Serumo atsako faktorius skatina atsparumą lėtiniam socialiniam stresui, indukuodamas DeltaFosB (2010).

PASTABOS: Nors tiek stresas, tiek piktnaudžiavimo narkotikais, tiek tam tikri natūralūs atlygiai sukelia DeltaFosB kaupimąsi, stresas aktyvina skirtingas ląsteles ir vėliau skirtingus receptorius ir genus. Kitaip tariant, priklausomybės ir atsparumas stresui remiasi iš esmės skirtingais mechanizmais

Visiškas tyrimas

J Neurosci. 2010, 27, 30 (43): 14585-92.

Vialou V, Maze I, Renthal W, LaPlant QC, Watts EL, Mouzon E, Ghose S, Tamminga CA, Nestler EJ.

Šaltinis

„Fishberg“ neurologijos katedra, Sinajaus kalno medicinos mokykla, Niujorkas, Niujorkas 10029, JAV.

Abstraktus

Molekuliniai mechanizmai, kuriais grindžiami streso ir narkotikų sukeltos neuronų adaptacijos, yra nepakankamai suprantami. Viena molekulė, susijusi su tokiais pritaikymais, yra ΔFosB, transkripcijos faktorius, kaupiantis graužikų branduolyje accumbens (NAc), kuris yra pagrindinis smegenų atlygio regionas, reaguojant į chronišką stresą arba pakartotinį piktnaudžiavimo narkotikais poveikį. Tśie aplinkos stimulai ΔFosB indukcijos kontroliuojantys transkripcijos mechanizmai išlieka nepastebimi. Čia mes identifikuojame nuo aktyvumo priklausomą transkripcijos faktorių, serumo atsako faktorių (SRF), kaip naują priešpriešinį streso, bet ne kokainas-, sukėlė ΔFosB. SRF yra sumažintas tiek depresija sergančių pacientų, tiek ir chroniškai veikiančių socialinio pralaimėjimo streso NAC, metu. Šis atsparus gyvūnams nenaudojamas. Naudojant indukuojamą mutagenezę parodome, kad streso tarpininkaujanti ΔFosB indukcija, kuri vyksta daugiausia elastinėse pelėse, priklauso nuo SRF ekspresijos šioje smegenų srityje. Be to, specifinis SRF genetinis ištrynimas NAc skatina įvairius prodepresantus ir proanxiety tipo fenotipus, o gyvūnai tampa jautresni žalingam lėtinio streso poveikiui. Priešingai, mes parodome, kad, reaguodama į lėtinį kokaino poveikį, SRF neturi vaidmens ΔFosB kaupimuose NAc. Be to, NAF specifinis SRF išjungimas neturi jokio poveikio kokaino sukeltam elgesiui, nurodydamas, kad lėtinis socialinio pralaimėjimo stresas ir pakartotinis kokaino poveikis reguliuoja ΔFosB kaupimąsi ir elgesio jautrumą nepriklausomais mechanizmais.

Įvadas

Svarbiausias smegenų atlyginimų regionas yra branduolys accumbens (NAc), svarbus integruojant jutimo ir pažinimo įvesčius, kurie skatina motyvaciškai svarbų elgesį reaguojant į aplinkos stimulus („Nestler“ ir „Carlezon“, „2006“, „Sesack“ ir „Grace“, 2010). NAc taip pat buvo susijęs su elgesio sutrikimais, susijusiais su narkomanija ir depresija. Taigi, įrodyta, kad NAc nukreipimas į gilų smegenų stimuliavimą palengvina depresiją ir priklausomybę panašų elgesį tiek žmonėms, tiek graužikams (Schlaepfer ir kt., 2008; Vassoler ir kt., 2008; Heinze ir kt., 2009; Kuhn et al. al., 2009).

Pakartotinis piktnaudžiavimo ar streso poveikis narkotikams sukelia pasikeitusius genų ekspresijos modelius NAc, galimai priklausantį nuo priklausomybės ir depresijos chroniškumo (Berton ir kt., 2006; Krishnan ir kt., 2007; Maze ir kt., 2010; Vialou ir kt. ., 2010). Įdomu tai, kad transkripcijos faktorius ΔFosB, fosB geno skilimo produktas, kaupiasi NAc, reaguojant į pakartotinį vaisto ar streso poveikį (Nestler, 2008; Perrotti ir kt., 2008; Vialou ir kt., 2010). ΔFosB buvo pasiūlytas kaip galimas molekulinis jungiklis, nukreipiantis perėjimą nuo rekreacinio narkotikų vartojimo į chroniškai priklausomą būseną (Nestler ir kt., 1999; McClung ir kt., 2004; Renthal et al., 2009), nes jo kaupimasis NAc padidina atlyginti atsakymus į keletą piktnaudžiavimo narkotikų. Neseniai buvo išaiškintas ΔFosB indukcijos vaidmuo NAc po lėtinio socialinio pralaimėjimo streso (Nikulina ir kt., 2008; Vialou ir kt., 2010): ΔFosB skatina aktyvų atsaką į stresinius stimulus ir padidina atsparumą. Nors ΔFosB indukcija vyksta priklausomai nuo stimulo, mechanizmai, atsakingi už narkotikų ir streso sukeltą ΔFosB kaupimąsi NAc, lieka nežinomi.

Serumo atsako faktorius (SRF) yra transkripcijos faktorius, reikalingas kelių neatidėliotinų ankstyvųjų genų, įskaitant c-fos, fosb, Egr1 ir Arc, nuo aktyvumo priklausomai transkripcijos aktyvacijai (Knöll ir Nordheim, 2009). Naujausi tyrimai parodė SRF poveikį morfologinėms ir citoarchitektūrinėms neuronų savybėms, įskaitant sinapsinio aktyvumo reguliavimą ir grandinių formavimąsi suaugusių smegenyse (Knöll ir Nordheim, 2009). Šios išvados paskatino mus ištirti, ar SRF funkciškai reguliuoja lėtinis piktnaudžiavimo ar streso poveikis, taip pat galimą tokio reguliavimo poveikį ΔFosB indukcijai šiomis sąlygomis.

Čia mes apibūdiname naują mechanizmą, kurį taikant SRF sumažinimas NAc skatina prodepresantus ir anksiogeninius fenotipus, galų gale padidindamas gyvūno pažeidžiamumą kenksmingam lėtinio streso poveikiui.. Šį poveikį iš dalies sąlygoja stresą patyrusių gyvūnų ΔFosB indukcijos praradimas. Pastebėtas SRF ir ΔFosB ekspresijos sumažėjimas postmortem NAc audiniuose, gautuose iš depresijos turinčių pacientų, patvirtina mūsų išvadų svarbą žmogaus depresijai. Įdomu tai, kad šis mechanizmas, kontroliuojantis ΔFosB kaupimąsi, yra būdingas stresui: lėtinis kokaino poveikis neturi įtakos SRF ekspresijai, SRF išbraukimas iš NAc neturi įtakos ΔFosB kaupimuisi po lėtinio kokaino poveikio, o toks SRF ištrynimas neturi jokio poveikio kokainui. sukeltas elgesys. Ši nauja SRF ir ΔFosB sąveika streso kontekste gali būti svarbus homeostatinis mechanizmas, reguliuojantis asmens jautrumą lėtiniam stresui.

Medžiagos ir metodai

gyvūnai

Aštuonių savaičių amžiaus C57BL / 6J pelės (Jackson Laboratory) buvo naudojamos visuose elgesio ir biocheminiuose eksperimentuose. Visi gyvūnai buvo pripratę prie gyvūnų įrenginio mažiausiai prieš 1 savaitę prieš eksperimentus ir buvo palaikomi 23 – 25 ° C, esant 12 h šviesos / tamsos ciklui (šviesos įsijungė iš 7: 00 AM į 7: 00 PM) su ad libitum prieiga prie maisto ir vandens. Eksperimentai buvo atlikti pagal Neurologijos draugijos ir institucinio gyvūnų priežiūros ir naudojimo komiteto rekomendacijas Sinajaus medicinos mokykloje.

Kokaino eksperimentams buvo naudojamos [Western blotting ir kiekybinės chromatino imunopretipitacijos (ChIP)], 8-10 savaitės vyrai C57BL / 6J. Gyvūnai suleido septynis intraperitoninius arba fiziologinius tirpalus, arba kokainą (20 mg / kg kokaino-HCl; Sigma). Po galutinio gydymo pelės buvo naudojamos 24 h. Elgsenos eksperimentams pelės buvo atskirai laikomos posturgeryje ir buvo gydomos 10 mg / kg (lokomotorinis jautrinimas) arba 7.5 mg / kg (sąlyginė vieta) kokaino-HCl, kaip aprašyta žemiau.

Srffl / fl pelės buvo sukurtos, kaip aprašyta anksčiau (Ramanan ir kt., 2005). NAc-specifinis Srf išskyrimas buvo pasiektas per stereotaksinę injekciją ir vėlesnę Cre rekombinazės (Cre) pernelyg ekspresiją, sulietą su žaliu fluorescentiniu baltymu (GFP), naudojant adeno asocijuotus virusus (AAV). Buvo naudojamas „ne“ pašalinantis „Cre“. AAV-GFP švirkščiama vietoj AAV-Cre-GFP su Srffl / fl pelėmis kaip kontrolė. Trumpai tariant, pelės buvo anestezuotos naudojant ketamino (10 mg / kg) ir ksilazino (10 mg / kg) mišinį su tokiomis stereotaksinėmis koordinatėmis, kurios buvo naudojamos virusui tiekti: + 1.6 (priekinis / užpakalinis), + 1.5 (šoninis), - 4.4 (nugaros / ventralinis) 10 ° kampu nuo vidurinės linijos (palyginti su bregma). Iš viso 0.5 μl išgryninto viruso per 5 min. Laikotarpį (0.1 μl / min) buvo pristatytas dvišaliu būdu, po to 5 min. Pelėms buvo atliktos 2 savaitės po operacijos, kai viruso ekspresija buvo maksimali, o virusų injekcijos vietos buvo patvirtintos visiems gyvūnams, naudojant standartinius histologinius metodus. Virusinės medijuojamos Cre ekspresijos efektyvumas buvo patvirtintas imunohistochemija ir atvirkštinės transkriptazės PCR Srf, atliktas su mikroelementais NAc štampais iš gyvūnų, kuriems buvo suteiktas AAV-Cre-GFP ir AAV-GFP į NAc. AAV-GFP ir AAV-Cre-GFP virusai buvo sukurti kaip aprašyta anksčiau (Maze ir kt., 2010).

Elgesio procedūros

Socialinis pralaimėjimo stresas.

C57BL / 6J pelėms buvo atlikta lėtinė socialinė pralaimėjimo įtampa 10 iš eilės einančioms dienoms, kaip aprašyta anksčiau (Berton ir kt., 2006; Krishnan ir kt., 2007; Vialou ir kt., 2010). Trumpai tariant, kiekviena pelė buvo paveikta nepažįstamą ir agresyvią vyrų CD1 pensininką pelę 5 min per dieną. Po tiesioginės sąveikos su CD1 agresoriumi, gyvūnai buvo įterpti į gretimą tos pačios narvelės skyrių kitam 24 h jutimo, bet ne fizinio kontakto. Kontroliniai gyvūnai buvo laikomi lygiavertėse narvuose, bet su tos pačios padermės nariais. Socialinės sąveikos tyrimai buvo atlikti 24 h po paskutinės pralaimėjimo dienos.

Socialinis vengimas nepažįstamo CD1 patino patino buvo įvertintas pagal paskelbtus protokolus (Berton ir kt., 2006; Krishnan ir kt., 2007; Vialou ir kt., 2010). Eksperimentinė pelė pirmą kartą buvo įvesta į lauką, kuriame buvo tuščias vielos tinklo narvelis, 2.5 min. Antrojo seanso metu į laidinį narvą buvo įvestas nepažįstamas CD1 vyrų patinas. Buvo matuojamas laikas, praleistas sąveikos zonoje (8 cm pločio koridorius, supantis narvą). Nugalėtų pelių atskyrimas į jautrius ir atsparius pogrupius buvo atliktas taip, kaip aprašyta anksčiau (Krishnan et al., 2007; Vialou et al., 2010). Kadangi dauguma kontrolinių pelių daugiau laiko praleido sąveikaudami su socialiniu taikiniu nei su tuščiu taikinio gaubtu, sąveikos santykis 100 (lygus laikas praleistas sąveikos zonoje, kai nėra socialinio taikinio) buvo nustatytas kaip riba. Pelės, kurių balai buvo <100, buvo pažymėtos kaip jautrios, o tos, kurių balai buvo ≥100, buvo pažymėtos kaip atsparios. Išsami elgesio, biocheminė ir elektrofiziologinė analizė patvirtina šių skirtingų jautrių ir atsparių pogrupių pagrįstumą (Krishnan et al., 2007; Wilkinson et al., 2009; Vialou et al., 2010).

Siekiant ištirti Srffl / fl pelių pažeidžiamumą socialinio pralaimėjimo stresui, pelės, kurios buvo švirkštos dvišaliu būdu su AAV-GFP arba AAV-Cre-GFP, tą pačią dieną buvo nugalėtos trimis nuosekliais, o vėliau išbandytos dėl socialinės sąveikos 24 h vėliau. Ši submaximalinė pralaimėjimo procedūra buvo patvirtinta anksčiau, kad būtų atskleistos jautrumo fenotipai po genetinių manipuliacijų (Krishnan ir kt., 2007; Vialou ir kt., 2010).

Išmoktas bejėgiškumas.

Su AAV-GFP arba AAV-Cre-GFP per daug ekspresuojančios Srffl / fl pelės buvo išbandytos, kaip aprašyta anksčiau (Berton ir kt., 2007). Trumpai tariant, pelės buvo veikiamos su pertrūkiais, neišvengiamais pėdų sukrėtimais 1 h per 2 sekos dienas (0.45 mA, 5 s trukmė). Bandymo dieną pelės buvo vėl įdėtos į 15 iš eilės ištrūkimo bandymus. Kiekvieno tyrimo metu buvo perduodamas nuolatinis šokas, o pelėms buvo suteikta galimybė pabėgti, patekus į gretimą neelektrinį skyrių. Sėkmingai pabėgus, durys buvo automatiškai uždarytos ir užregistruota pabėgimo latencija. Kai pelės nepasitraukė per 25 s, bandymas buvo nutrauktas ir užregistruotas kaip gedimas. Ankstesni tyrimai parodė, kad viruso ekspresija NAc ir kituose regionuose neturi jokio poveikio bazinės linijos evakuacijos elgesiui be streso (Newton ir kt., 2002; Berton ir kt., 2007).

Lokomotorinis jautrinimas.

Praėjus dviem savaitėms po AAV-GFP arba AAV-Cre-GFP injekcijos NAra viduje, Srffl / fl pelėms buvo atliktas lokomotorinis sensibilizavimas. Pelės buvo pripratintos prie judėjimo arenos 30 min per dieną 4 d. Po pripratimo gyvūnams į pilvaplėvės ertmę įšvirkščiama 10 mg / kg kokaino-HCl ir dedama į judėjimo dėžes. Gyvūnų judėjimo aktyvumas buvo užfiksuotas naudojant fotobangų sistemą (San Diego Instruments), nes ambulatorinis pluoštas nutrūko 30 minučių per dieną. Lokomotorinis jautrinimas buvo užfiksuotas per 6 d.

Reguliuojamos vietos nustatymas.

Vietos kondicionavimo procedūra buvo atlikta taip, kaip aprašyta anksčiau (Maze et al., 2010), su šiomis modifikacijomis. Trumpai tariant, praėjus 18 dienų po AAV-GFP arba AAV-Cre-GFP infuzijų NAr viduje Srffl / fl pelėse, gyvūnai buvo dedami į kondicionavimo kameras, kurias sudarė trys kontekstiniu požiūriu skirtingos aplinkos. Tyrimas nebuvo įtrauktas į peles, kurios pirmenybę teikė bet kuriai iš dviejų kondicionavimo kamerų (<10% visų gyvūnų). Kondicionavimo grupės buvo dar labiau subalansuotos, kad prisitaikytų prie vis dar egzistuojančio kameros šališkumo. Vėlesnėmis dienomis gyvūnams buvo suleistas fiziologinis tirpalas ir po 30 minučių uždarytas vienoje kameroje po pietų, po to suleistas kokainas (7.5 mg / kg, ip) ir kitą dieną 30 min. Uždaryti į kitą kamerą, t. Y. du asociacijos mokymo etapai vienam gydymui (du fiziologinio tirpalo ir du kokaino poros). Tyrimo dieną pelės buvo negrąžintos 20 minučių atgal į aparatą ir išbandytos, kad būtų įvertintas pirmenybė šonams. Judėjimo reakcija į kokainą buvo vertinama spindulių pertraukomis kokaino suporuotose kamerose, kad būtų užtikrintas gydymo narkotikais efektyvumas. Visoms grupėms buvo įvertintas pradinis judėjimas reaguojant į fiziologinį tirpalą, siekiant užtikrinti, kad virusinis gydymas nepakenktų judesiui.

Kiti elgsenos tyrimai.

Srffl / fl pelės buvo išbandytos atviro lauko, šviesos / tamsos ir priverstinio plaukimo bandymuose, remiantis paskelbtais protokolais (Vialou ir kt., 2010). Pelių aktyvumas atvirame lauke buvo užfiksuotas 5 min naudojant vaizdo sekimo sistemą (Ethovision) raudonos šviesos sąlygomis. Šviesos ir tamsos bandymui pelėms buvo leista laisvai ištirti dviejų kamerų dėžę, kurią sudarė viena didelė apšviesta arena, prijungta prie mažesnės uždaros arenos. Pelės buvo išbandytos 5 min. Laikotarpiu, kad būtų galima įvertinti, kiek laiko praleido bet kurioje korpuse. Atviro lauko ir šviesos / tamsos bandymuose vidurio ir šviesos arenoje praleistas laikas buvo vertinamas kaip atvirkštinis su nerimu susijusių atsakymų indeksas. 1 priverstinio plaukimo bandymas buvo atliktas 5 min. Padidėjęs judėjimo laikas priverstinio plaukimo bandymo metu buvo interpretuojamas kaip prodepresantinis elgesys. 1 d priverstinio plaukimo bandymas pelėse buvo plačiai naudojamas ir patvirtintas kaip prognozavimo galiojimo matas, nes antidepresantų terapija mažina judrumo laiką.

Imunohistochemistry

Srffl / fl pelės buvo anestezuotos ir perfuzuojamos intrakardialiai su 4% paraformaldehidu / PBS. Smegenys buvo pašalintos ir saugomos 30% sacharozės / PBS. Koroniniai pjūviai (30 μm) buvo nupjauti ant užšalimo mikrotomo ir apdoroti imunohistocheminėms analizėms. Srffl / fl išjungimo patvirtinimas buvo atliktas naudojant polikloninį antikūną, nukreiptą prieš SRF (1 / 2000; Santa Cruz Biotechnology). Cre ekspresija buvo patvirtinta per GFP (vištienos polikloninį, 1 / 8000, Aves Labs) ekspresiją išskaidytose smegenyse, nes Cre yra sujungtas su GFP. AFosB indukcijos kiekybiniam įvertinimui po socialinio pralaimėjimo streso Srffl / fl knock-out pelėse AFosB buvo aptiktas naudojant triušio polikloninį antikūną, sukeltą prieš baltymo N-galinį regioną (1 / 1000; Santa Cruz Biotechnology). Vaizdai buvo paimti konfokaliniu mikroskopu (20 × padidinimas; Zeiss). GFP-imunopozitinių ląstelių skaičius, apskaičiuotas kaip neigiamas ir teigiamas ΔFosB imunoreaktyvumui, kiekvienam gyvūnui buvo kiekybiškai įvertintas, o kiekvienam gyvūnui apskaičiuotos vidutinės vertės. Kiekvienas gyvūnas buvo laikomas individualiu stebėjimu statistinei analizei.

Žmogaus postmorteminis NAc audinys

Žmogaus pomirtinis smegenų audinys buvo gautas iš Dalaso smegenų kolekcijos, kur audiniai surenkami iš Dalaso medicinos egzaminuotojų biuro ir Teksaso universiteto (UT) pietvakarių audinių transplantacijos programos, gavus artimiausio giminės sutikimą. Audiniai buvo analizuojami iš vyrų ir moterų pagal amžių, pomirtinį intervalą, RNR vientisumo skaičių (RIN) ir pH. Specifiniai agoniniai veiksniai, įskaitant komą, hipoksiją, pireksiją, priepuolius, dehidraciją, hipoglikemiją, daugybinių organų nepakankamumą ir neurotoksinių medžiagų nurijimą mirties metu, įtakoja RNR vientisumą smegenų audiniuose po mirties (Tomita ir kt., 2004). Mes naudojome agoninio faktoriaus skalę (AFS), kad apibūdintume audinių mėginius kiekvienoje iš šių aštuonių sąlygų. Agoninio faktoriaus nebuvimui buvo priskirtas 0 balų ir jo buvimas buvo įvertintas kaip 1, kad bendras AFS rezultatas būtų nuo 0 iki 8. Audiniai, kurių agoniniai balai yra 0 arba 1, atspindi geros kokybės mėginius; atvejų demografija pateikta 1 lentelėje. Puiki audinių kokybė buvo patvirtinta didelėmis RIN reikšmėmis. Atvejai buvo standartiškai išpjaustyti prieš užšaldant -40 ° C izopentane ir laikant -80 ° C temperatūroje; tolesnis NAc skrodimas buvo atliktas sušalusiame audinyje. UT Pietvakarių institucinė peržiūros taryba peržiūrėjo ir patvirtino šio audinio surinkimą tyrimams. Vėliau buvo atliktas tiesioginis informatorių interviu apie kiekvieną depresijos atvejį, kuriame buvo dokumentuojama informacija apie ligos ligą; dviejų tyrimų psichiatrai, naudodamiesi DSM-IV kriterijais, nustatė bendrą depresijos sutrikimo diagnozę. Nė viename iš šiame tyrime nurodytų atvejų kraujo toksikologiniai ekranai nebuvo vertinami dėl piktnaudžiavimo narkotikų, alkoholio ar kitų receptinių vaistų, išskyrus antidepresantus. Nepaisant gydymo antidepresantais, visi tiriamieji mirties metu buvo kliniškai prislėgti. Audinių mėginiai analizei buvo išleisti aklinai.

1 lentelė.

Demografiniai duomenys apie žmogaus postmorteminį tyrimą

Western blotting

Žmogaus ir pelės NAc mėginiai buvo apdoroti, kaip aprašyta anksčiau (Maze ir kt., 2010). Sušaldyti audiniai buvo ultragarsuojami 5 mM HEPES lizės buferyje, turinčiame 1% SDS su proteaze (Roche) ir fosfatazės inhibitoriais (Sigma). Baltymų koncentracijos buvo nustatytos naudojant Dc baltymų tyrimą (Bio-Rad). Vienodas baltymų mėginių kiekis buvo paveiktas SDS-PAGE ir Western blotting. Vakarų blotai buvo išbandyti naudojant antikūną prieš SRF (1 / 2000; Santa Cruz biotechnologija) arba GAPDH (1 / 1500; Abcam) ir tada buvo nuskaityti ir kiekybiškai įvertinti naudojant „Odyssey“ vaizdavimo sistemą (Licor).

RNR išskyrimas ir kiekybinė PCR

RNR išskyrimas, kiekybinis PCR (qPCR) ir duomenų analizė buvo atlikti kaip aprašyta anksčiau (Maze ir kt., 2010; Vialou ir kt., 2010). Trumpai tariant, RNR buvo išskirta su TriZol reagentu (Invitrogen) ir toliau valoma su Qiagen RNAeasy mikro rinkiniais. Nustatyta, kad visi RNR mėginiai turi 260 / 280 ir 260 / 230 reikšmes ≥1.8. Atvirkštinė transkripcija buvo atlikta naudojant „iScript“ („Bio-Rad“). qPCR naudojant SYBR žalia (Quanta) buvo atlikta su Applied Biosystems 7900HT RT PCR sistema su tokiais ciklo parametrais: 2 min 95 ° C; 40 ° C 95 ciklus 15 s, 59 ° C 30 s, 72 ° C 33 s; ir laipsniškai šildo iki 95 ° C, kad sukurtų disociacijos kreives, patvirtinančias atskirus PCR produktus. Duomenys buvo analizuojami lyginant gydymo būklės C (t) reikšmes (kontrolė ir jautrios arba elastingos pelės, arba žmogaus kontrolė vs depresija) su ΔΔC (t) metodu (Tsankova ir kt., 2006). ΔFosB qPCR gruntai: foward, AGGCAGAGCTGGAGTCGGAGAT ir atvirkštiniai, GCCGAGGACTTGAACTTCACTCG.

ChIP

ChIP buvo atliktas taip, kaip aprašyta anksčiau (Maze ir kt., 2010) dėl sujungtų dvišalių NAc štampų iš kontrolinių, jautrių ir elastingų pelių (keturi 14 matuokliai / pelės) 1 h po paskutinės pralaimėjimo patirties ir iš druskos ir kokaino. gydyti gyvūnai 24 h po galutinio gydymo. Audinys buvo susietas su 1% formaldehidu. Vėliau fiksavimas buvo nutrauktas naudojant gliciną, o audiniai buvo plaunami ir laikomi -80 ° C temperatūroje iki naudojimo. Sheared chromatin buvo inkubuojamas per naktį su anti-SRF antikūnu (Santa Cruz Biotechnology), anksčiau susijusią su magnetiniais karoliukais (Dynabeads M-280; Invitrogen). Po atvirkštinio kryžminimo ir DNR gryninimo, SRF surišimas su fosb promotoriumi buvo nustatytas qPCR, naudojant pradmenis, apimančius fosbo promotoriaus regioną, turintį dvi serumo atsako elementų surišimo vietas. SRF nuleidimai buvo žymiai praturtinti, palyginti su kontroliuojant be antikūnų. Pelės fosbo geno promotoriaus pradmenys: pirmyn, CCCTCTGACGTAATTGCTAGG ir atvirkštinis, ACCTCCCAAACTCTCCCTTC.

Statistinės analizės

Biocheminėje ir elgesio analizėje buvo naudojamos vienpusės ANOVA, kad būtų galima palyginti kontrolinių, imlių ir atsparių pelių vidurkius. Dviejų krypčių ANOVA buvo naudojami palyginti ΔFosB indukciją pagal socialinį pralaimėjimą Srf vietinėse išmuštose pelėse, taip pat palyginti Srf išmušimo efektą išmoktuose bejėgiškumo ir judėjimo motorinio jautrinimo protokoluose. Studentų t testai buvo naudojami norint palyginti vidutines Srf išjungimo įtakos ΔFosB indukcijai ir tarp grupių žmogaus pomirtinio audinio ir pelės ChIP analizę. Skirtumai tarp eksperimentinių sąlygų buvo laikomi statistiškai reikšmingais, kai p ≤ 0.05.

rezultatai

SRF ir ΔFosB ekspresija žmogaus depresijoje ir socialiai nugalėtose pelėse

Norėdami ištirti galimą SRF vaidmenį vystant į depresiją panašų elgesį, pirmiausia įvertinome SRF baltymų ekspresiją po mirties patyrusių žmonių depresijoje. Depresija sergančių asmenų rodikliai žymiai sumažino SRF lygį NAc, palyginti su jų amžiaus grupėmis (t (19) = 1.9; p <0.05) (1A pav.). Atsižvelgdami į SRF vaidmenį reguliuojant nuo aktyvumo priklausančią betarpišką ankstyvą genų ekspresiją (Ramanan ir kt., 2005), mes iškėlėme hipotezę, kad SRF gali dalyvauti kontroliuojant ΔFosB ekspresiją šiame smegenų regione. Patvirtindami šią hipotezę, mes pastebėjome, kad Δfosb mRNR lygis taip pat buvo žymiai sumažėjęs depresija sergančių žmonių NAc (t (16) = 1.8; p <0.05) (1B pav.). Tai atitinka naujausius nustatytus sumažėjusio ΔFosB baltymo kiekio nustatymus ir šiomis sąlygomis (Vialou ir kt., 2010).

1 pav.

Lėtinė streso sukelta SRF represija koreliuoja su sumažėjusia ΔFosB transkripcija NAc. A, B, Postmortem žmogaus depresija sergantiems pacientams nustatytas sumažėjęs SRF baltymo lygis (n = 10 / grupė; A) ir Δfosb mRNR ekspresija NAc (n = 8 / grupė; B). C, pelės, patyrusios lėtinį (10 d) socialinio pralaimėjimo stresą, buvo sugrupuotos į jautrius ir atsparius pogrupius. D, lėtinis socialinio pralaimėjimo stresas sumažina SRF baltymų kiekį jautrių pelių, bet ne atsparių pelių NAc, palyginti su kontrolinėmis grupėmis praėjus 24 valandoms po socialinės sąveikos testo, parodyto C. E, ΔfosB mRNR koncentracijos NAc nepakitusios jautrioms pelėms, tačiau reikšmingai reguliuojami atspariems gyvūnams (n = 7–15 / grupė). F, SRF baltymai padidina prisijungimą prie fosb geno promotoriaus po lėtinio socialinio pralaimėjimo streso tik tampriose, o ne jautriose pelėse (n = 5 / grupė). Rodomi duomenys išreiškiami kaip vidutinis ± SEM (pateikiami kaip klaidų juostos). Kon., Kontrolė; Dep., Prislėgtas; Sus., Imlus; Res., Atsparus. * p <0.05, palyginti su kontrole; *** p <0.001, palyginti su kontrole; # p <0.05, palyginti su imliaisiais; ## p <0.01, palyginti su jautriu; ### p <0.001, palyginti su jautriu.

Norėdami išplėsti šias išvadas, mes naudojome lėtinio socialinio pralaimėjimo streso protokolą pelėms. Remiantis socialinio vengimo matu, buvo akivaizdžios dvi išskiriamos nugalėtų pelių grupės, jautrios ir atsparios (Krishnan ir kt., 2007), kuriose imlių gyvūnų socialinė sąveika žymiai sumažėjo, palyginti su kontroliniais ir atspariais gyvūnais (F (2,23, 157.2) = 0.001; p <0.001; t testai su Bonferroni korekcija, jautrūs ir kontroliniai, p <0.05; atsparūs ir kontroliniai, p <0.01; atsparūs ir jautrūs, p <1) (2,32C pav.). Praėjus dviem dienoms po paskutinio pralaimėjimo epizodo, jautrios, atsparios ir nenugalėtos kontrolinės pelės buvo analizuojamos dėl SRF ekspresijos NAc. Panašiai kaip ir žmogaus depresijos atveju, SRF baltymų kiekis jautrių pelių NAc žymiai sumažėjo, palyginti su kontrolinėmis, tuo tarpu atsparių pelių NAc SRF lygis nebuvo paveiktas (F (4.7) = 0.05; p <0.05; t testai su „Bonferroni“ korekcija, imli ir kontrolinė, p <0.05; elastinga ir jautri, p <1) (XNUMXD pav.).

Toliau mes ištyrėme Δfosb iRNR išraišką šių trijų gyvūnų grupių NAc ir pastebėjome reikšmingą Δfosb raiškos padidėjimą tik atspariuose gyvūnuose, tačiau jautrioms pelėms pastebėta tendencija, tačiau reikšmingo padidėjimo nebuvo (t (14) = 2.1; p <0.05 ) (1E pav.). Norėdami toliau tirti galimą sąveiką tarp SRF lygių ir Δfosb transkripcijos, mes naudojome ChIP, kad ištirtume, ar SRF prisijungimas prie fosb geno promotoriaus buvo pakitęs po lėtinio socialinio pralaimėjimo streso atskirose jautrių ir atsparių pelių kohortose. Atsparūs gyvūnai parodė žymiai sustiprintą SRF prisijungimą prie fosb promotoriaus NAc lyginant su kontrolinėmis grupėmis (t (8) = 2.1; p <0.05), taip pat lyginant su imliomis pelėmis (t (8) = 2.0; p <0.05). Nebuvo pastebėtas skirtumas tarp kontrolinių ir imlių pelių, tikriausiai atspindintis SRF indukcijos nebuvimą imliose pelėse (1F pav.).

Norėdami patvirtinti SRF vaidmenį reguliuojant ΔFosB po lėtinio socialinio pralaimėjimo streso, Srffl / fl pelės buvo naudojamos tiriant selektyvaus SRF pašalinimo iš NAc poveikį ΔFosB indukcijai stresui. Srffl / fl pelėms buvo stereotaksiškai įšvirkštas į NA-AAV vektorius, ekspresuojančius GFP arba Cre-GFP. NAAV specifinis SRF išjungimas, kurį sukėlė AAV-Cre-GFP, buvo patvirtintas imunohistocheminiu būdu (2A pav.). Iš tiesų, SRF dažymas ir Cre ekspresija nepersidengė, o tai rodo išmušimo efektyvumą. Mikrodalintais NAc štampais nustatėme reikšmingą 50% SRF baltymų lygio sumažėjimą (t (11) = 4.3; p <0.001). Dydis greičiausiai atspindi faktą, kad audinių dalis tokiose mikrodisekcijose nėra virusiškai užkrėsta.

2 pav.

SRF tarpininkauja ΔFosB indukcijai dėl lėtinio socialinio pralaimėjimo streso. A, AAV-Cre-GFP injekcija į Srffl / fl pelių NAc sukelia CreF ekspresuojančiuose neuronuose SRF baltymą. AAV-GFP injekcija neturėjo pastebimo efekto. B, Toks selektyvus SRF pašalinimas iš NAc visiškai blokuoja ΔFosB indukciją NAc po lėtinio socialinio pralaimėjimo streso (n = 4 / grupė). Rodomi duomenys išreiškiami kaip vidutinis ± SEM (pateikiami kaip klaidų juostos). * p <0.05, palyginti su AAV-GFP valdymu; ** p <0.01, palyginti su AAV-GFP pralaimėjimu.

Toliau atlikome kiekybinę ΔFosB imunohistochemiją pralaimėtų Srffl / fl pelių NAc NAc viduje AAV-Cre-GFP arba AAV-GFP. Po lėtinio socialinio pralaimėjimo streso AAV-GFP švirkščiamų gyvūnų NAc reikšmingai sukėlė ΔFosB ekspresiją (viruso × gydymo sąveika, F (1,12) = 6.4; t testai su Bonferroni korekcija, kontrolė prieš nugalėjimą, p <0.05; AAV-Cre ir AAV-GFP, p <0.01). Tačiau ši indukcija nebuvo pastebėta Srffl / fl pelėms, gaunančioms AAV-Cre-GFP (2B pav.), Įrodant, kad ΔFosB indukcijai NAc lėtiniu stresu reikia SRF.

SRF kišimasis į NAc skatina prodepresijos ir proanxiety tipo fenotipus

Kadangi anksčiau buvo įrodyta, kad ΔFosB indukcija dėl lėtinio socialinio pralaimėjimo streso tarpina atsparumą (Vialou ir kt., 2010), mes iškėlėme hipotezę, kad SRF sumažinimas ir dėl to sumažėjęs ΔFosB indukcija jautriems gyvūnams gali būti neigiama adaptacija, kuri galiausiai gyvūnai, labiau pažeidžiami žalingo streso poveikio. Norėdami patikrinti šią hipotezę, mes sukėlėme vietinį NAc specifinį Srf geno ištrynimą suaugusioms Srffl / fl pelėms, kaip aprašyta aukščiau, o gautos pelės ir jų kontrolė buvo išbandyta daugelyje elgesio paradigmų, kad būtų galima įvertinti pradinę depresiją ir nerimą. kaip elgesys. Vietinis SRF pašalinimas iš NAc skatino panašų į prodepresiją efektą, išmatuotą per priverstinio plaukimo testą (t (30) = 2.5; p <0.05), taip pat anksiogeninį poveikį, išmatuotą atvirame lauke (t (38) = 1.9; p <0.05) ir šviesos / tamsos testai (t (8) = 1.9; p <0.05). Taigi, Srffl / fl pelėms, gaunančioms AAV-Cre-GFP į NAc, priverstinio plaukimo bandymo metu sumažėjo nejudrumo vėlavimas, mažiau laiko atviro lauko centre ir mažiau šviesos / tamsios dėžės šviesiame skyriuje. palyginti su AAV-GFP švirkščiamais gyvūnais (3A – C pav.). Tačiau, pašalinus SRF iš NAC, nepakito pradinis judėjimo lygis, o tai rodo, kad pastebėtas SRF išmuštų gyvūnų elgesio poveikis atsirado ne dėl bendro judėjimo aktyvumo anomalijų (3D pav.). Šie duomenys yra įdomūs atsižvelgiant į ankstesnes ataskaitas, kuriose teigiama, kad nors NAc ΔFosB reguliuoja į depresiją panašų elgesį, neatrodo, kad jis dalyvautų su nerimu susijusiose reakcijose (Vialou ir kt., 2010). Mūsų dabartinės išvados, kad SRF praradimas sukelia anksiogeninius atsakus, rodo, kad tai daro per kitus nei ΔFosB tikslus.

3 pav.

SRF pašalinimas iš NAc skatina į depresiją ir nerimą panašius fenotipus. A – C, selektyvus SRF išjungimas iš NAc, pasiektas naudojant AAV-Cre-GFP injekciją į Srffl / fl pelių NAc, sumažina latentą iki nejudrumo priverstinio plaukimo bandyme (n = 14–18 / grupė; A) ir sumažina laiką, praleistą centre, ir laiką, praleistą šviesos skyriuje atvirame lauke (B) ir šviesiai / tamsiai (C), atitinkamai (n = 5–15 / grupė). D, pelių, gavusių AAV-GFP ar AAV-Cre-GFP, NAc injekcijų atvirame lauke bazinio judėjimo aktyvumo skirtumo nepastebėta. E, F, padidėjęs jautrumas išmoktam bejėgiškumui (n = 7–8 / grupė; E) ir socialinio pralaimėjimo stresas (n = 5–6 / grupė; F), matuojamas atitinkamai ištrūkimo delsos ir socialinės sąveikos metu . Rodomi duomenys išreiškiami kaip vidutinis ± SEM (pateikiami kaip klaidų juostos). * p <0.05, palyginti su GFP, arba prieš tikslą nėra; ** p <0.01, palyginti su GFP; *** p <0.001, palyginti su GFP.

Toliau mes ištyrėme, ar SRF pašalinimas NAc taip pat padidina gyvūno pažeidžiamumą dėl žalingo pakartotinio streso poveikio. Srffl / fl pelės, suleistos AAV-Cre-GFP arba AAV-GFP į NAc, buvo tiriamos dviem depresijos modeliais, išmokta bejėgiškumo ir lėtinio socialinio pralaimėjimo streso. Išmokus bejėgiškumo, Srffl / fl gyvūnai, vartojantys AAV-Cre-GFP, padidino latentą, kad išvengtų pėdos šoko po to, kai buvo patirta neišvengiamo pėdos šoko streso (gydymas × bandymų sąveika, F (14,180) = 10.2; t testai su Bonferroni korekcija, p <0.001; AAV-Cre vs AAV-GFP, p <0.01), rodantis padidėjusį jautrumą streso sukeltam elgesio deficitui (3E pav.). Panašiai vietinis SRF pašalinimas iš NAc taip pat padidino socialinę baimę (t (10) = 1.8; p <0.05), palyginti su AAV-GFP švirkščiamais kontroliniais gyvūnais po lėtinio socialinio pralaimėjimo streso (3F pav.), Panašaus į prodepresiją.

SRF nedalyvavimas ΔFosB indukcijos ir elgesio atsakuose į kokainą

Atsižvelgiant į tai, kad ΔFosB taip pat yra indukuojamas NAc reaguojant į piktnaudžiavimo narkotikais, pavyzdžiui, kokaino, buvo įdomu išnagrinėti galimą SRF vaidmenį vykdant kokaino veiksmus. Skirtingai nuo lėtinio socialinio pralaimėjimo streso, pakartotinis kokaino poveikis nekeitė SRF baltymų ekspresijos NAc (t (14) = 0.8; p> 0.05) (4A pav.) Ir neturėjo jokio poveikio SRF prisijungimui prie fosB geno promotoriaus šiame smegenų regione (t (4) = 0.7; p> 0.05) (4B pav.). Tai rodo, kad, priešingai nei stresas, ΔFosB indukcija po lėtinio kokaino nėra tarpininkaujama per SRF. Mes tai išbandėme tiesiogiai, ištyrę, ar Srffl / fl gyvūnams, gaunantiems AAV-Cre-GFP, palyginti su AAV-GFP, į NAc pasikeitė ΔFosB kaupimasis po lėtinio kokaino. Mes nustatėme, kad SRF ištrynimas neturėjo jokio poveikio kokaino sukeltam ΔFosB kaupimui šiame smegenų regione (4 pav. C).

4 pav.

SRF praradimas neturėjo įtakos ΔFosB ar kokaino reguliuojamo elgesio kokaino indukcijai. A, B, pakartotinis kokaino ekspozicija (7 d, 20 mg / kg kokaino-HCl) neturėjo poveikio SRF baltymų ekspresijai NAc (A) arba SRF surišimu prie fosB geno promotoriaus šiame smegenų regione (B) 24 h po vaisto ekspozicija (n = 5 / grupė). C, ΔFosB kaupimasis, išmatuotas imunocitochemiškai, po lėtinio kokaino ekspozicijos neturi įtakos konkrečiam NAF išskyrimui iš SRF. D, E, Vietinis SRF ištrynimas iš NAc taip pat neturėjo poveikio lokomotoriniam aktyvumui po fiziologinio tirpalo injekcijos (d 1) dėl kokaino sukelto lokomotorinio aktyvumo ir jautrumo (n = 8 / grupė) (d 1 – 7; D) arba dėl kokaino sąlygojamos vietos pirmenybės (n = 8 / grupė; E). Rodomi duomenys yra išreikšti kaip vidurkis ± SEM (pateikiami kaip klaidų juostos).

Norėdami tęsti šią stebinančią išvadą, mes ištyrėme, ar selektyvus SRF išjungimas iš NAc keičia elgesio reakcijas į kokainą. Atsižvelgiant į tai, kad SRF nepakankamai reguliuoja ΔFosB indukciją kokainu, NAc specifinis SRF išjungimas neturėjo jokio poveikio lokomotoriniam aktyvumui, kurį sukėlė ūmus kokainas ar lokomotorinis jautrinimas, pastebėtas po pakartotinio kokaino ekspozicijos (gydymas × laiko sąveika, F (4,80) = 0.3; p> 0.05) (4D pav.). Panašiai ir NAc specifinis SRF išjungimas neturėjo įtakos kokaino sąlygotoms vietos pirmenybėms (t (14) = 0.1; p> 0.05) (4 pav. E), kuri suteikia netiesioginį kokaino atlygio matą.

Diskusija

Šiame tyrime nustatyta, kad SRF yra naujas AFosB tarpininkas NAc po chroniško socialinio pralaimėjimo streso, o SRF yra susijęs su depresijos ir nerimo požiūriu. Mes pateikiame tiesioginius įrodymus, kad lėtinis socialinio pralaimėjimo stresas mažina jautrių, bet ne atsparių gyvūnų SRF lygį NAc, ir kad šis sumažėjimas neleidžia ΔFosB indukcijai šiame smegenų regione, kurį mes parodėme, kad reikia veiksmingai susidoroti su lėtiniu stresu, ty atsparumas (Vialou ir kt., 2010). Panašus SRF ekspresijos sumažėjimas buvo nustatytas depresinių žmonių NAc, kur taip pat sumažėjo ΔFosB mRNR ir baltymų ekspresija. Priešingai, jautrių pelių NAc AFosB koncentracija nesumažėjo, nepaisant SRF sumažėjimo, kuris apima kitus transkripcijos mechanizmus, dar nežinomus, kontroliuojant ΔFosB ekspresiją. SRF priežastinis vaidmuo tarpininkaujant AFosB indukcijai NAc po lėtinio streso buvo nustatytas naudojant indukuotiną genetinį SRF išbraukimą iš šio smegenų srities. Pelių elgesio analizė su šiuo NAc-specifiniu SRF išstūmimu dar labiau paveikia SRF kaip svarbų vaidmenį vystant tiek pradinę, tiek streso sukeltą depresiją ir nerimą. Priešingai, SRF ištrynimas neturėjo įtakos ΔFosB indukcijai atsakant į lėtinį kokaino vartojimą ar kokaino elgesio poveikį. Šie atradimai patvirtina naują SRF stimulo vaidmenį reguliuojant ΔFosB indukciją ir elgesio atsakus į skirtingus aplinkos sutrikimus.

Buvo įrodyta, kad SRF pernešamas transkripcijos atsakas į sinaptinį aktyvumą, kurį daugiausia skatina padidėjęs kalcio srautas, ir padidėjęs neurotrofinis aktyvumas, ypač smegenų neurotrofinio faktoriaus (BDNF) atveju (Bading ir kt., 1993; Xia ir kt., 1996; Johnson ir kt., 1997; Chang ir kt., 2004; Kalita ir kt., 2006; Knöll ir Nordheim, 2009). Tai kelia įdomų klausimą, kodėl SRF yra reguliuojamas NAc jautrių, bet ne atsparių pelių po lėtinio socialinio pralaimėjimo streso. Tikėtina, kad šis diferencialinis reguliavimas nesusijęs su dopamino arba BDNF signalizavimu, nes jautrios pelės rodo padidėjusius BDNF baltymų lygius ir padidino pasroviui BDNF signalizaciją NAc, taip pat padidėjusį ventralinio tegmental zonos (VTA) dopamino neuronų, kurie innervuoja NAc, sprogimą, kadangi atsparūs gyvūnai turi normalaus BDNF signalizacijos ir VTA šaudymo spartų lygius (Krishnan ir kt., 2007). Alternatyvi galimybė yra tai, kad SRF ekspresija yra slopinama NAc, reaguojant į pasikeitusį šio smegenų srities glutamaterginį inervavimą, kuris, kaip mes parodėme, yra skirtingai reguliuojamas jautriose ir elastingose ​​pelėse (Vialou ir kt., 2010). Reikia toliau dirbti, kad būtų galima tiesiogiai ištirti šį ir kitus galimus mechanizmus.

Naujausi tyrimai, naudojant genomo ir kitus metodus, rodo, kad neur5 – 10% SRF tikslinių genų neuronuose yra tiesioginiai ankstyvieji genai (Philippar ir kt., 2004; Ramanan ir kt., 2005; Etkin ir kt., 2006; Nordheim, 2009). Tai atitinka mūsų duomenis, rodančius kritinį SRF vaidmenį indukuojant ΔFosB, kuris yra trumpalaikis fosfo ankstyvojo geno produktas, dėl lėtinio streso. Įdomu tai, kad daugelyje SRF tikslinių genų, identifikuotų šiuose įvairiuose tyrimuose, taip pat yra žinomi AFosB tikslai NAc (Kumar ir kt., 2005; Renthal ir kt., 2008, 2009; Maze ir kt., 2010). Tarp šių dažniausiai reguliuojamų genų yra keletas, kurie, kaip žinoma, reguliuoja neuroninį citozeloną (pavyzdžiui, Cdk5, Arc ir Actb). Tai, savo ruožtu, atitinka pranešimus, kad SRF įtakoja aktino dinamiką ir neuronų judrumą keliuose neuronų ląstelių tipuose (Alberti ir kt., 2005; Ramanan ir kt., 2005; Knöll ir kt., 2006), o ΔFosB yra žinomas paveikia dendritinį stuburo išplitimą NAc neuronuose (Maze ir kt., 2010). Tokie bendri funkciniai parametrai gali atspindėti suderintus SRF poveikius, kartu su ΔFosB indukcija, veikiantys keletą bendrų tikslinių genų, kurie turi įtakos neuronų morfologijai ir galiausiai sudėtingam elgesiui.

Įrodyta, kad SRF vaidina svarbų vaidmenį reguliuojant sinaptinį plastiškumą ir nuo neuronų aktyvumo priklausomą genų ekspresiją ir elgesį. Pavyzdžiui, SRF priklausomas artimų ankstyvųjų genų indukcijos praradimas, reaguojant į savanorišką naujų aplinkų tyrimą arba neuroninį aktyvavimą elektrokonvulsiniais priepuoliais, siejamas su ilgalaike Srf mutantų hipokampo sinapsinio potencialo sumažėjimu (Ramanan et al. , 2005, Etkin ir kt., 2006). Be to, įrodyta, kad SRF slopinimas hipokampe sukelia ilgalaikio sinaptinio depresijos trūkumą, greitą ankstyvą geno ekspresiją, kurią sukelia naujas kontekstas, ir sutrikusią pripratimą tiriant naują aplinką (Etkin ir kt., 2006). Šie duomenys įrodo SRF svarbą gyvūno gebėjimui tinkamai prisitaikyti prie aplinkos sutrikimų, kaip minėta anksčiau, kai mokomasi priprasti prie naujos aplinkos, arba, jei prisitaiko prie neigiamų stresinių dirgiklių, kad būtų išvengta streso paskelbimo. sukeltas elgesio deficitas, kaip ir mūsų dabartiniame tyrime. Taigi mes pastebime, kad gyvūnai, turintys SRF ekspresijos deficitą, reaguoja į jautrių asmenų socialinį pralaimėjimo stresą arba tiesioginį SRF nukritimą, rodo padidėjusį depresinį ir nerimo būdą. Atsižvelgiant į tai, kad depresija sergantiems žmonėms taip pat sumažėja SRF lygis NAc, galima įsivaizduoti, kad SRF vaidina pagrindinį vaidmenį reguliuojant asmens gebėjimą teigiamai prisitaikyti prie neigiamų aplinkos dirgiklių, iš dalies reguliuojant ΔFosB išraišką NAc.

SKIRTINGI MECHANIZMAI: PRIEŽIŪRA VS STRESO ATSPARUMAS

Šio tyrimo nustebinantis faktas yra tas, kad nors SRF yra reikalingas ΔFosB kaupimui NAc, atsakant į lėtinį stresą, jis nėra būtinas ΔFosB indukcijai toje pačioje smegenų srityje atsakant į lėtinį kokainą. Lygiai taip pat, SRF nėra reikalingas normaliam elgsenos atsakui į vaistą. Šie duomenys rodo, kad, nepaisant to, kad ΔFosB yra sukeltas NAc, reaguojant į daugelio tipų dirgiklius (Nestler ir kt., 1999; Nestler, 2008), atrodo, kad yra skirtingi molekuliniai keliai, lemiantys ΔFosB indukciją. Vienas iš galimų šių atradimų paaiškinimų yra iš dalies skirtingi ląstelių tipai, rodantys ΔFosB kaupimąsi reaguojant į stresą ir kokainą. Lėtinis stresas sukelia ΔFosB maždaug vienodai dviejose pagrindinėse NAc vidutinio spyglių neuronų, kurie išreiškia daugiausia D1 ir D2 dopamino receptorius, pogrupiuose, o lėtinis kokainas sukelia AFosB daugiausia D1 + neuronuose (Kelz ir kt., 1999; Perrotti ir kt., 2004; Perrotti ir kt., 2; . Taigi gali būti, kad SRF priklausomi keliai gali būti svarbūs ΔFosB indukcijai DXNUMX + neuronuose. Vis dėlto tai nepaaiškintų pilno ΔFosB indukcijos praradimo SRF išmuštose pelėse po lėtinio streso, nes indukcija vyksta abiejuose neuronų potipiuose. Alternatyvus paaiškinimas yra tas, kad lėtinis stresas ir lėtinis kokainas daro įtaką atskiroms intracelulinėms signalizavimo kaskadoms, atsižvelgiant į jų skirtingus veikimo būdus NAc neuronams, su lėtiniu stresu, galbūt dirbdami per pakeistą glutamaterginį perdavimą, kaip minėta anksčiau, ir lėtinį kokainą, daugiausia veikiantį per D1. receptorių signalizacija (Nestler, 2008). Dar viena galimybė yra ta, kad ΔFosB indukcija pagal lėtinį stresą, palyginti su lėtiniu kokainu, priklauso nuo skirtingų transkripcijos mechanizmų, kurie yra skirtingai kontroliuojami skirtingais neuroniniais įėjimais, įkvepiančiais NAc iš įvairių glutamaterginių projekcinių regionų, pavyzdžiui, keliuose prefrono žievės regionuose, hipokampe ir amygdaloje. Reikia daug toliau dirbti, kad ištirtų šias ir alternatyvias galimybes.

Kartu mūsų atradimai identifikuoja naują transkripcijos mechanizmą, per kurį NAc paskatino ΔFosB tarpininkauti prieš įtampą skatinančius stimulus. Šis tyrimas taip pat suteikia svarbų naują įžvalgą apie SRF vaidmenį NAc lygmenyje reguliuojant depresijos ir nerimo požymius. Geriau suprantant SRF transkripcijos vaidmenį reguliuojant tokį elgesį, bus lengviau nustatyti naujus genų taikinius, susijusius su atsparumu su stresu susijusiems sutrikimams, ir tai gali palengvinti būsimų veiksmingesnių antidepresantų terapijos plėtrą ateityje.

Šis darbas buvo paremtas Nacionalinio psichikos sveikatos instituto ir Nacionalinio piktnaudžiavimo narkotikais instituto ir mokslinių tyrimų sąjungos su AstraZeneca stipendijomis. Dėkojame Dovydui D. Ginty'ui už Srffl / fl pelių teikimą.

Korespondencija turėtų būti adresuojama Eric J. Nestler, Fishberg Neurologijos katedra, Sinajaus kalno medicinos mokykla, Vienas Gustave L. Levy vieta, Box 1065, Niujorkas, NY 10029-6574. [apsaugotas el. paštu]

Autorinės teisės © 2010 autoriai 0270-6474 / 10 / 3014585-08 $ 15.00 / 0

Nuorodos

1. ↵

1. Alberti S

2. Krause SM

3. Kretz O

4. Philippar U,

5. Lemberger T

6. Casanova E,

7. Wiebel FF,

8. Schwarz H

9. Frotscher M,

10. Schütz G,

11. Nordheim A

(2005) Neuronų migracijai pelių rostralio migracijos sraute reikalingas serumo atsako faktorius. Proc Natl Acad Sci JAV 102: 6148 – 6153.

Anotacija / NEMOKAMAS Visas tekstas

2. ↵

1. Bading H,

2. Ginty DD,

3. Greenberg ME

(1993) Genų ekspresijos reguliavimas hipokampo neuronuose, naudojant skirtingus kalcio signalizacijos kelius. Mokslas 260: 181 – 186.

Anotacija / NEMOKAMAS Visas tekstas

3. ↵

1. Bertonas O

2. McClung CA

3. Dileone RJ,

4. Krishnan V,

5. Renthal W,

6. Russo SJ,

7. Graham D,

8. Tsankova NM

9. Bolanos CA

10. Rios M,

11. Monteggia LM,

12. Savarankiškas DW

13. Nestler EJ

(2006b) Esminis BDNF vaidmuo mezolimbinėje dopamino trasoje socialiniame pralaimėjime. Mokslas 311: 864 – 868.

Anotacija / NEMOKAMAS Visas tekstas

4. ↵

1. Bertonas O

2. Covington HE 3rd.,

3. Ebner K,

4. Tsankova NM

5. Carle TL,

6. Ulery P,

7. Bhonsle A,

8. Barrot M,

9. Krishnan V,

10. Singewald GM,

11. Singewald N,

12. Birnbaum S

13. Neve RL,

14. Nestler EJ

(2007) ΔFosB indukcija periaqueductal pilka spalva skatina aktyvų susidorojimo atsaką. Neuronas 55: 289 – 300.

„CrossRefMedline“

5. ↵

1. Chang SH,

2. Poser S,

3. Xia Z

(2004) Naujas vaidmuo serumo atsako faktoriui neuronų išgyvenamumui. J Neurosci 24: 2277 – 2285.

Anotacija / NEMOKAMAS Visas tekstas

6. ↵

1. Etkin A,

2. Alarcón JM,

3. Weisberg SP,

4. Touzani K,

5. Huang YY,

6. Nordheim A,

7. Kandel ER

(2006) SRF vaidmuo mokymosi procese: ištrynimas suaugusiųjų priešpriešos sutrikimu LTD ir tiesioginės naujos atminties atminties formavimasis. Neuronas 50: 127 – 143.

„CrossRefMedline“

7. ↵

1. Heinze HJ

2. Heldmann M,

3. Voges J,

4. Hinrichs H

5. Marco-Pallares J,

6. Hopf JM,

7. Müller UJ,

8. Galazky I,

9. Sturm V

10. Bogerts B,

11. Münte TF

(2009) Kovojant su stipria alkoholio priklausomybe skatinamuoju jautrinimu, naudojant gilų smegenų stimuliavimą branduolyje accumbens: klinikiniai ir pagrindiniai mokslo aspektai. Priekinis Hum Neurosci 3: 22.

Medline

8. ↵

1. Johnson CM,

2. Hill CS,

3. Chawla S

4. Treisman R

5. Bading H

(1997) Kalcis kontroliuoja genų ekspresiją per tris skirtingus kelius, kurie gali veikti nepriklausomai nuo Ras / mitogeno aktyvuotų baltymų kinazių (ERK) signalizacijos kaskados. J Neurosci 17: 6189 – 6202.

Anotacija / NEMOKAMAS Visas tekstas

9. ↵

1. Kalita K,

2. Kharebava G,

3. Zheng JJ,

4. Hetmanas M

(2006) Megakarioblastinio ūminio leukemijos-1 vaidmuo ERK1 / 2 priklausomame serumo atsako faktoriaus sukeliamo BDNF transkripcijos stimuliavime arba padidėjęs sinaptinis aktyvumas. J Neurosci 26: 10020 – 10032.

Anotacija / NEMOKAMAS Visas tekstas

10. ↵

1. Kelz MB,

2. Chen J,

3. Carlezon WA Jr.

4. Whisler K,

5. Gilden L

6. Beckmann AM,

7. Steffen C,

8. Zhang YJ,

9. Marotti L,

10. Savarankiškas DW

11. Tkatch T,

12. Baranauskas G,

13. Surmeier DJ

14. Neve RL,

15. Duman RS,

16. Picciotto MR

17. Nestler EJ

(1999) Transkripcijos faktoriaus ΔFosB ekspresija smegenyse kontroliuoja jautrumą kokainui. Gamta 401: 272 – 276.

„CrossRefMedline“

11. ↵

1. Knöll B,

2. Nordheim A

(2009) Funkcinis transkripcijos faktorių universalumas nervų sistemoje: SRF paradigma. Tendencijos Neurosci 32: 432 – 442.

„CrossRefMedline“

12. ↵

1. Knöll B,

2. Kretz O

3. Fiedler C,

4. Alberti S

5. Schütz G,

6. Frotscher M,

7. Nordheim A

(2006) Serumo atsako faktorius kontroliuoja neuroninės grandinės surinkimą hipokampe. Nat Neurosci 9: 195 – 204.

„CrossRefMedline“

13. ↵

1. Krishnan V,

2. Han MH

3. Graham DL,

4. Bertonas O

5. Renthal W,

6. Russo SJ,

7. Laplant Q,

8. Graham A,

9. Lutter M,

10. Lagace DC,

11. Ghose S,

12. Reister R,

13. Tannous P,

14. Žalioji TA,

15. Neve RL,

16. Chakravarty S,

17. Kumar A,

18. Eisch AJ,

19. Savarankiškas DW

20. Lee FS,

21. et al.

(2007) Molekuliniai pritaikymai, kurie yra jautrūs ir atsparūs socialiniam pralaimėjimui smegenų atlygio regionuose. Ląstelė 131: 391 – 404.

„CrossRefMedline“

14. ↵

1. Kuhn J,

2. Bauer R

3. Pohl S,

4. Lenartz D,

5. Huff W

6. Kim EH,

7. Klosterkoetter J,

8. Sturm V

(2009) Stebėjimai dėl nepageidaujamo rūkymo nutraukimo po gilaus smegenų stimuliavimo. Eur Addict Res 15: 196 – 201.

„CrossRefMedline“

15. ↵

1. Kumar A,

2. Choi KH,

3. Renthal W,

4. Tsankova NM

5. Theobald DE,

6. Truong HT

7. Russo SJ,

8. Laplant Q,

9. Sasaki TS

10. Whistler KN

11. Neve RL,

12. Savarankiškas DW

13. Nestler EJ

(2005) Chromatino remodeliacija yra pagrindinis mechanizmas, kuriuo grindžiamas striatumo kokaino sukeltas plastiškumas. Neuronas 48: 303 – 314.

„CrossRefMedline“

16. ↵

1. Labirintas I,

2. Covington HE 3rd.,

3. Dietz DM,

4. „LaPlant Q“

5. Renthal W,

6. Russo SJ,

7. Mechanikas M,

8. „Mouzon E“,

9. Neve RL,

10. Haggarty SJ,

11. Ren Y,

12. Sampath SC

13. Hurdas YL,

14. Greengard P,

15. Tarakhovsky A,

16. Schaefer A,

17. Nestler EJ

(2010) Esminis histono metiltransferazės G9a vaidmuo kokaino sukeltame plastikume. Mokslas 327: 213 – 216.

Anotacija / NEMOKAMAS Visas tekstas

17. ↵

1. McClung CA

2. Ulery PG,

3. Perrotti LI

4. Zachariou V,

5. Bertonas O

6. Nestler EJ

(2004) DeltaFosB: molekulinis jungiklis, skirtas ilgalaikiam prisitaikymui smegenyse. Brain Res Mol Brain Res 132: 146 – 154.

Medline

18. ↵

1. Nestler EJ

(2008) Transkripciniai priklausomybės mechanizmai: deltaFosB vaidmuo. „Philos Trans R Soc Lond B Biol Sci 363: 3245 – 3255.

Anotacija / NEMOKAMAS Visas tekstas

19. ↵

1. „Nestler EJ“,

2. Carlezon WA Jr.

(2006) Mesolimbinė dopamino atsipirkimo grandinė depresijoje. Biologinė psichiatrija 59: 1151 – 1159.

„CrossRefMedline“

20. ↵

1. „Nestler EJ“,

2. Kelz MB,

3. Chen J

(1999) ΔFosB: molekulinis mediatorius, turintis ilgalaikį nervų ir elgesio plastiškumą. Brain Res 835: 10 – 17.

„CrossRefMedline“

21. ↵

1. Niutonas SS,

2. Thome J,

3. Wallace TL,

4. Shirayama Y

5. Schlesinger L,

6. Sakai N,

7. Chen J,

8. „Neve R“,

9. „Nestler EJ“,

10. „Duman RS“

(2002) cAMP atsako elemento surišančio baltymo arba dinorfino inhibavimas branduolio accumbens metu sukelia antidepresantą. J Neurosci 22: 10883 – 10890.

Anotacija / NEMOKAMAS Visas tekstas

22. ↵

1. Nikulina EM,

2. Arrillaga-Romynas I,

3. Miczek KA,

4. Plaktukas RP jaunesnysis

(2008) Ilgalaikis mezokortikolimbinių struktūrų pakitimas po pakartotinio socialinio pralaimėjimo streso žiurkėms: mu-opioidų receptorių mRNR ir FosB / DeltaFosB imunoreaktyvumo laikas. Eur J Neurosci 27: 2272 – 2284.

„CrossRefMedline“

23. ↵

1. Perrotti LI

2. Hadeishi Y

3. Ulery PG,

4. Barrot M,

5. Monteggia L,

6. Duman RS,

7. Nestler EJ

(2004) ΔFosB indukcija, susijusi su smegenų struktūromis, susijusiomis su lėtiniu stresu. J Neurosci 24: 10594 – 10602.

Anotacija / NEMOKAMAS Visas tekstas

24. ↵

1. Perrotti LI

2. Audėjas RR,

3. Robison B,

4. Renthal W,

5. Labirintas I,

6. Yazdani S,

7. Elmore RG,

8. Knapp DJ

9. Selley DE,

10. Martin BR,

11. „Sim-Selley L“,

12. „Bachtell RK“,

13. Savarankiškas DW

14. Nestler EJ

(2008) Skirtingi DeltaFosB indukcijos modeliai smegenyse, naudojant narkotikus. „Synapse 62“: „358 – 369“.

„CrossRefMedline“

25. ↵

1. Philippar U,

2. Schratt G,

3. Dieterich C,

4. Müller JM,

5. Galgóczy P,

6. Engel FB,

7. Keating MT,

8. Gertler F

9. Schüle R

10. Vingron M,

11. Nordheim A

(2004) SRF tikslinis genas Fhl2 antagonizuoja RhoA / MAL priklausomą SRF aktyvaciją. Mol Cell 16: 867 – 880.

„CrossRefMedline“

26. ↵

1. Ramanan N,

2. Shen Y,

3. Sarsfield S

4. Lemberger T

5. Schütz G,

6. Linden DJ

7. Ginty DD

(2005) SRF tarpininkauja aktyvumo sukeltai genų ekspresijai ir sinaptiniam plastiškumui, bet ne neuroniniam gyvybingumui. Nat Neurosci 8: 759 – 767.

„CrossRefMedline“

27. ↵

1. Renthal W,

2. Carle TL,

3. Labirintas I,

4. Covington HE 3rd.,

5. Truong HT

6. Alibhai I,

7. Kumar A,

8. Montgomery RL

9. Olson EN,

10. Nestler EJ

(2008) Delta FosB tarpininkauja c-fos geno epigenetiniam desensibilizacijai po lėtinio amfetamino poveikio. J Neurosci 28: 7344 – 7349.

Anotacija / NEMOKAMAS Visas tekstas

28. ↵

1. Renthal W,

2. Kumar A,

3. Xiao G,

4. Wilkinson M,

5. Covington HE 3rd.,

6. Labirintas I,

7. Sikder D,

8. Robison AJ,

9. „LaPlant Q“

10. Dietz DM,

11. Russo SJ,

12. Vialou V

13. Chakravarty S,

14. Kodadek TJ,

15. Stack A,

16. Kabbaj M,

17. Nestler EJ

(2009) Genomo mastu atlikta kromatino reguliavimo kokainu analizė atskleidžia sirtuinų vaidmenį. Neuronas 62: 335 – 348.

„CrossRefMedline“

29. ↵

1. Schlaepfer TE,

2. Cohen MX,

3. Frick C,

4. Kosel M,

5. Brodesser D,

6. Axmacher N,

7. Joe AY,

8. Kreft M,

9. Lenartz D,

10. Sturm V

(2008) Gilus smegenų stimuliavimas, skirtas atlyginti grandinę, mažina anhedoniją, kai yra sunki depresija. Neuropsichofarmakologija 33: 368 – 377.

„CrossRefMedline“

30. ↵

1. Sesack SR,

2. Grace AA

(2010) „Cortico-basal“ ganglijų atlyginimų tinklas: mikroprocesorius. Neuropsichofarmakologija 35: 27 – 47.

„CrossRefMedline“

31. ↵

1. Tomita H

2. Vawter MP,

3. Walsh DM,

4. Evans SJ,

5. Choudary PV

6. Li J,

7. Overman KM,

8. Atz ME

9. Myers RM

10. Jones EG,

11. „Watson SJ“,

12. Akil H

13. Bunney WE Jr.

(2004) Agoninių ir postmorteminių veiksnių įtaka genų ekspresijos profiliui: kokybės kontrolė mikroarray analizėse arba žmogaus smegenų postmortem. Biol psichiatrija 55: 346 – 352.

„CrossRefMedline“

32. ↵

1. Tsankova NM

2. Bertonas O

3. Renthal W,

4. Kumar A,

5. Neve RL,

6. Nestler EJ

(2006) Ilgalaikis hipokampo chromatino reguliavimas pelės depresijos ir antidepresantų modeliuose. Nat Neurosci 9: 519 – 525.

„CrossRefMedline“

33. ↵

1. „Vassoler FM“,

2. „Schmidt HD“,

3. Gerardas ME,

4. Įžymūs KR,

5. Ciraulo DA

6. Kornetsky C,

7. „Knapp CM“,

8. Pierce RC

(2008) Gilus smegenų stimuliavimas branduolyje accumbens apvalkalas susilpnina kokaino priminimo sukeltą žiurkių paieškos iš naujo gydymą. J Neurosci 28: 8735 – 8739.

Anotacija / NEMOKAMAS Visas tekstas

34. ↵

1. Vialou V

2. Robison AJ,

3. „Laplant“ QC,

4. Covington HE 3rd.,

5. Dietz DM,

6. Ohnishi YN,

7. „Mouzon E“,

8. Skubėti AJ 3rd.,

9. Vatai EL,

10. Wallace DL,

11. Iñiguez SD,

12. Ohnishi YH,

13. Steiner MA,

14. Warren BL,

15. Krishnan V,

16. Bolaños CA

17. Neve RL,

18. Ghose S,

19. Bertonas O

20. Tamminga CA

21. Nestler EJ

(2010) ΔFosB smegenų atlygio grandinėse tarpininkauja atsparumui stresui ir antidepresantams. Nat Neurosci 13: 745 – 752.

„CrossRefMedline“

35. ↵

1. Wilkinson MB,

2. Xiao G,

3. Kumar A,

4. „LaPlant Q“

5. Renthal W,

6. Sikder D,

7. Kodadek TJ,

8. Nestler EJ

(2009) Imipramino gydymas ir atsparumas turi panašų chromatino reguliavimą pagrindiniame smegenų atlygio regione. J Neurosci 29: 7820 – 7832.

Anotacija / NEMOKAMAS Visas tekstas

36. ↵

1. „Xia Z“,

2. Dudek H

3. Miranti CK,

4. Greenberg ME

(1996) Kalcio srautas per NMDA receptorių sukelia greitą ankstyvo geno transkripciją, veikiantį MAP kinazės / ERK priklausomu mechanizmu. J Neurosci 16: 5425 – 5436.

Anotacija / NEMOKAMAS Visas tekstas