DeltaFosB ekspresija branduoliuose accumbens imituoja apsauginį priklausomybės fenotipą, bet ne aplinkosauginio sodrinimo (2014) apsauginį depresijos fenotipą.

Priekinė Behav Neurosci. 2014; 8: 297.

Paskelbta internete Aug 29, 2014. doi:  10.3389 / fnbeh.2014.00297

PMCID: PMC4148937

Abstraktus

Aplinkos sodrinimas žiurkėse sukuria apsauginį priklausomybę ir depresijos fenotipus. ΔFosB yra transkripcijos faktorius, reguliuojantis atlygį smegenyse ir jį sukelia psichologinis stresas bei piktnaudžiavimo vaistai. Tačiau FFosB vaidmuo aplinkosauginio sodrinimo apsauginiuose fenotipuose nebuvo gerai ištirtas. Čia mes parodome, kad ΔFosB yra skirtingai reguliuojamas žiurkėms, auginamoms izoliuotomis sąlygomis (IC), palyginti su turtomis sąlygomis (EC), reaguojant į suvaržymo stresą arba kokainą.

Lėtinis stresas arba lėtinis kokaino gydymas kiekvieną kartą padidina ΔFosB baltymų koncentraciją IC žiurkių, bet ne EB žiurkių, branduoliuose accumbens (NAc), nes dėl EK sąlygų padidėja bazinis ΔFosB kaupimasis..

Viršutinė αFosB viršsekspresija pora laikomų žiurkių NAc korpuse (ty nepriklausomai nuo aplinkos praturtėjimo / izoliacijos) padidina operantą atsaką į sacharozę, kai motyvuoja badas, bet mažėja reaguojant į prisotintus gyvūnus. Be to, ΔFosB viršsekspresija mažina kokaino savarankišką vartojimą, padidina kokaino išnykimą ir mažina kokaino sukeltą intraveninio kokaino savarankiško vartojimo atkūrimą; visi elgesio duomenys atitinka sodrinimo fenotipą.

Tačiau priešingai, ΔFosB pernelyg didelė ekspresija nepakeitė porų laikomų žiurkių atsako į kelis nerimo ir depresijos elgesio tyrimus.

Taigi, ΔFosB NAc korpuso imitacija apsauginis priklausomybės fenotipas, bet ne aplinkos apsaugos sodrinimo fenotipas.

Raktiniai žodžiai: [prieaugis]„FosB“, aplinkos praturtinimas, depresija, kokaino savęs administravimas, adeno sukeltas virusas (AAV), viršijimas

Įvadas

Gyvenimo patirtis, ypač ankstyvuosiuose gyvenimo etapuose, turi didelį poveikį gyvūnų elgesiui visą gyvenimą. Aplinka vaidina svarbų vaidmenį pažeidžiamumui ir atsparumui psichikos sutrikimams žmonėms (Elisei et al., 2013; Akdeniz ir kt. 2014; Kato ir Iwamoto, 2014; van Winkel ir kt. 2014). Graužikų modeliuose buvo pranešta, kad gyvena praturtintoje aplinkoje nuo nujunkymo iki jaunimo. (Green et al., 2002, 2003, 2010; Laviola ir kt. 2008; Solinas ir kt. 2008, 2009; El Rawas ir kt. 2009; Thiel ir kt. 2009, 2010). Šioje paradigmoje gyvūnai priskiriami arba praturtintai būklei (EB), kurioje gyvūnai yra grupuojami, ir kasdien turi prieigą prie naujų objektų arba izoliuotos būklės (IC), kurioje gyvūnai yra laikomi atskirai be naujumo ar socialinio kontakto. Gyvūnai, auginami praturtintoje būklėje, įskaitant socialinį kontaktą, fizinį krūvį ir naujumą, į veną vartojamų savarankiško savarankiškumo paradigmoje mažiau kokaino ar amfetamino. (Green et al., 2002, 2010). Be priklausomybės fenotipo, toks patekimo į aplinką poveikis sukelia antidepresantą panašų poveikį depresijos gyvūnų modeliuose. (Green et al., 2010; Jha ir kt. 2011). Tiksliau sakant, praturtinti gyvūnai turi sumažėjusį anhedoniją panašų elgesį sacharozės pirmenybės teste, mažiau socialinio pasitraukimo atliekant socialinio sąveikos testą ir mažiau judumo priverstinio plaukimo bandyme (FST). Nepaisant priklausomybės ir antidepresantų panašaus poveikio sodrinimo, mechanizmai, kuriais grindžiami šie aplinkos apsaugos praturtėjimo fenotipai, išlieka nepakankamai suprantami, nors ankstesni tyrimai parodė, kad transkripcijos faktoriaus, CREB, aktyvumas branduolyje accumbens (NAc ) tarpininkaujant kai kuriuos aplinkos sodrinimo padarinius (Green et al., 2010; Larson ir kt. 2011). Taigi šių skirtingų auginimo tyrimų tikslas yra naudoti pagrindinį mokslo metodą, siekiant nustatyti molekulinius atsparumo mechanizmus, kurie vėliau gali būti verčiami į kliniką. Šis požiūris yra aplinkos apsaugos ekvivalentas gerai žinomoms genetinėms strategijoms, tokioms kaip selektyvus veisimas (McBride et al., 2014).

Čia mes sutelkiame dėmesį į kitą transkripcijos veiksnį ΔFosB, kurį NAc aiškiai sukelia tam tikros streso formos arba beveik visi piktnaudžiavimo vaistai, įskaitant kokainą, morfiną, alkoholį, nikotiną ir amfetaminą (Hope et al., 1992; Kelzas ir Nestleris 2000; Perrotti ir kt. 2004, 2008). Kaip transkripcijos faktorius ΔFosB dimerizuojasi su Jun šeimos proteinais, pirmiausia JunD, kad suformuotų aktyvų AP-1 kompleksą, kuris prisijungia prie AP-1 atsako elemento, kad padidintų arba slopintų tikslinių genų transkripciją (Nestler, 2001), nors nauji tyrimai rodo, kad ΔFosB taip pat gali veikti kaip homodimeris (Wang et al., 2012). ΔFosB baltymas yra sutrumpintas FosB genas, dėl kurio FosB baltymo trūksta dviejų C-galinių degronų domenų, užkertant kelią AFosB baltymams, atsiradusiam sparčiai skaidant FosB ir visus kitus Fos šeimos baltymus. Kadangi ΔFosB yra nepaprastai stabilus NAc, ΔFosB veikia labai skirtingai, reaguodamas į ūmus ir lėtinius stimulus, palyginti su kitais Fos baltymais. Kartu su piktnaudžiavimo ar streso poveikiu ΔFosB baltymas palaipsniui kaupiasi ir išlieka iki kelių savaičių, o FosB ir kiti Fos baltymai indukuojami tik trumpą laiką (valandomis) ir vėlesniam poveikiui išsivysto susilpnėjusi indukcija (Nestler ir kt., 2001; „Nestler“ 2008).

ΔFosB svarba yra ne tik tai, kad jį labai skatina piktnaudžiavimo ir streso vaistai, bet ir įrodyta, kad manipuliavimas ΔFosB smegenyse veikia gyvūnų elgseną. Pasirinkus ΔFosB indukciją suaugusių pelių dinamorinų vidurio spygliuočių neuronuose, padidėja lokomotorinis jautrumas reaguojant į ūminį ir pakartotinį kokainą, taip pat už atlygį už kokaino vartojimą sąlygotoje vietoje pirmenybės paradigmoje ir sustiprinant savęs administravimo paradigmą (Kelz et al., 1999; Kelzas ir Nestleris 2000; Colby ir kt. 2003).

Nors apsauginiai priklausomybės ir depresijos fenotipai buvo išsamiai aprašyti aplinkoje praturtintoms žiurkėms, galimas ΔFosB vaidmuo tarpininkaujant šiems apsauginiams fenotipams nebuvo iki galo įvertintas. Ankstesni aplinkosaugos praturtinimo tyrimai parodė, kad, palyginti su standartine aplinka (SE), praturtėjusi aplinka padidina bazinius ΔFosB lygius tiek D1, tiek D2 vidutinio smegenų neuronų neuronuose pelėms. (Solinas ir kt., 2009; Lobo ir kt. 2013). Be to, praturtintos Wistar žiurkės NAc ir prefrontalinėje žievėje parodė padidėjusias ΔFosB teigiamas ląsteles, lyginant su SE žiurkėmis, o tai rodo galimą ΔFosB vaidmenį apsauginiame priklausomybės fenotipe prie nikotino. (Venebra-Muñoz ir kt., 2014). Be to, per didelė ΔFosB ekspresija per visą pelių striatą didina kasdienį ratų važiavimą, kuris gali būti analogiškas padidėjusiam žiurkių aktyvumui praturtintoje aplinkoje. (Werme ir kt., 2002).

Šiame tyrime hipotezėme, kad: (1) aplinkos sodrinimas padidintų bazinių ΔFosB lygių kaupimąsi NAc; ir (2) šis ΔFosB kaupimasis prisidėtų prie aplinkos sodrinimo apsaugos poveikio.

medžiagos ir metodai

gyvūnai

Aplinkos sodrinimo atveju patelės Sprague-Dawley žiurkės (Harlanas, Hiustonas, TX, JAV) buvo atsitiktinai priskirtos EB arba IC korpusui nuo 21 dienos iki 51 dienos. EB žiurkės buvo laikomos grupėje (20 viename narve) dideliame metaliniame narve (70 × 70 × 70 cm) su keliais kietais plastikiniais objektais (vaikų žaislai, plastikiniai indai, PVC vamzdžiai ir tt). Šie objektai buvo pakeisti naujais objektais ir kasdien pertvarkyti į naują konfigūraciją. IC žiurkės buvo atskirai laikomos standartiniuose polikarbonato narveliuose. Žiurkės išliko šiose sąlygose per visą eksperimentą, o visi elgsenos tyrimai ir biocheminiai tyrimai prasidėjo po 51 dienų (ty bent 30 dienų praturtinimo / izoliavimo). Per FFBB ekspresijai patinų žiurkės Sprague-Dawley (Harlan, Houston, TX, USA) buvo gautos 225 – 250 g dydžio ir poros laikomos standartiniuose polikarbonato narvuose, prieš jas stereotaktiškai švirkščiant adeno sukeltą virusinį vektorių (AAV2) controlFosB pernelyg išreiškiant žaliąja fluorescenciniu proteinu (GFP) arba tiesiog GFP kaip kontrolę (žr. žemiau). Standartinė žiurkių čiaušė ir vanduo buvo laisvai prieinami visoms žiurkėms, išskyrus elgsenos testus ir maisto produktus. Visos žiurkės buvo palaikomos kontroliuojamoje aplinkoje (temperatūra, 22 ° C, santykinė drėgmė, 50% ir 12 h šviesos / tamsos ciklas, žibintai 600 h) laboratorijos gyvūnų priežiūros (AAALAC) patvirtintos kolonijos asociacijos. . Visi eksperimentai atitiko NIH laboratorinių gyvūnų priežiūros ir naudojimo vadovą ir Teksaso universiteto medicinos skyriaus institucinį gyvūnų priežiūros ir naudojimo komitetą.

Aplinkos sodrinimas yra sudėtinė manipuliacija, kurią sudaro naujovė, socialinis kontaktas ir pratimas. Pora būstas suteikia socialinį ryšį ir taip atstovauja EB (žr. NIH vadovą). Taigi, atitinkama kontrolės grupė, skirta naujoviškumui, socialiniam kontaktui ir pratyboms, būtų grupė, neturinti naujumo, socialinio kontakto ar pratybų, IC sąlyga. IC žiurkės rodo mažiau lėtinio streso požymių nei EB žiurkės. Konkrečiai, EB žiurkės turi padidėjusius antinksčius (Mlynarik et al., 2004), blunted CORT atsakymai (Stairs ir kt., 2011), susilpnėjusi tiesioginė ankstyvoji geno indukcija (Zhang et al., rankraštis ruošiant) ir ΔFosB kaupimasis (Solinas ir kt., 2009; Lobo ir kt. 2013), visi lėtinio streso požymiai (Crofton ir kt.).

Psichologinis stresas

Didesnės ir izoliuotos žiurkės buvo dedamos į vienkartinius minkštus plastikinius graužikų sulaikymo įrenginius (DecapiCone®, Braintree Scientific Inc., MA, JAV) 60 min. Trumpam ekspozicijos mRNR tyrimams 1 žiurkės (9 žiurkės vienai grupei) buvo nušalintos 30 min po paskutinio suvaržymo streso laikotarpio pradžios, išgautos žiurkės smegenys ir NAc buvo išskirstyta mRNR analizei. Imunohistochemijai 5 žiurkės buvo perfuzuotos su fiziologiniu tirpalu ir 30% paraformaldehidu, smegenys ekstrahuotos, po fiksavimo 12% paraformaldehide ir saugomos 4% glicerolyje 4xPBS 20 ° C temperatūroje. Žiurkės smegenys buvo supjaustytos 1 μm temperatūroje su užšalimo mikrotomu. Smegenys buvo nuimtos 4 h po galutinio streso, kad pilnas ilgis FosB baltymas galėtų suskaidyti (Perrotti ir kt., 2008).

Intraveninis kokaino savarankiškas vartojimas su aplinkos praturtinimu

Intraveninė kateterio implantacija

Žiurkės buvo anestezuotos naudojant ketaminą (100 mg / kg IP) ir ksilaziną (10 mg / kg IP), o silikatinį kateterį įdėjus ir pritvirtinus jugulinėje venoje, išeinant iš odos ant gyvūno nugaros. Kiekvieną dieną kateteriai buvo infuzuojami su 0.1 ml sterilaus fiziologinio tirpalo, kuriame yra heparino (30.0 U / ml), penicilino G kalio (250,000 U / ml) ir streptokinazės (8000 TV / ml), kad būtų užkirstas kelias infekcijai ir palaikomas kateterio nepageidaujamumas. eksperimentų.

Kokaino savęs administravimas su aplinkos praturtinimu

Dvidešimt praturtintų ir 20 izoliuotų žiurkių buvo dedamos į operacines kameras 30 × 24 × 21 cm (Med-Associates, St. Albans, VT) ir leido spausti svirtį, skirtą kokaino infuzijoms (0.5 mg / kg / infuzija, NIDA vaisto tiekimas, Tyrimų trikampio institutas, NC, JAV) arba fiziologinis tirpalas 1 h per dieną 1 (FR2) nustatytu santykiu 14 dienomis. Siekiant išlaikyti panašų kokaino vartojimą tarp EB ir IC grupių, buvo didžiausia 30 infuzija per sesiją. Audinių apdorojimo pajėgumai buvo riboti 30 mėginiais, todėl mažiausiai atsakančios žiurkės iš kiekvienos grupės nebuvo apdorotos, paliekant 8 Ns kokainui ir 7 druskų grupėms. Taigi EB ir IC skirtumų tarp infuzijų tarp EB ir IC žiurkių nebuvo. Žiurkės smegenys buvo išgautos 3 h po paskutinės savęs įvedimo sesijos pradžios, o NAc buvo išskaidyta mRNR ir baltymų analizei. Viena NAc pusė buvo naudojama „Western blot“, kita - „qPCR“.

Neapibrėžtas kokaino administravimas su aplinkos praturtinimu

Tiesioginiam palyginimui su anksčiau paskelbta literatūra (Hope et al., 1994; Chen ir kt. 1995), EB (N = 12) ir IC žiurkės (N 12) buvo švirkščiamas fiziologiniu tirpalu arba 20 mg / kg kokaino intraperitoniniu būdu (IP) 1 dieną (ūminis) arba 9 dienas (kartojamas). Perdirbant buvo prarasta viena EB ėminė. Ūminė grupė suleido fiziologinį tirpalą 8 paros metu ir vieną XIII-XIX dieną kokaino injekciją, todėl visos žiurkės gavo tokį patį injekcijų skaičių. Po paskutinės injekcijos smegenys buvo išgautos 9 min., O NAc buvo išskirstyta mRNR analizei.

MRNR kiekybinis nustatymas naudojant qPCR

RNR ekstrahuota homogenizuojant RNA STAT-60 (Teltest, Friendswood, TX), išskiriant RNR iš DNR ir baltymų, naudojant chloroformą, ir iš viso RNR nusodinant izopropanoliu. Užteršta DNR buvo pašalinta (TURBO DNA-Free, Life Technologies, CA, USA) ir išgrynintos RNR 5 ug atvirkštinės transkribuotos į cDNA (SuperScript III First Strand Synthesis: Invitrogen katalogas # 18080051). ΔFosB mRNR buvo kiekybiškai įvertintas naudojant kiekybinį realaus laiko PCR (SYBR Green: Applied Biosystems, Foster City, CA) „Applied Biosystems 7500“ greito termociklerio su pradmenimis, skirtais aptikti tik ΔFosB (pirmyn: AGGCAGAGCTGGAGTCGGAGAT; atvirkštinis: GCCGAGGACTTGAACTTCACTCG) ir normalizuotas į pradmenis, suprojektuotus aptikti žiurkės GAPDH (į priekį: AACGACCCCTTCATTGAC; atvirkštinis: TCCACGACATACTCAGCAC). Visi pradmenys buvo patvirtinti ir analizuojami specifiškumui ir tiesiškumui prieš eksperimentus (Alibhai ir kt., 2007).

Vakarų dėmė

Dešinė NAc pusė iš kokaino arba fiziologinio tirpalo savarankiškai vartojančių EC ir IC žiurkių buvo homogenizuota buferyje, kuriame yra sacharozės, Hepes buferio, natrio fluorido, 10% SDS ir proteazės bei fosfatazės inhibitorių (Sigma-Aldrich: P-8340, P -2850, P-5726). Baltymų koncentracija buvo įvertinta naudojant Pierce BCA Protein Assay Kit (Thermo Scientific, IL, JAV). Kadangi baltymų, išgautų iš vieno žiurkės, analizei nepakanka, 2 mėginiai iš tos pačios grupės buvo sujungti kartu, kiekvienai grupei gaminant 4 mėginius. Baltymų mėginiai buvo denatūruoti 95 ° temperatūroje 5 min. Ir paleisti 10 – 20% poliakrilamido gradiento gelyje (Kriterijus TGX, Bio-Rad Laboratories, CA, USA), tada perkelti į polivinilidenfluorido (PVDF) membraną (Millipore, MA, JAV ). Membrana buvo blokuojama blotavimo laipsnio blokatoriumi (riebalų neturinčiu sausu pienu), inkubuojama su AFosB pirminiu antikūnu (triušiu, 1: 1000, #2251, ląstelių signalizavimo technologija, MA, JAV) ir β-aktino pirminiu antikūnu (pelė, 1: 1000 , Cell Signaling Technology, MA, USA), plaunamas TBST ir po to inkubuojamas su fluorescuojančiais antriniais antikūnais (asilo anti-triušis (780 nm), asilo anti-pelė (680 nm), 1: 15000, Li-Cor Biosciences, NE, JAV). Tada vaizduojami Western blotai (Odyssey, Li-Cor Biosciences, NE, USA) ir baltymų kiekiai, apskaičiuoti naudojant Odyssey programinę įrangą.

Imunohistochemistry

Pav Figure11 (N = 3), ląstelės, turinčios ΔFosB, buvo vizualizuotos ir skaičiuojamos imunohistocheminiu ΔFosB žymėjimu NAc sluoksniuose, dažytuose DAB (DAB peroksidazės substrato rinkinys, Vector Laboratories, CA, USA). Smegenys buvo išgautos, pastatytos, užklijuotos ir suskirstytos į 40 μm griežinėliais, turinčiais NAc, ant slankiojo šaldymo mikrotomo (Leica Biosystems, IL, JAV). Skiltelės išliko plūduriuojančios ir prieš skirdamos 1% normalaus ožkos serumo (Jackson ImmunoResearch, PA, USA) su 3% tritonu ir avidinu D (Vector Laboratories, CA, USA), buvo išplautos 0.3xPBS, prieš endogenines peroksidazes. NAc skiltelės buvo inkubuojamos su FosB pirminiu antikūnu per naktį (1: 1000, Santa Cruz Biotechnology, Dallas, TX, USA) su 3% ožkų serumu, 0.3% triton, 1xPBS ir biotino tirpalu (Vector Laboratories, CA, USA). Nors šis antikūnas atpažįsta FosB ir ΔFosB, ankstesni Western blot tyrimai parodė, kad 24 h po stimuliacijos didžioji dalis imunohistocheminio signalo susideda iš ΔFosB, nes FosB gerokai skaidosi prieš 24 h (Perrotti ir kt., 2008). Po plovimo griežinėliai buvo inkubuojami su biotiniluotu ožkos anti-triušio antriniu antikūnu IgG (Vector Laboratories, CA, USA), ožkų serumu ir 1xPBS. Tada griežinėliai buvo inkubuojami su avidin-biotino komplekso (ABC) peroksidazės dėmėmis 15 min (Thermo Scientific, IL, USA). Galiausiai, griežinėliai buvo sumontuoti, dehidratuoti naudojant etanolį ir CitriSolv (Fischer Scientific, MA, JAV) ir padengti DPX (Fisher Scientific). Ląstelių skaičiavimui iš Bregma + 1.80 mėginiai buvo paimti iš kiekvieno gyvūno. Bendras AFosB imunopozitinių ląstelių skaičius skaičiuojamas iš keturių NAc sekcijų iš kiekvienos žiurkės šerdies ir lukšto.

1 pav  

stresas ir [prieaugis]FosB EB ir IC žiurkėms. (REKLAMA) Reprezentatyvus ΔFosB imunohistocheminis dažymas NAc apvalkale ir IC šerdyje (A ir B) ir EB (C ir D) žiurkės su (B ir D) ir be (A ir C) pakartotinis stresas (N = 3). (E) Kiekybinis nustatymas ...

Adeno sukeltas virusas pernelyg išreiškiamas [prieaugis]FosB

AAV2 pagrindu veikiantis vektorius, ekspresuojantis FosB ir humanizuotą renilės GFP (hrGFP; Winstanley ir kt., 2007, 2009a,b) arba hrGFP kontrolės vektorius (N = 10 kiekvienas) buvo švirkščiamas dvišaliai į žiurkės NAc. Kadangi nėra IC žmonių, vietoj IC žiurkių buvo naudojamos pora laikomos žiurkės, kad šis tyrimas padidintų aktualumą mokslo bendruomenei, parodydamas ΔFosB poveikį. nepriklausomas EC / IC paradigmos. Kontroliumi buvo naudojamas AGF, kuris ekspresuoja hrGFP, bet kuris neužkerta ΔFosB. ΔFosB išraiška in vivo buvo patvirtintas imunofluoresciniu dažymu FosB pirminiu antikūnu (1: 200, Rabbit, Cell Signaling Technology, MA, JAV). AAV vektoriai buvo įšvirkšti į NAc apvalkalą dvišaliu būdu (1 μl / pusė per 10 min), naudojant koordinates (AP = 1.7, L = 2.0, D = −6.5). Elgesio tyrimai prasidėjo po 3 savaičių po stereotaksinės operacijos. Tikslus nustatymas buvo nustatytas imunohistochemiškai po to, kai buvo atliktas elgesio tyrimas.

Sacharozės neofobija

ΔFosB viršekspresinės žiurkės (N = 10) ir kontrolinės žiurkės (N = 8) buvo apdorotos 1 savaitę prieš elgesio bandymų pradžią. Norint išbandyti nerimą panašų elgesį, žiurkės buvo įvertintos neofobija pagal naują skonį (sacharozę). Žiurkės buvo atskirtos į atskirus narvus, o vanduo pašalintas 1600 h. Standartiniai žiurkių vandens buteliai buvo užpildyti 1% w / v sacharozės tirpalu žiurkių normaliame „vandentiekio“ vandenyje ir pasveriami prieš juos dedant ant kiekvieno narvo 1800 h. Po 30 min. Buteliai buvo pašalinti ir pakartotinai pasverti, ir apskaičiuotas sacharozės butelių svorio skirtumas prieš ir po bandymo. Tuomet narveliuose sacharozė buvo pakeista papildomoms 2 dienoms, kad žiurkės galėtų susipažinti su sacharozės skoniu prieš sacharozės pirmenybės tyrimą.

Padidėjęs plius labirintas

Kitas nerimo elgesio bandymas, padidėjęs labirintas (EPM), buvo išbandytas 2 dienas po sacharozės neofobijos. EPM matuoja vektorinį modifikuotą tiriamąjį elgesį naujoje ir nerimą keliančioje aplinkoje (Green et al., 2008). Dvi uždaros rankos ir dvi atviros rankos (Med Associates Inc., VT, JAV), matuojančios 12 × 50 cm, buvo 75 cm virš grindų ir turėjo fotometrą prie kiekvienos rankos įėjimo. Laikas, praleistas ant atvirų ginklų, buvo stebimas 5 min.

Šalto streso sukeltas išmatavimas

Kitą dieną po EPM buvo atliktas trečiasis nerimo testas: ištuštinimas, atsakas į šiek tiek įtemptą aplinką (šalta). Polikarbonato pelės narveliai (33 × 17 × 13 cm) iš anksto atšaldyti ant ledo 10 min. Žiurkės buvo dedamos į narvelius ant ledo 30 min, o išmatų skaičius buvo užfiksuotas kas 5 min.

Socialinis kontaktas

Kitą dieną depresijai panašus elgesys buvo matuojamas naudojant socialinio sąveikos testą. Žiurkės 24 h buvo atskiriamos prieš tyrimą. Tyrimo dieną žiurkės buvo įdėtos į naują aplinką (plastikinį indą, 45 × 40 × 45 cm) su jų narvų nariu ir elgesys buvo įrašytas vaizdo įraše 30 min. Mokslininkas aklas žiurkių būklei matavo, kiek laiko žiurkių pora išlaiko vieni kitus.

Sacharozės pirmenybė

Po socialinio kontakto sacharozės pirmenybės testas buvo naudojamas kaip anhedonijos modelis. Pora laikomos žiurkės 1600 val. Buvo atskiriamos su maistu, bet 2 h nebuvo leista patekti į vandenį. 1800 h metu ant kiekvieno narvo buvo dedami du iš anksto pasverti vandens buteliai, iš kurių vienas buvo vanduo, kitas - 1% sacharozės tirpalas vandenyje. Vandens buteliai buvo patalpinti į įprastą padėtį, o sacharozė buvo patalpinta maždaug 10 cm atstumu. Buteliai išimti ir pasverti po 15 min.

Lokomotorinis aktyvumas

Praėjus trims dienoms po sacharozės pirmenybės, lokomotorinis aktyvumas buvo vertinamas įprastomis šviesos sąlygomis, įdėjus žiurkes į skaidrias plexiglas kameras (40 × 40 × 40 cm) su plonu sluoksniu, apsuptu dviem 4 × 4 fotomėgių matricomis, viena 4 cm aukštyje žemės ir vienas 16 cm aukštyje virš žemės, kad būtų užregistruota horizontalioji pluoštinė ir vertikali (auginimo) veikla. Fotoaparato pertraukos buvo stebimos 2 h modifikuotoje atviro lauko veikimo sistemoje (San Diego Instruments, CA, JAV).

Priverstinis plaukimo bandymas

Paskutinis spontaniškas elgesio testas buvo FST, kuris buvo jautrus antidepresantams. Žiurkės buvo dedamos į Plexiglas cilindrą, užpildytą maždaug 14 L kambario temperatūros (24 ± 0.5 °) vandeniu 15 min. Sesijoje 1, ir 5 min sesijoje 2 kitą dieną. Žiurkės buvo išdžiovintos ir dedamos atgal į savo namų narvus. Plaukimo aktyvumas buvo įrašytas į vaizdo įrašą, o pirmosios nepastovumo periodo (1 s) latentinis laikas ir bendras judėjimo laikas buvo nustatytas 2 sesijos metu, kai tyrėjas aklino sąlygas.

Sacharozės operantas reaguoja

Kontrolinės AAV žiurkės ir AFosB viršįtampančios žiurkės buvo reguliuojamos pagal 85% laisvo maitinimo svorio per 7 dienas. Visos žiurkės buvo apmokytos barstyti sacharozės granules (Bio-Serv, NJ, USA) FR1 sustiprinimo schemoje 15 min sesijoms 5 iš eilės. Tada žiurkėms buvo suteikta galimybė laisvai patekti į maistą 3 dienoms ir vėl buvo leidžiama užspausti sacharozės granules, naudojant FR1 grafiką 15 min.

Kokaino savęs administravimas

Įsigijimas

Vieną savaitę po kateterinės operacijos (kaip aprašyta aukščiau) visos žiurkės (7 kontrolinės žiurkės ir 10 ΔFosB ekspresuojančios žiurkės, viena kontrolinė žiurkė buvo prarastos iš kateterinės operacijos) buvo dedamos į operacines kameras 30 × 24 × 21 cm (Med-Associates, St. Albans, VT) ir leido 0.2 h per parą 2 h per parą vartoti 4 mg / kg / infuzijos vieneto dozę; tada 0.5 mg / kg / infuzija 3 dienoms pagal FR1 grafiką. Kiekviena infuzija į veną buvo tiekiama 0.01 ml tūrio 5.8 s. Infuziją signalizavo dviejų 20 siųstuvų apšvietimas, kuris signalizavo apie laiko tarpą, kurio metu negalima pasiekti tolesnių infuzijų.

Gesinimas

Kadangi lėtinė kokaino ekspozicija greičiausiai sukeltų ΔFosB kaupimąsi kontrolinėse žiurkėse, dėl kurių abiejų vektorių sąlygomis žiurkės galvos smegenų AFosB kiekis būtų aukštas, žiurkės 4 dienoms apsiribojo savo namų narvais be savęs įvedimo. AFosB baltymų koncentracija sumažėja kontrolinės vektoriaus žiurkėse. Po 4 dienų abstinencijos, žiurkės buvo dedamos į operantinę kamerą ir leista savarankiškai vartoti fiziologinį tirpalą vietoj kokaino pagal XXXXX 1 sesijų 1 pertraukas pagal FR3 grafiką.

Fiksuotas santykinis dozės atsakas

Kiekviena žiurkė (kontrolinė ir ΔFosB viršekspresija) buvo leista savarankiškai 0.00325, 0.0075, 0.015, 0.03, 0.06, 0.125, 0.25, 0.5 mg / kg / infuzijos kokainą vartoti didėjančia tvarka pagal FR1 tvarkaraštį kiekvieną dieną 5 iš eilės. Žiurkės patys kiekvieną kartą vartojo kokainą 30 min.

Kokaino sukeltas atstatymas

Žiurkėms buvo atlikta per sesijos atkūrimo procedūrą. Žiurkės gavo 0.5 mg / kg / infuziją pagal FR1 grafiką 60 min, po to 3 h išnykimo (su kontingentiniais kokaino užuominomis). Po to jie gavo IP injekciją (Green et al., 2010) kokaino, kuriame yra viena iš penkių dozių (0, 2.5, 5, 10, arba 20 mg / kg), kiekvienam žiurkės atsitiktine tvarka per 5 atkūrimo sesijas. Paskutinis 3 h sesijos etapas buvo atsakas į gydymą, vėl su kokaino užuominomis, tačiau vis dar nebuvo kokaino infuzijų. Po kiekvieno kokaino sukeltos atkūrimo sesijos žiurkės gavo 2 dideles dozes (0.5 mg / kg / infuzija) per 1 h FR2 grafiką, kad palaikytų aukštą atsakymų skaičių per sesijas. Per kokaino savarankiško vartojimo procesą kai kurių žiurkių kateteriai palaipsniui prarado savarankiškumą; todėl 6 kontrolinių žiurkių ir 7 ΔFosB-ekspresuojančių žiurkių duomenys buvo naudojami šioje analizėje.

Statistinė analizė

Siekiant palyginti keturias gydymo grupes, buvo atliktos dviejų krypčių dispersijos analizės (ANOVAs) ir dvipusės pakartotinės priemonės ANOVA, o palyginimui tarp sąlygų buvo naudojami planuojami palyginimai. Tik dviejų sąlygų reikšmė buvo išanalizuota naudojant Studentą t-testas. Viskas t-tyrimo duomenys išlaikė „Shapiro-Wilk“ normalumo testą. Visi duomenys išreiškiami kaip vidurkis ± SEM. Statistinis reikšmingumas nustatytas p <0.05. Visos praturtintos žiurkės, skirtos vienam eksperimentui, buvo laikomos viename narve, tačiau buvo traktuojamos kaip atskiri subjektai, o tai turėjo įtakos galimos pseudoreplikacijos klausimui.

rezultatai

EB žiurkės pasižymi didesniu baziniu lygiu [prieaugis]FosB NAc nei IC žiurkės

Palyginti su IC žiurkėmis, EB žiurkės turi žymiai didesnį ΔFosB teigiamų ląstelių skaičių abiejose NAc šerdyse (t(4) = −3.31, p <0.05) ir apvalkalas (t(4) = −6.84, p <0.05) (pav 1A, C, E, F), rodo, kad bazinis ΔFosB tonas EB žiurkėse yra didesnis nei IC žiurkėms. Be to, Western blot rezultatai parodė, kad EB druskos žiurkėms, turinčioms didesnį bazinį AFosB baltymo lygį NAc, nustatyta didelė tendencija, palyginti su IC druskų žiurkėmis (t(6) = −2.03, p = 0.089; Pav Fig. 2A) 2A), naudojant dvipusį bandymą. Tačiau, atsižvelgiant į padidėjusią išraišką figūrose 1A – F ir kiti dokumentai (Solinas ir kt., 2009), esame įsitikinę šiuo požiūriu. Western blot rezultatai taip pat patvirtina, kad beveik visas imunohistochemijos metu nustatytas imunoreaktyvumas FosB panašus į FosB, o ne FosB, kuris nebuvo aptinkamas 24 h.

2 pav  

Kokainas ir [prieaugis]FosB EB ir IC žiurkėms. (A – B) Vidutinis ΔFosB baltymas () ir mRNR (B) (x SUM) NAc po 14 dienų fiziologinio tirpalo arba kokaino savarankiško skyrimo IC ir EC žiurkėms (\ tN = 7 – 8). Raudonos juostos skydelyje a žymi ...

[prieaugis]FosB diferencialiai sukelia EB ir IC žiurkėms stresą

Abiejų apvalkalų pakartotinio suvaržymo įtempis turėjo didelį poveikį.F(1, 8) = 16.6, P <0.005) ir šerdis (F(1, 8) = 7.9, P <0.05) NAc ir pagrindinis aplinkos praturtinimo lukštais poveikis (F(1, 8) = 22.3, P <0.005; Skaičiai 1A – F). Dar svarbiau, kad sąveika tarp streso ir aplinkos sodrinimo taip pat buvo reikšminga abiejuose korpusuose (F(1, 8) = 25.6, P <0.01) ir šerdis (F(1, 8) = 6.7, P <0.05). Sąveika buvo tokia, kad po pakartotinio suvaržymo streso ΔFosB teigiamų ląstelių skaičius žymiai padidėjo IC žiurkėse, o šis skaičius nepakito EC žiurkėms po pakartotinio streso.

Toliau ištirti, kaip ΔFosB dinamiškai reguliuoja ūminis ir kartotinis stresas ir leidžia palyginti su ankstesniais tyrimais (Alibhai et al., 2007), ΔFosB indukcija iRNR buvo tiriamas ūmaus ir kartotinio suvaržymo stresas (1 pav. \ t (Figure1G) .1G). Svarbus streso poveikis buvo didelis (F(2, 24) = 31.9, P <0.001) ir aplinkos praturtinimas (F(1, 24) = 5.1, P <0.05). IC žiurkėse ΔFosB mRNR buvo stipriai sukelta po ūmaus suvaržymo streso. Tačiau, kartojant stresą, ΔFosB mRNR indukcija buvo žymiai susilpninta, palyginti su ūmine indukcija. Taip pat buvo reikšminga sąveika (F(2, 24) = 4.6, P <0.05), įrodant, kad ūminė ΔFosB mRNR indukcija buvo mažesnė EB žiurkėms, palyginti su IC žiurkėmis. Taigi, EB žiurkės turi didesnį ΔFosB bazinį lygį baltymų NAc, bet mažiau ΔFosB iRNR reakcija į ūminį stresą.

[prieaugis]FosB yra skirtingai sukeltas kokaino EB ir IC žiurkių NAc

Siekiant nustatyti, ar EB ir IC žiurkės atsako į kokainą skirtingai, tyrėme ΔFosB baltymo ir mRNR reguliavimą žiurkės NAc po kokaino savarankiško vartojimo (skaičiai 2A, B atitinkamai). „Western blot“ atskleidė svarbų kokaino poveikį (F(1, 12) = 24.9, P <0.001) ir reikšminga sąveika (F(1,12) = 5.5, P <0.05). Sąveika buvo tokia, kad ΔFosB padidėjo daugiau IC žiurkėms nei EC žiurkėms (XNUMX pav.) (Figure2A) .2A). Iš tiesų, po kokaino savarankiško vartojimo FFBB baltymų kiekis buvo žymiai padidėjęs tik IC žiurkėms. Kalbant apie mRNR lygį, qPCR rezultatai taip pat atskleidė svarbų kokaino poveikį (F(1, 26) = 47.1, P <0.001) ir pagrindinis aplinkos sodrinimo poveikis (F(1, 26) = 13.8, P <0.005). Nors bendras EC žiurkių kiekis buvo mažesnis, abi grupės padidino ΔFosB mRNR (XNUMX pav.) (Figure2B2B).

Nors baltymų duomenys patvirtino pradinę hipotezę, tai buvo hipotezė iš Fig Figure1G1G kad EB žiurkės pasirodytų mažiau iRNR pirmiau minėto kokaino eksperimento indukcija nei izoliuotos žiurkės, kurios neįvyko Figure1G1G naudojo 30 min laiko tašką, o kokaino eksperimentas naudojo 3 h laiko tašką. Siekiant toliau tirti mRNR hipotezę, 30 min laiko taškas buvo naudojamas siekiant tirti tiek ūminį, tiek pakartotinį gydymą kokainu kaip geresnį palyginimą su paveikslu Figure1G.1G. Kadangi ūminis kokaino savarankiškas vartojimas yra problemiškas pagal pobūdį (ty įsigijimo mokymąsi), EB ir IC žiurkėms buvo skiriamos ūminės arba 9 dienos kartotinių nefunkcinių kokaino IP injekcijų (20 mg / kg). Kaip hipotezė, buvo reikšmingas aplinkosaugos praturtėjimo poveikis (F(1, 17) = 14.3, P <0.005), tačiau pagrindinis kokaino vartojimo poveikis (F(2, 17) = 3.4, P = 0.057) ir sąveika (F(2, 17) = 3.4, P = 0.055) parodė tik stiprią tendenciją, kai buvo atliktas dviejų rūšių bandymas. Tačiau, turint omenyje, kad mes turėjome kryptines hipotezes iš Fig Fig. 1G, 1G, mes manome, kad EK žiurkės turi mažiau indukcijos nei IC žiurkės (žr. 5 pav.) (Figure2C2C).

Viršijimas [prieaugis]FosB NAc korpuse imituoja apsauginį sodrinimo sukeltą priklausomybės fenotipą

Norint ištirti ΔFosB poveikį žiurkių elgesiui, nepriklausomai nuo aplinkos praturtėjimo / izoliacijos (ty, kad šie rezultatai būtų labiau susiję su ne EK / IC tyrimais), adeno sukeltas virusas (AAV) buvo naudojamas viršutinei ΔFosB ekspresijai NAc nesuvartotos poros laikomos žiurkės. Pagal ankstesnius tyrimus, NAc apvalkalas yra jautriausias depresijai ir narkotikų vartojimui / paieškai elgtis, todėl AAV vektoriai šiam tyrimui buvo švirkščiami į NAc apvalkalą (Green et al., 2006, 2008, 2010). Skaičiai 3A, B parodyti reprezentatyvią ΔFosB imunohistofluorescenciją su kontroliniu vektoriumi (skydelis A, ty endogeninė ΔFosB ekspresija) ir ΔFosB-viršekspressuojančiu vektoriumi (B skydelis), esantį NAc apvalkale.

3 pav  

Viršijimas [prieaugis]FosB į NAc korpusą imituoja aplinkos apsaugos praturtėjimo fenotipą. (A – B) Reprezentatyvi ΔFosB imunohistochemija hrGFP kontrolei () ir ΔFosB-pernelyg išreiškiama (B) AAV vektoriai. ...

Patvirtinę titrą, in vivo viruso vektoriaus išraiška ir bendras išdėstymas, pirmiausia ištyrėme ΔFosB pernelyg didelio poveikio nerimo modeliuose poveikį. Nepakankama ΔFosB ekspresija NAc korpuse nebuvo pakankama, kad būtų galima atkurti anxiogeninį poveikį, susijusį su aplinkos sodrinimu sacharozės neofobijoje ir šalto streso sukeltose defekacijos paradigmose (duomenys nerodomi). Be to, nebuvo jokio poveikio EPM (duomenys nerodomi). Kadangi žiurkėms aplinkosauginis praturtėjimas sukelia antidepresantą panašų poveikį, mes atlikome su depresija susijusius tyrimus su ΔFosB viršįtampančiomis žiurkėmis. Panašiai kaip nerimo modeliai, rezultatai parodė, kad pernelyg didelio ΔFosB ekspresijos NAc apvalkale nepakanka depresijai panašaus elgesio sumažinimui sacharozės preferencijos teste, socialinio sąveikos teste arba FST (duomenys nerodomi).

Aplinkos sodrinimo paradigmoje EB žiurkėms yra mažesnis bazinis lokomotorinis aktyvumas nei IC žiurkėms (Bowling ir kt., 1993; Boulingas ir Bardo 1994; Smith et al., 1997; Green et al., 2003, 2010). Siekiant ištirti ΔFosB pernelyg didelio poveikio NAc korpuse poveikį, spontaniškas lokomotorinis aktyvumas buvo ištirtas 120 min. Naudojant dvipusį bandymą, rezultatai parodė, kad pernelyg didėjantis ΔFosB gavimas NAc korpuse davė stiprią bazinės lokomotorinio aktyvumo žiurkėms tendenciją (žr. (Fig. 3C; 3C; t(16) = 1.84, p = 0.084). Nepaisant to, kad jie nėra gana statistiškai reikšmingi atliekant dvigubą bandymą, šie duomenys vis dar intriguoja, atsižvelgiant į tai, kad jie atitinka mūsų aiškią kryptinę hipotezę, pagrįstą Green et al. (2010), kuris atitinka aplinkos praturtinimo poveikį.

In priešingai depresijos ir nerimo modeliams, „FosB“ pernelyg didėjantis NAc korpuse sugebėjo sukurti panašų į fenotipą daugelyje priklausomybės / stiprinimo paradigmų. Isacharozės granulių operacinio savarankiško testavimo metu buvo reikšminga sąveika tarp ΔFosB overexpression ir žiurkių bado motyvacijos (F(1, 16) = 7.4, P <0.01). Žiurkės, per daug ekspresavusios ΔFosB NAc apvalkale, užtruko daugiau sacharozės granulės esant motyvuotoms bado sąlygoms (ty be 85% be kūno svorio), bet mažiau granulių esant mažai motyvuotai būklei (pvz., 100% laisvo pašaro svorio; Fig. 3D), 3D), kuris puikiai imituoja EB fenotipą (Green et al., 2010).

Aplinkos sodrinimo paradigmoje EK žiurkės ekstinkcijos ir kokaino sukeltos atstatymo metu sumažino kokaino ieškojimo elgesį (Green et al., 2010). Taigi, kokaino vartojimas ir ieškojimas elgiamasi ΔFosB ekspresuojančiose žiurkėse, naudojant intraveninę kokaino savarankiško vartojimo paradigmą. Kaip troškimo modelis, kokaino išnykimo paradigma atskleidė, kad ΔFosB pernelyg didelė išraiška NAc korpuse sumažino vaistų paieškos elgsenąr (F(1, 15) = 6.7, P <0.05; Pav Figure3E) .3E). Taip pat įvyko svarbus sesijos poveikis (F(2, 30) = 74.0, P <0.001). Palaikomajam atsakui pagal FR1 tvarkaraštį buvo reikšmingas pagrindinis dozės poveikis (F(7, 105) = 222.6, P <0.001) ir reikšminga sąveika (F(7, 105) = 2.3, P <0.05) suvartojant kokainą. Sąveikos pobūdis buvo toks, kad skirtumai buvo akivaizdūs tik vartojant didesnes kokaino dozes (XNUMX pav.) (Figure3F) .3F). Galiausiai, dėl kokaino sukeltos atkūrimo buvo reikšmingas pagrindinis dozės poveikis (\ tF(4, 44) = 15.5, P <0.001) ir pagrindinio ΔFosB ekspresijos efekto tendencija naudojant dviejų uodegų testą (F(1, 11) = 4.1, P = 0.067). Tačiau, atsižvelgiant į „Green et al. (2010) ir statistiškai reikšmingi bei nuoseklūs rezultatai, pateikti skaičiuose 3D, E, F, tikėtina, kad ΔFosB sumažina atkūrimą (1 pav. \ t (Figure3G) .3G). Atsakas į 10 mg / kg dozę buvo žymiai mažesnis ΔFosB ekspresuojančioms žiurkėms. Rezultatai, kaip visuma, rodo, kad ΔFosB per didelė ekspresija žiurkės NAc korpuse mažina kokaino vartojimą ir elgesį, kuris atitinka aplinkos praturtėjimo elgesio poveikį.

Diskusija

Žmonių pažeidžiamumas priklausomybei ir depresijai labai priklauso nuo aplinkos veiksnių. Aplinkos sodrinimas yra paradigma, kuri manipuliuoja gyvūnų gyvenamąja aplinka ir kuria apsauginį poveikį daugeliui psichikos sąlygų. ΔFosB atlieka pagrindinį vaidmenį reguliuojant atlygio funkciją daugelyje smegenų regionų, įskaitant NAc ir dorsal striatum (Koob ir kt., 1998; Išminčius, 1998; Wallace ir kt. 2008; Grueter ir kt. 2013; Pitchers ir kt. 2013). Šiame projekte ištyrėme dinamišką ΔFosB reguliavimą ribojantį stresą ir kokainą praturtintose ir izoliuotose žiurkėse. Pagrindiniai šio projekto rezultatai yra:

(1) EB žiurkės pradžioje NAc padidino AFosB koncentraciją lyginant su IC žiurkėmis;

(2) tik IC žiurkės sukaupia papildomą ΔFosB baltymą su pakartotiniu stresu;

(3) EB žiurkėms pavyko susilpninti ΔFosB mRNR indukciją po streso ar kokaino; ir

(4) per daug ekspresuojant ΔFosB pora laikomų žiurkių NAc, imituoja apsauginį priklausomybės fenotipą, bet ne apsauginį depresijos fenotipą.

Galima tikėtis iš paskelbtos literatūros, kuri rodo, kad transgeninės ΔFosB viršekspressuojančios pelės rodo didesnį jautrumą kokaino atlyginimui ir savarankiškam vartojimui mažomis vaistų dozėmis (Kelz et al. 1999; Colby ir kt. 2003; Vialou ir kt. 2010; Robison ir kt. 2013), kad šiuo eksperimentu AFosB viršįtampančios žiurkės parodytų didesnį polinkį į kokaino savęs administravimą ir ieškojimą. ITačiau dabartiniuose eksperimentuose FFosB pernelyg didėjant NAc korpuse sumažėjo kokaino vartojimas ir kokaino vartojimas išnykimo ir atkūrimo metu, o tai rodo, kad mažėja kokaino motyvacija. Neatitikimas gali būti dėl to, kad transgeninės pelės išreiškė ΔFosB per visą striatumą, bet tik dinamorino + ląstelėse (Colby ir kt., 2003). Dabartiniame eksperimente ΔFosB buvo pernelyg išreikštas per AAV vektorių, kurie užkrečia dinorfino + ir enkefalino + neuronus. Antra, dabartiniame tyrime daugiausia dėmesio buvo skiriama NAc korpusui, o ne visam striatų regionui.

Be priklausomybės fenotipo, aplinkos sodrinimas žiurkėms sukuria antidepresantų ir anksiogeninių panašių profilių. (Green et al., 2010; Vialou ir kt. 2010). Dabartiniame tyrime ΔFosB per didelė ekspresija NAc nesukėlė jokio trijų depresijos ar trijų nerimo testų poveikio.. Nors yra daug galimų veiksnių, kurie gali prisidėti prie „FosB“ imituojančio priklausomybės nuo priklausomybės, tačiau ne depresijos fenotipo, gali būti, kad NAc apvalkalas dominuoja priklausomybės nuo elgesio atžvilgiu, o su depresija susijęs elgesys gali būti labiau įtvirtintas kitų regionų. Šios išvados prieštarauja tyrimams pelės kur ΔFosB viršsekspresija NAc (kur negalima patikimai atskirti apvalkalo ir branduolio) sukėlė tvirtą antidepresantą panašų poveikį keliose elgsenos analizėse (Vialou ir kt., 2010). Viena iš priežasčių yra tai, kad gali būti lengviau matyti ΔFosB poveikį sunkiems streso elgsenos modeliams, pvz., Socialiniam pralaimėjimui. Dabartinė per didelės ekspresijos studija ištyrė panašų į depresiją elgesį, nesant stipraus streso.

Atliekant šį tyrimą, aukšti ΔFosB baziniai lygiai (pvz., Iš sodrinimo, pakartotinio streso ar kokaino) koreliavo su silpnesniu vėlesniu ΔFosB indukcija. Tai gali reikšti lubų efektą, be papildomo indukcinio baltymo lygio. Taip pat yra įmanoma, kad sukaupti ΔFosB lygiai gali paskatinti slopinti tolesnę ΔFosB mRNR indukciją po streso ar kokaino kaip neigiamos grįžtamosios linijos. Pavyzdžiui, EC žiurkės turėjo didelį AFosB kiekį ir parodė susilpnintą ΔFosB indukciją po streso ar kokaino. Tai rodo neigiamą koreliaciją tarp ΔFosB baltymų lygių ir jo mRNR indukcijos. Neigiamas susikaupusio ΔFosB grįžtamasis ryšys taip pat lemia susilpnintą ΔFosB indukciją su pakartotiniu stresu IC žiurkėse.

Kad būtų aišku, mes nepateikiame jokių teiginių, kad aplinkos sodrinimo paradigma turi tiesioginį reikšmingumą, nes yra labai mažai vaikų, kurie išgyvenami tikrojo atėmimo metu (reikėtų pažymėti, kad socialinis ir ekonominis trūkumas neatitinka aplinkos trūkumo). Šios paradigmos naudingumas yra tai, kad tai yra ne narkotikų, ne chirurginė, ne genetinė manipuliacija, kuri sukuria apsauginius elgesio fenotipus priklausomybei ir depresijai, kuriuos galima panaudoti laboratorijoje kontroliuojamoje aplinkoje kaip pagrindinį mokslinį įrankį molekuliniams mechanizmams nustatyti atsparumą psichikos sąlygoms. Ankstesni tyrimai išsamiai aprašė elgesio fenotipus (Bowling ir kt., 1993; Boulingas ir Bardo 1994; Bardo ir kt. 1995; Green et al., 2002, 2003; El Rawas ir kt. 2009) ir naujesni tyrimai (Solinas ir kt., 2009; Green et al., 2010; Lobo ir kt. 2013), kartu su šiuo metu atliktu tyrimu, pateikiami užuominų apie šių elgsenos fenotipų transkripcinius mechanizmus. Toliau tiriami transkripcijos tiksliniai genai / baltymai, gaminantys apsauginius fenotipus, šiuo metu tiriami (Fan et al., 2013a,b; Lichti ir kt. 2014).

Mūsų aplinkosaugos praturtinimo koncepcija yra ta, kad sodrinimas yra kontinuumas su izoliacija žemo galo ir visiško sodrinimo metu. „Visapusiškas sodrinimas šiuo atveju apibrėžiamas kaip aplinka, kurioje subjektai susiduria su naujumu, nekeliančiu socialinio kontakto su specifiniais, ir yra leidžiami erdvė ir objektai pratyboms. Tvisi šie trys veiksniai atspindi „sodrinimo“ sudėtinę būseną, nes kiekvienas jų yra naudingas ir kiekvienas išleidžiamas dopaminas NAc, ir todėl aktyvina bendrą neurobiologinę grandinę (Louilot ir kt., 1986; Calcagnetti ir Schechter, 1992; Crowder ir Hutto, 1992; Rebec ir kt. 1997; Bevins ir kt. 2002). Šioje konceptualizacijoje izoliacija laikoma kontroline grupe, nes ji atspindi manipuliacijos nebuvimą (ty praturtinimą; Crofton ir kt., Peržiūros metu). Tačiau yra ir kitų konceptualizacijų. Vienoje alternatyvioje konceptualizacijoje kontinuumas yra tas pats, tačiau izoliacijos grupė yra eksperimentinė grupė, o praturtinta grupė yra kontrolė. Iniame modelyje, atimant normalaus sodrinimo subjektams is faktinį manipuliavimą. Išiuo atveju, užuot sakiusi, kad sodrinimas yra apsauginis, galima teigti, kad izoliacija suteikia jautrumą. Dar trečiasis konceptualizavimas reiškia, kad nėra tęstinumo ir kad sodrinimas ir izoliavimas yra dvi iš esmės skirtingos manipuliacijos. Atsižvelgiant į tai, sodrinimas ir izoliavimas turėtų būti atskirti ir abu, palyginti su valdymu, kuriame yra poras. Visuotinio sutarimo dėl praturtėjimo pobūdžio trūkumas yra paradigmos apribojimas, tačiau suteikia kryptį būsimiems tyrimams. Nepaisant to, šių eksperimentų rezultatai yra tvirti, nepaisant vėlesnio aiškinimo.

Aplinkos ir gyvenimo patirtis turi didelę įtaką daugelio psichikos sąlygų vystymuisi ir išraiškai. Apsaugos priklausomybės ir depresijos fenotipų supratimas apie aplinkos praturtėjimą sprendžia esminį psichikos sutrikimų tyrimo klausimą - būtent aplinkos indėlį į jautrumą ar atsparumą psichikos sąlygoms. Šiame tyrime pabrėžiama ΔFosB reikšmė reguliuojant priklausomybę. Būsimuose tyrimuose turi būti toliau tiriamas ΔFosB poveikis ir jo aktyvavimo bei slopinimo poveikis specifiniams tiksliniams genams, atsižvelgiant į aplinkos sodrinimo modelį.

Finansavimas ir atskleidimas

Yafang Zhang, niekas; Elizabeth J. Crofton, niekas; Dingge Li, nėra; Mary Kay Lobo, niekas; Xiuzhen Fan, niekas; Eric J. Nestler, R37DA007359; Thomas A. Green, DA029091.

Interesų konflikto pareiškimas

Autoriai teigia, kad tyrimas buvo atliktas nesant jokių komercinių ar finansinių santykių, kurie galėtų būti laikomi galimu interesų konfliktu.

Padėka

Šie eksperimentai buvo finansuojami iš Nacionalinio narkotikų vartojimo instituto, DA029091 ir R37DA007359. Kokainas, kurį teikia Nacionalinis piktnaudžiavimo narkotikais institutas.

Nuorodos

  1. Akdeniz C., Tost H., Meyer-Lindenberg A. (2014). Šizofrenijos socialinės aplinkos rizikos neurobiologija: besivystanti mokslinių tyrimų sritis. Soc. Psichiatrija Psichiatras. Epidemiolis. 49, 507 – 517 10.1007 / s00127-014-0858-4 [PubMed] [Kryžiaus nuoroda]
  2. Alibhai IN, Žalioji TA, Potashkin JA, Nestler EJ (2007). FozB ir DeltafosB mRNR ekspresijos reguliavimas: in vivo ir in vitro tyrimai. Brain Res. 1143, 22 – 33 10.1016 / j.brainres.2007.01.069 [PMC nemokamas straipsnis] [PubMed] [Kryžiaus nuoroda]
  3. Bardo MT, Bowling SL, Rowlett JK, Manderscheid P., Buxton ST, Dwoskin LP (1995). Aplinkos sodrinimas mažina judrumo jautrinimą, bet ne in vitro dopamino išsiskyrimą, kurį sukelia amfetaminas. Pharmacol. Biochem. Behav. 51, 397 – 405 10.1016 / 0091-3057 (94) 00413-d [PubMed] [Kryžiaus nuoroda]
  4. Bevins RA, Besheer J., Palmatier MI, Jensen HC, Pickett KS, Eurek S. (2002). Naujo objekto vietos kondicionavimas: elgesio ir dopaminerginiai procesai, išreiškiantys naujumo atlygį. Behav. Brain Res. 129, 41 – 50 10.1016 / s0166-4328 (01) 00326-6 [PubMed] [Kryžiaus nuoroda]
  5. Bowling SL, Bardo MT (1994). Amfetamino poveikis lokomotoriniam ir naudingam praturtintose, socialinėse ir izoliuotose auginamose žiurkėse. Pharmacol. Biochem. Behav. 48, 459 – 464 10.1016 / 0091-3057 (94) 90553-3 [PubMed] [Kryžiaus nuoroda]
  6. Bowling SL, Rowlett JK, Bardo MT (1993). Aplinkos sodrinimo poveikis amfetamino stimuliuojamam lokomotoriniam aktyvumui, dopamino sintezei ir dopamino išsiskyrimui. Neurofarmakologija 32, 885 – 893 10.1016 / 0028-3908 (93) 90144-r [PubMed] [Kryžiaus nuoroda]
  7. Calcagnetti DJ, Schechter MD (1992). Vietos kondicionavimas atskleidžia naudingą jaunų žiurkių socialinės sąveikos aspektą. Physiol. Behav. 51, 667 – 672 10.1016 / 0031-9384 (92) 90101-7 [PubMed] [Kryžiaus nuoroda]
  8. Chen J., Nye HE, Kelz MB, Hiroi N., Nakabeppu Y., Hope BT, et al. (1995). Delta FosB ir FosB panašių baltymų reguliavimas elektrokonvulsinių priepuolių ir kokaino gydymu. Mol. Pharmacol. 48, 880 – 889 [PubMed]
  9. Colby CR, Whisler K., Steffen C., Nestler EJ, Self DW (2003). Striatyvinė ląstelių tipo specifinė „DeltaFosB“ ekspresija padidina kokaino skatinimą. J. Neurosci. 23, 2488 – 2493 [PubMed]
  10. Crowder WF, Hutto CW (1992). Operatoriaus patalpų kondicionavimo priemonės, ištirtos naudojant du nesuderintus stiprintuvus. Pharmacol. Biochem. Behav. 41, 817 – 824 10.1016 / 0091-3057 (92) 90233-6 [PubMed] [Kryžiaus nuoroda]
  11. Elisei S., Sciarma T., Verdolini N., Anastasi S. (2013). Atsparumas ir depresijos sutrikimai. Psichiatras. Danubas. 25 (papild. 2), S263 – S267 [PubMed]
  12. El Rawas R., Thiriet N., Lardeux V., Jaber M., Solinas M. (2009). Aplinkos sodrinimas mažina naudingą, bet ne aktyvų heroino poveikį. Psichofarmakologija (Berl) 203, 561 – 570 10.1007 / s00213-008-1402-6 [PubMed] [Kryžiaus nuoroda]
  13. Fan X., Li D., Lichti CF, Green TA (2013a). Dinaminė branduolių accumbens proteomika reaguojant į ūminį psichologinį stresą aplinkoje praturtintose ir izoliuotose žiurkėse. PLoS One 8: e73689 10.1371 / žurnalas.pone.0073689 [PMC nemokamas straipsnis] [PubMed] [Kryžiaus nuoroda]
  14. Fan X., Li D., Zhang Y., Green TA (2013b). Atskiras žiurkių branduolių accumbens fosforo baltymų reguliavimas reaguojant į ūminį stresą. PLoS One 8: e79893 10.1371 / žurnalas.pone.0079893 [PMC nemokamas straipsnis] [PubMed] [Kryžiaus nuoroda]
  15. Green TA, Alibhai IN, Hommel JD, Dileone RJ, Kumar A., ​​Theobald DE ir kt. (2006). Indukcinio cAMP ankstyvosios repressoriaus ekspresijos indukcija branduolyje accumbens streso arba amfetamino pagalba padidina elgesio atsaką į emocinius stimulus. J. Neurosci. 26, 8235 – 8242 10.1523 / jneurosci.0880-06.2006 [PubMed] [Kryžiaus nuoroda]
  16. Green TA, Alibhai IN, Roybal CN, Winstanley CA, Theobald DE, Birnbaum SG, et al. (2010). Aplinkos sodrinimas sukuria elgsenos fenotipą, kurį sąlygoja mažas ciklinis adenozino monofosfato atsako elemento surišimo (CREB) aktyvumas branduolyje accumbens. Biol. Psichiatrija 67, 28 – 35 10.1016 / j.biopsych.2009.06.022 [PMC nemokamas straipsnis] [PubMed] [Kryžiaus nuoroda]
  17. Green TA, Alibhai IN, Unterberg S., Neve RL, Ghose S., Tamminga CA ir kt. (2008). Aktyvuojančių transkripcijos faktorių (ATFX) ATF2, ATF3 ir ATF4 indukcija branduolyje accumbens ir jų emocinio elgesio reguliavimas. J. Neurosci. 28, 2025 – 2032 10.1523 / jneurosci.5273-07.2008 [PubMed] [Kryžiaus nuoroda]
  18. Žalioji TA, Kainas ME, Thompson M., Bardo MT (2003). Aplinkos sodrinimas sumažina nikotino sukeltą hiperaktyvumą žiurkėms. Psichofarmakologija (Berl) 170, 235 – 241 10.1007 / s00213-003-1538-3 [PubMed] [Kryžiaus nuoroda]
  19. Žalioji TA, Gehrke BJ, Bardo MT (2002). Aplinkos sodrinimas mažina intraveninį amfetamino savarankišką vartojimą žiurkėms: dozės ir atsako funkcijos fiksuoto ir progresyvaus santykio grafikams. Psichofarmakologija (Berl) 162, 373 – 378 10.1007 / s00213-002-1134-y [PubMed] [Kryžiaus nuoroda]
  20. Grueter BA, Robison AJ, Neve RL, Nestler EJ, Malenka RC (2013). ΔFosB diferencialiai moduliuoja branduolio accumbens tiesioginę ir netiesioginę trajektorijos funkciją. Proc. Natl. Acad. Sci. JAV 110, 1923 – 1928 10.1073 / pnas.1221742110 [PMC nemokamas straipsnis] [PubMed] [Kryžiaus nuoroda]
  21. Hope B., Kosofsky B., Hyman SE, Nestler EJ (1992). Greitos ankstyvosios geno ekspresijos reguliavimas ir AP-1 surišimas žiurkių branduolyje akrobatinio lėtinio kokaino. Proc. Natl. Acad. Sci. JAV 89, 5764 – 5768 10.1073 / pnas.89.13.5764 [PMC nemokamas straipsnis] [PubMed] [Kryžiaus nuoroda]
  22. Hope BT, Nye HE, Kelz MB, Self DW, Iadarola MJ, Nakabeppu Y. et al. (1994). Ilgalaikio AP-1 komplekso, kurį sudaro kintantys Fos tipo baltymai smegenyse, sukėlimas lėtiniu kokainu ir kitais lėtiniais gydymais. Neuronas 13, 1235 – 1244 10.1016 / 0896-6273 (94) 90061-2 [PubMed] [Kryžiaus nuoroda]
  23. Jha S., Dong B., Sakata K. (2011). Gausus aplinkos gydymas pakeičia priešišką elgesį su depresija ir atstato sumažėjusį hipokampo neurogenezę ir smegenų kilmės neurotrofinio faktoriaus baltymų lygius pelėse, kurios neturi ekspresijos per promotorių IV. Vertimas. Psichiatrija 1: e40 10.1038 / tp.2011.33 [PMC nemokamas straipsnis] [PubMed] [Kryžiaus nuoroda]
  24. Kato T., Iwamoto K. (2014). Visapusiška DNR metilinimo ir hidroksimetilinimo analizė žmogaus smegenyse ir jos įtaka psichikos sutrikimams. Neurofarmakologija 80, 133 – 139 10.1016 / j.neuropharm.2013.12.019 [PubMed] [Kryžiaus nuoroda]
  25. Kelz MB, Chen J., Carlezon WA, Whisler K., Gilden L., Beckmann AM ir kt. (1999). Transkripcijos faktoriaus deltaFosB ekspresija smegenyse kontroliuoja jautrumą kokainui. Gamta 401, 272 – 276 10.1038 / 45790 [PubMed] [Kryžiaus nuoroda]
  26. Kelz MB, Nestler EJ (2000). deltaFosB: molekulinis jungiklis, pagrįstas ilgalaikiu nerviniu plastiškumu. Curr. Opin. Neurolis. 13, 715 – 720 10.1097 / 00019052-200012000-00017 [PubMed] [Kryžiaus nuoroda]
  27. Koob GF, Sanna PP, Bloom FE (1998). Neurologija priklausomybei. Neuronas 21, 467 – 476 [PubMed]
  28. Larson EB, Graham DL, Arzaga RR, Buzin N., Webb J., Green TA ir kt. (2011). CREB ekspresija branduolio accumbens lukšte padidina kokaino sustiprinimą savarankiškai vartojančioms žiurkėms. J. Neurosci. 31, 16447 – 16457 10.1523 / JNEUROSCI.3070-11.2011 [PMC nemokamas straipsnis] [PubMed] [Kryžiaus nuoroda]
  29. Laviola G., Hannan AJ, Macrì S., Solinas M., Jaber M. (2008). Didesnės aplinkos įtaka neurodegeneracinių ligų ir psichikos sutrikimų gyvūnų modeliams. Neurobiol. Dis. 31, 159 – 168 10.1016 / j.nbd.2008.05.001 [PubMed] [Kryžiaus nuoroda]
  30. Lichti CF, Fan X., anglų RD, Zhang Y., Li D., Kong F., et al. (2014). Aplinkos sodrinimas keičia baltymų ekspresiją ir proteominį atsaką į kokainą žiurkių branduoliuose. Priekyje. Behav. Neurosci. 8: 246 10.3389 / fnbeh.2014.00246 [PMC nemokamas straipsnis] [PubMed] [Kryžiaus nuoroda]
  31. Lobo MK, Zaman S., Damez-Werno DM, Koo JW, Bagot RC, Dinieri JA ir kt. (2013). ΔFosB indukcija striatrijose vidutinio smegenų neuronų potipiuose atsakant į lėtinius farmakologinius, emocinius ir optogenetinius stimulus. J. Neurosci. 33, 18381 – 18395 10.1523 / JNEUROSCI.1875-13.2013 [PMC nemokamas straipsnis] [PubMed] [Kryžiaus nuoroda]
  32. Louilot A., Le Moal M., Simon H. (1986). Dopaminerginių neuronų reaktyvumas branduolyje accumbens reaguojant į skirtingas elgesio situacijas. In vivo voltametrinis tyrimas su laisvai judančiomis žiurkėmis. Brain Res. 397, 395 – 400 10.1016 / 0006-8993 (86) 90646-3 [PubMed] [Kryžiaus nuoroda]
  33. McBride WJ, Kimpel MW, Mcclintick JN, Ding ZM, Edenbergas HJ, Liang T. et al. (2014). Geno ekspresijos pokyčiai išplėstoje amygdaloje, kai alkoholio vartojančių paauglių (P) žiurkių alkoholio vartojimas buvo panašus. Pharmacol. Biochem. Behav. 117, 52 – 60 10.1016 / j.pbb.2013.12.009 [PMC nemokamas straipsnis] [PubMed] [Kryžiaus nuoroda]
  34. Mlynarik M., Johansson BB, Jezova D. (2004). Didesnė aplinka įtakoja antinksčių korekcinį atsaką į imuninį poveikį ir glutamato receptorių genų ekspresiją žiurkių hipokampe. Ann. NY Acad. Sci. 1018, 273 – 280 10.1196 / annals.1296.032 [PubMed] [Kryžiaus nuoroda]
  35. Nestler EJ (2001). Priklausomybės molekulinė neurobiologija. Esu. J. Addict. 10, 201 – 217 10.1080 / 105504901750532094 [PubMed] [Kryžiaus nuoroda]
  36. Nestler EJ (2008). Peržiūra. Transkripcijos priklausomybės mechanizmai: DeltaFosB vaidmuo. Filosas. Trans. R. Soc. Lond. B Biol. Sci. 363, 3245 – 3255 10.1098 / rstb.2008.0067 [PMC nemokamas straipsnis] [PubMed] [Kryžiaus nuoroda]
  37. „Nestler EJ“, „Barrot M.“, „Self DW“ („2001“). DeltaFosB: ilgalaikis molekulinis jungiklis priklausomybei. Proc. Natl. Acad. Sci. JAV 98, 11042 – 11046 10.1073 / pnas.191352698 [PMC nemokamas straipsnis] [PubMed] [Kryžiaus nuoroda]
  38. Perrotti LI, Hadeishi Y., Ulery PG, Barrot M., Monteggia L., Duman RS ir kt. (2004). DeltaFosB indukcija su lydinčiomis smegenų struktūromis po lėtinio streso. J. Neurosci. 24, 10594 – 10602 10.1523 / jneurosci.2542-04.2004 [PubMed] [Kryžiaus nuoroda]
  39. Perrotti LI, Weaver RR, Robison B., Renthal W., Maze I., Yazdani S., et al. (2008). Skirtingi DeltaFosB indukcijos modeliai smegenyse, naudojant narkotikus. Sinchronizavimas 62, 358 – 369 10.1002 / syn.20500 [PMC nemokamas straipsnis] [PubMed] [Kryžiaus nuoroda]
  40. Pitchers KK, Vialou V., Nestler EJ, Laviolette SR, Lehman MN, Coolen LM (2013). Natūralūs ir narkotikų apdovanojimai veikia bendruosius neuroninius plastiškumo mechanizmus su ΔFosB kaip pagrindiniu tarpininku. J. Neurosci. 33, 3434 – 3442 10.1523 / jneurosci.4881-12.2013 [PMC nemokamas straipsnis] [PubMed] [Kryžiaus nuoroda]
  41. Rebec GV, Christensen JR, Guerra C., Bardo MT (1997). Regioniniai ir laikini skirtumai realaus laiko dopamino išsiliejime į branduolį accumbens per laisvai pasirenkamą naujovę. Brain Res. 776, 61 – 67 10.1016 / s0006-8993 (97) 01004-4 [PubMed] [Kryžiaus nuoroda]
  42. Robison AJ, Vialou V., Mazei-Robison M., Feng J., Kourrich S., Collins M., et al. (2013). Norint elgtis ir struktūrinis atsakas į lėtinį kokainą, reikia, kad branduolio accumbens apvalkale būtų ΔFosB ir kalcio / kalmodulino priklausomos baltymų kinazės II. J. Neurosci. 33, 4295 – 4307 10.1523 / jneurosci.5192-12.2013 [PMC nemokamas straipsnis] [PubMed] [Kryžiaus nuoroda]
  43. Smith JK, Neill JC, Costall B. (1997). Po atjunkymo būsto sąlygos daro įtaką kokaino ir d-amfetamino elgesio poveikiui. Psichofarmakologija (Berl) 131, 23 – 33 10.1007 / s002130050261 [PubMed] [Kryžiaus nuoroda]
  44. Solinas M., Chauvet C., Thiriet N., El Rawas R., Jaber M. (2008). Kokaino priklausomybės panaikinimas aplinkos praturtinimu. Proc. Natl. Acad. Sci. JAV 105, 17145 – 17150 10.1073 / pnas.0806889105 [PMC nemokamas straipsnis] [PubMed] [Kryžiaus nuoroda]
  45. Solinas M., Thiriet N., El Rawas R., Lardeux V., Jaber M. (2009). Aplinkos sodrinimas ankstyvuoju gyvenimo etapu sumažina kokaino elgesio, neurocheminius ir molekulinius efektus. Neuropsichofarmakologija 34, 1102 – 1111 10.1038 / npp.2008.51 [PubMed] [Kryžiaus nuoroda]
  46. Laiptai DJ, Prendergast MA, Bardo MT (2011). Su žiurkėmis sukeltas kortikosterono ir gliukokortikoidų receptorių blokavimas dėl amfetamino savarankiško vartojimo. Psichofarmakologija (Berl) 218, 293 – 301 10.1007 / s00213-011-2448-4 [PMC nemokamas straipsnis] [PubMed] [Kryžiaus nuoroda]
  47. Thiel KJ, Pentkowski NS, Peartree NA, tapytojas MR, Neisewander JL (2010). Aplinkos gyvenimo sąlygos, įvestos priverstinio susilaikymo metu, keičia kokainą ieškantį elgesį ir Fos baltymų ekspresiją. Neurologija 171, 1187 – 1196 10.1016 / j.neuroscience.2010.10.001 [PMC nemokamas straipsnis] [PubMed] [Kryžiaus nuoroda]
  48. Thiel KJ, Sanabria F., Pentkowski NS, Neisewander JL (2009). Aplinkos sodrinimo pasipriešinimas nuo potraukio. Vid. J. Neuropsychopharmacol. 12, 1151 – 1156 10.1017 / s1461145709990472 [PMC nemokamas straipsnis] [PubMed] [Kryžiaus nuoroda]
  49. van Winkel M., Peeters F., Van Winkel R., Kenis G., Collip D., Geschwind N. ir kt. (2014). BDNF geno pokyčių įtaka socialinio streso jautrumui ir teigiamų emocijų buferiniam poveikiui: replikacija ir geno-aplinkos sąveikos išplėtimas. Euras. Neuropsychopharmacol. 24, 930 – 938 10.1016 / j.euroneuro.2014.02.005 [PubMed] [Kryžiaus nuoroda]
  50. Venebra-Muñoz A., Corona-Morales A., Santiago-García J., Melgarejo-Gutiérrez M., Caba M., García-García F. (2014). Didesnė aplinka silpnina savarankišką nikotino vartojimą ir sukelia ΔFosB ekspresijos pokyčius žiurkių prefrono žievėje ir branduolyje accumbens. Neuroreportas 25, 694 – 698 10.1097 / wnr.0000000000000157 [PubMed] [Kryžiaus nuoroda]
  51. Vialou V., Robison AJ, Laplant QC, Covington HE, Dietz DM, Ohnishi YN ir kt. (2010). „DeltaFosB“ smegenų atlygio grandinėse tarpininkauja atsparumui stresui ir antidepresantams. Nat. Neurosci. 13, 745 – 752 10.1038 / nn.2551 [PMC nemokamas straipsnis] [PubMed] [Kryžiaus nuoroda]
  52. Wallace DL, Vialou V., Rios L., Carle-Florence TL, Chakravarty S., Kumar A., ​​et al. (2008). „DeltaFosB“ įtaka branduoliui siejama su natūraliu atlygiu. J. Neurosci. 28, 10272 – 10277 10.1523 / jneurosci.1531-08.2008 [PMC nemokamas straipsnis] [PubMed] [Kryžiaus nuoroda]
  53. Wang Y., Cesena TI, Ohnishi Y., Burger-Caplan R., Lam V., Kirchhoff PD ir kt. (2012). Mažos molekulės atranka nustato transkripcijos faktoriaus ΔFosB reguliatorius. ACS Chem. Neurosci. 3, 546 – 556 10.1021 / cn3000235 [PMC nemokamas straipsnis] [PubMed] [Kryžiaus nuoroda]
  54. Werme M., Messer C., Olson L., Gilden L., Thorén P., Nestler EJ, et al. (2002). Delta FosB reguliuoja ratų važiavimą. J. Neurosci. 22, 8133 – 8138 [PubMed]
  55. Winstanley CA, Bachtell RK, Theobald DE, Laali S., Green TA, Kumar A., ​​et al. (2009a). Padidėjęs impulsyvumas pertraukus iš kokaino savarankiško vartojimo: DeltaFosB vaidmuo orbitofrontalinėje žievėje. Cereb. „Cortex 19“, „435 – 444 10.1093 / cercor / bhn094 [PMC nemokamas straipsnis] [PubMed] [Kryžiaus nuoroda]
  56. Winstanley CA, Green TA, Theobald DE, Renthal W., LaPlant Q., DiLeone RJ, et al. (2009b). DeltaFosB indukcija orbitofrontalinėje žievėje stiprina lokomotorinį jautrumą, nors ir silpnina kokaino sukeltą pažinimo sutrikimą. Pharmacol. Biochem. Behav. 93, 278 – 284 10.1016 / j.pbb.2008.12.007 [PMC nemokamas straipsnis] [PubMed] [Kryžiaus nuoroda]
  57. Winstanley CA, LaPlant Q., Theobald DE, Green TA, Bachtell RK, Perrotti LI ir kt. (2007). DeltaFosB indukcija orbitofrontalinėje žievėje skleidžia toleranciją kokaino sukeltai kognityvinei disfunkcijai. J. Neurosci. 27, 10497 – 10507 10.1523 / jneurosci.2566-07.2007 [PubMed] [Kryžiaus nuoroda]
  • Išminčius RA (1998). Narkotikų aktyvinimas smegenų atlyginimų keliuose. Priklauso nuo alkoholio. 51, 13 – 22 10.1016 / s0376-8716 (98) 00063-5 [PubMed] [Kryžiaus nuoroda]