DeltaFosB stabilumo reguliavimas fosforilinimo būdu (2006)

J Neuroscience. 2006 May 10;26(19):5131-42.

Ulery PG, Rudenko G, Nestler EJ.

Šaltinis

Psichiatrijos katedra, Pagrindinės neurologijos centras, Teksaso universiteto Pietvakarių medicinos centras, Dalasas, Teksasas 75390-9070, JAV.

Abstraktus

Transkripcijos faktorius DeltaFosB (dar vadinamas FosB2 arba FosB [short form]) yra svarbus ilgalaikio plastiškumo, kurį sukelia smegenys, lėtai veikiant keliems psichoaktyviems stimulams, įskaitant piktnaudžiavimo, streso ir elektrokonvulsinių traukulių, tarpininkas. . Skirtingas „DeltaFosB“ bruožas yra tas, kad atsiradus, jis išlieka smegenyse gana ilgą laiką, nesant tolesnės stimuliacijos. Vis dėlto mechanizmai, kuriais grindžiamas šis akivaizdus stabilumas, išliko nežinomi. Čia parodome, kad DeltaFosB yra santykinai stabilus transkripcijos faktorius, kurio pusinės eliminacijos laikas ląstelių kultūroje yra maždaug 10 h. Be to, parodome, kad DeltaFosB yra fosfoproteinas smegenyse ir kad labai konservuotos serino liekanos (Ser27) fosforilinimas DeltaFosB apsaugo jį nuo proteasominio degradacijos. Pateikiame keletą įrodymų, rodančių, kad fosforilinimą tarpininkauja kazeino kinazė 2. Šie faktai yra pirmasis įrodymas, kad „DeltaFosB“ yra fosforilintas ir parodo, kad fosforilinimas prisideda prie jo stabilumo, o tai yra pagrindinė jos gebėjimo tarpininkauti ilgalaikes adaptacijas smegenyse pagrindas.

Įvadas

Transkripcijos faktorius ΔFosB, taip pat žymimas FosB2 arba FosB [trumpąja forma], yra trumpalaikio ankstyvojo geno C galo sutrumpintas jungimo variantas fosb (Dobrazanski ir kt., 1991; Nakabeppu ir Nathans, 1991; Yen ir kt., 1991). Kaip ir pilno ilgio FosB, ΔFosB turi DNR surišantį bazinį domeną ir leucino užtrauktuką, per kurį jis dimerizuojasi su Jun proteinais, kad suformuotų aktyvatoriaus-1 (AP-1) transkripcijos faktoriaus kompleksus, kurie reguliuoja daugelio genų ekspresiją (Morganas ir Curranas, 1995; Rylski ir Kaczmarek, 2004). Nepaisant to, kad FosB C gale nėra transaktyvacijos domeno dalies, ΔFosB veikia kaip stiprus transkripcijos aktyvatorius ir represorius kultivuotose ląstelėse ir smegenyse (Dobrazanski ir kt., 1991; Nakabeppu ir Nathans, 1991; Chen ir kt., 1997; McClung ir Nestler, 2003; Kumar ir kt., 2005).

ΔFosB smegenų sukeltas regionui būdingas aukštas kiekis po lėtinio, bet ne ūminio įvairių psichoaktyvių stimulų poveikio, įskaitant stresą, tam tikrus pažeidimus, antipsichozinius ir antidepresantus, piktnaudžiavimo narkotikus ir natūralius atlygius (Hope ir kt., 1994b; Hiroi ir Graybiel, 1996; Moratalla ir kt., 1996; Bing ir kt., 1997; Mandelzys ir kt., 1997; Kelz ir kt., 1999; Werme ir kt., 2002; Andersson ir kt., 2003; Colby ir kt., 2003; Peakman ir kt., 2003; Perrotti ir kt., 2004; Zachariou ir kt., 2006). ΔFosB indukcija yra tiesiogiai susijusi su kelių šių stimulų funkciniais poveikiais smegenyse. ΔFosB išlikimas net ir tuo atveju, jei nėra papildomos stimuliacijos, jį skiria nuo visų kitų Fos šeimos transkripcijos faktorių, kurie greitai reaguoja į ūminius stimulus, per kelias valandas pamažu grįžta į bazinį lygį ir paprastai po desinansinės stimuliacijos rodo desensibilizaciją (Hope ir kt., 1992; Daunais ir kt., 1993; Persico ir kt., 1993; Hiroi ir Graybiel, 1996; Perrotti ir kt., 2004). Dėl to ΔFosB yra patrauklus kandidatas tarpininkauti kai kuriems ilgalaikiams pokyčiams genų ekspresijoje, kurie yra stabilių neuronų adaptacijų, atsirandančių dėl tam tikrų lėtinių stimulų, pagrindas.

Kadangi ilgesnis ΔFosB buvimas atsiranda nesant tolesnio jo mRNR indukcijos (Chen ir kt., 1995), mes spėliojame, kad, skirtingai nei viso ilgio FosB ir visi kiti Fos šeimos baltymai, kurie yra iš esmės nestabilūs, ΔFosB gali būti neįprastai stabilus transkripcijos faktorius (Hope ir kt., 1994b; Chen ir kt., 1997; Nestler ir kt., 2001; McClung ir kt., 2004). Be to, ūmaus ir lėtinio stimuliavimo smegenų audinio imunoblotinė analizė leido manyti, kad ΔFosB pokyčiai yra akivaizdūs Mr (molekulinė masė) nuo ∼33 kDa ūminės būklės iki ∼35 – 37 kDa \ tHope ir kt., 1994a; Chen ir kt., 1995). Kadangi nėra jokių įrodymų, kad egzistuotų papildomos mRNR, kurios galėtų koduoti šiems skirtingiems izoformams, toliau spėliojame, kad ΔFosB yra po transliacijos modifikuotas ir galbūt tai prisideda prie jo neįprasto stabilumo. Tačiau iki šiol nebuvo pranešta apie ΔFosB apyvartos ar posttranslacinių modifikacijų biochemines analizes. Šio tyrimo tikslas buvo nustatyti, ar ΔFosB yra fosfoproteinas ir ar fosforilinimas vaidina jo stabilumą.

Ankstesnis skyriusKitas skyrius

Medžiagos ir metodai

Žinduolių ląstelių linijos ir DNR konstrukcijos.

PC12 ląstelės (Clontech, Mountainview, CA) buvo auginamos didelio gliukozės DMEM, turinčio l-glutamino (L-Gln), ir papildytos 5% vaisiaus galvijų serumu (FBS), 10% arklių serumu (abu iš Invitrogen, Carlsbad, CA) 100 U / ml penicilino ir 100 μg / ml streptomicino (abu iš Sigma-Aldrich, St. Louis, MO). HeLa ląstelės (Amerikos tipo kultūros kolekcija, Manassas, VA) buvo kultivuojamos didelio gliukozės DMEM, turinčio L-Gln, ir papildytos 10% FBS, penicilinu ir streptomicinu. Abi ląstelių linijos buvo palaikomos 37 ° C drėgnoje 5% CO2 atmosfera.

Pereinamosioms transfekcijoms su DNR, PC12 arba HeLa ląstelės buvo sėjamos į šešių šulinių plokšteles (padengtos kolagenu I PC12 ląstelėms), kad kitą dieną pasiektų 90 – 100% susiliejimą, o po to buvo transfekuotos naudojant Lipofectamine 2000 (Invitrogen). Kai kuriuose eksperimentuose (žr Fig. 1-7), ΔFosB buvo trumpam išreikštas PC12 ląstelėse, infekcija rekombinantiniu herpes simplex virusu (HSV).

ΔFosB ir FosB cDNA buvo gautos iš mūsų pačių pTetop konstrukcijų (Chen ir kt., 1997) ir subklonavo į pcDNA3.1 vektorių (Invitrogen). Šie pcDNA3.1-AFosB / FosB konstruktai buvo naudojami ekspresijai žinduolių ląstelėse ir kaip šablonas, nukreiptas į nukreiptą mutagenezę. Rekombinantinis HSV-ΔFosB buvo paruoštas, kaip aprašyta anksčiau (Neve et al., 1997), ir preparato titras buvo ∼1 × 108 pfu / ml.

Eksperimentai su impulso persekiojimu.

Maždaug po 24 h po infekcijos / transfekcijos ląstelės (PC12 arba HeLa) šešių šulinėlių lėkštelėse buvo plaunamos du kartus tris kartus 2 ml PBS ir inkubuojamos 37 ° C temperatūroje ∼1 h 2 ml Cys / Met-free DMEM (Invitrogen), papildytas 5% dializuotu FBS (Hyclone, Logan, UT), kad išeikvotų Met ir Cys ląstelių ląstelės. Šio „bado“ laikotarpio pabaigoje buvo pridėta vaistų (jei ląstelės buvo gydomos) ir ląstelės buvo pažymėtos (impulsu) su 12 – 25 μCi iš 35S baltymų ženklinimo mišinys (PerkinElmer, Wellesley, MA) už for1 h 37 ° C, kad būtų galima pažymėti visus naujai sintezuotus baltymus. Po to radioaktyvusis ženklas buvo pašalintas plaunant ląsteles nuo dviejų iki trijų kartų su 2 ml PBS ir 35Buvo laikomasi S-žymėtų baltymų (chase), pakeičiant terpę „šaltą“ (neradioaktyvią) terpę, papildytą 5% FBS, ir surenkant ląsteles įvairiais laiko taškais. Ląstelių apdorojimas buvo palaikomas visoje važiavimo metu. Visi šių eksperimentų skaičiai rodo panašius pradinių įvairių baltymų kiekius, siekiant optimizuoti jų apyvartos rodiklių palyginimą.

Gyvūnai ir lėtinis elektrokonvulsinis priepuolių gydymas.

Suaugusiems Sprague Dawley patinams (200 – 300 g; Charles River Laboratories, Kingston, RI) 7 – 9 d buvo gydomi vieną kartą per parą su elektrokonvulsiniais priepuoliais (ECS). ECS buvo atlikta kaip aprašyta anksčiau (Hope ir kt., 1994a) naudojant Ugo Basile (Comerio VA, Italija) ECS įrenginys su šiais nustatymais: dažnis, 100 impulsai / s; impulsas su, 0.5 ms; smūgio trukmė, 1.0 s; ir srovė, 75 mA. Šlamšto kontroliniai gyvūnai buvo gydomi lygiagrečiai, naudojant ausų gnybtų elektrodus be jokios elektros srovės.

32 P metabolinis ženklinimas.

Smegenų griežinėliams žymėti žiurkės buvo dekapituotos, smegenys greitai išpjaustytos, o 300 μm priekinės žievės griežinėliai buvo paruošti su DSK mikrosliceriu (Ted Pella, Redding, CA). Skiltelės buvo inkubuojamos plastikiniuose mėgintuvėliuose 2 ml fosfato trūkumo dirbtinio CSF ​​(ACSF) ir palaikomos 30 ° C temperatūroje pastoviai švelniai burbant su O2/ CO2 mišinys (Hemmings ir kt., 1989). Skiltelės (dvi griežinėliai per mėgintuvėlį) buvo pažymėtos 1.3 mCi 8 – 10 h, jei yra okadainės rūgšties (100 ng / ml) arba jo nėra. Šio inkubavimo pabaigoje skiltelės buvo plaunamos mažiausiai tris kartus šaltu ACSF ir tada homogenizuotos ultragarsu naudojant 250 μl šalto radioimunoprecipitacinio tyrimo (RIPA) buferio [PBS, pH 7.4, 150 mm NaCl, 1% (v / v ) Igepal, 0.5% (m / V) natrio dezoksicholato, 0.1% (m / V) SDS, 1 mm EDTA], prieš vartojimą vartojant su SDS iki 0.6%, proteazių inhibitoriaus kokteilis žinduolių ląstelėms (naudojamas 5 μl / ml; Sigma-Aldrich), fosfatazės inhibitorių kokteiliai I ir II (naudojami 1: 100; Sigma-Aldrich), 1 mm PMSF ir 2% glicerolis. Tada homogenatai buvo virinami 15 min ir išvalyti centrifuguojant 15,000 × g už 15 min. Gautų supernatantų baltymų koncentracija buvo įvertinta naudojant BCA baltymų tyrimą (Pierce, Holmdel, NJ).

Dėl 32Kultūruotų ląstelių P ženklinimas, ∼24 h po infekcijos / transfekcijos, ląstelės buvo plaunamos nuo dviejų iki trijų kartų fosfatų neturinčia terpe ir inkubuojamos šioje terpėje ∼1 h. Po šio bado laikotarpio 0.2 – 0.3 mCi iš 32PH3PO4 (PerkinElmer) buvo pridėta prie kiekvieno šulinio, o ląstelės buvo pažymėtos 4 – 12 h priklausomai nuo eksperimento rūšies (žr. 1 – 7 pav.). Po to ląstelės tris kartus plaunamos PBS ir lizuojamos ledu 15 min su 50 μl papildyto RIPA buferio. Lizatai buvo surinkti grandiniu ir 10 laikais per 25 gaunamąjį švirkštą pernešami į šlyties DNR, virinami 10 min. Ir 15,000 – 15 min. Išvalyti lizatai (supernatantai) buvo perkelti į naują mėgintuvėlį ir atliktas BCA baltymų tyrimas (Pierce). Visi šių eksperimentų paveikslai rodo panašius viso laukinio tipo (WT) ir S30A ΔFosB baltymų kiekius, siekiant optimizuoti jų santykinį fosforilinimo lygį.

Cheminių medžiagų ir ląstelių kultūros gydymas.

Okadaino rūgštis (OA; Sigma-Aldrich) buvo ištirpinta etanolyje ir naudojama galutinėje 100 ng / ml koncentracijoje. 5,6-dichlor-1-β-d-ribofuranozil-benzimidazolas (DRB; Biomol, Plymouth Meeting, PA) buvo ištirpintas dimetil sulfoksidu (DMSO; Sigma-Aldrich) ir panaudotas ląstelių kultūroje galutinėje 50 μm koncentracijoje. Sperminas (Sigma-Aldrich) buvo ištirpintas vandenyje ir naudojamas galutinėje 200 μm koncentracijoje. Calphostin-C (Biomol) buvo ištirpintas DMSO ir naudojamas 0.2 μm, o forbolas 12-miristatas 13-acetatas (PMA; Promega, Madison, WI) buvo ištirpintas DMSO ir naudojamas 0.1 μm. myristoilintas-autokamido-2 susijęs inhibitorinis peptidas (m-AIP; Biomol) buvo ištirpintas vandenyje ir naudojamas galutinėje 1 ir 10 μm koncentracijoje. Plataus spektro baltymų kinazės inhibitoriai H-7 ir H-8 (Biomol) buvo ištirpinti vandenyje ir naudojami galutinėje 150 ir 200 μm koncentracijoje. MG132 (Calbiochem, San Diego, CA) ir epoksomicinas (Peptides International, Louisville, KY) abu buvo ištirpinti DMSO ir naudojami galutinėje 12.5 ir 7.5 μm koncentracijoje. Visuose eksperimentuose DMSO (nešiklis) buvo pridėtas prie ląstelių, kaip reikia, kad būtų išlaikytas pastovus DMSO kiekis tarp gydymo. Dėl 32P ženklinimo eksperimentai, vaistai buvo pridėti prieš pat etiketę ir laikomi likusį etiketės laikotarpio laikotarpį. Eksperimentams su pulsų sukibimu Cys / Met „bado“ metu buvo pridėti vaistų, kurie buvo laikomi ženklinimo etape, o po to pridedami atgal į chase terpę. Proteasomos inhibitoriai buvo įtraukti į kiekvieną 3 – 4 h visą chase, kad kompensuotų greitą šių peptidų apyvartą.

ΔFosB imunoprecipitacija, imunoblotavimas ir autoradiografija.

Imunoprecipitacijoms lizatai buvo atskiesti 1: 5 su paprastu RIPA, kad SDS koncentracija būtų sumažinta iki 0.1%, prieš pradedant imunoprecipitaciją (IP). Siekiant apriboti nespecifinį surišimą, lizatai pirmą kartą buvo išvalyti imunoprecipituojant su neimuniniu IgG ir baltymu G-Sepharose (Sigma-Aldrich) mažiausiai 4 h. Po to FosB buvo imunizuotas iš išvalytų lizatų, naudojant ožkų polikloninį antikūną, kuris atpažįsta vidinį epitopą, esantį tiek FosB, tiek ΔFosB (SC-48G; Santa Cruz biotechnologija, Santa Cruz, CA), esant 0.5-1 μg IgG per 10 μg lizato baltymo (50 – 300 μg viso baltymo) bendro 0.5 ml tūrio. IP buvo švelniai sumaišyti 4 ° C temperatūroje ant rotoriaus mažiausiai 8 h ir tada pridėta 15 μl baltymo G-Sepharose ir IP buvo sumaišyti mažiausiai kitą 4 h. IP buvo išpjauti verpiant 3000 × g 3 – 5 min. esant 4 ° C, tris kartus plaunama 0.5 ml šalto paprasto RIPA ir du kartus šaltu PBS, turinčiu 0.1% Tween 20. Tada IP buvo resuspenduojami 0.5 ml šalto PBS, perkelti, granuliuoti naujajame mėgintuvėlyje, o imunoprecipituoti baltymai buvo eluuojami pridedant 15-25 μl 2 × redukuojančio Laemmli baltymo mėginio buferio. Šis IP protokolas lėmė specifinį ir veiksmingą beveik visos AFosB nusodinimą lizate. Imunopretipituoti baltymai buvo paveikti SDS-PAGE, pakraunant visą IP į 12.5% Tris-HCl Criterion gelį (Bio-Rad, Hercules, CA), po to perkeliant į PVDF arba nitroceliuliozę. Po perkėlimo membrana džiovinta oru ir 32P- ir 35S-radioaktyviai pažymėtos baltymų juostos buvo stebimos autoradiografija, naudojant Kodak (Rochester, NY) autoradiografinę plėvelę, taip pat fosforizuojant Storm (Amersham Biosciences, Piscataway, NJ) PhosphorImager. Bendras (nes fosforilintas ir fosforilintas) ΔFosB ląstelių lizatuose arba smegenų homogenatuose buvo aptiktas imunoblotuojant baltymą, naudojant tą pačią membraną (naudojant tą pačią membraną, naudojamą aptikimui). 32P-žymėtas baltymas) arba vienodo kiekio lizato / homogenato baltymas, paveiktas SDS-PAGE, ir perkeltas į PVDF arba nitroceliuliozę. Pirmiausia membrana buvo blokuojama inkubuojant ją 1% (m / V) riebalų neturinčiu sausu pienu (Bio-Rad) PBS, papildytame 0.1% (v / v) Tween 20 (Sigma) 1 h, esant 25 ° C. Tada membrana per naktį imunoblotuota 4 ° C temperatūroje su savo paukščių anti-FosB polikloniniu antikūnu, susidariusiu prieš FosB / ΔFosB aminorūgštis 1 – 16 (naudojama 1: 10,000). Po pirminio inkubavimo membranos buvo nuplaunamos keturis kartus 5 min blokavimo buferiu, o po to inkubuojamos 25 ° C temperatūroje N1 h, o ožkų anti-triušio IgG, konjuguoto prie krienų peroksidazės (naudojama 1: 5000 blokuojančiame buferyje, nuo Vektoriaus Laboratories, Burlingame, CA). Tada membranos tris kartus plaunamos 10 min blokavimo buferiu ir vieną kartą 5 min PBS. Bendrosios AFosB baltymų juostos buvo vizualizuotos „Kodak MR“ plėvelėje, naudojant sustiprintą chemiliuminescenciją (Pierce) ir (arba) nustatant fluorescenciją naudojant ECL-Plus reagentus (Amersham Biosciences) ir „Storm PhosphorImager“.

Rekombinantinio ΔFosB perteklius ir gryninimas iš vabzdžių ląstelių.

FosB buvo pernelyg išreikštas Sf9 vabzdžių ląstelėse kaip N-galo heksa-His-žymėtas baltymas (N-His (6) ΔFosB), naudojant Bac-to-Bac baculovirus ekspresijos sistemą (Invitrogen) ir vadovaudamasis gamintojo nurodymais. Trumpai tariant, ΔFosB cDNA (likučiai 2 – 237), prieš kurią yra afiniteto N-galinė žyma MGHHHHHHAG, buvo subklonuota pFASTBacTM1 vektoriuje, kuris buvo naudojamas rekombinantiniam bakulovirui generuoti. Sf9 ląstelės buvo užkrėstos rekombinantiniu virusu, o N-His (6) AFosB buvo išgrynintas iš ląstelių lizatų keliais chromatografiniais etapais, įskaitant afininę chromatografiją, naudojant nikelio kolonėlę (Qiagen, Valencia, CA), anijonų mainus naudojant mono-Q kolonėlę (Amersham Biosciences) ir dydžio išskyrimą naudojant gelio filtravimo kolonėlę (Amersham Biosciences).

In vitro fosforilinimo tyrimai.

In vitro fosforilinimo reakcijos laiko ir stechiometrijos analizei atlikti 30 μl, turinčio 10 μm substratą (N-His (6) ΔFosB arba teigiamą kontrolinį substratą), 250 μm ATP ir 1 μCi / μl [γ-32P] ATP, kinazės gamintojo tiekiamas buferis, ir viena iš šių kinazių: CK2 (20 ng / μl; Upstate, Charlottesville, VA), CaMKII (10 ng / μl; Upstate), PKC (1.6 ng / μl; Calbiochem) arba p70S6K (2.5 mU / μl; Upstate). Laiko eigos reakcijos buvo atliktos pašalinant 5 μl alikvotines dalis iš reakcijos tirpalo nurodytu laiku ir pridedant vienodą tūrį 4 × mažinantį Laemmli baltymų mėginio buferį. Michaelis-Menten kinetiniai CK2 reakcijos parametrai buvo nustatyti empiriškai apibrėžtomis linijinėmis pusiausvyros sąlygomis. Šios reakcijos buvo atliktos 15 min 10 μl tūrio, kuriame yra 2 ng / μl fermento, 250 μm ATP, 1 μCi / μl [γ-32P] ATP ir N-His (6) ΔFosB koncentracijos nuo 2.5 – 30 μm. Visos reakcijos buvo atliekamos 30 ° C temperatūroje vandens vonioje. Po SDS-PAGE ir gelio dažymo Bio-Safe Coomassie (Bio-Rad), gelis buvo išdžiovintas, ir 32P-fosfato įsisavinimas buvo įvertintas fosforizavimo analize (žr. Toliau, Duomenų kiekybinis įvertinimas, skaičiavimai ir statistika).

Dvimatis fosfopeptidų žemėlapis ir fosfoamino rūgščių analizė.

Abi šios analizės buvo atliktos taip, kaip aprašyta Ploegh ir Dunn (2000). Trumpai tariant, sausos gelio fragmentai, kuriuose yra 32P žymėtas ΔFosB (arba iš in vitro ląstelių imunoprecipitatai), buvo išskirti, rehidratuoti, nuplauti ir tirti trypti. Supernatantas, kuriame yra trypto virškinimo produktų, buvo liofilizuotas ir liofilizatas keletą kartų plaunamas ir resuspenduojamas 10 μl elektroforezės buferio, pH 1.9. Mėginys (3 μl) buvo pastebėtas ant celiuliozės plonasluoksnės chromatografijos (TLC) plokštelės (Analtech, Newark, DE) ir vienas matmuo atskirtas elektroforezės būdu ir kitas matmuo didėjančiu TLC. Gauti fosfopeptidiniai žemėlapiai buvo vizualizuoti autoradiografijos ir fosforizavimo būdu. Fosfoamino rūgšties analizei 2 μl tirpalo, kuris buvo resuspenduotas elektroforezės buferyje, toliau buvo išskaldytas HCl hidrolizės metu 105 ° C temperatūroje 25 min.2 atmosfera. Reakcija buvo sustabdyta šešis kartus praskiedus vandenyje ir mišinys liofilizuotas. Liofilizatas resuspenduojamas 5 μl elektroforezės buferio, pH 1.9, ir pastatytas ant celiuliozės TLC plokštės kartu su fosfo- Ser, -Thr ir -Tyr standartais. Elektroforezė buvo atlikta per pusę TLC plokštės ilgio, naudojant elektroforezės buferį, pH 1.9, ir tada plokštelė buvo perkelta į pH 3.5 buferį, o elektroforezė buvo baigta. Fosfoamino rūgšties standartai buvo vizualizuoti purškiant TLC plokštę 1% (v / v) ninhidrino tirpalu acetone ir 32P-žymėti aminorūgščių mėginiai buvo vizualizuoti autoradiografijos ir fosforizavimo būdu.

siRNR sukeltas CK2α nusileidimas.

Mes pasirinkome RNR interferencinį metodą, kad pasirinktinai nustumtume CK2 lygius (Di Maira ir kt., 2005). PC12 ląstelės buvo sėjamos į kolageno I dengtas šešių šulinėlių plokšteles, kad kitą dieną pasiektų ∼70 – 80% konfluentą, kai jos buvo laikinai transfekuotos 20 nm (galutinė koncentracija) arba nukreipiančio siRNR, arba siRNR, nukreiptos į katalizinio mRNR. α žiurkės CK2 subvienetas, naudojant 5 μl transfekcijos agento SilentFectin (Bio-Rad) ir laikantis gamintojo nurodymų. Maždaug 24 h vėliau ląstelės buvo laikinai transfekuotos ΔFosB plazmidėmis, kaip nurodyta aukščiau. Maždaug 24 h vėliau (∼48 h po siRNA transfekcijos), ląstelės buvo veikiamos arba 32P medžiagų apykaitos ženklinimas arba pulsinės sekos analizė, kaip aprašyta aukščiau. Šie keturi CK2α siRNAs buvo naudojamas su panašių rezultatų: 5'P-CAAACUAUAAUCGUACAUCUU3 ", 5'P-UCAAUCAU-GACAUUAUGCGUU3", 5'P-UAGUCAUAUAAAUCUUCCGUU3 ", 5'P-AAAUCCCUG ACAUCAUAUUUU3 '(Dharmacon, Lafayette, CO). Kaip neigiama kontrolė, mes naudojome Duslintuvas neigiama kontrolė #3 siRNA iš Ambion (Austin, TX). CK2 nuleidimo apimtis buvo stebima imunoblotuojant, naudojant anti-CK2 polikloninį antikūną (katalogas # 06-873 iš Upstate) per naktį 1: 1000 praskiedimu. β-Tubulinas buvo naudojamas kaip pakrovimo kontrolė ir buvo aptiktas su monokloniniu antikūnu (katalogas # 05-661 iš Upstate) per naktį 1: 20,000 praskiedimu.

Vietovės nukreipta mutagenezė.

Ser27 mutacija į Ala arba Asp buvo atlikta naudojant Quick Change Site-Directed Mutagenesis rinkinį (Stratagene, La Jolla, CA) ir laikantis gamintojo nurodymų. Norint įvesti Ser27 mutacijas pelės AFosB proteinu, buvo naudojami šie mutagenezės pradmenys. Ser27 į Ala: (atvirkštinis gruntas) 5′GCCGAAGGAGTCCACCGAAGCCAGGTACTGAGACTCGGCGGAGGG3 ′. Ser27 į Asp (priekinis gruntas) 5′CCCTCCGCCGAGTCTCAGTACCTGGATTCGGTGGACTCCTTCGGC3 ′. Mutuotos bazės yra paryškintos, o Ser27 kodonas yra kursyvu.

Bioinformatika.

Buvo ieškoma potencialių ΔFosB fosforilinimo vietų ir kinazių, pateikiant pelių baltymų seką specializuotoms duomenų bazėms, įskaitant „ProSite“ (http://www.expasy.org/prosite/), PredictProtein (Rost ir kt., 2004) ir „NetPhosK“ (Blom ir kt., 2004).

Duomenų kiekybinis įvertinimas, skaičiavimai ir statistika.

PVDF arba nitroceliuliozės membranoje esantis baltymų kiekis buvo kiekybiškai įvertintas naudojant Storm PhosphorImager ir pridedamą „ImageQuant“ programinę įrangą (Amersham Biosciences / Molecular Dynamics). Ląstelių kultūros ir smegenų pjūvio fosforilinimo tyrimuose buvo gautos vertės 32P-žymėtas baltymas tada buvo padalytas iš gautų verčių visam ΔFosB ir išreiškiamas santykiu. Viduje konors in vitro fosforilinimo tyrimai 32P-žymėtas ΔFosB vienam FosB moliui (stechiometrija) buvo apskaičiuotas taip, kaip aprašyta anksčiau (Sahin ir kt., 2004). Visi matavimai buvo atlikti pagal naudojamo prietaiso tiesiškumo intervalą. Kinetiniai parametrai buvo apskaičiuoti naudojant Michaelis-Menten modelį V = Vdaugiausia[S] / ([S]+KM) ir Vdaugiausia = k2[EVISO]. Pusinės eliminacijos laikas (t1 / 2ΔFosB ir FosB buvo apskaičiuoti iš pulso-chase sklypų (naudojant netiesinę regresiją, geriausiai atitinkančią duomenų taškus) ir atitinka laiką, per kurį likusio baltymo kiekis yra 50% originalo. Visuose paveiksluose pateikti rezultatai reprezentuoja mažiausiai du ar tris nepriklausomus eksperimentus. Visuose grafikuose pateikti duomenys yra vidurkiai ± SEM (3 ≤ n ≤16). Statistinis skirtumų reikšmingumas buvo įvertintas naudojant nesusietą t bandymas, pataisytas dėl daugelio palyginimų, ir žvaigždutėmis p ≤ 0.05.

Ankstesnis skyriusKitas skyrius

rezultatai

ΔFosB yra neįprastai stabilus transkripcijos faktorius

Nors anksčiau spėliojame, kad ΔFosB yra santykinai stabilus transkripcijos faktorius (Nestler ir kt., 2001), iki šiol nebuvo atlikta tiesioginė baltymų apyvartos profilio analizė. Kad išspręstume šį klausimą, mes atlikome pulso-chase eksperimentus, naudojant PC12 ląsteles, kurios buvo plačiai naudojamos kaip neuronų tipo ląstelių linija, kurioje ΔFosB buvo trumpalaikis ekspresavimas per infekciją rekombinantiniu herpes simplex virusu (HSV-ΔFosB). Naujai sintetinti baltymai buvo metabolizuojami metaboliniu būdu 35S-Met / Cys ir degradacijos modelis 35S žymėtas ΔFosB (35S-ΔFosB) buvo stebimas imunoprecipitiuojant jį iš ląstelių lizatų, gautų įvairiais laiko momentais po radioaktyviai žymėtų aminorūgščių pašalinimo. Imunoprecipitatų analizė SDS-PAGE ir autoradiografija parodė, kad ΔFosB pusinės eliminacijos laikas PC12 ląstelėse yra ∼10 h (Pav 1). Šie rezultatai rodo, kad ΔFosB pusinės eliminacijos laikas yra didesnis nei daugelio indukuojamų transkripcijos faktorių (žr. „Diskusija“), įskaitant visą ilgį FosB, kurio pusinės eliminacijos laikas ląstelių kultūroje yra ∼90 min.Dobrazanski ir kt., 1991; Carle et al. 2004). Be to, verta pažymėti, kad ΔFosB degradacija neatitinka pirmojo laipsnio eksponentinės skilimo kreivės, bet yra dvifazė, pradedant nuo lėtesnio skilimo greičio. Tai rodo, kad yra daugiau nei viena ΔFosB rūšis ir (arba) daugiau nei vienas skaidymo būdas.

1 pav.

Peržiūrėti didesnę versiją:

1 pav.

ΔFosB yra neįprastai stabilus transkripcijos faktorius. ΔFosB pusinės eliminacijos laikas ląstelių kultūroje yra ∼10 h. ΔFosB buvo išreikštas PC12 ląstelėse arba infekcija HSV-AFosB, arba trumpalaikis transfekcija su FosB turinčiu plazmidu, ir ląstelės buvo tiriamos kaip pulso-chase eksperimentai, kaip aprašyta Medžiagos ir metodai. Lygiaverčiai rezultatai buvo gauti neatsižvelgiant į metodą, naudojamą ΔFosB viršijimui. Paveiksle parodyta ΔFosB degradacijos laiko eiga (ir reprezentatyvi autoradiograma). Apskaičiuoti duomenys yra mažiausiai 15 atskirų duomenų taškų, gautų iš bent penkių nepriklausomų eksperimentų, vidurkis ± SEM. Palyginimui, nurodomas pilno ilgio FosB pusinės eliminacijos laikas.

ΔFosB yra fosfoproteinas smegenyse

Mes hipotezėme, kad po translacionalinio ΔFosB modifikavimo gali padidėti jo matomas stabilumas. Kadangi įrodyta, kad fosforilinimas įvairiais būdais moduliuoja transkripcijos faktorių aktyvumą, įskaitant jų stabilumą (žr. Žr. \ T Desterro ir kt., 2000; Whitmarsh ir Davis, 2000), ištyrėme, ar ΔFosB yra fosfoproteinas. Šiuo tikslu αFosB ekspresija buvo paskatinta žiurkių smegenyse, naudojant lėtinį ECS - gydymą, kuris, kaip žinoma, sukelia aukštus ΔFosB kiekius, ypač priekinėje žievėje (Hope ir kt., 1994a). Vieną dieną po paskutinio ECS gydymo, kai ΔFosB koncentracija išlieka didelė, plonos priekinės žievės griežinėliai buvo paruošti ir metabolizuojami metaboliniu būdu 32P-ortofosfatas. Paralelinis griežinėlių rinkinys nebuvo paženklintas radioaktyviuoju būdu, ir jie buvo panaudoti bendriems AFosB lygiams aptikti. Po imunoprecipitacijos specifiniu anti-FosB / ΔFosB antikūnu ir imunopretipituotų baltymų atskyrimu SDS-PAGE, fosforilinto 32P-žymėtas AFosB buvo aptiktas autoradiografija, o bendras ΔFosB buvo nustatytas imunoblotuojant. Ši analizė parodė, kad ΔFosB yra fosforilintas smegenyse, kaip rodo specifinis 32P-žymėta X35 kDa juosta, esanti chroniškai apdorotuose smegenų mėginiuose, tačiau faktiškai neaptinkama kontroliuojamose kontrolinėse grupėse (Pav 2A). Tai atitinka faktą, kad nesant lėtinės stimuliacijos ΔFosB baziniai lygiai yra labai maži. Imunoprecipitacijos reakcijos specifiškumą iliustruoja signalo trūkumas neimuninėje IgG nuosėdose.

2 pav.

Peržiūrėti didesnę versiją:

2 pav.

ΔFosB yra fosfoproteinas smegenyse. A, AFosB yra fosforilintas smegenyse. Endogeninis ΔFosB buvo indukuotas žiurkių smegenyse lėtiniu ECS gydymu, kaip aprašyta Medžiagos ir metodai. Frontalinės žievės griežinėliai buvo metabolizuojami metaboliniu būdu 32PH3PO4 kelias valandas. Po skiltelių homogenizavimo ΔFosB buvo imunizuotas ir fosforilintas ΔFosB (32P-ΔFosB) buvo aptiktas autoradiografija (viršutinė plokštė). Bendras ΔFosB ne-radioaktyviuose imunoprecipitatuose buvo aptiktas imunoblotuojant (apačioje). Kaip neigiami kontroliniai preparatai yra parodyta, kaip imunizuota imunizuota gyvūnų ir neimuninė IgG. B, Bioinformatinės analizės būdu buvo gautos kandidatų fosforilinimo vietos ir kinazės su atitinkamais pelės ΔFosB baltymų sekos prognozavimo rezultatais. Kandidatų svetainės su aukštesniais prognozavimo balais yra paryškintos baltymų sekoje ir išvardytos lentelėje. DNR surišantis (bazinis) domenas ir leucino užtrauktukas baltymų sekoje yra paryškinti. C, DΔFosB fosforilinimas padidėja Ser / Thr fosfatazės inhibitoriumi OA. C, 32P-ΔFosB lygiai imunopretipitatuose iš frontalinių žievės pjūvių, pažymėtų be 100 ng / ml OA (grafikas ir viršutinė plokštė), nebuvo pažymėti autoradiografija. Apatinėje plokštėje rodomas bendras ΔFosB, aptiktas imunopretipitatuose iš nepažymėtų skiltelių imunoblotavimo būdu. D, PC12 ląstelės buvo užsikrėtusios HSV-ΔFosB arba HSV-LacZ (vektoriniu) ir metaboliškai paženklintos 32PH3PO4 100 ng / ml OA nėra (Ctr) arba yra. 32P-ΔFosB lygiai imunoprocipituose buvo nustatyti autoradiografija (grafikas, viršutinis skydelis). Apatinėje plokštėje rodomas bendras ląstelių lizatuose aptiktas ΔFosB imunoblotais.

Kaip pirmas žingsnis siekiant išsiaiškinti, kuri kinazė (-ės) ir vieta (-os) dalyvauja FosB fosforilinimo procese, jo aminorūgščių seka buvo atlikta keliais bioinformatiniais tyrimais. Tai parodė, kad nors ΔFosB sudėtyje nėra Tyr fosforilinimo kandidatų vietų, ji apima kelias Ser / Thr kinazės konsensuso vietas, įskaitant tris CaMKII vietas, tris CK2 vietas ir dvi PKC vietas su labai aukštais fosforilinimo prognozavimo rezultatais (Pav 2B). Jei, kaip prognozuojama per bioinformatiką, ΔFosB fosforilinamas tik Ser arba Thr likučiuose, tuomet jo fosforilinimas turėtų būti reikšmingai moduluojamas Ser / Thr fosfatazių aktyvumu. Norėdami išbandyti šią hipotezę, mes su priekiniais žievės griežinėliais pažymėjome 32P-ortofosfatas, esant OA, Ser / Thr baltymų fosfatazės inhibitoriui arba jo nėra. Kaip parodyta 2 pavCOA sukėlė didelį (N2.5 kartų) padidėjimą 32P-ΔFosB. Tai taip pat sukėlė nedidelį bendrą ΔFosB lygį, kuris atitinka ankstesnes ataskaitas, susiejančias OA kancerogeninį poveikį jo gebėjimui sukelti keletą tiesioginių ankstyvųjų genų, įskaitant Fos baltymus (Miller ir kt., 1998; Choe ir kt., 2004). Grynasis rezultatas yra reikšmingas bendras padidėjimas (N60%) fosforilintuose ΔFosB lygiuose.

Tada mes ištyrėme, ar PC12 ląstelėse, kurios yra labiau tinkamos eksperimentiniam manipuliavimui, ΔFosB parodė, kad fosforilinimo modelis yra panašus į smegenų. PCFNUMX ląstelėse mes ekspresavome ΔFosB per HSV-ΔFosB infekciją ir metaboliškai žymėjome ląsteles su 32P-ortofosfatas, esant OA arba jo nėra. Sėkminga baltymo ekspresija ir imunoprecipitacija iš HSV-ΔFosB infekuotų ląstelių yra įrodyta tiek imunoblotoje (Pav 2Dbottom35 kDa juostos apatinė plokštė) ir autoradiografas (viršutinė plokštė), nėra vektoriuje užkrėstose ląstelėse. Kaip pastebėta smegenyse, OA sukėlė nedidelį bendrą ΔFosB koncentracijos padidėjimą, tačiau daug didesnis (maždaug dvigubas) padidėjimas 32P-ΔFosB, todėl reikšmingas (N50%) grynas AFosB fosforilinimo padidėjimas. Be to, atsižvelgiant į bioinformatikos prognozes, PC12 ląstelių gydymas Tyr fosfatazės inhibitoriumi nesukėlė reikšmingų pokyčių. 32P-ΔFosB lygiai (duomenys nerodomi). Kartu šie rezultatai atskleidė, kad ΔFosB fosforilinamas ant Ser ir / arba Thr likučių smegenyse ir PC12 ląstelėse, ir patvirtino, kad ji yra gera ląstelių kultūros sistema, kurioje toliau tiriami ΔFosB fosforilinimo ir skaidymo profiliai.

CK2, bet ne PKC arba CaMKII fosforilina ΔFosB in vitro

Kaip aprašyta aukščiau, FosB aminorūgščių sekos analizė atskleidė aukštus CK2, PKC ir CaMKII fosforilinimo vietų prognozavimo balus. Norėdami nustatyti, kuri iš šių kinazių gali fosforilinti ΔFosB, atlikome eilę in vitro fosforilinimo reakcijos naudojant išgrynintas kinainas ir išgrynintą rekombinantinį ΔFosB. Kaip parodyta 3 pavA, iš trijų kandidatų kinazių tik CK2 fosforilavo ΔFosB reikšmingai. Be to, buvo išbandytos kelios kitos kinazės (pvz., GSK3 ir p70S6K), tačiau nepavyko reikšmingai fosforiluoti ΔFosB (duomenys nerodomi). Papildomas CK2 reakcijos apibūdinimas pagal laiko analizę parodė, kad ši kinazė gali katalizuoti ∼0.5 molio fosfato koncentraciją viename molyje ΔFosB (Pav 3B). Tai, kad CK2 gali fosforilinti ΔFosB in vitro iki didelės stechiometrijos (∼50%) rodo fiziologiškai svarbią reakciją. Tada ištyrėme šios reakcijos kinetiką, inkubuojant CK2, esant didesniam kiekiui išgryninto ΔFosB, ir nustatėme, kad CK2 fosforilina ΔFosB su Vdaugiausia iš 5.8 pmol · min-1 · Μg-1 fermento, a KM 18.4 μm, ir a kkaip 0.2 / s (Pav 3C). Šių kinetinių parametrų vertės toliau patvirtina šios reakcijos fiziologinę reikšmę. Pavyzdžiui, KM CK2 DARPP32, vienas iš geriausiai žinomų substratų, yra 3.4 μm, o kkaip yra ∼0.3 / s (Girault ir kt., 1989); KM ATP svyruoja nuo ∼10 – 40 μm (Cochet ir kt., 1983; Silva-Neto ir kt., 2002) ir kazeino svyruoja nuo ∼10 – 50 μm (Meggio ir kt., 1977; Pyerin ir kt., 1987). Kartu šie duomenys rodo, kad ΔFosB yra bona fide substratas CK2 in vitro.

3 pav.

Peržiūrėti didesnę versiją:

3 pav.

CK2, bet ne PKC arba CaMKII fosforilina ΔFosB in vitro. Autoradiografas (viršutinė plokštė) rodo fosforilintą produktą, o Coomassie dažomas gelis (apatinis skydas) rodo bendrą reakcijoje esantį ΔFosB. AIšvalytas rekombinantinis ΔFosB in vitro fosforilinimas įvairiomis kandidatų kinazėmis (iš kurių trys rodomos). B, Laiko ir stechiometrinės analizės rodo, kad CK2 gali fosforilinti ΔFosB in vitro su o50% stechiometrija. CKinetinė CK2 reakcijos analizė parodė, kad ΔFosB yra bona fide in vitro substratas. Reakcijos linearizavimas parodytas dvigubo reciprokinio sklypo (apačios), tačiau kinetiniai parametrai buvo gauti iš Michaelis-Menten kreivės (viršuje).

CK2 moduliuoja FosB fosforilinimą ir stabilumą nepažeistose ląstelėse

Norint įvertinti FFBB fosforilinimo CK2 sukeltą fiziologinę reikšmę, mes atlikome lyginamąjį fosfopeptidų kartografavimą naudojant in vitro fosforilintas ir PC12-ląstelių fosforilintas ΔFosB. Po SDS-PAGE ir gelio eliuavimo 32P-ΔFosB (iš in vitro reakcijų arba iš imunopecipitato 32P-žymėtos ląstelės), baltymas buvo suskaidytas trippsinu, ir gauti fosfopeptidai buvo dvimatis atskyrimas. Ši analizė atskleidė, kad pagrindinis fosfopeptidas iš CK2 reakcijos sugrįžo su vienu iš dviejų pagrindinių fosfeptidų iš FosB, fosforilintoje PC12 ląstelėse (Pav 4A), o fosfeptidai, atsirandantys iš PKC arba CaMKII (duomenų neparodyta) reakcijos nebuvo. Iš PC12 ląstelių žemėlapyje buvo antrasis FosB fosfopeptidas, bet dėl ​​to, kad nė viena iš kinazių nesugebėjo išbandyti panašaus fosfopeptido. in vitrošiuo metu mes nežinome, ar šis antrasis fosfopeptidas turi kitokią fosforilinimo vietą nei kitas fosfopeptidas arba ar jis yra atskiro triptinio peptido, kuriame yra ta pati fosforilinimo vieta.

4 pav.

Peržiūrėti didesnę versiją:

4 pav.

CK2 moduliuoja FosB fosforilinimą ir stabilumą nepažeistose ląstelėse. A, CK2, bet ne PKC, atrodo, fosforilina ΔFosB ląstelėse. CK2 arba PKC fosforilinto ΔFosB dviejų dimensijų fosfeptidų žemėlapiai in vitro arba nepažeistos PC12 ląstelės. Rodyklės rodo CK2 fosforilinto peptido, bet ne PKC-fosforilinto, sujungimą su vienu iš FFBB fosfeptidų, gautų iš PC12 ląstelių. BΔFosB fosforilinimas PC12 ląstelėse padidėja gydant ląsteles su stipriais CK2 aktyvatoriaus sperminu (SP) ir sumažėja gydant CK2 inhibitoriumi DRB. Priešingai, AFosB fosforilinimas PC12 ląstelėse neturėjo įtakos gydymui PKC aktyvatoriumi (PMA) arba PKC specifiniu inhibitoriumi calphostin-C (Calph). Rodoma reprezentatyvi autoradiograma (viršutinė plokštė) ir imunoblotas (apačioje). C – F, CK2 aktyvumo įtaka ΔFosB stabilumui. Brėžiniuose parodyta ΔFosB degradacijos laiko eiga (ir reprezentatyvi autoradiograma). PC12 ląstelės, trumpai ekspresuojančios ΔFosB, buvo tiriamos pulso-persekiojimo eksperimentais, atliktais be CK2 inhibitoriaus DRB (C), CK2 aktyvatoriaus sperminas (D) arba plataus spektro kinazės inhibitorius H-8 (E), kuris buvo naudojamas kontroliuoti nespecifinį DRB poveikį. F, Katalizinio CK2 subvieneto nukritimo įtaka ΔFosB stabilumui. PC12 ląstelės buvo transfekuotos su necenorientuojančiu siRNR (Ctr) arba siRNR, nukreipiančiu žiurkės CK2α ir 24 h, vėliau transfekuotos su FosB plazmide. Viršutinėje plokštėje vaizduojami viso ląstelių lizatų imunoblotai, rodantys CK2 siRNA poveikį CK2 ir ΔFosB baltymų lygiams. Atitinkamas β-tubulino imunoblotas rodomas kaip pakrovimo kontrolė.

Toliau sprendžiant CK2 kaip FosB kinazės fiziologinę svarbą, mes apdorojome AFosB ekspresuojančias PC12 ląsteles dviem vaistais, kurie moduliuoja CK2 aktyvumą. Kaip parodyta 4 pavB, AFosB fosforilinimas buvo sumažintas apdorojant PC12 ląsteles su ląsteliu pernešamu CK2 inhibitoriumi DRB (Meggio ir kt., 1990; Szyszka ir kt., 1995) ir padidėjo gydant poliamino sperminu, kuris, kaip žinoma, yra stiprus CK2 aktyvatorius (Cochet ir Chambaz, 1983; Meggio ir kt., 1983). Priešingai, PC12 ląstelių gydymas PKC inhibitoriumi calphostin-C (Kobayashi ir kt., 1989; Tamaoki ir kt., 1990) arba PKC aktyvatorius PMA (Schmidt ir Hecker, 1975; Beh ir kt., 1989) nesukėlė reikšmingų ΔFosB fosforilinimo pokyčių. PMA atveju nedidelis (ir ne didelis) padidėjimas 32P-ΔFosB gali būti apskaičiuojamas padidinus šio vaisto sukeltą bendrą ΔFosB lygį; iš tiesų buvo pranešta, kad forbolų esteriai sukelia kelių Fos šeimos baltymų, įskaitant FosB, ekspresiją (Yoza ir kt., 1992; Suh ir kt., 2004). Be to, ląstelių gydymas specifiniu ląsteliu pernešamu CaMKII inhibitoriumi m-AIP (Ishida ir Fujisawa, 1995; Stevens ir kt., 1999) taip pat nesukėlė sumažėjusio ΔFosB fosforilinimo (duomenys nerodomi). Kartu šie rezultatai atitinka mūsų in vitro išvados ir rodo, kad nepažeistose ląstelėse ΔFosB gali būti fosforilintas CK2, bet ne PKC ar CaMKII. Tai, kad CK2 slopinimas ne visiškai užkerta kelią FosB fosforilinimui, rodo papildomų fosforilinimo vietų buvimą baltyme.

Toliau ištyrėme, ar CK2 vaidina svarbų vaidmenį ΔFosB apyvartoje ir tuo pačiu stabilumą. Šiuo tikslu mes atlikome pulso-chase eksperimentus, naudojant ΔFosB ekspresuojančias PC12 ląsteles, apdorotas arba CK2 inhibitoriumi, arba CK2 aktyvatoriumi, naudojamu fosforilinimo tyrime. Kaip parodyta 4 pavCląstelių gydymas CK2 inhibitoriumi DRB turėjo reikšmingą poveikį ΔFosB apyvartos greičiui, kurį patvirtina jo degradacijos kreivės formos pasikeitimas nuo bifazės iki kreivės, kuri yra arčiau eksponentinio skilimo kreivės. Atvirkščiai, CK2 aktyvatoriaus spermino buvimas sukėlė reikšmingą ΔFosB degradacijos greičio sumažėjimą, dėl kurio baltymai susikaupė per pirmąsias persileidimo valandas.Pav 4D).

Kaip ir daugelio kinazių aktyvatorių ir inhibitorių atveju, sperminas ir DRB gali turėti metabolinį poveikį ne CK2 aktyvumo moduliavimui. Tiesą sakant, įrodyta, kad DRB slopina transkripcijos faktoriaus IIH (TFIIH) priklausomą kinazę (Yankulov ir kt., 1995), dėl kurios slopinama RNR polimerazės II transliacija. Kadangi šis poveikis gali turėti įtakos ΔFosB stabilumui, mes analizavome plačios spektro kinazės inhibitoriaus H-8 (Hidaka ir Kobayashi, 1992) apie ΔFosB apyvartą, esant koncentracijai (200 μm), kuri, kaip žinoma, slopina su TFIIH susijusią kinazę, bet ne CK2 (Yankulov ir kt., 1995). Kaip parodyta 4 pavEgydymas H-8 neturėjo įtakos ΔFosB apyvartai. Panašūs rezultatai buvo gauti ir su H-7, kitu plačiu spektru veikiančiu kinazės inhibitoriumi, naudojamu koncentracijoje, kuri slopina su TFIIH susijusią kinazę, bet ne CK2 (duomenys nerodomi). Šie duomenys taip pat patvirtina aiškinimą, kad DRB sukeltas ΔFosB stabilumo sumažėjimas greičiausiai priklauso nuo CK2 slopinimo.

Norėdami toliau nustatyti CK2 vaidmenį ΔFosB apyvartoje, ištyrėme CK2 nukritimo pasekmes per siRNA. Šiuos eksperimentus atlikome naudodami PC12 ląsteles, kurios pirmą kartą buvo transfekuotos su kontroline (nontargetuojančia) siRNR arba siRNA, kuri nukreipta į žiurkės CK2 (CK2α) katalizinio subvieneto mRNA ir 24 h, vėliau transfekuotų ΔFosB. Kaip parodyta 4 pavF, transfekcija su CK2α siRNA efektyviai ir specialiai nulaužė CK2α baltymų lygius, nedarant įtakos ΔFosB lygiams (viršuje). Pulso-chase analizė atskleidė, kad CK2 nukritimas lėmė reikšmingą ΔFosB apyvartos greičio padidėjimą, kaip rodo spartesnis baltymo skaidymas. Tai, kad CK2 aktyvumo slopinimas (nesvarbu, ar tai yra DRB apdorojimas, ar siRNR) padidina ΔFosB apyvartą ir lemia lėtos bifazinės kreivės komponento išnykimą, o CK2 aktyvinimas padidina lėtą kreivės fazę, suteikia tvirtą palaikymą idėja, kad CK2 vaidina svarbų vaidmenį reguliuojant ΔFosB stabilumą.

CK2 fosforilina ΔFosB Ser27

Kad pradėtume identifikuoti CK2 fosforilintą AFosB vietą (-as), atlikome rekombinantinio ΔFosB fosforilinto fosforilinto CK2 analizę. in vitro ir AFosB, fosforilintoje PC12 ląstelėse. Šie eksperimentai parodė, kad abiem atvejais vienintelė aptikta fosforo-amino rūgštis buvo fosfo-Ser (Pav 5A). Ši išvada kartu su stechiometrija, gauta CK2 in vitro fosforilinimo reakcija (N50%) (Pav 3B) ir tik viena reikšminga vieta CK2 fosfopeptido žemėlapyje (Pav 4A), rodo, kad ΔFosB fosforilinimas CK2 greičiausiai apsiriboja vienu serino liekana. Ši išvada atitinka fosforilinimo konsensuso vietos analizę (Pav 2B), kuri numatė tik vieną kandidatą seriną, ty Ser27, CK2. Taksonominė analizė parodė, kad „Ser27“ yra labai konservuota per Fos šeimos narių evoliuciją.Pav 5B), rodo, kad ji gali turėti svarbią fiziologinę funkciją.

5 pav.

Peržiūrėti didesnę versiją:

5 pav.

CK2 fosforilatai ΔFosB ant Ser27. AFosfonamino rūgščių analizė, fosforilinta CK2 (in vitro) ir PC12 ląstelių fosforilintas ΔFosB, rodantis, kad abiem atvejais pagrindinė liekana fosforiluota yra serinas. B„FosB / ΔFosB“ aminorūgščių sekos kryžminių rūšių analizė atskleidė didelį Ser27 išsaugojimą tarp Fos šeimos narių nuo žmogaus iki zebrafijos (tamsios spalvos). Tačiau rūgščiosios liekanos, esančios padėtyje + 3, reikalingos CK2 sutarimo vietai, nėra išsaugotos (šviesos išryškinimas). C, HeLa ląstelės buvo laikinai transfekuotos su laukiniu AFosB (WT) arba ΔFosB, turinčiu taško mutaciją, siekiant pakeisti Ser27 su Ala (S27A). Ląstelės buvo metaboliškai paženklintos 32PH3PO4 CK2 suaktyvinti ir apdoroti transporto priemone arba sperminu (SP). Pateikiami reprezentatyvūs autoradiograma (viršutinė plokštė) ir gautų ΔFosB imunoprecipitatų imunoblotas (apačioje). Parodyta imituotų transfekuotų ląstelių (vektoriaus) imunoprecipitacija.

Norint nustatyti, ar Ser27 yra fosforilintas ΔFosB, mes šią mutaciją mutavome Ala ir analizavome baltymo fosforilinimo būseną. Šiuo tikslu mes naudojome HeLa ląsteles (kurios gali būti transfekuotos su didesniu efektyvumu), kad trumpalaikiai išreikštų WT arba S27A mutantą ΔFosB. Maždaug po 24 h po transfekcijos ląstelės buvo metabolizuojamos metaboliškai 32Paruošti P-ortofosfatai ir viso ląstelių lizatai. Po imunoprecipitacijos ir SDS-PAGE, 32P-ΔFosB buvo aptiktas autoradiografija ir bendras ΔFosB imunoblotais. Kaip parodyta 5 pavC (apatinis skydelis), vektoriuje transfekuotose ląstelėse AFosB nebuvo aptikta, o ląstelės, transfekuotos arba WT, arba S27A mutantu ΔFosB, sėkmingai išreiškė baltymą. Nustatėme, kad mutacija S27A sukėlė reikšmingą (N30%) sumažėjimą 32P-ΔFosB lygiai (Pav 5C, viršutiniame skydelyje ir grafike), nurodant, kad gyvose ląstelėse ΔFosB yra fosforilintas Ser27. Siekiant nustatyti, ar ląstelėse Ser27 iš tikrųjų yra fosforilintas CK2, mes lyginome CK2 aktyvatoriaus spermino gebėjimą moduliuoti WT ir S27A ΔFosB fosforilinimą. Kaip anksčiau pastebėjome PC12 ląstelėse (Pav 4B), HeLa ląstelių gydymas sperminu žymiai padidino WT baltymo fosforilinimą. Tai, kad S27A mutacija labai sumažino šį poveikį (Pav 5C) palaiko aiškinimą, kad Ser27 ΔFosB yra fiziologinis CK2 substratas.

Ser27 fosforilinimas reguliuoja ΔFosB stabilumą

Nustačius, kad ΔFosB stabilumas sumažėja, kai CK2 yra užblokuotas ir sustiprintas, kai CK2 yra aktyvuotasPav 4) ir kad CK2 fosforilina ΔFosB Ser27 (Pav 5), mes prognozavome, kad šios svetainės fosforilinimo prevencija turėtų destabilizuoti baltymą. Eksperimentiniai impulso testai su HeLa ląstelėmis, ekspresuojančiomis arba WT, arba S27A mutantą ΔFosB, atskleidė, kad, kaip buvo prognozuota, S27A mutacija lėmė reikšmingą ΔFosB degradacijos greičio padidėjimą ir kartu sumažėjusį baltymo pusinės eliminacijos laiką. (Pav 6A). Tada ištyrėme, ar šis reguliavimo mechanizmas taip pat vyksta labiau neuroniškoje PC12 ląstelių linijoje. Šie eksperimentai parodė, kad, kaip matėme HeLa ląstelėse, S27A taško mutacija sukelia dramatišką ΔFosB pusėjimo trukmės sumažėjimą PC12 ląstelėse (nuo ∼11 iki ∼4 h).Pav 6B). Tai, kad šis destabilizavimas yra panašus į CK2 slopinimo arba nuleidimo (Pav 4) suteikia papildomą paramą idėjai, kad CX2 tarpininkaujamas Ser27 fosforilinimas reguliuoja ΔFosB stabilumą. Papildomi įrodymai, kad Ser27 fosforilinimas priklauso nuo FosB baltymų apyvartos, buvo gauti naudojant fosfomimetinius Ser27 į Asp mutacijas (S27D). S27D mutacija laikoma fosfomimetiku, nes ji įneša didelę neigiamo krūvio (karboksilo) grupę į aminorūgštį 27 ir taip iš dalies imituoja Ser27 fosforilinimą. Kaip parodyta 6 pavC, S27D mutacija sukėlė priešingą S27A mutacijos efektą, todėl baltymas žymiai stabilesnis nei WT baltymas. Panašiai kaip ir efektas, gautas aktyvavus CK2 (Pav 4D), S27D mutacija sukėlė kaupimąsi ir taip padidino ΔFosB lygį per pirmąsias persekiojimo valandas.

6 pav.

Peržiūrėti didesnę versiją:

6 pav.

Ser27 fosforilinimas reguliuoja ΔFosB stabilumą. A, C, Pulse-chase analizė, parodanti Ser27 fosforilinimo poveikį ΔFosB apyvartai. Rodomi laukinio tipo AFosB (WT), Ser27 į Ala mutantą (S27A) ir fosfomimetiniai Ser27 iki Asp mutantai (S27D) degradacijos profilis ir apskaičiuotas pusinės eliminacijos laikas. Tie patys rezultatai gauti HeLa ląstelėse (A) ir PC12 ląstelės (B, C).

Ser27 fosforilinimas stabilizuoja ΔFosB, užkertant kelią jo proteasominiam skaidymui

Norėdami pradėti išaiškinti mechanizmą, kuriuo Ser27 fosforilinimas stabilizuoja ΔFosB, ištyrėme proteasomų inhibitorių MG132 gebėjimą (Palombella ir kt., 1994; Tsubuki ir kt., 1996) ir epoksomicino (Hanada ir kt., 1992; Kim ir kt., 1999) moduluoti WT ir S27A mutanto ΔFosB degradacijos greitį. Bandymai su pulsais buvo atliekami naudojant PC12 ląsteles, užkrėstas rekombinantiniu HSV, ekspresuojančiu arba WT, arba S27A AFosB, ir apdorotas DMSO arba vienu iš dviejų proteasomų inhibitorių. Šie eksperimentai parodė, kad nors WT baltymo skilimo greitis yra santykinai nejautrus abiejų proteasomų inhibitorių buvimui (Pav 7A), S27A mutanto jautrumas šiems vaistams (Pav 7B). Tai rodo, kad, skirtingai nei WT baltymas, S27A mutantas yra proteaomos degradacijos tikslas. Iš tiesų ląstelių gydymas MG132 arba epoksomicinu visiškai pakito S27A mutacijos poveikį ΔFosB degradacijos greičiui, kurį patvirtina S27A mutanto pusėjimo trukmės padidėjimas nuo ∼4 iki ∼9 h MG132 ir ∼ 12 h epoksomicinui (Pav 7B). Kartu šie duomenys rodo, kad ΔFosB fosforilinimas Ser27 apsaugo baltymą nuo proteasomo degradacijos ir todėl yra būtinas jo neįprastam stabilumui.

7 pav.

Peržiūrėti didesnę versiją:

7 pav.

Ser27 fosforilinimas stabilizuoja ΔFosB, užkertant kelią proteaomų degradacijai. A, B, Impulsinės analizės su HSV infekuotomis PC12 ląstelėmis, rodančiomis laukinio tipo ΔFosB degradacijos profilį ir apskaičiuotą pusėjimo trukmę (A) arba S27A ΔFosB (B), kai nėra dviejų proteasomų inhibitorių [MG132 ir epoksomicino (Epoxo)] arba jų nėra. Atkreipkite dėmesį į tai, kad nė vienas vaistas neturi reikšmingo poveikio laukinio tipo AFosB apyvartai, o ląstelių gydymas su proteasomų inhibitoriumi stabilizavo S27A ΔFosB. C, Ser27 fosforilinimo vaidmuo ΔFosB gebėjime tarpininkauti ilgalaikio smegenų plastiškumo. Indukavus AFosB dalį smegenyse stabilizuoja S2 sukeltas CK27 fosforilinimas. Tai lemia jo kaupimąsi, o tai savo ruožtu lemia ilgalaikius genų ekspresijos pokyčius. Šie stabilūs genų ekspresijos pokyčiai prisideda prie stabilių elgesio adaptacijų. Atvirkščiai, S27 defosforilinimas Ser / Thr fosfatazėmis PP1 ir / arba PP2A sukelia baltymų destabilizavimą ir jo apdorojimą proteasominėje mašinoje.

Ankstesnis skyriusKitas skyrius

Diskusija

Šiame tyrime parodėme, kad ΔFosB pusinės eliminacijos laikas ∼10 h ląstelių kultūroje yra stabilus, palyginti su pilno ilgio FosB ir daugeliu kitų indukuojamų transkripcijos faktorių, kurių pusinės eliminacijos laikas ląstelių kultūroje gali būti toks trumpas kelias minutes ir retai viršija 3 h (Hann ir Eisenman, 1984; Dobrazanski ir kt., 1991; Roberts ir Whitelaw, 1999; Ferrara ir kt., 2003; Hirata ir kt., 2004). Be to, pastebime, kad ΔFosB yra fosforilintas smegenyse ir kad jo fosforilinimas yra jautrus PP1 / PP2A inhibitoriui okadaino rūgščiai. Mūsų ląstelių kultūros tyrimai parodė, kad ΔFosB stabilumas yra moduliuojamas CK2, o didesnis CK2 aktyvumas stabilizuoja baltymą. Galiausiai, mūsų rezultatai rodo, kad CK2 fosforilina ΔFosB ant labai konservuoto N-galo serino (S27) ir įrodo, kad S27 fosforilinimas apsaugo ΔFosB nuo proteasominio degradacijos. Todėl siūlome modelį, pagal kurį CK27 ΔFosB fosforilinimas S2 yra kritinis reguliavimo ΔFosB apyvartos mechanizmas (Pav 7C). Toks fosforilinimo tarpininkaujantis ΔFosB stabilizavimas yra funkciniu požiūriu svarbus, nes įrodyta, kad padidėjęs ΔFosB kiekis tam tikruose smegenų regionuose tiesiogiai reguliuoja daugelį neuronų genų in vivo ir daryti stiprų elgesio poveikį kelių neuropsichiatrinių sutrikimų gyvūnų modeliuose (žr. Įvadą).

Nors fosforilinimas yra greitas ir grįžtamasis būdas reguliuoti tam tikrų transkripcijos faktorių, pvz., CREB (cAMP atsako elemento surišimo baltymo) transkripcijos aktyvumą (Bohmann, 1990), transkripcijos faktorių degradacijos moduliavimas suteikia dar galingesnę (mažiau lengvai grįžtamą) reguliavimo formą (Desterro ir kt., 2000). Transkripcijos veiksniai, kurių funkcinis aktyvumas yra reguliuojamas jų skilimo lygiu, apima NFκB (Desterro ir kt., 2000), c-Myc (Sears ir kt., 1999) ir c-Fos (Ferrara ir kt., 2003), tarp kitų. Daugeliu atvejų fosforilinimas yra pagrindinis transkripcijos faktoriaus stabilumo reguliatorius, kaip parodyta c-Fos (Okazaki ir Sagata, 1995; Tsurumi ir kt., 1995), Su Fos susijęs antigenas-1 (Fra-1) (Vial ir Marshall, 2003), Fra-2 (Manabe ir kt., 2001), c-Jun (Fuchs ir kt., 1996), JunB (Fuchs ir kt., 1997), ATF2 (Fuchs ir kt., 2000) ir p53 (Buschmann ir kt., 2001). Mūsų tyrimai taip pat prideda ΔFosB į šį transkripcijos faktorių sąrašą, kurio funkcinis aktyvumas yra reguliuojamas priklausomai nuo fosforilinto stabilumo.

CK2 yra visur esanti ir iš esmės aktyvi Ser / Thr kinazė, turinti iki šiol identifikuotų> 300 tariamų substratų ir susijusi su daugeliu biologinių procesų, įskaitant ląstelių mirtį ir išgyvenimą (Litchfield, 2003; Unger ir kt., 2004), ląstelių streso atsakas (Yanagawa ir kt., 1997; Kato ir kt., 2003) ir DNR taisymas ir chromatino rekonstrukcija (Barz ir kt., 2003; Krohn ir kt., 2003). Daugiau nei trečdalis galimų CK2 substratų yra baltymai, dalyvaujantys reguliuojant genų ekspresiją (Meggio ir Pinna, 2003). Iš tiesų, įrodyta, kad CK2 yra žinoma branduolinė kinazė (Krek ir kt., 1992) (peržiūrėti, žr Yu ir kt., 2001) ir sąveikauti su kelių transkripcijos veiksnių bZIP domenais (Yamaguchi ir kt., 1998). Taip pat įrodyta, kad CK2 sukeltas fosforilinimas moduliuoja daugelio baltymų, įskaitant IkB, degradaciją (didinant arba mažinant).Schwarz ir kt., 1996), PTEN (Torres ir Pulido, 2001), objektyvo connexin (Yin ir kt., 2000), su chromatinu susijęs baltymas HMG1 (Wisniewski ir kt., 1999) ir keletas transkripcijos veiksnių, tokių kaip HMGB (Stemmer ir kt., 2002), Myf-5 (Winter ir kt., 1997) ir c-Myc (Channavajhala ir Seldin, 2002). CK2 yra daugiausiai smegenų (Alcazar ir kt., 1988; Girault ir kt., 1990), ir jo veikla buvo susijusi su daugeliu smegenų funkcijos aspektų, įskaitant neuronų išgyvenimą (\ tBoehning ir kt., 2003), diferenciacija (Nuthall ir kt., 2004), jonų kanalo funkcija (Jones ir Yakel, 2003; Bildl ir kt., 2004) ir ilgalaikio potencialo bei neuronų plastiškumo (Diaz-Nido ir kt., 1992; Lieberman ir Mody, 1999; Reikhardt ir kt., 2003).

Nepaisant šio didėjančio CK2 vaidmens reguliuojant neuronų funkciją įrodymų, mažai žinoma apie tai, kas kontroliuoja jo veiklą. Manoma, kad CK2 aktyviai veikia, reguliuodamas jo gebėjimą fosforiluoti specifinius substratus, daugiausia remdamasis jo intraceliozės lokalizacijos pokyčiais (pvz., Citozolis ir branduolys).Ahmed ir Tawfic, 1994; Yu ir kt., 1999). Ši informacija kelia svarbų klausimą, kokie signalai reikalingi norint sukelti ΔFosB kaupimąsi smegenyse po lėtinės stimuliacijos (Pav 7C). Vienas reikalavimas yra pakartotinis fosB genas ir ΔFosB mRNR indukcija (Chen ir kt., 1995). Mūsų duomenys rodo, kad ΔFosB fosforilinimas CK2 yra labai svarbus jo stabilumui, o tai reiškia, kad gali prireikti antrojo signalo ilgalaikiam ΔFosB poveikiui genų ekspresijai, būtent signalui, stimuliuojančiam proteino fosforilinimą CK2. Tai gali reikšti CK2 aktyvavimą tam tikru nežinomu mechanizmu arba jo perkėlimu į branduolį. Alternatyviai, AFosB CK2 fosforilinimas gali būti konstitutyvus, todėl, kad ΔFosB baltymas yra transliuojamas atsakant į kiekvieną stimulą, dalis jo išsiskiria ir taip stabilizuojasi taip, kad pakartotinai stimuliuojant jis susikaupia į aukštus kiekius paveiktuose neuronuose.

Mūsų rezultatai rodo, kad CK2 ir S27 tikriausiai nėra vienintelė kinazė ir vieta, atsakinga už AFosB fosforilinimą, nes nei CK2 slopinimas, nei S27A mutacija nesugebėjo visiškai išvengti ΔFosB fosforilinimo. Be to, faktas, kad S27A mutacija sukelia 30% sumažėjimą fosfo-ΔFosB, teigia, kad S27 yra pagrindinė baltymo fosforilinimo vieta. Vis dėlto mes tiriame kitas galimas kinazes ir fosforilinimo vietas ΔFosB. Galų gale taip pat bus svarbu analizuoti S27 ir kitų fosforilinimo vietų ΔFosB fosforilinimą smegenyse. in vivo po įvairių tipų lėtinės stimuliacijos, pvz., naudojant masių spektrometrijos arba fosforo specifinius antikūnus.

Kaip minėta pirmiau, SFNUMX ΔFosB yra labai konservuotas per evoliuciją ir tarp kitų Fos šeimos baltymų. Tačiau sutarimo vieta CK27 nėra: kaip parodyta 5 pavBtik FosB / AFosB (ir Zebrafish xenolog), bet ne c-Fos arba Fra-2, turi rūgštinę liekaną + 3, kuris yra pagrindinis CK2 fosforilinimo faktorius (Marin ir kt., 1986; Meggio ir kt., 1994). Taigi, CK2 fosforilinimo trūkumas S27 gali paaiškinti, kodėl kiti Fos šeimos baltymai nėra tokie stabilūs kaip ΔFosB. Tačiau tai nepaaiškina, kodėl FosB, kurio CK2 konsensuso vieta yra tokia pati kaip ΔFosB, nėra panašiai stabilizuota. Mes nežinome, ar CK2 šiam konservuotam likučiui fosforiluoja pilno ilgio FosB. Vienintelės FosB ataskaitos (Skinner ir kt., 1997) ir c-Fos (Okazaki ir Sagata, 1995; Chen ir kt., 1996) fosforilinimas apibūdina šių baltymų C-galinio regiono vietas, kurios nėra ΔFosB. Norint, kad CK2 gautų visą FosB ir kitų Fos šeimos baltymų fosforilinimą, reikia tiesioginio tyrimo. Vis dėlto, net jei jie yra fosforilinti, kiti Fos šeimos baltymai turi savo C galuose esančius motyvus, kurie nukreipia baltymus sparčiai skaidant (Papavassiliou ir kt., 1992; Jariel-Encontre ir kt., 1997; Acquaviva ir kt., 2002). Pavyzdžiui, buvo įrodyta, kad os21 likučių, esančių visų Fos šeimos baltymų C gale, bet nėra ΔFosB, ruožas veikia kaip c-Fos destabilizuojantis domenas (Acquaviva ir kt., 2001). Mes nustatėme, kad nors ši seka panašiai destabilizuoja visą ilgio FosB (Carle ir kt., 2004), šio domeno nebuvimas ΔFosB visapusiškai neatsižvelgia į jo stabilizavimą. Atvirkščiai, šio C galinio domeno ir Ser27 fosforilinimo nebuvimas visiškai atitinka maždaug penkis kartus skirtumą tarp ΔFosB ir FosB.

Nors „Fos“ šeimos baltymų skaidymas yra sudėtingas ir nėra visiškai suprantamas, proteasominis degradavimas yra svarbiausias būdas (Salvat ir kt., 1999; Acquaviva ir kt., 2002; Ferrara ir kt., 2003). Čia pateikti duomenys, kuriuose proteasomų inhibitoriai reikšmingai nekeičia ΔFosB degradacijos greičio, teigia, kad, skirtingai nuo kitų Fos šeimos baltymų, ΔFosB išvengia 26S proteasomos, ir tai vaidina pagrindinį vaidmenį stabilizuojant. Todėl siūlome schemą, pagal kurią padidėjęs ΔFosB stabilumas priskiriamas dviejų pagrindinių veiksnių: (1), C-terminalo destabilizuojančio domeno ir (2), S27 fosforilinimo CK2, nebuvimui.

Apibendrinant galima pasakyti, kad šiame tyrime pateikiamas mechaninis supratimas, kodėl ΔFosB - artimiausio ankstyvojo geno produktas fosB, skirtingai nuo visų kitų „Fos“ šeimos narių, yra gana ilgai išgyvenęs baltymas. Nors manoma, kad kiti Fos šeimos baltymai tarpininkauja greitam, bet trumpam stimuliaciniam transkripcijai (Morganas ir Curranas, 1995), santykinis ΔFosB stabilumas suteikia jai galimybę tarpininkauti ilgesnius transkripcijos pokyčius, kuriuos sukelia lėtinė stimuliacija. Tai patvirtina požiūrį, kad ΔFosB veikia kaip ilgalaikis molekulinis jungiklis smegenyse, palaipsniui keičiant ūminius atsakus į lėtinius pritaikymus. Ser27 fosforilinimo, kaip pagrindinio ΔFosB stabilumo mechanizmo, atpažinimas atveria naujas galimybes plėtoti ΔFosB funkciją reguliuojančias priemones ir taip moduliuoti jo ilgalaikį poveikį nervų ir elgesio plastikai.

Ankstesnis skyriusKitas skyrius

Išnašos

  • Gavo lapkričio 21, 2005.
  • Peržiūrėta ataskaita vasario 21, 2006.
  • Priimta balandžio 2, 2006.
  • Šiam darbui pritarė Nacionalinis šizofrenijos ir depresijos tyrėjų aljanso aljansas PGU, Nacionalinis narkotikų vartojimo instituto (NIDA) nacionalinis mokslinių tyrimų tarnybos apdovanojimas PGU, ir Nacionalinio psichikos sveikatos instituto ir NIDA dotacijos EJN. padėkoti dr. Jamesui Bibbui už jo pagalbą in vitro fosforilinimo tyrimai, dr. Ming-Hu Han, padedantis paruošti medžiagų apykaitai naudojamus smegenų gabaliukus, ir dr. Rachael Neve, padedant pakuoti rekombinantinius HSV.
  • Dabartinis G. Rudenko adresas: Gyvybės mokslų institutas ir Mičigano universiteto Farmakologijos katedra, 210 Washtenaw Avenue # 3163A, Ann Arbor, MI 48109-2216.
  • Korespondencija turėtų būti adresuojama Ericui J. Nestleriui, 5323 Harry Hines Boulevard, Dallas, TX 75390-9070. El. Paštas: [apsaugotas el. paštu]

Ankstesnis skyrius

 

Nuorodos

Acquaviva C, Brockly F, Ferrara P, Bossis G, Salvat C, Jariel-Encontre I, Piechaczyk M (2001) C-galinio tripeptido motyvo, susijusio su c-Fos proto-onkoproteino greito proteasominio degradavimo kontroliuojant G (0) -S-fazės perėjimą, identifikavimas. onkogeno 20:7563–7572.

CrossRefMedline

Acquaviva C, Bossis G, Ferrara P, Brockly F, Jariel-Encontre I, Piechaczyk M (2002) Fos šeimos baltymų dauginimo būdai. Ann NY Acad Sci 973:426–434.

Medline

Ahmed K, Tawfic S (1994) Baltymų kinazės CK2 intracelulinio reguliavimo mechanizmas: stimuliuojančio subnuklidinės asociacijos vaidmuo. Cell Mol Biol Res 40:539–545.

Medline

Alcazar A, Martin E, Lopez-Fando J, Salinas M (1988) Patobulinta kazeino kinazės II gryninimo procedūra ir savybės. Neurochem Res 13:829–836.

CrossRefMedline

Andersson M, Westin JE, Cenci MA (2003) Stimalaus DeltaFosB tipo imunoreaktyvumo ir prodinorfino mRNR kiekio trukmė nutraukus lėtinį dopaminomimetinį gydymą. Eur J Neurosci 17:661–666.

CrossRefMedline

Barz T, Ackermann K, Dubois G, Eils R, Pyerin W (2003) Genomo pločio ekspresijos ekranai rodo baltymų kinazės CK2 pasaulinį vaidmenį chromatino remodeliavime. J Cell Sci 116:1563–1577.

Anotacija / NEMOKAMAS Visas tekstas

Beh I, Schmidt R, Hecker E (1989) Dviejuose PKC izoenzimuose, randamuose HL-60 ląstelėse, nustatyta, kad aktyvumas yra skirtingas forbolo esterio TPA. FEBS Lett 249:264–266.

Medline

Bildl W, Strassmaier T, Thurm H, Andersen J, Eble S, Oliver D, Knipper M, Mann M, Schulte U, Adelman JP, Fakler B (2004) Baltymų kinazė CK2 yra sujungta su mažais laidumo Ca (2 +) - aktyvuotais K + kanalais ir reguliuoja kanalų prijungimą. Neuronas 43:847–858.

CrossRefMedline

Bing G, Wang W, Qi Q, Feng Z, Hudson P, Jin L, Zhang W, Bing R, Hong JS (1997) Ilgalaikė su Fos susijusių antigenų ekspresija ir trumpalaikė delta FosB ekspresija, susijusi su priepuoliais žiurkių hipokampe ir striatume. J Ncurochcm 68:272–279.

Medline

Blom N, Sicheritz-Ponten T, Gupta R, Gammeltoft S, Brunak S (2004) Prognozuojama, kad po aminorūgščių sekos yra baltymų postranslacinis glikozilinimas ir fosforilinimas. proteomiką 4:1633–1649.

CrossRefMedline

Boehning D, Moon C, Sharma S, Hurt KJ, Hester LD, Ronnett GV, Shugar D, Snyder SH (2003) Anglies monoksido neurotransmisija, aktyvuota pagal Hem oxase-2 CK2 fosforilinimą. Neuronas 40:129–137.

CrossRefMedline

Bohmann D (1990) Transkripcijos faktoriaus fosforilinimas: ryšys tarp signalo perdavimo ir genų ekspresijos reguliavimo. Vėžinių ląstelių 2:337–344.

Medline

Buschmann T, Potapova O, Bar-Shira A, Ivanovas VN, Fuchs SY, Hendersonas S, Fried VA, Minamoto T, Alarcon-Vargas D, Pincus MR, Gaarde WA, Holbrook NJ, Shiloh Y, Ronai Z (2001) Birželio NH2-terminalo kinazės fosforilinimas p53 ant Thr-81 yra svarbus p53 stabilizavimui ir transkripcinei veiklai reaguojant į stresą. Mol Cell Biol 21:2743–2754.

Anotacija / NEMOKAMAS Visas tekstas

Carle TL, Ulery PG, Nestler EJ (2004) Konservuoto Fos šeimos C-terminalo domeno nebuvimas prisideda prie unikalaus „deltaFosB“ stabilumo. Soc Neurosci Abstr 30: 692.2.

Channavajhala P, Seldin DC (2002) Funkcinė baltymų kinazės CK2 ir c-Myc sąveika lymphomagenesis. onkogeno 21:5280–5288.

CrossRefMedline

Chen J, Nye HE, Kelz MB, Hiroi N, Nakabeppu Y, Hope BT, Nestler EJ (1995) Delta FosB ir FosB panašių baltymų reguliavimas elektrokonvulsinių priepuolių ir kokaino gydymu. Mol Pharmacol 48:880–889.

Abstraktus

Chen J, Kelz MB, Hope BT, Nakabeppu Y, Nestler EJ (1997) Lėtiniai su FOS susiję antigenai: stabilūs ΔFosB variantai, kuriuos sukelia lėtinis gydymas smegenyse. J Neuroscience 17:4933–4941.

Anotacija / NEMOKAMAS Visas tekstas

Chen RH, Juo PC, Curran T, Blenis J (1996) C-Fos fosforilinimas C-gale padidina jo transformacinį aktyvumą. onkogeno 12:1493–1502.

Medline

Choe ES, Parelkar NK, Kim JY, Cho HW, Kang HS, Mao L, Wang JQ (2004) Baltymų fosfatazės 1 / 2A inhibitorius okadaino rūgštis padidina CREB ir Elk-1 fosforilinimą ir c-fos ekspresiją žiurkių striatume in vivo. J Ncurochcm 89:383–390.

CrossRefMedline

Cochet C, Chambaz EM (1983) Poliamino sukeltos baltymų fosforilacijos: galimas intraceliozinio poliamino poveikio tikslas. Mol Cell Endocrinol 30:247–266.

CrossRefMedline

Cochet C, Feige JJ, Chambaz EM (1983) Labai išgryninto G tipo kazeino kinazės katalizinės ir molekulinės savybės iš galvijų plaučių audinio. Biochim Biophys Acta 743:1–12.

Medline

Colby CR, Whisler K, Steffen C, Nestler EJ, Self DW (2003) Striatyvinė ląstelių tipo specifinė „DeltaFosB“ ekspresija padidina kokaino skatinimą. J Neuroscience 23:2488–2493.

Anotacija / NEMOKAMAS Visas tekstas

Daunais JB, Roberts DC, McGinty JF (1993) Kokaino savarankiškas vartojimas padidina preprodynorfiną, bet ne c-fos, mRNR žiurkių striatume. NeuroReport 4:543–546.

Medline

Desterro JM, Rodriguez MS, Hay RT (2000) Transkripcijos faktorių reguliavimas pagal baltymų skaidymą. Cell Mol Life Sci 57:1207–1219.

CrossRefMedline

Diaz-Nido J, Armas-Portela R, Avila J (1992) Citoplazminio kazeino kinazės II tipo aktyvumo padidėjimas, susijęs su neitito augimu po DNR sintezės slopinimo NIA-103 neuroblastomos ląstelėse. J Ncurochcm 58:1820–1828.

Medline

Di Maira G, Salvi M, Arrigoni G, Marin O, Sarno S, Brustolon F, Pinna LA, Ruzzene M (2005) Baltymų kinazė CK2 fosforilina ir reguliuoja Akt / PKB. Ląstelių mirtis skiriasi 12:668–677.

CrossRefMedline

Dobrazanski P, Noguchi T, Kovary K, Rizzo CA, Lazo PS, Bravo R (1991) Abu fosB geno produktai, FosB ir jo trumpoji forma, FosB / SF, yra transkripcijos aktyvatoriai fibroblastuose. Mol Cell Biol 11:5470–5478.

Anotacija / NEMOKAMAS Visas tekstas

Ferrara P, Andermarcher E, Bossis G, Acquaviva C, Brockly F, Jariel-Encontre I, Piechaczyk M (2003) Struktūriniai determinantai, atsakingi už c-Fos baltymų proteasominį skaidymą, skiriasi priklausomai nuo ekspresijos sąlygų. onkogeno 22:1461–1474.

CrossRefMedline

Fuchs SY, Dolan L, Davis RJ, Ronai Z (1996) Nuo c-Jun ubikvitinacijos priklausomybės nuo fosforilinimo priklausomybės nuo Jun N-kinazės. onkogeno 13:1531–1535.

Medline

Fuchs SY, Xie B, Adler V, Fried VA, Davis RJ, Ronai Z (1997) c-Jun NH2-terminalo kinazės yra susijusios su jų susijusių transkripcijos faktorių ubikvityvumu. J Biol Chem 272:32163–32168.

Anotacija / NEMOKAMAS Visas tekstas

Fuchs SY, Tappin I, Ronai Z (2000) ATF2 transkripcijos faktoriaus stabilumą reguliuoja fosforilinimas ir defosforilinimas. J Biol Chem 275:12560–12564.

Anotacija / NEMOKAMAS Visas tekstas

Girault JA, Hemmings HC Jr, Williams KR, Nairn AC, Greengard P (1989) DOPPP-32, dopamino ir cAMP reguliuojamo fosfoproteino fosforilinimas kazeino kinazės II pagalba. J Biol Chem 264:21748–21759.

Anotacija / NEMOKAMAS Visas tekstas

Girault JA, Hemmings HC Jr, Zorn SH, Gustafson EL, Greengard P (1990) DARPP-32 serino kinazės, identiškos kazeino kinazei II, apibūdinimas žinduolių smegenyse. J Ncurochcm 55:1772–1783.

Medline

„Hanada M“, „Sugawara K“, „Kaneta K“, „Toda S“, „Nishiyama Y“, „Tomita K“, „Yamamoto H“, „Konishi M“, „Oki T“ (1992) Epoksomicinas - naujas mikrobų kilmės navikas. J Antibiot (Tokijas) 45:1746–1752.

Medline

Hann SR, Eisenman RN (1984) Žmogaus c-myc onkogeno koduojami baltymai: diferencinė ekspresija neoplastinėse ląstelėse. Mol Cell Biol 4:2486–2497.

Anotacija / NEMOKAMAS Visas tekstas

„Hemmings HC Jr“, „Girault JA“, „Williams KR“, „LoPresti MB“, „Greengard P“ (1989) ARPP-21, ciklinis AMP reguliuojamas fosfoproteinas (Mr = 21,000), praturtintas dopamino inervuotais smegenų regionais. Amino rūgščių seka, fosforilinta cikliniu AMP, nepažeistose ląstelėse ir kinetiniai jo fosforilinimo tyrimai in vitro. J Biol Chem 264:7726–7733.

Hidaka H, ​​Kobayashi R (1992) Baltymų kinazės inhibitorių farmakologija. Annu Rev Pharmacol Toxicol 32:377–397.

CrossRefMedline

Hirata H, Bessho Y, Kokubu H, Masamizu Y, Yamada S, Lewis J, Kageyama R (2004) Hes7 baltymo nestabilumas yra labai svarbus somito segmentacijos laikrodžiui. Nat Genet 36:750–754.

CrossRefMedline

„Hiroi N“, „Graybiel AM“ (1996) Netipiniai ir tipiški neuroleptiniai gydymo būdai sukelia skirtingas transkripcijos faktoriaus ekspresijos programas striatume. J Comp Neurol 374:70–83.

CrossRefMedline

„Hope B“, „Kosofsky B“, „Hyman SE“, „Nestler EJ“ (1992) Greitos ankstyvosios geno ekspresijos reguliavimas ir AP-1 surišimas žiurkių branduolyje akrobatinio lėtinio kokaino. Proc Natl Acad Sci USA 89:5764–5768.

Anotacija / NEMOKAMAS Visas tekstas

„Hope BT“, „Kelz MB“, „Duman RS“, „Nestler EJ“ (1994a) Lėtinis elektrokonvulsinis priepuolis (ECS) lemia ilgalaikio AP-1 komplekso ekspresiją smegenyse su pakeista sudėtimi ir savybėmis. J Neuroscience 14:4318–4328.

Abstraktus

„Hope BT“, „Nye HE“, „Kelz MB“, „Self DW“, „Iadarola MJ“, „Nakabeppu Y“, „Duman RS“, „Nestler EJ“ (1994b) Ilgalaikio AP-1 komplekso, kurį sudaro kintantys Fos tipo baltymai smegenyse, sukėlimas lėtiniu kokainu ir kitais lėtiniais gydymais. Neuronas 13:1235–1244.

CrossRefMedline

Ishida A, Fujisawa H (1995) Kalcitolino priklausomos baltymų kinazės II stabilizavimas per autoinhibitorinį domeną. J Biol Chem 270:2163–2170.

Anotacija / NEMOKAMAS Visas tekstas

Jariel-Encontre I, Salvat C, Steff AM, Pariat M, Acquaviva C, Furstoss O, Piechaczyk M (1997) Kompleksiniai c-fos ir c-jun degradacijos mechanizmai. Mol Biol Rep 24:51–56.

CrossRefMedline

Jones S, Yakel JL (2003) Kazeino kinazė ii (baltymų kinazė ck2) reguliuoja serotonino 5-ht (3) receptorių kanalo funkciją ng108 – 15 ląstelėse. Neurologijos 119:629–634.

CrossRefMedline

Kato T Jr, Delhase M, Hoffmann A, Karin M (2003) CK2 yra C-galinė IkappaB kinazė, atsakinga už NF-kappaB aktyvaciją UV atsako metu. Mol Cell 12:829–839.

CrossRefMedline

Kelz MB, Chen J, Carlezon WA Jr, Whisler K, Gilden L, Beckmann AM, Steffen C, Zhang YJ, Marotti L, Self DW, Tkatch T, Baranauskas G, Surmeier DJ, Neve RL, Duman RS, Picciotto MR, Nestler EJ (1999) Transkripcijos faktoriaus deltaFosB ekspresija smegenyse kontroliuoja jautrumą kokainui. Pobūdis 401:272–276.

CrossRefMedline

Kim KB, Myung J, Sin N, Crews CM (1999) Proteasomos slopinimas natūraliais produktais epoksomicinas ir dihidroeponemicinas: įžvalgos apie specifiškumą ir stiprumą. Bioorg Med Chem Lett 9:3335–3340.

CrossRefMedline

Kobayashi E, Nakano H, Morimoto M, Tamaoki T (1989) Kalpostinas C (UCN-1028C), naujasis mikrobinis junginys, yra labai stiprus ir specifinis baltymų kinazės inhibitorius. Biochem Biophys Res Commun 159:548–553.

CrossRefMedline

„Krek W“, „Maridor G“, „Nigg EA“ (1992) Kazeino kinazė II yra daugiausia branduolinis fermentas. J Cell Biol 116:43–55.

Anotacija / NEMOKAMAS Visas tekstas

„Krohn NM“, „Stemmer C“, „Fojan P“, „Grimm R“, „Grasser KD“ (2003) Baltymų kinazė CK2 fosforilina didelio mobilumo grupės domeno baltymą SSRP1, skatindama UV sugadintos DNR atpažinimą. J Biol Chem 278:12710–12715.

Anotacija / NEMOKAMAS Visas tekstas

Kumar A, Choi KH, Renthal W, Tsankova NM, Theobald DEH, Truong HT, Russo SJ, LaPlant Q, Whistler K, Neve RL, Self DW, Nestler EJ (2005) Chromatino rekonstrukcija yra pagrindinis mechanizmas, kuriuo grindžiamas striatumo kokaino sukeltas plastiškumas. Neuronas 48:303–314.

CrossRefMedline

Liebermanas DN, „Mody I“ (1999) Kazeino kinazė-II reguliuoja NMDA kanalo funkciją hipokampo neuronuose. Nat Neurosci 2:125–132.

CrossRefMedline

„Litchfield DW“ (2003) Baltymų kinazė CK2: struktūra, reguliavimas ir vaidmuo ląstelių sprendimuose dėl gyvenimo ir mirties. Biochem J 369:1–15.

CrossRefMedline

Manabe T, Kuramoto N, Nakamichi N, Aramachi K, Baba K, Hirai T, Yoneyama M, Yoneda Y (2001) C-Fos baltymo, išreikšto N-metil-d-parartino rūgštis pelių hipokampo branduolinėse frakcijose. Smegenų raiška 905:34–43.

Medline

Mandelzys A, Gruda MA, Bravo R, Morgan JI (1997) Nenutrūkstamai padidėjusio 37 kDa fos su antigeno ir AP-1 tipo DNR surišimo aktyvumo nebuvimas kainų rūgštimi apdorotų fosB null pelių smegenyse. J Neuroscience 17:5407–5415.

Anotacija / NEMOKAMAS Visas tekstas

Marin O, Meggio F, Marchiori F, Borin G, Pinna LA (1986) Kazeino kinazės-2 (TS) vietos specifiškumas žiurkių kepenų citozoliui. Tyrimas su modelinių peptidų substratais. Eur J Biochem 160:239–244.

McClung CA, Nestler EJ (2003) CREB ir DeltaFosB reguliuoja geno ekspresiją ir kokaino atlygį. Nat Neurosci 6:1208–1215.

CrossRefMedline

McClung CA, Ulery PG, Perrotti LI, Zachariou V, Berton O, Nestler EJ (2004) DeltaFosB: molekulinis jungiklis ilgalaikiam prisitaikymui smegenyse. Brain Res Mol Brain Res 132:146–154.

Medline

Meggio F, Pinna LA (2003) Vienas tūkstantis ir vienas baltymų kinazės CK2 substratas? FASEB J 17:349–368.

Anotacija / NEMOKAMAS Visas tekstas

Meggio F, Donella-Deana A, Pinna LA, Moret V (1977) Kazeino frakcijų fosforilinimas žiurkių kepenų „fosvitino kinaze“. FEBS Lett 75:192–196.

Medline

Meggio F, Brunati AM, Pinna LA (1983) 2 tipo kazeino kinazės TS autofosforilinimas tiek alfa, tiek beta-subvienetuose. Įvairių efektorių įtaka. FEBS Lett 160:203–208.

CrossRefMedline

Meggio F, Shugar D, Pinna LA (1990) Ribofuranozil-benzimidazolo dariniai kaip kazeino kinazės-2 ir kazeino kinazės-1 inhibitoriai. Eur J Biochem 187:89–94.

Medline

Meggio F, Marin O, Pinna LA (1994) CK2 baltymų kinazės substrato specifiškumas. Cell Mol Biol Res 40:401–409.

Medline

Miller C, Zhang M, He Y, Zhao J, Pelletier JP, Martel-Pelletier J, Di Battista JA (1998) Ciklooksigenazės-2 geno transkripcijos indukcija okadaino rūgšties fosfatazės aktyvumo slopinimu žmogaus chondrocituose: AP-1 ir CRE branduolinių junginių baltymas. J Cell Biochem 69:392–413.

CrossRefMedline

Moratalla R, Elibol B, Vallejo M, Graybiel AM (1996) Tinklo lygio pokyčiai indukuojamų Fos-Jun baltymų ekspresijoje striatume chroniško gydymo ir nutraukimo metu. Neuronas 17:147–156.

CrossRefMedline

Morgan JI, Curran T (1995) Skubūs ankstyvieji genai: praėjus dešimčiai metų. Tendencijos Neurosci 18:66–67.

CrossRefMedline

Nakabeppu Y, Nathans D (1991) Natūraliai sutrumpinta FosB forma, kuri slopina Fos / Jun transkripcijos aktyvumą. Ląstelė 64:751–759.

CrossRefMedline

„Nestler EJ“, „Barrot M“, „Self DW“ (2001) Delta FosB: ilgalaikis molekulinis jungiklis priklausomybei. Proc Natl Acad Sci USA 98:11042–11046.

Anotacija / NEMOKAMAS Visas tekstas

Neve RL, Howe JR, Hong S, Kalb RG (1997) Glutamato receptoriaus subvieneto 1 įvedimas į motorinius neuronus in vitro ir in vivo naudojant rekombinantinį herpes simplex virusą. Neurologijos 79:435–447.

CrossRefMedline

Nuthall HN, Joachim K, Stifani S (2004) Groucho / TLE239 serino 1 fosforilinimas pagal baltymų kinazę CK2 yra svarbus neuronų diferenciacijos slopinimui. Mol Cell Biol 24:8395–8407.

Anotacija / NEMOKAMAS Visas tekstas

Okazaki K, Sagata N (1995) Mos / MAP kinazės kelias stabilizuoja c-Fos fosforilinimą ir padidina jo transformacinį aktyvumą NIH 3T3 ląstelėse. EMBO J 14:5048–5059.

Medline

Palombella VJ, Rando OJ, Goldberg AL, Maniatis T (1994) Ubikvitino proteasomos kelias reikalingas NF-kappa B1 prekursoriaus baltymo apdorojimui ir NF-kappa B. Ląstelė 78:773–785.

CrossRefMedline

Papavassiliou AG, Treier M, Chavrier C, Bohmann D (1992) Tikslinis c-Fos, bet ne v-Fos, skaidymas nuo fosforilinimo priklausomo signalo c-Jun. Mokslas 258:1941–1944.

Anotacija / NEMOKAMAS Visas tekstas

Peakman MC, Colby C, Perrotti LI, Tekumalla P, Carle T, Ulery P, Chao J, Duman C, Steffen C, Monteggia L, Allen MR, Stock JL, Duman RS, McNeish JD, Barrot M, Self DW, Nestler EJ , Schaeffer E (2003) Indukcinis, smegenų srities specifinis dominuojančio neigiamo c-Jun mutanto ekspresija transgeninėse pelėse mažina jautrumą kokainui. Smegenų raiška 970:73–86.

CrossRefMedline

Perrotti LI, Hadeishi Y, Ulery PG, Barrot M, Monteggia L, Duman RS, Nestler EJ (2004) DeltaFosB indukcija su lydinčia smegenų struktūra po lėtinio streso. J Neuroscience 24:10594–10602.

Anotacija / NEMOKAMAS Visas tekstas

„Persico AM“, „Schindler CW“, „O'Hara BF“, „Brannock MT“, Uhl GR (1993) Smegenų transkripcijos faktoriaus ekspresija: ūminio ir lėtinio amfetamino ir injekcijos streso poveikis. Brain Res Mol Brain Res 20:91–100.

Medline

Ploegh HL, Dunn BM (2000) Post-transliacijos modifikacija: fosforilinimas ir fosfatazės. In: Dabartiniai baltymų mokslo protokolai (Dunn BM, red.) P. 13.01–13.02. Niujorkas: Wiley ir Sons.

Pyerin W, Burow E, Michaely K, Kubler D, Kinzel V (1987) Katalizinės ir molekulinės II tipo išgryninto fosvitino / kazeino kinazės savybės iš žmogaus epitelio ląstelių kultūroje (HeLa) ir ryšys su ekto baltymų kinaze. Biol Chem Hoppe Seyler 368:215–227.

Medline

Reikhardt BA, Kulikova OG, Borisova GY, Aleksandrova IY, Sapronov NS (2003) „Baltymų kinazės CK2-HMG14“ sistemos būklė su amžiumi susijusiose amžiaus grupėse žiurkėms. Neurosci Behav Physiol 33:799–804.

Medline

Roberts BJ, Whitelaw ML (1999) Pagrindinio helix-loop-helix / Per-ARNT-Sim homologijos srities dioksino receptoriaus skaidymas per ubikvitino / proteasomo kelią. J Biol Chem 274:36351–36356.

Anotacija / NEMOKAMAS Visas tekstas

Rost B, Yachdav G, Liu J (2004) „PredictProtein“ serveris. Nucleic Acids Res 32:W321–W326.

Anotacija / NEMOKAMAS Visas tekstas

Rylski M, Kaczmarek L (2004) Ap-1 tikslai smegenyse. Front Biosci 9:8–23.

CrossRefMedline

Sahin B, Kansy JW, Nairn AC, Spychala J, Ealick SE, Fienberg AA, Greene RW, Bibb JA (2004) Rekombinantinio pelės adenozino kinazės molekulinė charakteristika ir įvertinimas kaip baltymų fosforilinimo tikslas. Eur J Biochem 271:3547–3555.

Medline

Salvat C, Aquaviva C, Jariel-Encontre I, Ferrara P, Pariat M, Steff AM, Carillo S, Piechaczyk M (1999) Ar yra keli proteolitiniai keliai, prisidedantys prie c-Fos, c-Jun ir p53 baltymų skaidymo in vivo? Mol Biol Rep 26:45–51.

CrossRefMedline

Schmidt R, Hecker E (1975) Forbolų esterių autoksidavimas įprastomis laikymo sąlygomis. Vėžio rez 35:1375–1377.

NEMOKAMAS Visas tekstas

Schwarz EM, Van Antwerp D, Verma IM (1996) Konkretus IkappaBalpha fosforilinimas kazeino kinaze II dažniausiai vyksta serino 293: reikalavimas laisvos IkappaBalpha degradacijai. Mol Cell Biol 16:3554–3559.

Anotacija / NEMOKAMAS Visas tekstas

Sears R, Leone G, DeGregori J, Nevins JR (1999) Ras padidina Myc baltymų stabilumą. Mol Cell 3:169–179.

CrossRefMedline

Silva-Neto MA, Fialho E, Paes MC, Oliveira PL, Masuda H (2002) Cikliškos nepriklausomos vitellino fosforilacijos kazeino kinazės II, išgrynintos iš Rhodnius prolixo oocitų. Vabzdžių Biochem Mol Biol 32:847–857.

CrossRefMedline

Skinner M, Qu S, Moore C, išmintis R (1997) Transkripciniam aktyvavimui ir transformacijai FosB proteinu reikia karboksil-galinės aktyvacijos domeno fosforilinimo. Mol Cell Biol 17:2372–2380.

Anotacija / NEMOKAMAS Visas tekstas

Stemmer C, Schwander A, Bauw G, Fojan P, Grasser KD (2002) Baltymų kinazė CK2 diferencialiai fosforilina kukurūzų chromosomų aukšto mobilumo B grupės (HMGB) baltymus, reguliuojančius jų stabilumą ir DNR sąveiką. J Biol Chem 277:1092–1098.

Anotacija / NEMOKAMAS Visas tekstas

Stevens I, Derua R, Rondelez E, Waelkens E, Merlevede W, Goris J (1999) Cyk, ciklino B2 kinazės, kaip naujo kalcio / kalmodulino priklausomo baltymų kinazės II identifikavimas ir jo vaidmuo Xenopus laevis oocitų brandinimo metu. Exp Cell Res 252:303–318.

CrossRefMedline

Suh HW, Choi SS, Lee JK, Lee HK, Han EJ, Lee J (2004) C-fos ir c-jun geno ekspresijos reguliavimas lipopolisacharidu ir citokinais pirminiuose kultūriniuose astrocituose: PKA ir PKC takų poveikis. Arch Pharm Res 27:396–401.

Medline

Szyszka R, Boguszewska A, Grankowski N, Ballesta JP (1995) Dviejų endogeninių baltymų kinazių: kazeino kinazės-2 ir 60S kinazės ribosomų rūgščių baltymų diferencinis fosforilinimas. Acta Biochim Pol 42:357–362.

Medline

Tamaoki T, Takahashi I, Kobayashi E, Nakano H, Akinaga S, Suzuki K (1990) Kalpostinas (UCN1028) ir su kalpostinu susiję junginiai, nauja klasė proteinų kinazės specifinių ir stiprių inhibitorių klasė. „Adv“ antrasis „Messenger“ fosfoproteino rez 24:497–501.

Medline

Torres J, Pulido R (2001) Auglio slopintojas PTEN fosforilinamas proteino kinazės CK2 C gale. PTEN stabilumo pasekmės proteasomų skilimui. J Biol Chem 276:993–998.

Anotacija / NEMOKAMAS Visas tekstas

Tsubuki S, Saito Y, Tomioka M, Ito H, Kawashima S (1996) Difaininis calpaino ir proteasomų aktyvumo slopinimas di- leucino ir tri-leucino peptidilo aldehidais. J Biochem (Tokijas) 119:572–576.

Anotacija / NEMOKAMAS Visas tekstas

Tsurumi C, Ishida N, Tamura T, Kakizuka A, Nishida E, Okumura E, Kishimoto T, Inagaki M, Okazaki K, Sagata N (1995) C-Fos skaidymą 26S proteasomu pagreitina c-Jun ir daug baltymų kinazės. Mol Cell Biol 15:5682–5687.

Anotacija / NEMOKAMAS Visas tekstas

Unger GM, Davis AT, Slaton JW, Ahmed K (2004) Baltymų kinazė CK2 kaip ląstelių išlikimo reguliatorius: poveikis vėžio terapijai. Curr Cancer Drug Targets 4:77–84.

CrossRefMedline

Vial E, Marshall CJ (2003) Padidėjęs ERK-MAP kinazės aktyvumas apsaugo FOS šeimos narį FRA-1 prieš proteasomų skaidymą gaubtinės žarnos vėžio ląstelėse. J Cell Sci 116:4957–4963.

Anotacija / NEMOKAMAS Visas tekstas

Werme M, Messer C, Olson L, Gilden L, Thoren P, Nestler EJ, Brene S (2002) ΔFosB reguliuoja ratų važiavimą. J Neuroscience 22:8133–8138.

Anotacija / NEMOKAMAS Visas tekstas

Whitmarsh AJ, Davis RJ (2000) Transkripcijos faktoriaus funkcijos reguliavimas fosforilinimo būdu. Cell Mol Life Sci 57:1172–1183.

CrossRefMedline

Winter B, Kautzner I, Issinger OG, Arnoldas HH (1997) Myf-2 aktyvumui yra svarbios dvi numatomos baltymų kinazės CK5 fosforilinimo vietos. Biol Chem 378:1445–1456.

Medline

Wisniewski JR, Szewczuk Z, Petry I, Schwanbeck R, Renner U (1999) 1 didelio judrumo grupės rūgščių uodegų fosforilinimas kazeino kinaze II keičia jų konformaciją, stabilumą ir DNR surišimo specifiškumą. J Biol Chem 274:20116–20122.

Anotacija / NEMOKAMAS Visas tekstas

Yamaguchi Y, Wada T, Suzuki F, Takagi T, Hasegawa J, Handa H (1998) Kazeino kinazė II sąveikauja su kelių transkripcijos faktorių bZIP domenais. Nucleic Acids Res 26:3854–3861.

Anotacija / NEMOKAMAS Visas tekstas

Yanagawa T, Yuki K, Yoshida H, Bannai S, Ishii T (1997) A170 streso baltymo fosforilinimas kazeino kinazės II tipo aktyvumu makrofaguose. Biochem Biophys Res Commun 241:157–163.

CrossRefMedline

Yankulov K, Yamashita K, Roy R, Egly JM, Bentley DL (1995) Transkripcijos pailgėjimo inhibitorius 5,6-dichlor-1-beta-d-ribofuranozilbenzimidazolas slopina transkripcijos faktoriaus IIH susijusią baltymų kinazę. J Biol Chem 270:23922–23925.

Anotacija / NEMOKAMAS Visas tekstas

Yen J, Wisdom RM, Tratner I, Verma IM (1991) FosB alternatyvi spliced ​​forma yra neigiamas transkripcijos aktyvacijos ir transformacijos Fos baltymų reguliatorius. Proc Natl Acad Sci USA 88:5077–5081.

Anotacija / NEMOKAMAS Visas tekstas

Yin X, Jedrzejewski PT, Jiang JX (2000) Kazeino kinazė II fosforilina lęšių connexin 45.6 ir dalyvauja jos skaidyme. J Biol Chem 275:6850–6856.

Anotacija / NEMOKAMAS Visas tekstas

Yoza BK, Brooks JW, Mizel SB (1992) AP-1 transkripcijos faktoriaus komponentų indukcija T-ląstelių aktyvinimo metu interleukino 1 ir forbolo esteriais. Ląstelių augimas skiriasi 3:677–684.

Abstraktus

Yu S, Wang H, Davis A, Ahmed K (2001) CK2 signalizacijos pasekmės branduolinei matricai. Mol Cell Biochem 227:67–71.

CrossRefMedline

Yu S, Davis AT, Guo C, Green JE, Ahmed K (1999) Diferencijuotas baltymų kinazės CK2 nukreipimas į branduolinę matricą po trumpalaikio jo subvienetų ekspresijos. J Cell Biochem 74:127–134.

CrossRefMedline

Zachariou V, Bolanos CA, Selley DE, Theobald D, Cassidy MP, Kelz MB, Shaw-Lutchmann T, Berton O, Sim-Selley LJ, DiLeone RJ, Kumar A, Nestler EJ (2006) ΔFosB: esminis ΔFosB vaidmuo branduolyje accumbens morfino veikloje. Nat Neurosci 9:205–211.

CrossRefMedline

Straipsniai, kuriuose minimas šis straipsnis

  • Elgsenos ir struktūrinis atsakas į lėtinį kokainą reikalauja, kad „Delta“ FosB ir kalcio / kalmodulino priklausoma baltymų kinazė „Nucleus Accumbens Shell“ būtų įtraukta į priekį. Journal of Neuroscience ", 6 kovo 2013, 33(10):4295-4307
  • Striatinis pernelyg didelis {Delta} FosB ekspresija atkartoja lėtinį levodopos sukeltą netyčinį judėjimą Journal of Neuroscience ", 26 gegužės 2010, 30(21):7335-7343
  • Abstraktus
  • Visas tekstas
  • Visas tekstas (PDF)
  • Abstraktus
  • Visas tekstas
  • Visas tekstas (PDF)
  • Abstraktus
  • Visas tekstas
  • Visas tekstas (PDF)
  • Abstraktus
  • Visas tekstas
  • Visas tekstas (PDF)
  • Transkripcijos priklausomybės mechanizmai: {Delta} FosB vaidmuo Karališkosios draugijos filosofiniai sandorai B: biologiniai mokslai, 12 spalio 2008, 363(1507):3245-3255
  • Nuolatinis pažeidžiamumas dėl metamfetamino ieškojimo elgsenos atkūrimo glijų ląstelių linijos išvestinių neurotrofinių faktorių mutantų pelėms FASEB leidinys, 1 liepa 2007, 21(9):1994-2004
  • Aktyvatoriaus baltymų-1 transkripcijos faktorius kvėpavimo epitelio karcinogenezėje Molekuliniai vėžio tyrimai, 1 vasario 2007, 5(2):109-120