti LI, Hadeishi Y, Ulery PG, Barrot M, Monteggia L, Duman RS, Nestler EJ. Induktioun vum DeltaFosB a belountene Gehirerstrukturen no chronescher Stress. J Neurosci. 2004;24: 10594-10602. [PubMed]
  • Robinson TE, Kolb B. Strukturell Plastizitéit, déi mat der Belaaschtung vun Drogen vu Mëssbrauch ass. Neuropharmakologie 47 Suppl. 2004;1: 33-46. [PubMed]
  • Robison AJ, Nestler EJ. Transkriptiouns an epigenetesch Mechanismen vun der Sucht. Nat Rev Neurosci. 2011;12: 623-637. [PMC gratis Artikel] [PubMed]
  • Saha RN, Wissink EM, Bailey ER, Zhao M, Fargo DC, Hwang JY, Daigle KR, Fenn JD, Adelman K, Dudek SM. Rapid Aktivitéit-induzéiert Transkriptiouns vun Arc an aner IEGs hänkt vu geplangte RNA Polymerase II of. Nat Neurosci. 2011;14: 848-856. [PMC gratis Artikel] [PubMed]
  • Shaham Y, Hoffen BT. D'Roll vun Neuroadaptatiounen am Réckwee bei Drogen Sich. Nat Neurosci. 2005;8: 1437-1439. [PubMed]
  • Shen HW, Toda S, Moussawi K, Bouknight A, Zahm DS, Kalivas PW. Geännert dendritesch Wirbelsplastizitéit bei Kokain-entzuchten Ratten. J Neurosci. 2009;29: 2876-2884. [PMC gratis Artikel] [PubMed]
  • Valjent E, Corvol JC, Säiten C, Besson MJ, Maldonado R, Caboche J. Engagement vun der extrazellularer signalreguléierter Kinase Kaskade fir Kokain-belount Eegeschafte. J Neurosci. 2000;20: 8701-8709. [PubMed]
  • Zeitlinger J, Stark A, Kellis M, Hong JW, Nechaev S, Adelman K, Levine M, Young RA. RNA Polymerase bleift bei Entwécklungs Kontroll Genen am Drosophila melanogaster Embryo. Nat Genet. 2007;39: 1512-1516. [PMC gratis Artikel] [PubMed]
  • Vialou VF, Feng J, Robison AJ, Ferguson D, Scobie KN, Mazei-Robison M, Mouzon E, Nestler EJ. Serum Äntwert Faktor an cAMP Äntwert Element verbindlech Protein sinn souwuel fir Kokain Induktioun vun ΔFosB noutwendeg. J Neurosci. 2012 akzeptéiert. [PMC gratis Artikel] [PubMed]