DeltaFosB netiesiogiai reguliuoja Cck reklamuotojo veiklą (2010)

Brain Res. 2010 gegužės 6; 1329: 10 – 20.

Paskelbta internete 2010 kovas 11. doi:  10.1016 / j.brainres.2010.02.081

PMCID: PMC2876727

John F. Enwright, III,1 Megan Wald,1 Madison Paddock,1 Elizabeth Hoffman,1 Rachel Arey,2 Scott Edwards,2 Sade Spencer,2 Eric J. Nestler,3 ir Colleen A. McClung2, *

Autoriaus informacija ► Informacija apie autorių teises ir licencijas ►

Galutinę leidėjo redaguotą šio straipsnio versiją galite rasti tinklalapyje Smegenų raiška

Žr. Kitus PMC straipsnius citata paskelbtas straipsnis.

Eiti į:

Abstraktus

Kai kurie svarbūs biocheminiai, struktūriniai ir elgsenos pokyčiai, kuriuos sukelia lėtinis poveikis piktnaudžiavimui narkotikais, atrodo, tarpininkauja labai stabiliai transkripcijos faktoriui ΔFosB. Ankstesnis darbas parodė, kad ΔFosB overexpression pelėms 2 savaitėms padidina daugelio genų ekspresiją striatume, kurių dauguma vėliau yra reguliuojami po 8 savaičių ΔFosB ekspresijos. Įdomu tai, kad daugelis šių genų taip pat buvo reguliuojami pelėse, kurios pernelyg išreiškė transkripcijos faktorių CREB. Tačiau iš šio tyrimo nebuvo aišku, ar trumpalaikis ΔFosB reguliuoja šiuos genus per CREB. Čia mes pastebime, kad 2 savaitės ΔFosB overexpression padidina CREB išraišką striatume, o efektas išsklaido 8 savaites. Ankstyvoji indukcija yra susijusi su padidėjusiu CREB prisijungimu prie tam tikrų tikslinių genų promotorių šiame smegenų regione. Keista, kad vienas genas, kuris buvo įtariamas CREB tikslas pagal ankstesnes ataskaitas, cholecistokininas (Cck), CREB nekontroliavo striatume. Toliau tirti. \ T Cck po ΔFosB viršijimo, patvirtinome, kad trumpalaikis ΔFosB viršijimas padidina abu Cck promotoriaus aktyvumas ir genų ekspresija. Jis taip pat padidina privalomąjį aktyvumą numatomoje CREB surišimo vietoje (CRE) Cck reklamuotojas. Tačiau, nors CRE vieta yra būtina normaliai bazinei ekspresijai Cck, nereikalaujama ΔFosB indukcijai Cck. Kartu šie rezultatai rodo, kad nors trumpalaikis ΔFosB indukcija padidina CREB ekspresiją ir aktyvumą tam tikruose genų promotoriuose, tai ne vienintelis mechanizmas, kuriuo genai yra reguliuojami šiomis sąlygomis.

Raktiniai žodžiai: branduolys accumbens, transkripcija, priklausomybė

Eiti į:

ĮVADAS

Lėtinis piktnaudžiavimas narkotikais sukelia biocheminius ir struktūrinius pokyčius keliose smegenų srityse. Manoma, kad šie pokyčiai apima genų ekspresijos profilių pakeitimus mezolimbinėje sistemoje. Ši sistema susideda iš dopaminerginių neuronų, kurie nuo vidurinės smegenų dalies ventralinės tegmentalinės srities (VTA) išsivysto į vidutinius spygliuočius neuronus branduolių accumbens (vcc striatum), taip pat į kitus smegenų regionus. Buvo pasiūlyti dviejų transkripcijos faktorių, cAMP atsako elemento surišimo baltymo (CREB) ir ΔFosB (Fos šeimos baltymo) aktyvumo pokyčiai, siekiant tarpininkauti daugeliui biocheminių, struktūrinių ir elgsenos pokyčių, pastebėtų esant nuolatiniam piktnaudžiavimui narkotikais ( peržiūrėjo „Nestler“, „2005“).

CREB yra visur išreikštas transkripcijos faktorius, kuris yra CREB / ATF šeimos narys. CREB homodimeriai jungiasi prie CRE sekos (konsensuso: TGACGTCA) variacijų, rastų daugelio genų promotoriuose. CREB fosforilinimą (daugiausia serine 133, nors ir buvo identifikuotos kitos vietovės) galima skatinti keliais signalizacijos kaskadais, įskaitant tuos, kurie yra žemiau dopamino receptorių (Cole ir kt., 1995). Fosforilinant serine 133, CREB įdarbina bendro aktyvatoriaus CREB surišimo baltymą (CBP) arba susijusius baltymus, dėl kurių padidėja genų ekspresija (peržiūrėta Johannessen ir kt., 2004). Lėtinis piktnaudžiavimas opiatų ar psichostimuliuojančių vaistų poveikiu sukelia trumpalaikį CREB aktyvumo padidėjimą branduolio akumbensuose. (Barrot ir kt., 2002; Shaw-Lutchman ir kt., 2002, 2003), prisitaikymas, manantis, kad mažina šių vaistų naudingas savybes ir prisideda prie neigiamo emocinio narkotikų vartojimo nutraukimo („Nestler“, „2005“).

Lmanoma, kad piktnaudžiavimo narkotikų adaptacijos yra tarpininkaujamos ΔFosB, labai stabilus FosB jungimo variantas (Nestler ir kt., 1999; McClung ir kt., 2004; „Nestler“, „2008“). Fos šeimos nariai dimerizuojasi su Jun šeimos nariais, kad suformuotų aktyvatoriaus baltymą 1 (AP-1). AP-1 transkripcijos kompleksai prisijungia prie AP-1 atsako elemento (konsensuso: TGACTCA) variantų, kad reguliuotų transkripciją (peržiūrėjo Chinenov ir Kerppola, 2001). Nors ūminis piktnaudžiavimas narkotikais sukelia trumpalaikį Fos šeimos narių indukciją (valandą) (taip pat padidina CREB aktyvumą), kartotinis vaisto poveikis sukelia labai stabilų ΔFosB kaupimąsi.Hope ir kt., 1994; Perrotti ir kt., 2008), kurios išraiška išlieka savaites.

Bi-transgeninės pelės, kurios suaugusiųjų striatume indukuojasi per daug ekspresuojančios arba ΔFosB, arba CREB, rodo daugelį biocheminių ir elgsenos fenotipų, pastebėtų pakartotinai veikiantys gyvūnai psichostimuliantams ar kitiems piktnaudžiavimo vaistams. Agenų ekspresijos pokyčių šiose transgeniniuose gyvūnuose nalizė nustatė daugelį genų, reguliuojamų trumpalaikių (2 savaičių) ΔFosB viršekspresijos, pokyčių, susijusių su tuo pačiu sumažėjusiu vaisto atlygiu. Genų ekspresijos ir elgsenos atsako pokyčiai trumpalaikiais ΔFosB buvo labai panašūs į tuos, kurie buvo pastebėti gyvūnams, kurie pernelyg išreiškė CREB 2 arba 8 savaites (McClung ir Nestler, 2003). Dėl ryškaus kontrasto ilgai trunkanti ΔFosB (8 savaičių) ekspresija sumažino daugelio tų pačių genų ekspresiją ir padidino vaistų atlygį (Kelz ir kt., 1999; McClung ir Nestler, 2003).

Vienas iš šių tyrimų nustatytas genas cholecistokininas (Cck), neuropeptidas, gaminamas keliose smegenų srityse, įskaitant striatumą (Hokfelt ir kt., 1980). CCK gali keisti dopaminerginę transmisiją (Vaccarino, 1992), dalyvauja užmokesčio už narkotikus ir jų stiprinimo srityje (Josselyn et al., 1996; Josselyn ir kt., 1997; Hamiltonas ir kt., 2000; Beinfeld ir kt., 2002; Rotzinger ir kt., 2002), ir jį sukelia lėtinis kokainas (\ tDing ir Mocchetti, 1992). Be to, Cck Nustatyta, kad promotorius reaguoja tiek į CREB, tiek į AP-1 kompleksus (Haun ir Dixon, 1990; Deavall ir kt., 2000; Hansen, 2001). Kadangi daugelis genų (įskaitant Cck), kuri parodė didesnę ekspresiją po CREB ir trumpalaikių ΔFosB ekspresijos buvo žinomos arba įtariamos CREB tikslinės genai (McClung ir Nestler, 2003), norėjome nustatyti, ar trumpalaikė ΔFosB išraiška lemia šių genų reguliavimą (daugiausia dėmesio skiriant Cck) reguliuojant CREB arba taikant sudėtingesnius genų reguliavimo mechanizmus.

Eiti į:

REZULTATAI

ΔFosB pernelyg didelė ekspresija trumpam padidina CREB lygį

Mes naudojome Western blotting tyrimą, kad išsiaiškintume, ar ΔFosB overexpression padidina CREB baltymų koncentraciją pelių striatume. Šiame tyrime naudojome bi-transgenines peles (linija 11A), kuriose yra tiek NSE-tTA transgenas, tiek TetOp-ΔFosB transgenas. Nesant doksiciklino, šios pelės rodo stiprią ΔFosB ekspresijos dinamiką teigiamuose striatumo neuronuose.Kelz ir kt., 1999). Šis pernelyg didelio ΔFosB ekspresijos metodas buvo išsamiai dokumentuotas ir leidžia nustatyti specifinę regiono ekspresiją, kuri sutampa su ΔFosB indukcija, pastebėta gyvūnams, veikiantiems lėtinį kokainą (Hope ir kt., 1994; Kelz ir kt., 1999). Mes nustatėme, kad 11A pelėse, kurios pernelyg ekspresuoja ΔFosB, CREB baltymų koncentracija buvo reikšmingai padidinta po 2 savaičių ekspresijos, o šie lygiai grįžo į pradinę liniją po 8 ekspresijos savaitės (Pav. 1A, n = 8). Norėdami nustatyti, ar CREB lygio pokyčiai su trumpalaikiu ΔFosB perekspresija galėtų būti pakartoti kitoje sistemoje, mes laikinai perekspresavome ΔFosB PC12 ląstelėse ir nustatėme, kad CREB lygis žymiai padidėjo (p <0.05), palyginti su kontrolinėmis grupėmis (Pav. 1B, n = 4). Šie rezultatai rodo, kad trumpalaikė ΔFosB ekspresija padidina CREB baltymų kiekį.

1 pav

1 pav

CREB lygiai didėja, kai ΔFosB viršijimas. Lizatų analizė. \ T () pelės striata iš 11A pelių iš dox 2 arba 8 savaitėms arba (B) PC12 ląstelės, kurios viršija ΔFosB. Duomenys A rodomi kaip procentiniai pokyčiai, palyginti su lyginamuoju dox ...

Abi ΔFosB ir CREB prisijungia prie specifinių tikslinių genų promotorių striatume po trumpalaikio ΔFosB overexpression

Nustatėme striatinio audinio ChIP (chromatino imunoprocipitacijos) tyrimus, kad nustatytume, ar tam tikruose tikslinio geno promotoriuose atsirado ΔFosB arba CREB ir ar šis prisijungimas buvo padidintas po trumpalaikio ΔFosB overexpression. Mes analizavome privalomąjį BDNF ir Cck promotoriai, nes abu genai yra labai aukštyn reguliuojami po trumpalaikio ΔFosB viršsekspresijos, CREB viršijimo arba lėtinio kokaino gydymo (McClung ir Nestler, 2003). Mes taip pat išanalizavome privalomąjį CDK5 promotorius, nes jis yra žinomas tiesioginis ΔFosB tikslas (Chen ir kt., 2000; Bibb ir kt., 2001; Kumar ir kt., 2005). Galiausiai, mes matavome privalomąjį prodinorfinas kadangi ankstesniuose tyrimuose nustatyta, kad jį gali susieti ir ΔFosB, ir CREB skirtingomis sąlygomis (Andersson ir kt., 2001; Zachariou ir kt., 2006).

ChIP analizė buvo atlikta striata iš 11A pelių, kurios 2 savaites per daug ekspresavo ΔFosB, naudodami antikūnus, kurie atpažįsta CREB arba ΔFosB. Normaliomis sąlygomis mes nustatėme, kad ΔFosB prisijungia prie CDK5 ir prodinorfinas rėmėjų, nors nėra BDNF or Cck reklamuotojai (Lentelė 1). Be to, ΔFosB pernelyg didelė ekspresija padidino ΔFosB prisijungimą prie CDK5 reklamuotojas, bet ne prodinorfinas reklamuotojas. Tada mes matavome CREB surišimą šiuose promotoriuose ir nustatėme, kad CREB prisijungia prie CDK5, BDNF ir prodinorfinas reklamuotojams, bet ne Cck normalus striatumas, ir kad ΔFosB viršijimas 2 savaitėms padidina CREB \ t BDNF ir prodinorfinas reklamuotojai, bet ne CDK5 reklamuotojas. Kartu šie rezultatai rodo, kad ΔFosB ir CREB gali prisijungti prie tam tikrų genų promotorių, tokių kaip prodinorfinas ir CDK5tačiau CREB surišimas yra būdingas kitiems reklamuotojams, pvz., BDNF. Be to, ΔFosB viršsekspresija sąlygoja AFosB surišimo padidėjimą tam tikruose promotoriuose, kaip tikėtasi, bet taip pat ir CREB surišimą su specifiniais promotoriais, atitinkančius ΔFosB-medijuojamą CREB indukciją, stebėtą šiuo metu.

Lentelė 1

Lentelė 1

Prognozuojamų reguliavimo baltymų susiejimas su įvairiais promotoriais pelėms, kurios per dvi savaites ekspresuoja ΔFosB.

Ankstesnis darbas parodė, kad genų ekspresijos pokyčiai, kuriuos sukelia ilgalaikis ΔFosB viršsekspresijos, yra susiję su chromatino modifikacijomis, ypač histono H3 acetilinimu specifiniuose geno promotoriuose (Kumar ir kt., 2005). Norint nustatyti, ar tai gali sukelti genų ekspresijos pasikeitimus trumpesniu AFosB viršsekspresijos laikotarpiu, mes matavome acetilinto histono H3 (histono modifikacijos, susijusios su transkripciškai aktyviu chromatinu) arba metilinto histono H3 (Lys9, histono modifikacija, susijusi su transkripcija). neaktyvus chromatinas). Mes nustatėme, kad pernelyg didelė ΔFosB ekspresija 2 savaitėms nesukėlė acetilinto H3 prisijungimo prie bet kurio iš tiriamų genų promotorių pokyčių.Lentelė 1). Mes radome reikšmingą metilo histono H3 surišimo sumažėjimą prodinorfinas reklamuotojas, bet ne privalomas Cck reklamuotojui ir nėra privalomų pakeitimų CDK5 ir BDNF Tai reiškia, kad tai nėra bendras mechanizmas, pagal kurį ΔFosB per trumpą laiką reguliuoja genų ekspresiją. Buvome nustebinti ir susidomėję tuo, kad neradome jokių skirtumų mūsų „ChIP“ tyrimuose, kurie galėtų paskatinti padidėjimą Cck mRNR ekspresija 11A pelėse po 2 savaitės ΔFosB ekspresijos ir nusprendė toliau tirti šį mechanizmą.

Trumpalaikis AFosB didėja Cck išraiškos daugelyje sistemų

Bi-transgeninių 11A pelių, per daug ekspresuojančių ΔFosB striatume, apibūdinimas parodė, kad Cck ekspresijos lygiai didėja po 2 savaitės viršijimo ir po to palaipsniui mažėja ilgesniais ΔFosB ekspresijos periodais (Pav. 2A, n = 3). Mes patvirtinome šį efektą Cck naudojant realaus laiko PCR atskiroje gyvūnų grupėje 2 ir 8 savaitėmis ir nustatė, kad rezultatai dviem laiko taškais yra panašūs į „microarray“ analizę (duomenys nerodomi).

2 pav

2 pav

Padidėja trumpalaikis ΔFosB perteklius Cck genų ekspresija. (A) Cck mRNR ekspresija striatume po ΔFosB overexpression 11A pelėse 1, 2, 4 arba 8 savaitėms. Microarray analizė atlikta striatalų mėginiuose ir Cck lygiai ...

Toliau ištirti ΔFosB gebėjimą reguliuoti Cck išraiška, mes naudojome PC12 ląsteles, kurios buvo laikinai transfekuotos a Cck-luciferazės reporterio plazmidė ir arba FosB ekspresijos plazmidė, arba vienodas kiekis pCDNA. Abiejų (n = 5-9) ir trijų (n = 11-13) dienų, kai ΔFosB buvo išreikšta per didelė ekspresija, reikšmingai padidėjo Cckluciferazės ekspresija. Be to, trijų dienų ΔFosB pernelyg didelio ekspresijos rezultatas buvo žymiai didesnis Cckluciferazės indukcija, palyginti su dviejų dienų pernelyg didele ekspresija (Pav. 2B). OsFosB pernelyg išraiška nesukėlė promoterio luciferazės konstrukcijos ekspresijos (duomenys nerodomi). Jokiomis sąlygomis gydymas nebuvo sumažintas Cck- liuciferazės aktyvumas yra akivaizdus. Šie rezultatai rodo, kad trumpalaikė ΔFosB ekspresija padidina Cck ir palieka neatsakytą mechanizmą, pagal kurį susilpnėja ilgalaikė ΔFosB viršijimo išraiška Cck išraiška.

ΔFosB overexpression padidina rišimąsi tariamoje CREB surišimo vietoje Cck promotorius

Mūsų tyrimai parodė, kad Cck ekspresija padidėja po trumpalaikio ΔFosB ekspresijos, tačiau mūsų ChIP tyrimai parodė, kad nei CREB, nei ΔFosB nesiejasi su Cck reklamuotojas. Nustatyti, ar yra kokių nors baltymų surišimo pokyčių Cck αFosB viršsekspresijos aktyvatorius, mes naudojome elektroforezės judėjimo permainų tyrimus (EMSA) su zondu, turintį galimą CRE panašią vietą, esančią Cck reklamuotojas. Naudojant 11A pelių, iš kurių 2 savaitės viršijama ΔFosB, striata branduolinių ekstraktų, mes nustatėme, kad padidėjo privalomasis CRE svetainės kiekis. Cck reklamuotojas (3 A, C pav, n = 4). Įdomu tai, kad 11A pelės, kurios 8 savaitėms viršija ΔFosB, rodo, kad Cck išraiška, taip pat parodė padidintą privalomumą šioje svetainėje (3B, C pav, n = 4). Palyginimui, mes ištyrėme prisijungimą prie konsensuso CRE vietos pelėms, kurios 2 savaitėms pernelyg išreiškė ΔFosB, ir nustatė tvirtą CRE surišimą striatų ekstraktuose, bet nesumažėjo jungimosi po ΔFosB indukcijos (3F pav, n = 4). Taigi, nepaisant pointFosB sukeltų bendro CREB lygių padidėjimo, matomo šiuo laiko momentu, šie rezultatai atitinka mūsų „ChIP“ tyrimus, kuriuose nustatyta, kad padidėjęs CREB surišimas promotoriuose po ΔFosB viršsekspresijos yra specifinis tik tam tikriems genams ir nėra pasaulinis reiškinys . Norėdami nustatyti, ar CREB yra susietas su Cck EMSA analizėje, mes atlikome supershift tyrimus su CREB specifiniu antikūnu. Sutikdami su mūsų „ChIP“ tyrimais, neradome jokio CREB prijungimo prie a Cck zondas, turintis galimą CRE vietą EMSA tyrimuose, o CREB reikšmingai surišo ir pakeitė konsensuso CRE vietą (3D, E pav, n = 4). DNR surišimo aktyvumas Cck promotorius taip pat nebuvo paveiktas antikūnų prieš AFosB (duomenys nerodomi), esant kelioms ankstesnėms studijoms, blokuoti AFosB surišimą su bona fide AP-1 vietomis (Hope ir kt., 1994a, 1994b; Chen ir kt., 1995, Hiroi ir kt., 1998). Mes taip pat atlikome 11A gyvūnų striata ChIP tyrimus po 8 savaitės ΔFosB ekspresijos ir vis dar nerandame CREB ar ΔFosB surišimo. Cck reklamuotojas (duomenys nerodomi). Taigi, ΔFosB ekspresija padidina baltymų prisijungimą prie Cck po 2 ir 8 ekspresijos savaitės; tačiau šių veiksnių tapatumas nežinomas.

3 pav

3 pav

Baltymų rišimasis Cck reklamuotojas. (A, B) Elektroforetinio judėjimo permainų tyrimas naudojant Cck CRE tipo vietovė su striatalu iš gyvūnų, kurie per daug ekspresuoja ΔFosB 2 savaites (A) arba 8 savaites (B). Be (A), konkurencija su pertekliniu nepažymėtu konkurentu ...

Galima CRE svetainė Cck projekto vykdytojas nėra atsakingas už didesnę reklamuotojo veiklą

Kadangi mes nustatėme baltymų surišimo padidėjimą naudojant. \ T Cck reklamuotojui, kuriame yra numatoma CRE svetainė, po ΔFosB viršijimo, norėjome nustatyti, ar ši svetainė yra būtina padidintam Cck ekspresija po ΔFosB viršijimo. Norėdami išbandyti šią galimybę, mes perkėlėme PC12 ląsteles a Cck- luciferazės plazmidė, turinti nepažeistą CRE panašią vietą arba vietą, kurioje yra mutacija vietoje, kuri panaikintų bet kokią sąveiką su CREB. Įdomu tai, kad CRE tipo vietovės mutacija sumažėjo bazinė Cck 32% vykdytojo veiklaPav. 4A, n = 9), bet neturėjo įtakos Cck promotoriaus indukcija per didelę ekspresiją ΔFosB (Pav. 4B, n = 11-13). Tai rodo, kad nors Cck promotorius reikalauja nepažeistos CRE panašios vietovės visai bazinei veiklai, padidėjusiam promotoriaus aktyvumui, kurį sukelia ΔFosB viršijimas, nereikia CRE panašios sekos.

4 pav

4 pav

Šis Cckpanašus CRE tinklapis nėra būtinas Cck ΔFosB indukcija. (A) Cckluciferazės aktyvumas buvo matuojamas 2 dienas po transfekcijos bet kuriuo normaliu Cck-luciferazė arba tokia, kurioje mutavo į CRE panaši vieta. * p <0.05 (B) Cck-luciferazė ...

cFos prisijungia prie Cck promotorius

Ankstesni tyrimai parodė, kad cFos mRNR padidėja trumpalaikiu ΔFosB ekspresija, tačiau po ilgo AFosB ekspresijos sumažėja kokaino gydymo gebėjimas sukelti cFos striatume.McClung ir Nestler, 2003; Renthal ir kt., 2008). Todėl gali būti, kad cFos prisideda prie augimo Cck ekspresija po trumpalaikio ΔFosB ekspresijos. Mes atlikome ChIP tyrimus su specifiniu cFos antikūnu ir išmatuotais cFos junginiais Cck promotorius su trumpalaikiu ΔFosB išraiška ir be jos. Nors mes nustatėme, kad „cFos“ prisijungia prie „ Cck aktyvatorius, šis susiejimas žymiai nepadidėjo po ΔFosB viršijimo (5 pav, n = 5). Tai rodo, kad kadangi cFos jungiasi su Cck jis gali prisidėti prie bendrojo reglamentavimo Cck išraiška, tačiau ji greičiausiai nedalyvauja reguliavime Cck ΔFosB iniciatorius.

5 pav

5 pav

cFos prisijungia prie Cck reklamuotojas. Chromatino imunopresipitaciniai tyrimai buvo atlikti su specifiniu antikūnu cFos, naudojant striatalaus audinį iš ΔFosB viršekspressuojančių pelių arba doksų, arba po 2 savaičių doksų pašalinimo. Realaus laiko PCR analizė ...

Eiti į:

DISKUSIJA

Šis tyrimas patvirtina ir išplečia ankstesnes išvadas, rodančias, kad ΔFosB reguliuoja genų ekspresiją striatume ir nustatėme, kad tai veikia per kelis mechanizmus po trumpalaikės išraiškos. Mes parodome, kad po 2 savaitės pernelyg didelio ekspresijos ΔFosB tiesiogiai prisijungia prie tam tikrų genų promotorių, dėl kurių pasikeičia ekspresija (ty CDK5). Be to, jis padidina CREB baltymų koncentraciją, stebėtą kultivuojamose ląstelėse ir striatume, todėl padidėja CREB prisijungimas prie kitų genų promotorių (ty dinamorfinas ir BDNF). Ankstesniame tyrime nustatėme, kad trumpalaikis ΔFosB perteklius striatume sukelia daugelį tų pačių genų ekspresijos pokyčių, kurie randami, kai CREB yra pernelyg išreikštas, ir sukelia panašius elgesio atsakus į kokaino pasirinkimo matavimus (McClung ir Nestler, 2003). Taigi, dabartinė išvada, kad AFosB sukelia CREB indukciją, taip pat CREB prijungimas prie tam tikrų genų promotorių, padeda paaiškinti, kodėl tiek daug genų ekspresijos pokyčių dalijasi šie du transkripcijos faktoriai.

CREB indukcija ΔFosB yra įdomi, nes buvo įrodyta, kad piktnaudžiavimo vaistai sukelia serino 133 fosforilintų CREB lygių pokyčius (Mattson ir kt., 2005) ir padidina CRE tarpininkaujantį transkripciją (Barrot ir kt., 2002; Shaw-Lutchman ir kt., 2002, 2003), nekeičiant bendro CREB lygio. Gali būti, kad CREB koncentracijos pokyčiai gali būti laikini, todėl kiti tyrimai gali lengvai praleisti. Mūsų rankose matėme kokaino sukeltą CREB mRNR padidėjimą tam tikruose eksperimentuose, tačiau šis poveikis yra labai kintamas (nepublikuotas stebėjimas). Kadangi ir 11A transgeninės pelės, ir PC-12 ląstelės rodo CREB indukciją po trumpalaikio ΔFosB viršsekspresijos, tai rodo, kad CREB iš tikrųjų sukelia ΔFosB (arba ΔFosB tikslas), suteikiant dar vieną mechanizmą, paaiškinantį vaistų sukeltus genų pokyčius išraiška.

Stebėtina, kad nei CREB, nei ΔFosB nesieja Cck reklamuotojui Cck ekspresija aiškiai reguliuojama po trumpalaikio ΔFosB ekspresijos. Cck yra gausus neuropeptidas, išreikštas VTA ir NAc (Hokfelt ir kt., 1980) ir gali dalyvauti elgesio reakcijose į narkotikų vartojimą (Josselyn et al., 1996; Josselyn ir kt., 1997; Hamiltonas ir kt., 2000; Beinfeld ir kt., 2002; Rotzinger ir kt., 2002). Ląstelių kultūros tyrimuose Cck buvo gerai apibūdintas ir įrodytas, kad jis reaguoja į CREB ir AP-1 šeimos narius (peržiūrėjo Hansen, 2001). Haun ir Dixon (1990) parodė, kad AP-1 kompleksai gali prisijungti prie Cck CRE tipo svetainė in vitro, ir vėliau buvo įrodyta, kad naudojant SK-N-MC neuroblastomos ląsteles, CRE panašios vietos mutacija sumažino promotoriaus reakciją į pernelyg išreikštą cFos / cJun (Rourke ir kt., 1999). Iš tiesų, mes taip pat radome padidėjimą Cck reklamuotojo veikla (2 pav) ir privalomas CRE tipo elemente arba aplink jį (3 pav) po to, kai αFosB, kitas AP-1 šeimos narys, pernelyg išreiškiamas, tačiau mes nesame tiesioginio ΔFosB prisijungimo prie Cck promotorius in vivo or in vitro, net ir pernelyg intensyviai.

Daug darbo parodė CREB vaidmenį reglamentuojant Cck reklamuotojo veikla. The Cck CRE tipo svetainė yra išsaugota stuburiniuose gyvūnuose (Hansen, 2001) ir kai kuriuose ląstelių kultūros tyrimuose CREB ir AP-1 kompleksai jungiasi prie šios svetainės ir yra būtini Cck reklamuotojo veikla (Haun ir Dixon, 1990; Deavall ir kt., 2000; Hansen, 2001). Be to, yra keletas žinomų Cck ekspresija (įskaitant bFGF, PACAP, peptonus ir depolarizaciją) veikia per CREB (Hansen ir kt., 1999; Deavall ir kt., 2000; Bernard ir kt., 2001; Gevrey ir kt., 2002; Hansen ir kt., 2004). Mūsų Cck- luciferazės reporterio genų duomenys palaiko esminį CRE panašios vietos vaidmenį reguliuojant Cck aktyvumas, nes šios svetainės mutacija sumažina bazinę Cck reklamuotojo veikla ir. \ t CckLuciferazės ekspresija, kurią sukelia VP16-CREB, konstitutyviai aktyvi CREB forma, prarandama, kai ši svetainė yra mutuojama (nepublikuotas stebėjimas). Taigi, mes nustebome, kad CREB neatsiranda Cck promotorius striatų ekstraktuose arba pradiniame, arba trumpalaikiame ΔFosB viršsprendime, kai padidėja CREB lygis. Tai teigia, kad CREB lygiai Rep nėra vienintelis veiksnys nustatant privalomojo turinio kiekį šioje svetainėje, ir tai palaiko kitų darbas (Cha-Molstad ir kt., 2004). Kadangi kitų, anksčiau identifikuotų CREB tikslinių genų, pvz BDNF ir prodinorfinas, įpareigojo CREB, esame įsitikinę, kad CREB nėra privalomas Cck promotorius striatų branduolinių ekstraktų. Be to, CckΔFosB luciferazės aktyvumas nebuvo priklausomas nuo nepažeistos CRE panašios vietos, o tai rodo, kad ΔFosB nereglamentuoja Cck išraiškos, reguliuojant tiesioginį CREB prisijungimą prie Cck reklamuotojas.

Mūsų nesugebėjimas aptikti CREB sąveikos su Cck reklamuotojas yra palaikomas Renthal et al. (2009), kuris naudojo „ChIP-chip“ metodą, kad po lėtinio kokaino ekspozicijos apžiūrėtų globalius fosforilinto CREB (pCREB) ir ΔFosB prisijungimo striatume pokyčius. Šiuose eksperimentuose DNR-baltymų kompleksai buvo imunoprecipituoti su AFosB arba pCREB antikūnais, o nusodinta DNR po žymėjimo buvo hibridizuota į promotoriaus mikroelementą. Nors daugelis anksčiau apibūdintų CREB tikslinių genų buvo identifikuoti taikant šį metodą (pvz., BDNF, prodynorfinas), Cck nebuvo nustatyta. Be to, buvo įrodyta, kad CREB prisijungimas prie konsensuso CRE vietos labai skiriasi tarp kultūrinių ląstelių linijų (Cha-Molstad ir kt., 2004). Visi ankstesni tyrimai, kuriuose nustatyta CREB sąveika su Cck promotorius buvo atliktas ląstelių kultūroje (o ne smegenyse, iš kurių buvo gauti mūsų EMSA ir ChIP mėginiai) ir naudojami gelio perjungimo tyrimai baltymų ir DNR sąveikai tirti. Nors EMSA gali įvertinti faktoriaus, galinčio prisijungti prie DNR sekos, potencialą, ChIP bandymai suteikia naują požiūrį į šias sąveikas. in vivo. Be to, didžioji dalis duomenų, rodančių, kad yra Cck reklamuotojo veikla arba CREB, įpareigojanti Cck promotorius buvo gautas iš ląstelių, kurios buvo stimuliuojamos tokiais veiksniais kaipBernard ir kt., 2001), depolarizacija (Hansen ir kt., 2004) arba įvairūs intraceliulinių signalų kaskadų aktyvatoriai, įskaitant cAMP ir ERK (Hansen ir kt., 1999). Mūsų eksperimentuose vienintelis naudojamas „stimulas“ buvo ΔFosB viršijimas, kuris yra pakankamas, kad sukeltų Cck išraiška. Kartu tai rodo, kad CREB sugebėjimas susieti (ir galbūt reguliuoti) Cck promotorius yra labai priklausomas nuo ląstelių tipo ir tam tikrų signalizacijos takų aktyvavimo. Be to, Cck CRE panašus promotoriaus elementas (bent jau nenurodytose PC12 ląstelėse ir pelės striatume) nėra tiesioginis CREB ar ΔFosB tikslas. Įdomu tai, kad FosB CREB išraiška taip pat būdinga ląstelių tipui ir stimuliacijos tipui. Anderssono tyrimas et al. nustatė, kad CREB antisense oligonukleotidų injekcija į pelės striatumą iš dalies slopino FosB po kokaino vartojimo (Andersson ir kt., 2001). Tačiau jie taip pat nustatė, kad L-Dopa gebėjimas sukelti FosB ekspresija 6-OHDA pažeistoje striatume neturėjo įtakos CREB antisense oligonukleotidų buvimui.

Kadangi CREB ir ΔFosB netiesiogiai reguliuoja Cck ir kromatino struktūros pokyčiai buvo dokumentuoti atsakant į įvairius stimulus, kurie sukelia ΔFosB (Tsankova ir kt., 2004; Kumar ir kt., 2005; Renthal ir kt., 2008), mes argumentavome, kad ΔFosB netiesiogiai gali keisti promotoriaus aktyvumą, keisdamas chromatino struktūrą. Tačiau pelėms, kurios 2 savaitėms pernelyg ekspresuoja ΔFosB, histono H3 acetilinimo \ t Cck reklamuotojas (Lentelė 1). Tai patvirtina „ChIP“ lustų duomenys Renthal et al. (2009), kuris pranešė, kad acetilinto H3 jungimosi metu Cck promotorius pelėms, veikiančioms lėtinį kokainą. Nuo Cck promotorius yra aktyvus striatume, nesitikima, kad susilpnėtų metiluotas histonas H3. Įdomu tai, kad mes taip pat nematėme jokių pokyčių dėl ΔFosB overexpression acetilinto H3 BDNF reklamuotojui (kuris parodė padidėjusį CREB susiejimą) arba CDK5 ir prodinorfinas promotoriai (kurie parodė padidėjusį ΔFosB surišimą). Kadangi yra daugybė histono modifikacijų, susijusių su reklamuotojo veiklos pokyčiais (peržiūrėjo Rando ir Chang, 2009), greičiausiai yra ir kitų chromatino modifikacijų, susijusių su šių genų indukcija. Bet kuris atskiras chromatino modifikavimas, nors dažnai prognozuojantis promotoriaus aktyvumo lygį, gali keistis tam tikro geno aktyvinimo metu. Būsimame darbe būtų įdomu ieškoti kitų galimų chromatino struktūros pokyčių aplink Cck promotorius po ΔFosB viršijimo. Įdomu tai, kad lėtinis kokainas (tikėtinas per ΔFosB indukcija) parodė, kad sukelia sirtuino 1 ir 2, III klasės histono dezacetazių ekspresiją, kuri, atrodo, keičia neuronų fiziologiją, ERK signalizaciją ir elgesio atsaką į kokainą (Renthal ir kt., 2009). Histono deacetilazės indukcija galėtų vienu metu reguliuoti daugelio genų ekspresiją per pasauliniai chromatino struktūros pokyčiai.

Vienas galimas kandidatas Cck reguliavimas po ΔFosB overexpression buvo AP-1 šeimos narys cFos. CFos išraišką reguliuoja CREB (Sheng ir kt., 1990; Impey ir kt., 2004), ir cFos pernelyg didėjanti (suderinama su jo privalomo partnerio cJun viršijimu) Cck reklamuotojo veikla (Rourke ir kt., 1999). Todėl padidėjęs CREB lygis dėl trumpalaikio ΔFosB viršijimo gali padidinti cFos lygius ir padidinti padidėjimą. Cck CRE tipo svetainė. cfos mRNR indukuojama pelėms po dviejų savaičių ΔFosB viršsekspresijos (McClung ir Nestler, 2003) ir sumažėjo pelėms, veikiančioms lėtinį kokainą arba ilgalaikį ΔFosB viršįtampį (Renthal ir kt., 2008). Čia pastebime, kad cFos tiesiogiai jungiasi prie Cck promotorius striatų audinyje, tačiau ΔFosB overexpression reikšmingai nepadidina surišimo. Tai rodo, kad nors cFos gali būti įtrauktas į reguliavimą Cck išraiška apskritai, vien tik cFos surišimo pasikeitimas nėra tikėtinas mechanizmas, kuriuo ΔFosB reguliuoja Cck išraiška. Tačiau yra įmanoma, kad ΔFosB gali sukelti arba po transliacinius cFos pokyčius (pvz., Pakitusį fosforilinimą), arba sukelti jungiamojo partnerio (pvz., CJun) arba bendro aktyvatoriaus baltymo ekspresiją. Tačiau, nes nepažeistos CRE panašios svetainės (kuri anksčiau buvo įrodyta, kad ji yra AP-1 kompleksų rišimo vieta, žr. Haun ir Dixon, 1990) nereikalaujama padidinti Cck promotoriaus aktyvumas, matomas su ΔFosB viršsekspresija (kaip įvertintas mūsų reporterio geno eksperimentuose), yra pagrįstas, kad kiti trans-veikiantys veiksniai taip pat yra reguliuojami ΔFosB.

Šis Cck mūsų luciferazės reporterio geno eksperimentuose naudojamas promotoriaus fragmentas turi konservuotą Sp1 surišimo vietą ir E-box (peržiūrėjo Hansen, 2002). Konkrečiai, buvo įrodyta, kad E-box sekos susieja daugybę transkripcijos faktorių (peržiūrėjo Forrest ir McNamara, 2004). Naudojant PC12 ląsteles, matėme, kad E-box mutacija mažėja Cck promotoriaus aktyvumas, bet nepakeičia promotoriaus atsako į ΔFosB (duomenys nerodomi). Įdomu tai, kad Cck-luciferazės reporteris, turintis mutacijas tiek CRE, tiek E-box'e, neturi aptikimo bazinio aktyvumo ir nereaguoja į ΔFosB pernelyg didelę ekspresiją (nepublikuotas stebėjimas). Kitas galimas ΔFosB veiksmo tarpininkas Cck promotorius yra ATF, kurių tam tikros formos žinomos kaip striatume sukeltos lėtinės psichostimuliatoriaus poveikio (Green et al., 2008). Tačiau mes nerado jokių įrodymų, kad šių ATF indukcija ΔFosB (duomenys nerodomi), ir tikimasi, kad ATF nesusiję su mutacijos CRE panašia svetaine. Cck reklamuotojas.

Vienas iš šio tyrimo teiginių yra tai, kad mes naudojame bi-transgeninę sistemą, kad pernelyg išryškintume ΔFosB, ir todėl turime būti konservatyvūs rengiant paraleles tarp šios paradigmos ir lėtinio kokaino vartojimo. Tačiau 11A transgeninės pelės suteikia unikalią galimybę pažvelgti į specifinius ΔFosB poveikius striatume, nes pernelyg didelė ekspresija apsiriboja šiuo smegenų regionu (Chen ir kt., 1998), o kokaino vartojimas sukelia pokyčius daugelyje kitų smegenų regionų, kurie gali netiesiogiai paveikti striatumą. Be to, keli tyrimai parodė panašius elgesio ir molekulinius fenotipus 11A pelėse, lyginant su ne transgeniniais gyvūnais, gydomais lėtiniu kokainu (Kelz ir kt., 1999; McClung ir Nestler, 2003; Renthal ir kt., 2009). Be to, Bibb et al. (2001) pranešė panašų striatalo lygį Cdk5 mRNR ir baltymų indukcija tame pačiame 11A kamiene, lyginant su kokaino apdorotais, ne transgeniniais kraikas, taip pat panašūs CDK5, p35 ir DARPP-32 tikslai.

Apibendrinant, mes matome, kad trumpalaikis ΔFosB ekspresija sukelia genų indukciją striatume per kelis mechanizmus. Tai yra tiesioginis promotoriaus surišimas, CREB baltymo ir aktyvumo indukcija, chromatino modifikacija, be to, dar nenustatyti keliai.

Eiti į:

EKSPERIMENTINĖS PROCEDŪROS

gyvūnai

Šiame tyrime buvo naudojami vyriški bi-transgeniniai 11A gyvūnai (NSE-tTA x TetOP-AFosB), kurie apibūdinami Kelz ir kt., 1999. Norėdami pernelyg išreikšti ΔFosB, pelės buvo pašalintos iš doksiciklino tarp 3 ir 6 savaičių, o kontrolinės pelės buvo laikomos doksiciklinu. Visos pelės buvo grupuojamos ir laikomos 12: 12 šviesos / tamsos cikle, šviesos įsijungė 7 am ir išjungtos 7 val. nuospauda prieiga prie maisto ir vandens. Visi pelės eksperimentai atitiko protokolus, patvirtintus Teksaso universiteto Pietų vakarų medicinos centro gyvūnų priežiūros ir naudojimo komitete.

Reporteriai ir ekspresijos plazmidės

Laukinis tipas (WT) Cck promotoriaus-luciferazės reporteris buvo paruoštas įterpiant maždaug 200 bp PCR fragmentą į pGL3-luc vektorių (Promega). Šis fragmentas buvo gautas iš pelės genomo DNR (pradmenys: 5 'TATCCTCATTCACTGGGACGC 3' prieš srovę ir 5 'TACCTTTGGATGGGGAAATCG 3' žemyn) ir iš pradžių įterptas į pGEM-T Easy vektorių (Promega, #A1360). Po to promotoriaus fragmentas buvo klonuotas į pGL1-luc Kpn1 / Xho3 restrikcijos fermentų vietas.

Norėdami sukurti CRE taško mutaciją Cck promotorius, mutageninis pradas, nukreiptas prieš anksčiau nurodytą CRE tipo svetainę (prasmės pradmuo: 5'CGTGTCCTGCTGGACTGAGCTCGCACTGGGAAACA 3 ', antisense gruntas: 5'CTGTTTACCCAGTGCGCGCTGAGTCCAGCAGGACACik „The Kit Kit“ . Tai konvertuoja į CRE panašią svetainę (ACTGCGTCAGC) į ACTGAGCTCC. Visos reporterių plazmidės buvo patvirtintos sekos DNR. ΔFosB ekspresijos plazmidėje yra viso ilgio ΔFosB seka, įterpta į daugkartinę pCDNA 3 klonavimo vietą ir buvo aprašyta anksčiau (Ulery ir Nestler, 2007).

Ląstelių kultūra ir DNR transfekcijos

Žiurkės feochromocitomos (PC12) ląstelės buvo palaikomos Dulbecco modifikuotoje Eagle terpėje F-12, papildytoje 10% arklio serumu, 5% galvijų vaisiaus serumu ir 1% penicilino / streptomicino 37 ° C temperatūroje ir 5% CO2. Ląstelės buvo transfekuotos elektroporacijos būdu, naudojant BTX 360 elektroporatorių (350 V, 0 omų ir 850 μF) 800 μl Dulbecco fosfatu buferuoto fiziologinio tirpalo 4 mm tarpinėse kiuvetėse su 10 μg reporterio ir 5 μg ekspresijos konstrukcijos. Norint normalizuoti bendrą DNR kiekį, buvo naudojama tuščia vektorinė plazmidė (pCDNA). Po transfekcijos ląstelės nurodytą laiką buvo auginamos ant 35 mm kolagenu padengtų indų.

Liuciferazės tyrimai

Praėjus dviem ar trims dienoms po transfekcijos, ląstelės 3 kartus buvo plaunamos Dulbecco fosfatu buferiniame fiziologiniame tirpale, lizavus (naudojant 25 mM glicilglicino, 15 mM MgSO4, 4 mM EGTA, 1% Triton X-100, pH 7.8, 1 mM DTT), surinkti ir išvalyti centrifuguojant. 30 μL lizato buvo sujungtas su 140 μL luciferazės tyrimo buferiu (25 mM glicilglicinas, 15 mM MgSO4, 4 mM EGTA, 1 mM DTT, 1 mM ATP, 1 mM kalio fosfatas, 1 mM koenzimas A, pH 7.8). Po automatinio 800 μL 40 mM luciferino injekcijos šulinėle buvo matuojamas fluorescencinis fluorescencijos aktyvumas. Liuciferazės aktyvumas buvo normalizuotas pagal bendrą baltymų kiekį, nustatytą BioRad baltymų tyrimu.

Elektroforetinio judėjimo permainų tyrimas

Branduoliniai ekstraktai iš dvišalių striatumo griežinėlių iš bi-transgeninių 11A pelių (kad, jei 2 arba 8 savaitės palaikomos doksiciklinu arba iš jo)McClung ir Nestler, 2003) buvo paruošti pagal Huang ir Walters (1996). 32P-žymėti dvigubi oligonukleotidiniai zondai buvo paruošti naudojant „Promega Gel Shift Assay“ sistemos protokolą (#E3300) ir zondai buvo išgryninti naudojant „Roche Quick Spin“ stulpelius. Konsensuso CRE ir AP-1 zondų sekos buvo iš Promega (atitinkamai #E328A ir E320B) ir Cck CRE sekos buvo (Cck-CRE prasmė: CTAGCGAGCTCTGGACTGCGTCAGCACTGGGTGCA; Cck-CRE antisense: CCCAGTGCTGACGCAGTCCAGAGCTCGCTAGCTTT).

Susiejimo reakcijos ir elektroforezė buvo atlikti naudojant „Promega Gel Shift Assay“ sistemos procedūros (#E3300) modifikacijas. Žymėto zondo 50,000 CPM buvo sujungtas su 10 μg striatrijos branduoliniu ekstraktu. Prieš įvedant radioaktyviai pažymėtus zondus, buvo pridėta šalto konkurento DNR arba antikūnų. Eksperimentams su viršutiniu greičiu buvo naudojamas 2 μg CREB antikūno (Upstate Biotechnology # 06-083). Reakcijos buvo elektroforezuotos 4% poliakrilamido geliuose, džiovintos ir paveiktos plėvele (naudojant intensyvinančius ekranus 1 valandai iki 2 dienų).

Imunoblotavimas

PC12 ląstelėms 35 mm transfekuotų ląstelių plokštelės buvo nuplautos ledu šaltame Dulbecco fosfatu buferiniame fiziologiniame tirpale, o lizatai buvo paruošti lediniame šaltame RIPA lizės buferyje (50 mM Tris pH 7.4, 5 mM NaCl, 5 mM EDTA, 1% deoksicholato, 1 % Triton X-100, 0.1% natrio dodecilsulfato), turinčių proteazės inhibitorių. Po ultragarsinio tyrimo, išvalymo ir Bradfordo baltymų tyrimo lizatai buvo visiškai denatūruoti ir 50 μg kiekvieno mėginio elektroforezuota 10% SDS poliakrilamido geliuose. Baltymai buvo perkelti į PVDF membraną, 1 valandai užblokuoti 3% neriebiame sausame piene Tris buferiniame fiziologiniame tirpale, kuriame buvo 0.1% Tween-20 (TBS-T pienas), ir per naktį tirti 4 ° C temperatūroje pirminiais antikūnais (CREB- Upstate Biotechnology # 06-083, naudojama 1: 1,000 8795; GAPDH-Sigma # G1, naudojama 80,000: 1 5,000), praskiesta TBS-T pienu. Po daugkartinio plovimo TBS-T, blotai buvo tiriami vieną valandą kambario temperatūroje, naudojant šarminėmis fosfatazėmis konjuguotus antrinius antikūnus (Sigma), praskiestus 170: 6432 TBS-T piene. Po daugkartinio plovimo druskos tirpalu, turinčiu Tris, spalvinė reakcija buvo atlikta pagal BioRad (# XNUMX-XNUMX) instrukcijas. Membranos buvo džiovinamos per naktį, nuskaitytos plokščiuoju skaitytuvu ir densitometrija atlikta naudojant ImageJ (žr. Toliau).

Striatų ekstraktui atlikti buvo atlikti Western blot tyrimai, kaip buvo paskelbta anksčiau (Hope ir kt., 1994). Audinys buvo pašalintas iš dekapituotų pelių, dedamas ant ledo ir padalintas į smegenų matricą, kurios storis buvo 1 mm. Tada audinių štampai buvo paimti ir užšaldyti -80 ° C temperatūroje iki panaudojimo. Audinys buvo apdorojamas ledu modifikuotame buferiniame buferyje, kuriame yra tiek fosfatazės, tiek proteazės inhibitorių (Roche, Sigma). Po ultragarsinio apdorojimo mėginiai denatūruoti verdančiame vandenyje ir centrifuguoti 15,000xg 15 minučių; vėliau supernatantas buvo surenkamas ir apdorotas; baltymų koncentracijos kiekiai buvo kiekybiškai įvertinti naudojant Bradfordo tyrimą (Bio-Rad). Mėginiai buvo tiriami 10% akrilamido / bisakrilamido gelyje, perkeliami į PVDF membraną, blokuojami 5% piene ir inkubuojami su pirminiais antikūnais (Anti-CREB, Upstate, Lake Placid, NY). Vėliau blotai buvo vizualizuoti naudojant chemiluminescencijos sistemą (Pierce). Visi mėginiai buvo normalizuoti pagal GAPDH (Fitzgerald, Concord, MA). Standartinės kreivės buvo atliktos siekiant užtikrinti, kad mes esame tiesinio tyrimo intervale.

Densitometrijos analizė

PC12 imunoblotams densitometrijos analizė atlikta naudojant ImageJ su rodbardo kalibravimu. Vidutinis fono signalas buvo atimtas iš kiekvieno matavimo ir kiekvienam mėginiui apskaičiuotas CREB ir GAPDH signalo santykis. Striatalų imunoblotams ir EMSA analizei Scion Image 1.62c buvo naudojamas su fono atėmimu.

Chromatino imunoprecipitacija (ChIP)

ChIP tyrimai buvo atlikti pagal metodus Tsankova et al. (2004) ir Kumar et al. (2005). Trumpai tariant, dvišaliai 11A pelių striataliniai mėginiai, laikomi doksicikline ar už jo ribų, buvo susieti su 1% formaldehido ir kryžminis ryšys užgesintas glicinu (galutinė koncentracija - 0.125 M). Šie mėginiai buvo iš visų smegenų skiltelių, paimtų branduolio accumbens lygyje, pašalinus žievę. Chromatinas ultragarsu buvo nukirptas iki maždaug 0.2–1 kb fragmentų, išvalytas baltymų G karoliukais (Thermo Scientific # 22852), o pradiniai mėginiai užšaldyti -80 ° C temperatūroje. Kiekvienam nusodinimui buvo naudojama nuo 60 iki 100 μg chromatino. Buvo panaudota 5-10 μg kiekvieno pirminio antikūno (CREB: Upstate Biotechnology # 06-863, ΔFosB: Santa Cruz Biotechnology # SC-48x, acetilintas H3: Upstate Biotechnology # 06-599, metilintas H3 (LYS9): Cell Signaling Technology, „cFos“: Santa Cruz biotechnologija Nr. SC-7202x). Antikūnų-chromatino kompleksai imunoprodiptuoti su Protein G plus karoliukais pagal gamybos instrukcijas (Thermo Scientific # 22852). Po atvirkštinio įvestų ir nusodintų mėginių susiejimo kiekvienam mėginiui buvo atlikta kiekybinė PGR (qPCR). Visų šių antikūnų naudojimas ChIP buvo plačiai patvirtintas (Tsankova ir kt., 2004; Kumar ir kt., 2005; Renthal ir kt., 2009).

Baltymų surišimo lygiai kiekviename dominančiame geno promotoriuje buvo nustatyti matuojant susijusią DNR kiekį qPCR (Applied Biosystems (ABI) Prism 7700, Foster City, CA). Įvestis arba visa DNR (neimunoprecipituota) ir imunopretipuota DNR buvo amplifikuotos trimis egzemplioriais, dalyvaujant SYBR Green (Applied Biosystems, CA). Kiekvieno mėginio Ct vertės buvo gautos naudojant sekos detektoriaus 1.1 programinę įrangą. Santykinis matricos DNR kiekybinis nustatymas buvo atliktas naudojant ΔΔCt metodą (Tsankova ir kt., 2004). Naudojami pradmenys: BDNF promotorius 4: CTTCTGTGTGCGTGAATTTGCT; AGTCCACGAGAGGGCTCCA CDK5 promotorius: GCTGAAGCTGTCAGGAGGTC; GTGCCCCGCTCTTGTTATTA Cck reklamuotojas: CTTGGGCTAGCCTCATTCACTG; TTAAATAGCTCCTCCCGGTTCG Prodinorfino promotorius: GGCTTCCTTGTGCTTCAGAC; GCGCTGTTTGTCACTTTCAA.

Statistinė analizė

Visi duomenys pateikiami kaip vidurkis ± standartinė vidurkio paklaida. Statistinis skirtumas buvo nustatytas atlikus dviejų studentų t testą (p <0.05). Kai buvo atlikti keli palyginimai, p reikšmės buvo pakoreguotos naudojant Bonferroni korekciją.

Eiti į:

Padėka

Norėtume padėkoti Will Renthal ir Arvind Kumar už naudingas diskusijas. Taip pat norėtume padėkoti NIDA už šių eksperimentų finansavimą.

Eiti į:

Išnašos

Leidėjo atsisakymas: Tai PDF failas iš neregistruoto rankraščio, kuris buvo priimtas paskelbti. Kaip paslauga mūsų klientams teikiame šią ankstyvą rankraščio versiją. Rankraštis bus kopijuojamas, užrašomas ir peržiūrimas gautas įrodymas, kol jis bus paskelbtas galutinėje cituotojoje formoje. Atkreipkite dėmesį, kad gamybos proceso metu gali būti aptiktos klaidos, kurios gali turėti įtakos turiniui, ir visi su žurnalu susiję teisiniai atsakymai.

Klasifikavimo terminai:

Skyrius: Nervų sistemų ląstelinė ir molekulinė biologija

Eiti į:

Nuorodos

  1. Andersson M, Konradi C, Cenci MA. cAMP atsako elemento surišantis baltymas yra būtinas nuo dopamino priklausomam genų ekspresijai nepažeistame, bet ne dervamino denervuotame striatume. J Neurosci. 2001: 21: 9930 – 43. [PubMed]
  2. Barrot M, Olivier JD, Perrotti LI, DiLeone RJ, Berton O, Eisch AJ, Impey S, Storm DR, Neve RL, Yin JC, Zachariou V, Nestler EJ. CREB aktyvumas branduolio accumbens apvalkale kontroliuoja elgesio reakcijų į emocinius stimulus gavimą. Proc Natl Acad Sci US A. 2002, 99: 11435 – 40. [PMC nemokamas straipsnis] [PubMed]
  3. Beinfeld MC, Connolly KJ, Pierce RC. Gydant kokainą, padidėja ekstrakelinis cholecistokininas (CCK) ūmaus, laisvai judančių žiurkių ląstelėje, o tai padidina žiurkių, kurie elgsenai jautrūs kokainui, poveikį. J Neurochem. 2002: 81: 1021 – 7. [PubMed]
  4. Bernard C, Sutter A, Vinson C, Ratineau C, Chayvialle J, Cordier-Bussat M. Peptonai stimuliuoja žarnyno cholecistokinino genų transkripciją per ciklinius adenozino monofosfato atsako elementus. Endokrinologija. 2001: 142: 721 – 9. [PubMed]
  5. Bibb JA, Chen J, Taylor JR, Svenningsson P, Nishi A, Snyder GL, Yan Z, Sagawa ZK, Ouimet CC, Nairn AC, Nestler EJ, Greengard P. Lėtinio kokaino poveikio reguliuoja neuroninis baltymas Cdk5. Gamta. 2001: 410: 376 – 80. [PubMed]
  6. Cha-Molstad H, Keller DM, Yochum GS, Impey S, Goodman RH. Transkripcijos faktoriaus CREB ląstelių tipo specifinis prisijungimas prie cAMP atsako elemento. Proc Natl Acad Sci US A. 2004, 101: 13572 – 7. [PMC nemokamas straipsnis] [PubMed]
  7. Chen J, Nye HE, Kelz MB, Hiroi N, Nakabeppu Y, Hope BT, Nestler EJ. Delta FosB ir FosB panašių baltymų reguliavimas elektrokonvulsinių priepuolių ir kokaino gydymu. Mol Pharmacol. 1995: 48: 880 – 9. [PubMed]
  8. Chen J, Kelz MB, Zeng G, Sakai N, Steffen C, Shockett PE, Picciotto MR, Duman RS, Nestler EJ. Transgeniniai gyvūnai su indukuotu tiksliniu genų ekspresija smegenyse. Mol Pharmacol. 1998: 54: 495 – 503. [PubMed]
  9. Chen J, Zhang Y, Kelz MB, Steffen C, Ang ES, Zeng L, Nestler EJ. Ciklino priklausomos kinazės 5 indukcija hipokampe lėtiniais elektrokonvulsiniais priepuoliais: ΔFosB vaidmuo. J Neurosci. 2000: 20: 8965 – 71. [PubMed]
  10. Chinenov Y, Kerppola TK. Uždarykite daugelio rūšių susidūrimus: „Fos-Jun“ sąveikos, tarpininkaujančios transkripcijos reguliavimo specifiką. Onkogenas. 2001: 20: 2438 – 52. [PubMed]
  11. Cole RL, Konradi C, Douglass J, Hyman SE. Neuronų adaptacija prie amfetamino ir dopamino: molekuliniai prodynorfino genų reguliavimo mechanizmai žiurkių striatume. Neuronas. 1995: 14: 813 – 23. [PubMed]
  12. Deavall DG, Raychowdhury R, ​​Dockray GJ, Dimaline R. CCK geno transkripcijos kontrolė PACAP būdu STC-1 ląstelėse. Am J Physiol Gastrointest kepenų Physiol. 2000: 279: G605 – 12. [PubMed]
  13. Ding XZ, Mocchetti I. Cholecistokinino mRNR kiekio dopaminerginis reguliavimas žiurkių striatume. Brain Res Mol Brain Res. 1992: 12: 77 – 83. [PubMed]
  14. Forrest S, McNamara C. Id transkripcijos faktorių ir kraujagyslių pažeidimo formavimas. Arterioscler Thromb Vasc Biol. 2004: 24: 2014 – 20. [PubMed]
  15. Gevrey JC, Cordier-Bussat M, Némoz-Gaillard E, Chayvialle JA, Abello J. Reikalavimas dėl ciklinių AMP ir kalcio priklausomų baltymų kinazių cholecistokinino geno transkripcijai aktyvuoti baltymų hidrolizatais. J Biol Chem. 2002: 277: 22407 – 13. [PubMed]
  16. Green TA, Alibhai IN, Unterberg S, Neve RL, Ghose S, Tamminga CA, Nestler EJ. ATF2, ATF3 ir ATF4 aktyvuojančių transkripcijos faktorių (ATF) ir jų emocinio elgesio reguliavimas. J Neurosci. 2008: 28: 2025 – 32. [PubMed]
  17. Hamilton ME, Redondo JL, Freeman AS. Dopamino ir cholecistokinino perpildymas žiurkių branduolyje accumbens atsakas į ūminį vaisto vartojimą. Sinapsija. 2000: 38: 238 – 42. [PubMed]
  18. „Hansen TV“, „Rehfeld JF“, „Nielsen FC“. Mitogeno aktyvuota baltymų kinazė ir baltymų kinazės A signalizacijos keliai stimuliuoja cholecistokinino transkripciją aktyvuodami ciklinį adenozino 3 ′, 5′-monofosfato atsaką surišančius baltymus. Mol endokrinolis. 1999; 13: 466–75. [PubMed]
  19. Hansen TV, Nielsen FC. Neuronų cholecistokinino genų transkripcijos reguliavimas. Scand J Clin Lab Invest Suppl. 2001: 234: 61 – 7. [PubMed]
  20. „Hansen TV“. Cholecistokinino genų transkripcija: promotoriaus elementai, transkripcijos faktoriai ir signalizacijos keliai. Peptidai. 2001: 22: 1201 – 11. [PubMed]
  21. Hansen TV, Rehfeld JF, Nielsen FC. KCl ir forskolinas sinergetiškai reguliuoja cholecistokinino genų ekspresiją, koordinuojant CREB ir bendro aktyvatoriaus CBP aktyvavimą. J Neurochem. 2004: 89: 15 – 23. [PubMed]
  22. Haun RS, Dixon JE. Transkripcijos stipriklis, būtinas žiurkių cholecistokinino geno ekspresijai, turi seką, identišką žmogaus c-fos geno -296 elementui. J Biol Chem. 1990: 265: 15455 – 63. [PubMed]
  23. Hiroi N, Marek GJ, Brown JR, Ye H, Saudou F, Vaidya VA, Duman RS, Greenberg ME, Nestler EJ. Esminis fosB geno vaidmuo lėtinių elektrokonvulsinių priepuolių molekuliniuose, ląsteliniuose ir elgesio veiksmuose. J Neurosci 1998. 1998: 18: 6952 – 62. [PubMed]
  24. Hokfelt T, Rehfeld JF, Skirboll L, Ivemark B, Goldstein M, Markey K. Įrodymai dėl dopamino ir CCK sambūvio mezo-limbiniuose neuronuose. Gamta. 1980: 285: 476 – 8. [PubMed]
  25. Hope BT, Kelz MB, Duman RS, Nestler EJ. Lėtinis elektrokonvulsinis priepuolis (ECS) lemia ilgalaikio AP-1 komplekso ekspresiją smegenyse su pakeista sudėtimi ir savybėmis. J Neurosci. 1994: 14: 4318 – 28. [PubMed]
  26. Hope BT, Nye HE, Kelz MB, Self DW, Iadarola MJ, Nakabeppu Y, Duman RS, Nestler EJ. Ilgalaikio AP-1 komplekso, kurį sudaro kintantys Fos tipo baltymai smegenyse, sukėlimas lėtiniu kokainu ir kitais lėtiniais gydymais. Neuronas. 1994: 13: 1235 – 44. [PubMed]
  27. Huang KX, Walters JR. AP-1 transkripcijos faktoriaus DNR surišimo aktyvumo žiurkių striatume dopaminerginis reguliavimas. Neurologija. 1996: 75: 757 – 75. [PubMed]
  28. Impey S, McCorkle SR, Cha-Molstad H, Dwyer JM, Yochum GS, Boss JM, McWeeney S, Dunn JJ, Mandel G, Goodman RH. CREB regulono apibrėžimas: genomo pločio transkripcijos faktoriaus reguliavimo regionų analizė. Ląstelė. 2004: 119: 1041 – 54. [PubMed]
  29. Johannessen M, Delghandi MP, Moens U. Kas paverčia CREB? Mobilusis signalas. 2004: 16: 1211 – 27. [PubMed]
  30. Josselyn SA, Vaccarino FJ. CCK (A) ir CCK (B) antagonistų opozicinis poveikis kondicionuojamo aktyvumo vystymuisi žiurkėms. Behav Pharmacol. 1996: 7: 505 – 512. [PubMed]
  31. Josselyn SA, De Cristofaro A, Vaccarino FJ. Įrodyta, kad CCK (A) receptorių įsitraukimas į kokaino sukeltą sąlyginį aktyvumą žiurkėms įgyja. Brain Res. 1997: 763: 93 – 102. [PubMed]
  32. Kelz MB, Chen J, Carlezon WA, Jr, Whisler K, Gilden L, Beckmann AM, Steffen C, Zhang YJ, Marotti L, Self DW, Tkatch T, Baranauskas G, Surmeier DJ, Neve RL, Duman RS, Picciotto MR , Nestler EJ. Transkripcijos faktoriaus deltaFosB ekspresija smegenyse kontroliuoja jautrumą kokainui. Gamta. 1999: 401: 272 – 6. [PubMed]
  33. Kumar A, Choi KH, Renthal W, Tsankova NM, Theobald DE, Truong HT, Russo SJ, Laplant Q, Sasaki TS, Whistler KN, Neve RL, Self DW, Nestler EJ. Chromatino rekonstrukcija yra pagrindinis mechanizmas, kuriuo grindžiamas striatumo kokaino sukeltas plastiškumas. Neuronas. 2005: 48: 303 – 14. [PubMed]
  34. Mattson BJ, Bossert JM, Simmons DE, Nozaki N, Nagarkar D, Kreuter JD, Hope BT. Kokaino sukeltas CREB fosforilinimas kokaino jautrių žiurkių branduoliuose leidžiamas padidinus su ląstelėmis susietų kinazių aktyvavimą, bet ne baltymų kinazės A. J Neurochem. 2005: 95: 1481 – 94. [PubMed]
  35. McClung CA, Nestler EJ. CREB ir DeltaFosB reguliuoja geno ekspresiją ir kokaino atlygį. Nat Neurosci. 2003: 6: 1208 – 15. [PubMed]
  36. McClung CA, Ulery PG, Perrotti LI, Zachariou V, Berton O, Nestler EJ. DeltaFosB: molekulinis jungiklis ilgalaikiam prisitaikymui smegenyse. Brain Res Mol Brain Res. 2004: 132: 146 – 54. [PubMed]
  37. Nestler EJ, Kelz MB, Chen JS. ΔFosB: molekulinis mediatorius, turintis ilgalaikį nervų ir elgesio plastiškumą. Brain Res. 1999: 835: 10 – 17. [PubMed]
  38. Nestler EJ. Ar yra bendras priklausomybės molekulinis kelias? Nat Neurosci. 2005: 8: 1445 – 9. [PubMed]
  39. Nestler EJ. Transkripcijos priklausomybės mechanizmai: DeltaFosB vaidmuo. Philos Trans R Soc Lond B Biol Sci. 2008: 363: 3245 – 55. [PMC nemokamas straipsnis] [PubMed]
  40. Perrotti LI, Weaver RR, Robison B, Renthal W, Maze I, Yazdani S, Elmore RG, Knapp DJ, Selley DE, Martin BR, Sim-Selley L, Bachtell RK, Self DW, Nestler EJ. Skirtingi DeltaFosB indukcijos modeliai smegenyse, naudojant narkotikus. Sinapsija. 2008: 62: 358 – 69. [PMC nemokamas straipsnis] [PubMed]
  41. Rando OJ, Chang HY. Žmogaus genomo vaizdai apie chromatino struktūrą. Annu Rev Biochem. 2009: 78: 245 – 71. [PMC nemokamas straipsnis] [PubMed]
  42. Renthal W, Carle TL, Maze I, Covington HE, 3rd., Truong HT, Alibhai I, Kumar A, Montgomery RL, Olson EN, Nestler EJ. Delta FosB tarpininkauja c-fos geno epigenetiniam desensibilizavimui po lėtinio amfetamino poveikio. J Neurosci. 2008: 28: 7344 – 9. [PMC nemokamas straipsnis] [PubMed]
  43. Renthal W, Kumar A, Xiao G, Wilkinson M, Covington HE, 3rd, Maze I, Sikder D, Robison AJ, LaPlant Q, Dietz DM, Russo SJ, Vialou V, Chakravarty S, Kodadek TJ, Stack A, Kabbaj M, Nestler EJ. Visame pasaulyje atlikta kromatino reguliavimo kokainu analizė atskleidžia sirtuinų vaidmenį. Neuronas. 2009: 62: 335 – 48. [PMC nemokamas straipsnis] [PubMed]
  44. Rotzinger S, Bush DE, Vaccarino FJ. Cholecistokinino moduliavimas mezolimbinės dopamino funkcijos atžvilgiu: motyvuoto elgesio reguliavimas. Pharmacol Toxicol. 2002: 91: 404 – 13. [PubMed]
  45. Rourke IJ, Hansen TV, Nerlov C, Rehfeld JF, Nielsen FC. Neigiamas kooperatyvas tarp susietų E-box ir cAMP / TPA reaguojančių elementų cholecistokinino geno promotoriuje. FEBS Lett. 1999: 448: 15 – 8. [PubMed]
  46. Shaw-Lutchman TZ, Barrot M, Wallace T, Gilden L, Zachariou V, Impey S, Duman RS, Storm D, Nestler EJ. CRE-medijuojamo transkripcijos regioninis ir ląstelinis atvaizdavimas naltreksono nusodinto morfino pašalinimo metu. J Neurosci. 2002: 22: 3663 – 3672. [PubMed]
  47. Shaw-Lutchman TZ, Impey S, Storm D, Nestler EJ. CRE medijuojamo transkripcijos reguliavimas pelės smegenyse amfetamino pagalba. Sinapsija. 2003: 48: 10 – 7. [PubMed]
  48. Sheng M, McFadden G, Greenberg ME. Membranų depolarizacija ir kalcis sukelia c-fos transkripciją per transkripcijos faktoriaus CREB fosforilinimą. Neuronas. 1990: 4: 571 – 82. [PubMed]
  49. Tsankova NM, Kumar A, Nestler EJ. Histono modifikacijos žiurkių hipokampo genų promotoriaus regionuose po ūminių ir lėtinių elektrokonvulsinių priepuolių. J Neurosci. 2004: 24: 5603 – 10. [PubMed]
  50. Ulery PG, Nestler EJ. DeltaFosB transkripcijos aktyvumo reguliavimas, naudojant fosforilinimą Ser27. Eur J Neurosci. 2007: 25: 224 – 30. [PubMed]
  51. Vaccarino FJ. Nucleus accumbens dopamino-CCK sąveika psichostimuliantų atlygio ir susijusio elgesio atžvilgiu. Neurosci Biobehav Rev. 1992; 18: 207 – 14. [PubMed]
  52. Zachariou V, Bolanos CA, Selley DE, Theobald D, Cassidy MP, Kelz MB, Shaw-Lutchmann T, Berton O, Sim-Selley LJ, DiLeone RJ, Kumar A, Nestler EJ. ΔFosB: esminis ΔFosB vaidmuo branduolyje accumbens morfino veikloje. Gamta Neurosci. 2006: 9: 205 – 11. [PubMed]