phosphorylation အားဖြင့် DeltaFosB တည်ငြိမ်မှု၏စည်းမျဉ်းဥပဒေ (2006)

J ကို neuroscience ။ 2006 May 10;26(19):5131-42.

Ulery PG, Rudenko, G, Nestler EJ.

အရင်းအမြစ်

စိတ်ရောဂါကုသမှု, အခြေခံအာရုံကြောသိပ္ပံ, တက္ကသိုလ်တက္ကဆက်ပြည်နယ်၏အနောက်တောင်ပိုင်း Medical Center မှာ, Texas ပြည်နယ် Dallas 75390-9070, အမေရိကန်နိုင်ငံအဘို့အရေးစင်တာဌာန။

ြဒပ်မဲ့သော

အဆိုပါကူးယူအချက် DeltaFosB (စ FosB2 သို့မဟုတ် FosB [တိုတိုပုံစံ] အဖြစ်ရည်ညွှန်း) အများအပြားအလွဲသုံးစားမှုမူးယစ်ဆေးဝါးများအပါအဝင် psychoactive လှုံ့ဆော်မှုအမျိုးအစားများ, စိတ်ဖိစီးမှုနှင့် electroconvulsive သိမ်းယူမှုမှနာတာရှည်ထိတွေ့မှုအားဖြင့်ဦးနှောက်ထဲမှာသွေးဆောင်ရေရှည် plasticity ၏အရေးပါသောအာမခံ ။ DeltaFosB ၏တစ်ဦးကွဲပြားအင်္ဂါရပ်ကနောက်ထပ်ဆွ၏မရှိခြင်းအတွက်အချိန်အတော်လေးကြာမြင့်စွာကာလအဘို့အဦးနှောက်ထဲမှာဆက်ရှိနေသေးတစ်ကြိမ်သွေးဆောင်, သောကွောငျ့ဖွစျသညျ။ ဒီသရုပ်တည်ငြိမ်ရေးကိုအခြေခံအဆိုပါယန္တရားများ, သို့သော်, အမည်မသိကျန်ရစ်ခဲ့ကြသည်။ ဤတွင်ကျနော်တို့ DeltaFosB ဆဲလ်ယဉ်ကျေးမှု၌ခန့်မှန်းခြေအားဖြင့် 10 ဇ၏တစ်ဝက်ဘဝနှင့်အတူတစ်အတော်လေးတည်ငြိမ်ကူးယူအချက်ကြောင်းဆန္ဒပြခဲ့ကြသည်။ ထို့အပွငျ, ငါတို့ DeltaFosB ဦးနှောက်ထဲမှာ phosphoprotein သည်နှင့် DeltaFosB အတွက်အလွန်အမင်းရှေးရိုးစွဲ serine ကျန်ကြွင်း (Ser27) ၏ကြောင်း phosphorylation proteasomal ပျက်စီးခြင်းကနေကာကွယ်ပေးတယ်ကဖော်ပြသည်။ ငါတို့သည်ဤ phosphorylation casein kinase 2 ကကမကထပြုခဲ့ကြောင်းအကြံပြုသက်သေအထောက်အထားများအများအပြားလိုင်းများသည်။ ဤရွေ့ကားတွေ့ရှိချက် DeltaFosB phosphorylated သည်နှင့် phosphorylation ဦးနှောက်ထဲမှာကြာရှည်အလိုက်သင့်ပြောင်းလဲနေထိုင်ဖျန်ဖြေရန်၎င်း၏စွမ်းရည်၏အဓိကမှာဖြစ်သောယင်း၏တည်ငြိမ်မှု, ကိုအထောက်အကူပြုရန်ကွောငျးတငျပွကွောငျးပထမဦးဆုံးသက်သေအထောက်အထားပါဝင်သည်။

နိဒါန္း

ထို့အပြင် FosB2 သို့မဟုတ် FosB [တိုတိုပုံစံ] သတ်မှတ်ထားသောအဆိုပါကူးယူအချက်ΔFosB, ချက်ချင်းအစောပိုင်းမျိုးဗီဇတစ်ခုကို C terminus-နေရာများအစားထိုးလိုက် splice မူကွဲဖြစ်ပါသည် fosb (Dobrazanski et al ။ , 1991; Nakabeppu နှင့် Nathan, 1991; ယန်း et al ။ , 1991) ။ Full-အရှည် FosB ကဲ့သို့ပင်ΔFosBကြောင့်အများအပြားမျိုးဗီဇ၏ဟူသောအသုံးအနှုနျးကိုထိန်းညှိပေးသော Active ပရိုတိန်း-1 (AP-1) ကူးယူအချက်ရှုပ်ထွေးသော, (ဖွဲ့စည်းရန်ဇွန်ပရိုတိန်းနှင့်အတူ dimerizes ရာမှတဆင့်တစ်ဦးရဲ့ DNA-binding အခြေခံဒိုမိန်းနှင့် leucine ဇစ်ရှိပါတယ်မော်ဂန်နှင့် Curran, 1995; Rylski နှင့် Kaczmarek, 2004) ။ ယဉ်ဆဲလ်တွေနှင့်ဦးနှောက်အတွက်အစွမ်းထက်မှတ်တမ်း Active နှင့် repressor နှစ်ဦးစလုံးအဖြစ် FosB ၏ကို C terminus မှာတွေ့ရတဲ့ transactivation ဒိုမိန်း၏အစိတ်အပိုင်းတစ်ခု, ΔFosBလုပ်ဆောင်ချက်များကိုချို့တဲ့နေသော်လည်း (Dobrazanski et al ။ , 1991; Nakabeppu နှင့် Nathan, 1991; ချန် et al ။ , 1997; McClung နှင့် Nestler, 2003; Kumar က et al ။ , 2005).

ΔFosB နာတာရှည်ပြီးနောက်ဦးနှောက်ထဲမှာဒေသ-တိကျတဲ့ထုံးစံ၌မြင့်မားဖို့သွေးဆောင်ပေမယ့်စူးရှသောမ, စိတ်ဖိစီးမှု, အချို့ကိုတွေ့ရှိရပါသည်, antipsychotic နှင့်လက္ခဏာမူးယစ်ဆေးဝါး, အလွဲသုံးစားမှုမူးယစ်ဆေးဝါး, နှင့်သဘာဆုလာဘ်အပါအဝင် psychoactive လှုံ့ဆော်မှုအမျိုးမျိုး, ထိတွေ့နေသည် (et al မျှော်လင့်ပါတယ်။ , 1994b; Hiroi နှင့် Graybiel, 1996; Moratalla et al ။ , 1996; Bing မှ et al ။ , 1997; Mandelzys et al ။ , 1997; Kelz et al ။ , 1999; Werme et al ။ , 2002; Andersson et al ။ , 2003; Colby et al ။ , 2003; Peakman et al ။ , 2003; Perrotti et al ။ , 2004; Zachary et al ။ , 2006) ။ ΔFosB၏ induction ဦးနှောက်ပေါ်ဤအကြောင်းလှုံ့ဆော်မှုအတော်ကြာ၏အလုပ်လုပ်တဲ့သက်ရောက်မှုကိုတိုက်ရိုက် related ခဲ့တာဖြစ်ပါတယ်။ ပင်နောက်ထပ်ဆွ၏မရှိခြင်းအတွက်ΔFosBများ၏ဇွဲ (စူးရှသောလှုံ့ဆော်မှုတုံ့ပြန်လျှင်မြန်စွာသွေးဆောင်နေကြသမျှသည်အခြား Fos မိသားစုကူးယူအချက်များ, ကနေခွဲခြားနာရီအနည်းငယ်အတွင်းပြန် Basal အဆင့်ယိုယွင်းများနှင့်ယေဘုယျအားဖြင့်နာတာရှည်ဆွပြီးနောက် desensitization ပြသet al မျှော်လင့်ပါတယ်။ , 1992; Daunais et al ။ , 1993; Persico et al ။ , 1993; Hiroi နှင့် Graybiel, 1996; Perrotti et al ။ , 2004) ။ ဤသည်ΔFosBအချို့သောနာတာရှည်လှုံ့ဆော်မှုကြောင့်ဖြစ်ပွားတည်ငြိမ်သောအာရုံခံအလိုက်သင့်ပြောင်းလဲနေထိုင်အခြေခံကြောင်းဗီဇစကားရပ်ထဲတွင်ကြာရှည်အပြောင်းအလဲများကိုအချို့ပြေလည်အောင်ဆောင်ရွက်ပေးရန်အနေနဲ့ဆွဲဆောင်မှုကိုယ်စားလှယ်လောင်းစေသည်။

ΔFosB၏အချိန်ကြာမြင့်စွာရှိနေခြင်းက၎င်း၏ mRNA (ထပ်မံသော induction ၏မရှိခြင်းအတွက်ဖြစ်ပေါ်သောကြောင့်ချန် et al ။ , 1995), ကျနော်တို့ (Full-အရှည် FosB နှင့်ပင်ကိုစရိုက်ကမတည်မငြိမ်ဖြစ်ကြသမျှကိုအခြား Fos မိသားစုပရိုတိန်း, မတူဘဲΔFosBအနေနဲ့ထူးထူးခြားခြားတည်ငြိမ်ကူးယူအချက်ဖြစ်စေခြင်းငှါ, ကခန့်မှန်းသုံးသပ်သည်et al မျှော်လင့်ပါတယ်။ , 1994b; ချန် et al ။ , 1997; Nestler et al ။ , 2001; McClung et al ။ , 2004) ။ ထိုမှတပါး, နာတာရှည်-နှိုးဆွပေးဦးနှောက်တစ်သျှူးနှိုင်းယှဉ် acute- ၏ immunoblotting ခွဲခြမ်းစိတ်ဖြာΔFosBသိသာအတွက်ပြောင်းရွှေ့ရသည်ကြောင်းအကြံပြု Mr နာတာရှည်ရောဂါကုသနေစဉ်အတွင်း ~33-35 KDA ဖို့စူးရှသောအခြေအနေ ~37 KDA ကနေ (မော်လီကျူးအစုလိုက်အပြုံလိုက်) (et al မျှော်လင့်ပါတယ်။ , 1994a; ချန် et al ။ , 1995) ။ ဤအထူးထူးအပြားပြား isoforms အဘို့ဝှက်နိုင်ကြောင်းနောက်ထပ် mRNAs ၏တည်ရှိမှုအဘို့အဘယ်သူမျှမသက်သေအထောက်အထားလည်းမရှိသောကြောင့်, ကျနော်တို့နောက်ထပ်ΔFosB posttranslationally ပြုပြင်မွမ်းမံခြင်းနှင့်ဖြစ်ကောင်းဒီသည်၎င်း၏ပုံမှန်မဟုတ်သောတည်ငြိမ်မှုကိုအထောက်အကူပြုရန်ကြောင်းကြောင်းခန့်မှန်းပြောဆိုသည်။ ယနေ့အထိသို့သော်ΔFosB၏လည်ပတ်ငွေကြေးကြောင့်သို့မဟုတ် posttranslational ပြုပြင်မွမ်းမံမရှိထဲကဓာတုပစ်စညျးဆန်းစစ်ခြင်းများပြုလုပ်ထားခြင်းအစီရင်ခံတင်ပြခဲ့ကြသည်။ ပစ္စုပ္ပန်လေ့လာမှု၏ရည်မှန်းချက်ΔFosBတစ် phosphoprotein သည်နှင့် phosphorylation ယင်း၏တည်ငြိမ်ရေးအတွက်အခန်းကဏ္ဍရှိမရှိဆုံးဖြတ်ရန်ဖို့ဖြစ်တယ်။

ယခင်ပုဒ်မnext ကိုပုဒ်မ

ကုန်ကြမ်းနှင့်နည်းစနစ်များ

နို့တိုက်သတ္တဝါတွေကဆဲလ်လိုင်းများနှင့် DNA ကိုတည်ဆောက်ခြင်း။

PC12 ဆဲလ် (Clontech, Mountainview,, CA) ဌ-glutamine (L-Gln) ပါဝင်သောက high-ဂလူးကို့စ DMEM ယဉ်ကျေးမှုတို့ 5% သန္ဓေသား bovine သွေးရည်ကြည် (FBS) နဲ့ဖြည့်ဆည်း, (Invitrogen, Carlsbad,, CA ကနေနှစ်ဦးစလုံး) 10% မြင်းသွေးရည်ကြည် , 100 ဦး / ml penicillin နှင့် 100 μg / ml streptomycin (နှစ်ဦးစလုံး Sigma-Aldrich, စိန့်လူးဝစ်, MO ကိုကနေ) ။ HeLa ဆဲလ်တွေ (အမေရိကန်အမျိုးအစားယဉ်ကျေးမှုစုစည်းမှု, Manassas, VA သို့) L-Gln ်က high-ဂလူးကို့စ DMEM ယဉ်ကျေးမှုတို့ 10% FBS, penicillin နှင့် streptomycin နှင့်အတူဖြည့်ဆည်း။ နှစ်ဦးစလုံးဆဲလ်လိုင်းများတစ်ဦးစိုစွတ်သော 37% CO အတွက် 5 ဒီဂရီစင်တီဂရိတ်မှာထိန်းသိမ်းထားခဲ့သည်2 လေထု။

DNA ကိုအတူယာယီ transfections အဘို့, PC12 သို့မဟုတ် HeLa ဆဲလ်နောက်နေ့ 12-90% မြစ်ဆုံရောက်ရှိဖို့သကဲ့သို့ခြောက်ကောင်းစွာအပြား (ကျနော် PC100 ဆဲလ်များအတွက်ကော်လာဂျင်နှင့်အတူ coated) ပေါ်သို့ပါဝင်နေပါတယ်ခဲ့ကြသည်ပြီးတော့ Lipofectamine 2000 (Invitrogen) ကို အသုံးပြု. transfected ခဲ့ကြသည်။ အချို့စမ်းသပ်ချက်များတွင် (ကြည့်ရှု သင်္ဘောသဖန်းသီး။ 1-7), ΔFosBယာယီ recombinant ရေယုန် simplex virus ကို (HSV) နဲ့ရောဂါကူးစက်မှုကနေတဆင့် PC12 ဆဲလ်ထဲမှာထုတ်ဖော်ပြောဆိုခဲ့သည်။

ΔFosBနှင့် FosB cDNAs (ကျွန်တော်တို့ရဲ့ကိုယ်ပိုင် pTetop-Construction မှရရှိသောခဲ့ကြသည်ချန် et al ။ , 1997), နှင့်တစ်ဦး pcDNA3.1 အားနည်းချက်ကို (Invitrogen) သို့ subcloned ။ ဤရွေ့ကား pcDNA3.1-ΔFosB / FosB Construction နို့တိုက်သတ္တဝါငယ်တွေဆဲလ်တွေမှာရှိတဲ့နှင့် site-ညွှန်ကြား mutagenesis များအတွက် template ကိုအဖြစ်စကားရပ်များအတွက်အသုံးပြုခဲ့ကြသည်။ ယခင်ကဖော်ပြထားသကဲ့သို့ Recombinant HSV-ΔFosB (ပြင်ဆင်ထားခဲ့Neve et al ။ , 1997), နှင့်ပြင်ဆင်မှု ~1 × 10 တစ် titer ခဲ့8 pfu / ml ။

သွေးခုန်နှုန်း-Chase စမ်းသပ်ချက်။

ခန့်မှန်းခြေအားဖြင့် 24 ဇရောဂါကူးစက်မှု / transfection ပြီးနောက်ခြောက်ကောင်းစွာအပြားမှာရှိတဲ့ဆဲလ်တွေ (PC12 သို့မဟုတ် HeLa) PBS ၏ 2 ml နှင့်အတူနှစ်ဦးကိုမှသုံးကြိမ်ဆေးကြောခြင်းနှင့် Cys ၏ 37 ml အတွက် ~1 ဇ / Met-အခမဲ့ DMEM များအတွက် 2 ဒီဂရီစင်တီဂရိတ်မှာနွေးထွေးစွာရှိနေပြီးခဲ့ကြသည် (Invitrogen) 5% တွေ့ဆုံခဲ့ပြီး Cys ၏ intracellular ရေကန်ပျက်ဆီးဖို့ FBS (Hyclone, Logan, UT) dialyzed နှင့်အတူဖြည့်ဆည်း။ ဒီ "ငတ်မွတ်ခေါင်းပါး" ကာလ၏အဆုံးမှာ၏ 12-25 μCiနှင့်အတူ (သွေးခုန်နှုန်း) မူးယစ်ဆေး (ဆဲလ်ကုသခံရဖို့ခဲ့ကြသည်လျှင်) ကဆက်ပြောသည် ဖြစ်. , ဆဲလ်တွေတံဆိပ်ကပ်ခဲ့သည် 35S ကပရိုတိန်းတံဆိပ်ကပ်ရောနှော (PerkinElmer, 1 မှာ ~37 ဇများအတွက် Wellesley, MA) အားလုံးအသစ်ဖန်တီးပရိုတိန်းတံဆိပ်ကပ်ဖို့ကို C °။ အဆိုပါ radiolabel ထို့နောက် PBS ၏ 2 ml နှင့်အတူဆဲလ်နှစ်ခုမှသုံးကြိမ်ဆေးကြောခြင်းဖြင့်ဖယ်ရှား, နှင့်ခံခဲ့ရ 35က S-label တပ်ထားသောပရိုတိန်း 5% FBS နှင့်အတူဖြည့်ဆည်း "အအေး" (nonradioactive) အလတ်စားနှင့်အတူအလတ်စားအစားထိုးခြင်းနှင့်အမျိုးမျိုးသောအချိန်အချက်များမှာဆဲလ်တွေရိတ်သိမ်းနေဖြင့် (Chase) နောက်တော်သို့လိုက်ခဲ့သည်။ cell ကုသသည့် Chase တစ်လျှောက်လုံးထိန်းသိမ်းခံခဲ့ရသည်။ ဤအစမ်းသပ်ချက်အားလုံးသည်ကိန်းဂဏန်းများသူတို့ရဲ့လည်ပတ်ငွေကြေးကြောင့်နှုန်းနှိုင်းယှဉ်ပိုကောင်းအောင်အမျိုးမျိုးသောပရိုတိန်း၏အလားတူပဏာမပမာဏပြသပါ။

တိရစ္ဆာန်များနှင့်နာတာရှည် electroconvulsive ဖမ်းဆီးရမိကုသမှု။

အရွယ်ရောက်ပြီးသူ Sprague Dawley အထီးကြွက် (200-300 ပါ g; ချားလ်စ်မြစ် Laboratories, Kingston, RI က) 7-9 ဃများအတွက် electroconvulsive သိမ်းယူမှု (လိမ်လည်မှုများ) နဲ့နေ့စဉ်တစ်ကြိမ်ကုသခံခဲ့ရသည်။ ယခင်ကဖော်ပြထားသကဲ့သို့လိမ်လည်မှုများ (ဖျော်ဖြေခဲ့သည်et al မျှော်လင့်ပါတယ်။ , 1994a) တစ်ခုသုံးပြီး Ugo ပင်စိမ်း အောက်ပါဆက်တင်များဖြင့် (Comerio VA သို့, အီတလီ) လိမ်လည်မှုများကိုယူနစ်: ကြိမ်နှုန်း, 100 ပဲမျိုးစုံ / s ကို; 0.5 ms နှင့်အတူသွေးခုန်နှုန်း; ထိတ်လန့်ကြာချိန်, 1.0 s ကို; နှင့်လက်ရှိ, 75 MA ။ အတုအယောင်ထိန်းချုပ်မှုတိရိစ္ဆာန်များမဆိုလျှပ်စစ်လက်ရှိမပါဘဲနားထောငျ-ကလစ်လျှပ်လျှောက်ထားခြင်းအားဖြင့်အပြိုင်အတွက်ကုသခံခဲ့ရသည်။

32 P ကိုဇီဝဖြစ်စဉ်တံဆိပ်ကပ်ခြင်း။

ဦးနှောက်အချပ်များတံဆိပ်ကပ်ခြင်းအဘို့, ကြွက်ဦးနှောက်လျင်မြန်စွာခွဲဖြာ, ခေါင်းဖြတ်အသတ်ခံခဲ့ကြနှင့် 300 μmတိုကျရိုကျ cortical ချပ်တစ် DSK microslicer (Ted Pella, Redding,, CA) နဲ့ကိုပြင်ဆင်ခဲ့ကြသည်။ အဆိုပါချပ်ဖော့စဖိတ်-လစ်လပ်အတု CSF (ACSF) ၏ 2 ml အတွက်ပလပ်စတစ်ပြွန်အတွင်း၌နွေးထွေးစွာရှိနေပြီးတစ်ဦးချင်းနှင့်အတူအဆက်မပြတ်နူးညံ့သိမ်မွေ့ပူဖောင်းအောက်မှာ 30 ဒီဂရီစင်တီဂရိတ်မှာထိန်းသိမ်းထားခဲ့သည်2/ CO2 အရောအနှော (Hemmings et al ။ , 1989) ။ အဆိုပါချပ် (ပြွန်နှုန်းနှစ်ခုချပ်) okadaic အက်ဆစ် (1.3 ng / ml) ၏ရှေ့မှောက်တွင်သို့မဟုတ်မရှိခြင်းအတွက် 8-10 ဇများအတွက် 100 MCI နှင့်အတူတံဆိပ်ကပ်ခဲ့သည်။ [250 မီလီမီတာ NaCl, 7.4% (v / v PBS, သော pH 150 အိပ်ရေးဝြခင်းကဒီပေါက်ဖွား၏အဆုံးမှာချပ်အအေး ACSF နှင့်အတူအနည်းဆုံးသုံးကြိမ်ဆေးခဲ့ကြပြီးတော့အအေး radioimmunoprecipitation assay (RIPA) ၏ 1 μlအတွက် Sonic အားဖြင့် homogenized တက် 0.5%, 0.1 မှာအသုံးပြုသောနို့တိုက်သတ္တဝါငယ်တွေဆဲလ် (μl / ml များအတွက် protease inhibitor ကော့တေးမှ SDS နှင့်အတူအသုံးမပြုခင်ဖြည့်ဆည်း) Igepal, 1% (/ v) ဆိုဒီယမ် deoxycholate w, 0.6% (w / v) SDS, 5 မီလီမီတာ EDTA]; Sigma-Aldrich), ငါနှင့် II ကို (1 မှာအသုံးပြုသော phosphatase inhibitor ကော့တေး: 100; Sigma-Aldrich), 1 မီလီမီတာ PMSF နှင့် 2% က glycerol ။ တစ်သားတည်းဖြစ်တည်ခြင်းထို့နောက် 15 မိဘို့အပြုတ်နှင့်အ 15,000 ×မှာ centrifugal ခြင်းဖြင့်ရှင်းလင်းခဲ့သည် g 15 မိသည်။ ရလဒ် supernatants အတွက်ပရိုတိန်းအာရုံစူးစိုက်မှုအတွက် BCA ပရိုတိန်း assay (ပီယပ်, Holmdel, NJ) သုံးပြီးအကဲဖြတ်ခဲ့သည်။

အတွက် 32ယဉ်ဆဲလ် P ကိုတံဆိပ်ကပ်ခြင်း, ရောဂါကူးစက်မှု / transfection ပြီးနောက် ~24 ဇ, ဆဲလ်ဖော့စဖိတ်-အခမဲ့အလတ်စားနှင့်အတူနှစ်ဦးမှသုံးကြိမ်ဆေးကြောခြင်းနှင့် ~1 ဇအဘို့ဤအလတ်စားနွေးထွေးစွာရှိနေပြီးခဲ့ကြသည်။ ဒီအစာငတ်မွတ်မှုကာလ၏ 0.2-0.3 MCI ပြီးနောက် 32PH သည်3PO4 (PerkinElmer) ကောင်းစွာအသီးအသီးမှဆက်ပြောသည် ဖြစ်. , ဆဲလ် (သတ်မှတ်ချက်များအဘို့သင်္ဘောသဖန်းသီး။ 4-12 ကိုကြည့်ပါ) စမ်းသပ်မှု၏ကြင်နာပေါ် မူတည်. 1-7 ဇများအတွက်တံဆိပ်ကပ်ခဲ့သည်။ ဆဲလ်ထို့နောက် PBS နှင့်အတူသုံးကြိမ်ဆေးကြောခြင်းနှင့်ဖြည့်ဆည်း RIPA ကြားခံ၏ 15 μlနှင့်အတူ 50 မိဘို့ရေခဲပေါ် lysed ခဲ့ကြသည်။ Lysates scraping အားဖြင့်ကောက်ယူခဲ့ကြခြင်းနှင့် DNA ကိုတွေညှပ်ဖို့ 10 ga အပ်မှတစ်ဆင့် 25 အဆလွန်ခဲ့ 10 မိဘို့အပြုတ်နှင့် 15,000 ဒီဂရီစင်တီဂရိတ်မှာ 15-30 မိဘို့ 4 rpm မှာ centrifuged ။ အဆိုပါရှင်းလင်း lysates (supernatants) အသစ်တခုပြွန်ပြောင်းရွှေ့ခံခဲ့ရသည်နှင့်တစ်ဦး BCA ပရိုတိန်း assay (ပီယပ်) ဖျော်ဖြေခဲ့သည်။ ဤအစမ်းသပ်ချက်အားလုံးသည်ကိန်းဂဏန်းများသူတို့ရဲ့ဆွေမျိုး phosphorylation အဆင့်ဆင့်၏နှိုင်းယှဉ်ပိုကောင်းအောင်အလားတူစုစုပေါင်းရိုင်း-type အမျိုးအစား၏ပမာဏ (WT) နှင့် S27A ΔFosBပရိုတိန်းပြသပါ။

ဓာတုပစ္စည်းများနှင့်ဆဲလ်ယဉ်ကျေးမှုကုသမှု။

Okadaic အက်ဆစ် (oa; Sigma-Aldrich) အီသနောအတွက်ဖျက်သိမ်းနှင့် 100 ng / ml ၏နောက်ဆုံးအာရုံစူးစိုက်မှုမှာအသုံးပြုခဲ့သည်။ 5,6-Dichloro-1-β-D-ribofuranosyl-benzimidazole (DRB; Biomol, Plymouth အစည်းအဝေး, PA) dimethyl sulfoxide (DMSO; Sigma-Aldrich) အတွက်ဖျက်သိမ်းခံခဲ့ရခြင်းနှင့် 50 μm၏နောက်ဆုံးအာရုံစူးစိုက်မှုမှာဆဲလ်ယဉ်ကျေးမှု၌အသုံးပြုခဲ့သည်။ Spermine (Sigma-Aldrich) ရေအတွက်ဖျက်သိမ်းနှင့် 200 μm၏နောက်ဆုံးအာရုံစူးစိုက်မှုမှာအသုံးပြုခဲ့သည်။ Calphostin-C ကို (Biomol) (PMA; Promega, Madison, WI) DMSO အတွက်ဖျက်သိမ်းနှင့် 0.2 μmမှာအသုံးပြု phorbol 12-myristate 13-acetate သော်လည်းခဲ့သည် DMSO အတွက်ဖျက်သိမ်းနှင့် 0.1 μmမှာအသုံးပြုခဲ့သည်။ myristoylated-autocamtide-2-related inhibitory peptide (ဍ-AIP; Biomol) ရေအတွက်ဖျက်သိမ်းနှင့် 1 နှင့် 10 μm၏နောက်ဆုံးအာရုံစူးစိုက်မှုမှာအသုံးပြုခဲ့သည်။ အဆိုပါကျယ်ပြန့်ရောင်စဉ်ပရိုတိန်း kinase inhibitors H-7 နှင့် H-8 (Biomol) အသီးသီး, ရေအတွက်ဖျက်သိမ်းနှင့် 150 နှင့် 200 μm၏နောက်ဆုံးအာရုံစူးစိုက်မှုမှာအသုံးပြုခဲ့ကြသည်။ MG132 (Calbiochem, San Diego မှ,, CA) နှင့် epoxomicin (Peptides အင်တာနေရှင်နယ်, Louisville က, KY) နှစ်ဦးစလုံး DMSO အတွက်ဖျက်သိမ်းနှင့်အသီးသီး 12.5 နှင့် 7.5 μm၏နောက်ဆုံးအာရုံစူးစိုက်မှုမှာအသုံးပြုခဲ့ကြသည်။ အားလုံးစမ်းသပ်ချက်များတွင် DMSO (မော်တော်ယာဉ်) ကုသမှုကိုဖြတ်ပြီး DMSO တစ်ဦးစဉ်ဆက်မပြတ်ငွေပမာဏကိုဆက်လက်ထိန်းသိမ်းထားဖို့လိုအပ်သလိုဆဲလ်မှထည့်သွင်းခဲ့သည်။ အဘို့ 32P ကိုတံဆိပ်ကပ်စမ်းသပ်ချက်သည်မူးယစ်ဆေးဝါးများကိုတံဆိပ်မတိုင်မီချက်ချင်းဆက်ပြောသည်နှင့်အဆိုပါတံဆိပ်ကပ်ကာလ၏ကျန်ရှိသောအဘို့သိုထားခဲ့ကြသည်။ သွေးခုန်နှုန်း-Chase စမ်းသပ်ချက်အဘို့, မူးယစ်ဆေးဝါး Cys / Met ၏ထိုအချိန်ကဆက်ပြောသည်ခဲ့ကြသည် "ငတ်မွတ်ခေါင်းပါး" လို့တံဆိပ်ကပ်ကာလမှတဆင့်ထားရှိမည်, အဲဒီနောက် Chase အလတ်စားသို့ပြန်ဆက်ပြောသည်။ အဆိုပါ proteasome inhibitors ကဤ peptides ၏အမြန်လည်ပတ်ငွေကြေးကြောင့်များအတွက်လျော်ကြေးပေးရန် Chase တလျှောက်လုံးတိုင်း 3-4 ဇရောနှောခဲ့ကြသည်။

ΔFosB immunoprecipitative, immunoblotting နှင့် autoradiography ။

immunoprecipitative အဘို့, lysates 1 ရောခဲ့ကြသည်: လွင်ပြင် RIPA နှင့်အတူ 5 immunoprecipitative (IP) နှင့်အတူဆက်လက်မလုပ်ဆောင်ခင်ချ 0.1% ဖို့ SDS အာရုံစူးစိုက်မှုဆောင်ကြဉ်းရန်။ nonspecific စည်းနှောင်ကန့်သတ်ခြင်းငှါ, lysates ပထမဦးဆုံးကအနည်းဆုံး 4 ဇများအတွက် nonimmune IgG နှင့်ပရိုတိန်းဓာတ်, G-Sepharose (Sigma-Aldrich) နဲ့ immunoprecipitating ခြင်းဖြင့်ရှင်းလင်းခဲ့သည်။ ΔFosBထို့နောက် FosB နှင့်ΔFosBနှစ်ဦးစလုံးအတွက်လက်ဆောင်တစ်ခုပြည်တွင်းရေး epitope အသိအမှတ်ပြုတစ်ဆိတ်ကို polyclonal antibody ကိုသုံးပြီးရှင်းလင်း lysates ထံမှ immunoprecipitated ခဲ့သည် (SC-48G; Santa Cruz ဇီဝနည်းပညာ, Santa Cruz,, CA) lysate ပရိုတိန်း၏ 0.5 μgနှုန်း 1-10 μg IgG မှာ (စုစုပေါင်းပရိုတိန်း၏ 50-300 μg) 0.5 ml တစ်ဦးစုစုပေါင်း volume ထဲမှာ။ မိတ်ဖက်ညင်ညင်သာသာမှာအနည်းဆုံး 4 ဇများအတွက်ရဟတ်ပေါ် 8 ဒီဂရီစင်တီဂရိတ်မှာရောနှောခဲ့ကြပြီးတော့ပရိုတိန်း, G-Sepharose ၏ 15 μlထည့်သွင်းခဲ့သည်နှင့်မိတ်ဖက်သည်အနည်းဆုံးအခြား 4 ဇများအတွက်ရောနှောခဲ့ကြသည်။ မိတ်ဖက် 3000 ×မှာ spinning အားဖြင့် pelleted ခဲ့ကြသည် g 3 ဒီဂရီစင်တီဂရိတ်မှာ 5-4 မိဘို့, အအေး PBS 0.5% Tween 0.1 ်နှင့်အတူအအေးလွင်ပြင် RIPA နှစ်ယောက်အကြိမ် 20 ml နှင့်အတူသုံးကြိမ်ဆေးကြော။ မိတ်ဖက်ထို့နောက်အအေး PBS ၏ 0.5 ml အတွက် resuspended လွှဲပြောင်းအသစ်တစ်ခုပြွန်ထဲမှာ pelleted နှင့် immunoprecipitated ပရိုတိန်းထို့နောက် 15 ၏ 25-2 μl၏ထို့အပြင်ခြင်းဖြင့် eluted ကြ၏ Laemmli ပရိုတိန်းနမူနာကြားခံလျှော့ချ×။ ဤ IP protocol သည် lysate အတွက်နီးပါးအပေါငျးတို့သΔFosB၏များ၏တိကျသောနှင့်ထိရောက်သောမိုးရွာသွန်းမှုခဲ့သည်။ အဆိုပါ immunoprecipitated ပရိုတိန်းတစ် 12.5% Tris-HCl စံနှုန်းဂျယ်လ် (Bio-Rad, Hercules,, CA) ရက်နေ့တွင်မြေတပြင်လုံးသည် IP loading အားဖြင့် SDS-စာမကျြနှာမှအကြောင်းမဲ့, ပြီးတော့ PVDF သို့မဟုတ် nitrocellulose ပေါ်သို့ပြောင်းရွှေ့ခံခဲ့ရသည်။ လွှဲပြောင်းပြီးနောက်, အမြှေးပါး Air-သွေ့ခြောက်လေ၏နဲ့ 32P- နှင့် 35က S-radiolabeled ပရိုတိန်းခညျြအနှော Kodak (Rochester, NY) ကို အသုံးပြု. autoradiography အားဖြင့်ကြည့်ရှုလေ့လာခဲ့ကြ autoradiographic ရုပ်ရှင်အဖြစ်တစ်မုန်တိုင်း (Amersham Biosciences, Piscataway, NJ) PhosphorImager သုံးပြီး phosphorimaging ဖြင့်ပြုလုပ်နိုင်ပါတယ်။ ဆဲလ် lysates သို့မဟုတ်ဦးနှောက်ကိုတစ်သားတည်းဖြစ်တည်ခြင်းအတွက်စုစုပေါင်း (unphosphorylated နှင့် phosphorylated) ΔFosBအဆိုပါ detect ဖို့အသုံးပြုတူညီတဲ့အမြှေးပါးကို အသုံးပြု. immunoprecipitative ပရိုတိန်း (ဖြစ်စေ၏ immunoblotting အားဖြင့်ရှာဖွေတွေ့ရှိခဲ့သည် 32P-label တပ်ထားသောပရိုတင်း), သို့မဟုတ် lysate / တစ်သားတည်းဖြစ်တည်ခြင်းပရိုတိန်း၏တန်းတူပမာဏ၏ SDS-စာမကျြနှာမှအကြောင်းမဲ့နှင့် PVDF သို့မဟုတ် nitrocellulose ပေါ်သို့လွှဲပြောင်းပေးခဲ့သည်။ အဆိုပါအမြှေးပါးကိုပထမဆုံး PBS အတွက် 1% (w / v) nonfat ခြောက်သွေ့တဲ့နို့ (Bio-Rad) နှင့်အတူက incubating ပိတ်ဆို့ခံခဲ့ရ 0.1 ဒီဂရီစင်တီဂရိတ်မှာ 20 ဇများအတွက် 1% (v / v) Tween 25 (Sigma) နဲ့ဖြည့်ဆည်း။ အဆိုပါအမြှေးပါးထို့နောက်အမိုင်နိုအက်ဆစ် (4 1 မှာအသုံးပြုသော) FosB / ΔFosB၏ 16-1 ဆန့်ကျင်နေထုတ်လုပ်လိုက်တဲ့ကျွန်တော်တို့ရဲ့ကိုယ်ပိုင်ယုန် Anti-FosB polyclonal antibody ကိုအတူ 10,000 ဒီဂရီစင်တီဂရိတ်မှာနေ့ချင်းညချင်း immunoblotted ခဲ့သည်။ မူလတန်းပေါက်ဖွားပြီးနောက်အမြှေးပါးကြားခံပိတ်ဆို့ခြင်းနှင့်အတူ 5 မိဘို့လေးကြိမ်ဆေးကြောခဲ့ကြ, ပြီးတော့ 25 မှာအသုံးပြုသော horseradish peroxidase (ရန် conjugated ဆိတ် Anti-ယုန် IgG နှင့်အတူ ~1 ဇများအတွက် 1 ဒီဂရီစင်တီဂရိတ်မှာနွေးထွေးစွာရှိနေပြီး: Vector ကနေကြားခံပိတ်ဆို့ခြင်းအတွက် 5000 ဓါတ်ခွဲခန်း, Burlingame,, CA) ။ အမြှေးပါးထို့နောက် PBS နှင့်အတူကြားခံနှင့် 10 မိဘို့တစ်ကြိမ်ပိတ်ဆို့ခြင်းနှင့်အတူ 5 မိဘို့သုံးကြိမ်ဆေးကြောခဲ့သည်။ စုစုပေါင်းΔFosBပရိုတိန်းခညျြအနှောတိုးမြှင် chemiluminescence (ပီယပ်) ကနှင့် / သို့မဟုတ် ECL-Plus အားဓါတ်ကူပစ္စည်း (Amersham Biosciences) နှင့်မုန်တိုင်း PhosphorImager သုံးပြီးချောင်း၏ထောက်လှမ်းခြင်းဖြင့် Kodak MR ရုပ်ရှင်ပေါ်တွင်မြင်ခဲ့ကြသည်။

အင်းဆက်ပိုးမွှားဆဲလ်ကနေ recombinant ΔFosB၏ Overexpression နှင့်သန့်စင်။

ΔFosBအဆိုပါသည် Bac-to-သည် Bac baculovirus စကားရပ်စနစ် (Invitrogen) ကို အသုံးပြု. နှင့်ထုတ်လုပ်သူများ၏ညွှန်ကြားချက်များကိုအောက်ပါတစ်ခု N ကို terminus hexa-သူ့-Tagged ပရိုတိန်း (N-သူ့ (9) ΔFosB) အဖြစ် Sf6 အင်းဆက်ပိုးမွှားဆဲလ်တွေမှာရှိတဲ့ overexpressed ခဲ့သည်။ အတိုချုပ်ခြင်း, ΔFosB cDNA (အကြွင်းအကျန် 2-237) MGHHHHHHAG recombinant baculovirus generate ရန်အသုံးပြုခဲ့သည့် pFASTBacTM1 အားနည်းချက်ကိုအတွက် subcloned ခဲ့ဆှဖှေဲ့ N-terminal ကို tag ကိုတို့ကရှေ့ပြေး။ Sf9 ဆဲလ် recombinant ဗိုင်းရပ်စ်ပိုးကူးစက်ခံခဲ့ရခြင်း, N-သူ့ (6) ΔFosBတစ် mono-မေးကော်လံ (Amersham သုံးပြီးနီကယ်ကော်လံ (Qiagen, ဗလင်စီယာ,, CA), anion လဲလှယ်သုံးပြီးဆှဖှေဲ့ Chromatography အပါအဝင်အများအပြား chromatographic ခြေလှမ်းများအားဖြင့်ဆဲလ် lysates ကနေကိုစင်ကြယ်စေခဲ့သည် တစ်ဦးဂျယ်-filtration ကော်လံ (Amersham Biosciences) ကို အသုံးပြု. Biosciences), နှင့်အရွယ်အစားဖယ်။

စသည်တို့အတွက် phosphorylation လေ့လာမှုများ။

စသည်တို့အတွက် အချိန်သင်တန်းနှင့် stoichiometry ခွဲခြမ်းစိတ်ဖြာများအတွက် phosphorylation တုံ့ပြန်မှု 30 တစ် volume ထဲမှာဖျော်ဖြေခဲ့ကြသည်γ- [10 μmအလွှာ (N-သူ့ (6) ΔFosBတစ်ခုသို့မဟုတ်အပြုသဘောထိန်းချုပ်မှုအလွှာ), 250 μm ATP နှင့် 1 μCi / μl်μl32: P] ATP, အ kinase ထုတ်လုပ်သူများကထောက်ပံ့သည့်ကြားခံ, အောက်ပါ kinases များထဲမှ: CK2 (μl 20 ng /; အပေါ်ဘက်က, Charlottesville, VA သို့), CaMKII (μl 10 ng /; အပေါ်ဘက်က), PKC μl (1.6 ng /; Calbiochem) သို့မဟုတ် p70S6K (2.5 Mu / μl; အပေါ်ဘက်က) ။ အချိန်သင်တန်းတုံ့ပြန်မှု 5 သတ်မှတ်ထားသောအချိန်အချက်များမှာတုံ့ပြန်မှုဖြေရှင်းချက်ထံမှ aliquots μlနှင့် 4 တစ်ဦးတန်းတူအသံအတိုးအကျယ်ဖြည့်စွက် Laemmli ပရိုတိန်းနမူနာကြားခံလျှော့ချ×ဖယ်ရှားခြင်းအားဖြင့်ဖျော်ဖြေခဲ့ကြသည်။ အဆိုပါ CK2 တုံ့ပြန်မှုများအတွက် Michaelis-Menten kinetic parameters တွေကိုမျက်မြင်လက်တွေ့သတ်မှတ် linear တည်ငြိမ်-ပြည်နယ်အခြေအနေများအောက်တွင်ဆုံးဖြတ်ပေးခဲ့သည်။ ဤရွေ့ကားတုံ့ပြန်မှု 15 တစ် volume ထဲမှာ 10 မိဘို့ဖျော်ဖြေခဲ့ကြသည် 2 ng / μlအင်ဇိုင်း, 250 μm ATP, 1 μCi / μl [γ-်μl32: P] ATP နဲ့ N-သူ့ 6-2.5 μmကနေအထိ (30) ΔFosBပြင်းအား။ အားလုံးတုံ့ပြန်မှုတစ်ဦးရေရေချိုးအတွက် 30 ဒီဂရီစင်တီဂရိတ်မှာဖျော်ဖြေခဲ့ကြသည်။ Bio-Safe Coomassie (Bio-Rad) နှင့်အတူဂျယ်၏ SDS-စာမကျြနှာမြားနှငျ့အစွန်းအထင်းပြီးနောက်, လိမ်းဆေးအခြောက်ခံခဲ့ရခြင်း, 32P-ဖော့စဖိတ်ပေါင်းစပ်ဖွဲ့စည်းခြင်း (အောက်တွင်ဒေတာများအရေအတွက်, တွက်ချက်မှုများနှင့်စာရင်းဇယားကိုကြည့်ပါ) ခွဲခြမ်းစိတ်ဖြာ phosphorimaging အားဖြင့်အကဲဖြတ်ခဲ့သည်။

Two-ရှုထောင် phosphopeptide မြေပုံနှင့် phosphoamino အက်ဆစ်ခွဲခြမ်းစိတ်ဖြာ။

အားဖြင့်ဖော်ပြထားသကဲ့သို့, ဤစမ်းသပ်မှု၏နှစ်ဦးစလုံးဖျော်ဖြေခဲ့ကြ Ploegh နှင့် Dunn (2000)။ ပါဝင်တဲ့အတိုချုပ်ခြောက်သွေ့ဂျယ်အပိုင်းအစများ 32P-တံဆိပ်ကပ်ΔFosB (တစ်ခုခုကနေ စသည်တို့အတွက် တုံ့ပြန်မှုသို့မဟုတ်ဇီဝြဖစ်အမည်တပ်ထားသောဆဲလ် immunoprecipitative ထံမှ), excised rehydrated, ဆေးကြောခြင်းနှင့် tryptic အစာခြေအကြောင်းမဲ့ခဲ့ကြသည်။ အဆိုပါ tryptic အစာခြေထုတ်ကုန်များအဆိုပါ supernatant lyophilized နှင့် lyophilate အကြိမ်ပေါင်းများစွာဆေးကြောခြင်းနှင့် electrophoresis ကြားခံ, သော pH 10 ၏ 1.9 μlအတွက် resuspended ။ နမူနာ (3 μl) တစ်ဦး cellulose ပါးလွှာ-Layer Chromatography (TLC) ပန်းကန် (Analtech, Newark, DE) ရက်တွင်တွေ့ရှိခဲ့ခြင်းနှင့် electrophoresis နှင့် TLC တက်နေဖြင့်အခြားရှုထောင်အားဖြင့်တဦးတည်းရှုထောင်အတွက်ကွဲကွာခဲ့သည်။ ရရှိလာတဲ့ phosphopeptide မြေပုံ autoradiography နှင့် phosphorimaging အားဖြင့်မြင်ခဲ့သည်။ phosphoamino အက်ဆစ်ခွဲခြမ်းစိတ်ဖြာဘို့, electrophoresis ကြားခံအတွက် resuspended ခဲ့သော tryptic digests ၏ 2 μlနောက်ထပ်တစ်ခု N ကိုအောက်မှာ 105 မီတာ HCl အတွက် 25 မိဘို့ 3 ဒီဂရီစင်တီဂရိတ်မှာ HCl Hydrolysis အားဖြင့်မှီဝဲခဲ့ကြ2 လေထု။ အဆိုပါတုံ့ပြန်မှုရေထဲမှာတစ်ဦး sixfold dilution အားဖြင့်ရပ်တန့်ခဲ့ပါသည်, ထိုအရောအနှော lyophilized ခဲ့သည်။ အဆိုပါ lyophilate electrophoresis ကြားခံ, သော pH 5 ၏ 1.9 μlအတွက် resuspended နှင့် phospho-SER, -Thr နှင့် -Tyr စံချိန်စံညွှန်းများနှင့်အတူတစ်လျှောက် cellulose TLC ပန်းကန်ပေါ်ပြောက်ခဲ့ပါတယ်။ Electrophoresis electrophoresis ကြားခံ, သော pH 1.9 သုံးပြီး TLC ပန်းကန်၏အရှည်တစ်ဦး-တစ်ဝက်ကျော်ဖျော်ဖြေခဲ့ပါတယ်, အဲဒီနောက်ပန်းကန်ပုသော pH 3.5 ကြားခံသို့ပြောင်းရွှေ့ခဲ့သည်နှင့် electrophoresis ပြီးစီးဖို့ဖျော်ဖြေခဲ့သည်။ အဆိုပါ phosphoamino အက်ဆစ်စံချိန်စံညွှန်းများ acetone အတွက် 1% (v / v) ninhydrin ဖြေရှင်းချက်အတူ TLC ပန်းကန်ပက်ဖြန်းခြင်းဖြင့်မြင်လျက်, ခဲ့ကြသည် 32P-label တပ်ထားသောအမိုင်နိုအက်ဆစ်နမူနာ autoradiography နှင့် phosphorimaging နှစ်ဦးစလုံးအားဖြင့်မြင်ခဲ့သည်။

siRNA-သွေးဆောင်ခေါက်-Down CK2α။

ကျနော်တို့ (ရွေးချယ်ခေါက်-Down မှ CK2 ၏အဆင့်ဆင့်အနေနဲ့ RNA ်ရောက်စွက်ဖက်တဲ့နည်းလမ်းကိုအသုံးပြုခဲ့di Maira et al ။ , 2005) ။ သူတို့ယာယီအဆိုပါ catalytic ၏ mRNA ဆီသို့ညွှန်ကြား nontargeting siRNA သို့မဟုတ် siRNA ဖြစ်စေ၏ 12 nm (နောက်ဆုံးအာရုံစူးစိုက်မှု) နဲ့ transfected သောအခါ PC70 ဆဲလ်တွေ, နောက်နေ့ ~80-20% မြစ်ဆုံရောက်ရှိဖို့ကော်လာဂျင်ငါ-coated ခြောက်ကောင်းစွာပြားပေါ်သို့ပါဝင်နေပါတယ်ခဲ့ကြသည် Rat CK2 ၏α subunit, အ transfection အေးဂျင့် SilentFectin (Bio-Rad) ၏ 5 μlသုံးပြီးနှင့်ထုတ်လုပ်သူများ၏ညွှန်ကြားချက်များကိုအောက်ပါ။ အထက်တွင်ဖော်ပြထားသည့်အတိုင်းခန့်မှန်းခြေအားဖြင့် 24 ဇအကြာတွင်ဆဲလ်ယာယီ, ΔFosB plasmid နှင့်အတူ transfected ခဲ့ကြသည်။ ခန့်မှန်းခြေအားဖြင့် 24 ဇနောက်ပိုင်းတွင် (siRNA transfection ပြီးနောက် ~48 ဇ), ဆဲလ်ဖြစ်စေအကြောင်းမဲ့ခဲ့ကြသည် 32P ကိုဇီဝဖြစ်စဉ်တံဆိပ်ကပ်ခြင်းသို့မဟုတ်သွေးခုန်နှုန်း-Chase ခွဲခြမ်းစိတ်ဖြာအထက်တွင်ဖော်ပြထားသကဲ့သို့။ '' 2'P-AAAUCCCUG ACAUCAUAUUUU5, '(Dharmacon, Lafayette, CO) 3'P-UAGUCAUAUAAAUCUUCCGUU5, 3'P-CAAACUAUAAUCGUACAUCUU5' 3'P-UCAAUCAU-GACAUUAUGCGUU5 ': အောက်ပါလေးCK3α siRNAs အလားတူရလာဒ်များနှင့်အတူအသုံးပြုခဲ့ကြသည်။ အပျက်သဘောဆောင်သောထိန်းချုပ်မှုအဖြစ်ကျနော်တို့အသုံးပြုခဲ့ တိတ်ဆိတ်ခြင်း Ambion (Austin, TX) မှအနုတ်လက္ခဏာကိုထိန်းချုပ် #3 siRNA ။ CK2 ၏အတိုင်းအတာခေါက်-Down တစ် 2 မှာနေ့ချင်းညချင်း anti-CK06 polyclonal antibody ကို (အပေါ်ဘက်ကထံမှ catalog # 873-1) ကို အသုံးပြု. immunoblotting နေဖြင့်စောင့်ကြည့်ခဲ့သည်: 1000 dilution ။ β-Tubulin တစ်ဦးတင်ထိန်းချုပ်မှုအဖြစ်အသုံးပြုခြင်းနှင့်နေ့ချင်းညချင်းတစ်ဦး 05 မှာ monoclonal antibody ကို (အပေါ်ဘက်ကထံမှ catalog # 661-1) နဲ့ရှာဖွေတွေ့ရှိခဲ့သည်: 20,000 dilution ။

ဆိုက်ကို-ညွှန်ကြား mutagenesis ။

Ala ဖို့ဒါမှမဟုတ် ASP မှ Ser27 ၏ mutation တစ်ဦးလျင်မြန်စွာပြောင်းလဲခြင်းဆိုက်ကို-directional Mutagenesis ကိရိယာအစုံ (Stratagene,, La Jolla, CA) ကို အသုံးပြု. နှင့်ထုတ်လုပ်သူများ၏ညွှန်ကြားချက်များကိုအောက်ပါပြည့်စုံခဲ့သည်။ မောက်ΔFosBပရိုတိန်းအတွက် Ser27 ဗီဇပြောင်းလဲမှုတွေမိတ်ဆက်ပေးဖို့, အောက်ပါ mutagenesis primer အသုံးပြုခဲ့ကြသည်။ Ala မှ Ser27: (primer reverse) 5'GCCGAAGGAGTCCACCGAAGCCAGGTACTGAGACTCGGCGGAGGG3 '' ။ ASP မှ Ser27 (ရှေ့ဆက် primer) 5'CCCTCCGCCGAGTCTCAGTACCTGGATTCGGTGGACTCCTTCGGC3 '' ။ အဆိုပါ mutated အခြေစိုက်စခန်းရဲရင့်၌ရှိကြ၏, ထို Ser27 codon စာလုံးစောငျးဖြစ်ပါတယ်။

ကွန်ပြူတာအသုံးချဇီဝဗေဒ။

ΔFosBများအတွက်အလားအလာ phosphorylation က်ဘ်ဆိုက်များနှင့် kinases (ProSite အပါအဝင်အထူးပြု databases ကိုမှ mouse ကိုပရိုတိန်း sequence ကိုတင်သွင်းခြင်းအားဖြင့်ကိုရှာဖွေခဲ့သည်http://www.expasy.org/prosite/), PredictProtein (Rost et al ။ , 2004), နှင့် NetPhosK (Blom et al ။ , 2004).

ဒေတာကိုအရေအတွက်, တွက်ချက်မှုများနှင့်စာရင်းဇယား။

အဆိုပါ PVDF သို့မဟုတ် nitrocellulose အမြှေးပါးအတွင်းလက်ရှိပရိုတိန်းပမာဏကိုတစ်မုန်တိုင်း PhosphorImager နှင့်ပူးတွဲပါ ImageQuant software ကို (Amersham Biosciences / မော်လီကျူး Dynamics ကို) ကို အသုံးပြု. quantified ခဲ့သည်။ ဆဲလ်ယဉ်ကျေးမှုနှင့်ဦးနှောက်အချပ် phosphorylation လေ့လာမှုများမှာတန်ဖိုးအဘို့အရယူ 32P-label တပ်ထားသောပရိုတင်းပြီးတော့စုစုပေါင်းΔFosBများအတွက်ရရှိသောတန်ဖိုးများအားဖြင့်ခွဲကာအချိုးအဖြစ်ထုတ်ဖော်ပြောဆိုခဲ့သည်။ ထဲမှာ စသည်တို့အတွက် phosphorylation လေ့လာမှုများ, ပမာဏ 32ယခင်ကဖော်ပြထားသကဲ့သို့ΔFosB၏မှဲ့နှုန်း, P-တံဆိပ်ကပ်ΔFosB (stoichiometry) (တွက်ချက်ခဲ့သည်Sahin et al ။ , 2004) ။ အားလုံးတိုင်းတာအသုံးပြုသောတူရိယာများ Linear အကွာအဝေးအတွင်းခေါ်ဆောင်သွားခဲ့သည်။ Kinetic parameters တွေကိုသိရပါအံ့, ထို Michaelis-Menten မော်ဒယ်ကို အသုံးပြု. တွက်ချက်ခဲ့ကြသည် V = Vမက်စ်[S] / ([S]+KM) နှင့် Vမက်စ် = k2[Eစုစုပေါင်း] ။ အဆိုပါဝက်ဘဝ (t1 / 2) ΔFosBနှင့် FosB ၏အကောင်းဆုံး data တွေကိုမှတ်တပ်ဆင်သော nonlinear ဆုတ်ယုတ်သုံးပြီး (ထိုသွေးခုန်နှုန်း-Chase ကွက်ကနေခန့်မှန်း) နှင့်ကျန်ရှိသောပရိုတိန်းပမာဏကိုမူရင်း၏ 50% ဖြစ်သောမှာအချိန်ကိုက်ညီတဲ့ခဲ့ကြသည်။ အားလုံးကိန်းဂဏန်းများများတွင်ပြသရလဒ်ကအနည်းဆုံးနှစ်ခုမှသုံးလွတ်လပ်သောစမ်းသပ်ချက်၏ကိုယ်စားလှယ်ဖြစ်ကြသည်။ အားလုံးဂရပ်များအတွက်, ပြထားတဲ့ဒေတာ SEMs (3 ±ပျမ်းမျှရှိပါတယ်≤ n ≤16) ။ ကွဲပြားခြားနားမှု၏စာရင်းအင်းအရေးပါမှုတစ်ခု unpaired သုံးပြီးအကဲဖြတ်ခဲ့သည် t စမ်းသပ်မှုမျိုးစုံနှိုင်းယှဉ်ဘို့အတညျ့, နှင့်နေရာတွေမှာကြယ်ပွညွှန်ပြ p ≤ 0.05 ။

ယခင်ပုဒ်မnext ကိုပုဒ်မ

ရလဒ်များ

ΔFosBအနေနဲ့ထူးထူးခြားခြားတည်ငြိမ်ကူးယူအချက်ဖြစ်ပါသည်

ကျနော်တို့ΔFosB (ကအတော်လေးတည်ငြိမ်ကူးယူအချက်ကြောင်းယခင်ကခန့်မှန်းသုံးသပ်သည်ကြပေမယ့်Nestler et al ။ , 2001), ပရိုတိန်း၏လည်ပတ်ငွေကြေးကြောင့်ပရိုဖိုင်းကိုတစ်တိုက်ရိုက်ခွဲခြမ်းစိတ်ဖြာယနေ့အထိဖျော်ဖြေနိုင်ခြင်းမရှိသေးပေ။ ဤမေးခွန်းကိုဖြေရှင်းရန်ကျနော်တို့ကျယ်ကျယ်ΔFosBယာယီတစ် recombinant ရေယုန် simplex virus ကို (HSV-ΔFosB) နဲ့ရောဂါကူးစက်မှုကနေတဆင့်ထုတ်ဖော်ပြောဆိုခဲ့သည့်အတွက်အာရုံခံဆဲလျကဲ့သို့သောဆဲလ်လိုင်းအဖြစ်အသုံးပြုခဲ့ကြရာ PC12 ဆဲလ်ကို အသုံးပြု. သွေးခုန်နှုန်း-Chase စမ်းသပ်ချက်ပြုလုပ်ခဲ့သည်။ အသစ်ဖန်တီးပရိုတိန်းဇီဝြဖစ်နဲ့အတူတံဆိပ်ကပ်ခဲ့သည် 35က S-Met / Cys နှင့်များ၏ပျက်စီးခြင်းပုံစံ 35က S-တံဆိပ်ကပ်ΔFosB (35က S-ΔFosB) ကို radiolabeled အမိုင်နိုအက်ဆစ်များဖယ်ရှားရေးပြီးနောက်အမျိုးမျိုးသောအချိန်အချက်များမှာရရှိသောဆဲလ် lysates ကနေ immunoprecipitating နေဖြင့်စောင့်ကြည့်ခဲ့သည်။ SDS-စာမကျြနှာမြားနှငျ့ autoradiography အားဖြင့် immunoprecipitative ၏ analysis (PC12 ဆဲလ်တွေမှာရှိတဲ့ΔFosB၏ဝက်ဘဝ ~10 ဇကြောင်းထင်ရှားသဖန်းသီး။ 1) ။ ဤရွေ့ကားတွေ့ရှိချက်ΔFosB၏ဝက်ဘဝကိုအပြည့်အဝအရှည် FosB အပါအဝင်အများဆုံးသွေးဆောင်ကူးယူအချက်များ (ဆွေးနွေးချက်ကိုကြည့်ပါ) ၏ထက်ပိုမိုမြင့်မားကြောင်းပြဆဲလ်ယဉ်ကျေးမှု၌အဘယ်သူ၏ဝက်ဘဝ ~90 မိဖြစ်သတင်းပို့ခဲ့ပြီး (Dobrazanski et al ။ , 1991; Carl et al ။ 2004) ။ ထို့အပြင်ကြောင့်ΔFosB၏ပျက်စီးခြင်းတစ်ဦးပထမဦးဆုံးဒီဂရီအဆယိုယွင်းကွေး fit ပါဘူး, ဒါပေမယ့်မဟုတ်ဘဲကြောင့် biphasic ဖြစ်ပါသည်, တစ်ဦးနှေးကွေးပျက်စီးခြင်းမှုနှုန်းနှင့်အတူချွတ်စတင်သတိပြုမိကျိုးနပ်သည်။ ဤသည်တစ်ဦးထက်ပိုΔFosBမျိုးစိတ်နှင့် / သို့မဟုတ်တစ်ဦးထက်ပိုပျက်စီးခြင်းလမ်းကြောင်း၏တည်ရှိမှုအကြံပြုထားသည်။

ပုံ 1 ။

ပိုကြီးတဲ့ဗားရှင်းကိုကြည့်ရန်:

ပုံ 1 ။

ΔFosBအနေနဲ့ထူးထူးခြားခြားတည်ငြိမ်ကူးယူအချက်တခုဖြစ်ပါသည်။ ΔFosB၏ဝက်ဘဝဆဲလ်ယဉ်ကျေးမှု၌ ~10 ဇဖြစ်ပါတယ်။ ΔFosBΔFosBပါဝင်သော plasmid နှင့်အတူ HSV-ΔFosBသို့မဟုတ်ယာယီ transfection နှင့်အတူဖြစ်စေရောဂါကူးစက်နေဖြင့် PC12 ဆဲလ်ထဲမှာထုတ်ဖော်ပြောဆိုခဲ့ပါတယ်နှင့်ဆဲလ် pulse-Chase မှစမ်းသပ်ချက်ပစ္စည်းများနှင့်နည်းလမ်းများထဲမှာဖော်ပြထားတဲ့အတိုင်းအကြောင်းမဲ့ခဲ့ကြသည်။ ညီမျှရလဒ်များကိုမသက်ဆိုင်ΔFosB overexpress ဖို့အသုံးပြုတဲ့နည်းလမ်း၏ရရှိသောခဲ့ကြသည်။ အဆိုပါကိန်းဂဏန်းΔFosBပျက်စီးခြင်း၏အချိန်သင်တန်း (နှင့်ကိုယ်စားလှယ် autoradiogram) ပြသထားတယ်။ ကြံစည်အဆိုပါဒေတာကိုအနည်းဆုံးငါးလွတ်လပ်သောစမ်းသပ်ချက်ထံမှရရှိသောကအနည်းဆုံး 15 တစ်ဦးချင်းဒေတာမှတ်၏ပျမ်းမျှ± SEM ဖြစ်ကြသည်။ နှိုင်းယှဉ်မှုအဘို့, Full-အရှည် FosB ၏အစီရင်ခံဝက်ဘဝကိုညွှန်ပြနေသည်။

ΔFosBဦးနှောက်ထဲမှာ phosphoprotein ဖြစ်ပါသည်

ကျနော်တို့ΔFosB၏ posttranslational ပြုပြင်မွမ်းမံင်း၏သရုပ်တည်ငြိမ်ရေးကိုအထောက်အကူဖြစ်စေခြင်းအလိုငှါတွေးဆကြသည်။ phosphorylation (ပြန်လည်သုံးသပ်တွေ့၎င်းတို့၏တည်ငြိမ်မှုအပါအဝင်နည်းလမ်းများစွာအတွက်ကူးယူအချက်များများ၏လှုပ်ရှားမှု modulate ပြထားပြီးဖြစ်သောကြောင့် Desterro et al ။ , 2000; Whitmarsh နှင့် Davis က, 2000), ကျနော်တို့ΔFosBတစ် phosphoprotein ရှိမရှိစုံစမ်းစစ်ဆေး။ ဒီအဆုံး, ΔFosBစကားရပ်အထူးသဖြင့်တိုကျရိုကျ cortex အတွက်နာတာရှည်လိမ်လည်မှုများ, ΔFosB၏မြင့်မားသွေးဆောင်လူသိများနေတဲ့ကုသမှုကို အသုံးပြု. ကြွက်ဦးနှောက်ထဲမှာသွေးဆောင်ခဲ့သည် (et al မျှော်လင့်ပါတယ်။ , 1994a) ။ တစ်နေ့မှာတော့ΔFosBအဆင့်ဆင့်မြင့်သောကျန်ရှိနေသေးသည့်အခါနောက်ဆုံးလိမ်လည်မှုများကိုကုသမှုပြီးနောက်, ပါးလွှာတိုကျရိုကျ cortical ချပ်ပြင်ဆင်ထားခဲ့ကြခြင်းနှင့်ဇီဝြဖစ်နဲ့အတူတံဆိပ်ကပ် 32P-orthophosphate ။ ချပ်၏တစ်ဦးကအပြိုင်အစု radiolabeled မဟုတ်ခဲ့, ဤစုစုပေါင်းΔFosBအဆင့်ဆင့် detect လုပ်ဖို့အသုံးပြုခဲ့ကြသည်။ တိကျတဲ့ Anti-FosB / ΔFosB antibody ကိုနှင့် SDS-စာမျက်နှာအားဖြင့် immunoprecipitated ပရိုတိန်း၏ခွဲခြာနှင့်အတူ immunoprecipitative ပြီးနောက် phosphorylated 32စုစုပေါင်းΔFosB immunoblotting အားဖြင့်ရှာဖွေတွေ့ရှိခဲ့သည်သော်လည်း, P-တံဆိပ်ကပ်ΔFosB, autoradiography အားဖြင့်ရှာဖွေတွေ့ရှိခဲ့သည်။ တိကျတဲ့ခြင်းဖြင့်သက်သေအဖြစ်ဤခွဲခြမ်းစိတ်ဖြာ, ΔFosBဦးနှောက်ထဲမှာ phosphorylated ကြောင်းထင်ရှား 32အဆိုပါနာတာရှည်ကုသဦးနှောက်နမူနာအတွက် ~35 KDA ပစ္စုပ္ပန်၏, P-တံဆိပ်ကပ်တီးဝိုင်းပေမယ်အတုအယောင်-ကုသထိန်းချုပ်မှုအတွက်နီးပါးသိရှိနိုင်ဖြစ်ပါတယ် (သဖန်းသီး။ 2A) ။ ဒါဟာနာတာရှည်ဆွ၏မရှိခြင်းအတွက်ΔFosB၏ Basal အဆင့်ဆင့်ကအရမ်းနိမ့်ဖြစ်ကြဆိုတဲ့အချက်ကိုနှင့်ကိုက်ညီသည်။ အဆိုပါ immunoprecipitative တုံ့ပြန်မှုများ၏အထူး nonimmune IgG မိုးရွာသွန်းမှုအတွက်အချက်ပြ၏မရှိခြင်းအားဖြင့်သရုပ်ဖော်ထားသည်။

ပုံ 2 ။

ပိုကြီးတဲ့ဗားရှင်းကိုကြည့်ရန်:

ပုံ 2 ။

ΔFosBဦးနှောက်ထဲမှာ phosphoprotein ဖြစ်ပါတယ်။ A, ΔFosBဦးနှောက်ထဲမှာ phosphorylated ဖြစ်ပါတယ်။ ပစ္စည်းများနှင့်နည်းလမ်းများထဲမှာဖော်ပြထားတဲ့အတိုင်း Endogenous ΔFosBနာတာရှည်လိမ်လည်မှုများကိုကုသမှုအားဖြင့်ကြွက်ဦးနှောက်ထဲမှာသွေးဆောင်ခဲ့သည်။ တိုကျရိုကျ cortical ချပ်ဇီဝြဖစ်နဲ့အတူတံဆိပ်ကပ်ခဲ့သည် 32PH သည်3PO4 နာရီပေါင်းများစွာအဘို့။ အဆိုပါချပ်၏တစ်သားတည်းဖြစ်တည်ခြင်းပြီးနောက်ΔFosB immunoprecipitated ခဲ့ပါတယ်နှင့် phosphorylated ΔFosB (32P-ΔFosB) autoradiography (ထိပ် panel က) ကရှာဖွေတွေ့ရှိခဲ့ပါတယ်။ nonradioactive immunoprecipitative အတွက်စုစုပေါင်းΔFosB immunoblotting (အောက်ခြေ panel က) ကရှာဖွေတွေ့ရှိခဲ့ပါတယ်။ အနုတ်လက္ခဏာထိန်းချုပ်မှုအဖြစ်တစ်ဦးအတုအယောင်-ကုသတိရိစ္ဆာန်နှင့် nonimmune IgG ၏ immunoprecipitative ပြနေကြသည်။ B, mouse ကိုΔFosBပရိုတိန်း sequence ကိုများအတွက်သက်ဆိုင်ရာခန့်မှန်းရမှတ်များနှင့်အတူကိုယ်စားလှယ်လောင်း phosphorylation က်ဘ်ဆိုက်များနှင့် kinases ကွန်ပြူတာအသုံးချဇီဝဗေဒခွဲခြမ်းစိတ်ဖြာဖြင့်ရရှိသောခဲ့ကြသည်။ မြင့်ခန့်မှန်းရမှတ်များနှင့်အတူကိုယ်စားလှယ်လောင်းက်ဘ်ဆိုက်များပရိုတိန်း sequence ကိုအတွက်မီးမောင်းထိုးပြခြင်းနှင့် table ထဲမှာစာရင်းသွင်းဖော်ပြထားပါသည်။ အဆိုပါ DNA ကို-binding (အခြေခံ) ဒိုမိန်းနှင့် leucine ဇစ်ပရိုတိန်း sequence ကိုအတွက်ရဲရင့်၌ရှိကြ၏။ C, D, ΔFosB phosphorylation အဆိုပါ SER / Thr phosphatase inhibitor oa တိုးပွားလာနေသည်။ C, 32မရှိခြင်း (CTR) သို့မဟုတ် 100 ng / ml oa (ဂရပ်နှင့်ထိပ်တန်း panel က) ၏ရှေ့တော်၌တံဆိပ်ကပ်တိုကျရိုကျ cortical ချပ်ကနေ immunoprecipitative အတွက်, P-ΔFosBအဆင့်ဆင့် autoradiography နေဖြင့်တွေ့ရှိခဲ့ကြသည်။ အောက်ခြေ panel ကစုစုပေါင်းΔFosB immunoblotting ခြင်းဖြင့်ခေါင်းစဉ်မသိချပ်ကနေ immunoprecipitative တွေ့ရှိပြသထားတယ်။ D, PC12 ဆဲလ် HSV-ΔFosBသို့မဟုတ် HSV-LacZ (vector) နဲ့ကူးစက်နှင့်ဇီဝြဖစ်နဲ့အတူတံဆိပ်ကပ်ခဲ့သည် 32PH သည်3PO4 မရှိခြင်း (CTR) သို့မဟုတ် 100 ng / ml oa ၏ရှေ့တော်၌။ 32immunoprecipitative အတွက်, P-ΔFosBအဆင့်ဆင့် autoradiography (ဂရပ်ထိပ်တန်း panel က) ကရှာဖွေတွေ့ရှိခဲ့ကြသည်။ အောက်ခြေ panel ကစုစုပေါင်းΔFosB immunoblotting အားဖြင့်ဆဲလ် lysates တွေ့ရှိပြသထားတယ်။

kinase (s) နှင့်ဆိုဒ် (s) ကိုΔFosB phosphorylation တွင်ပါဝင်ပတ်သက်နေသော elucidating ဆီသို့တစ်ဦးပထမဦးဆုံးခြေလှမ်းအဖြစ်ကျနော်တို့တော်တော်များများကွန်ပြူတာအသုံးချဇီဝဗေဒဆန်းစစ်ခြင်းများပြုလုပ်ထားခြင်းရန်၎င်း၏အမိုင်နိုအက်ဆစ် sequence ကိုအကြောင်းမဲ့။ ဤ (သုံးမျိုး CaMKII က်ဘ်ဆိုက်များ, သုံး CK2 က်ဘ်ဆိုက်များနှင့်အလွန်မြင့်မား phosphorylation ခန့်မှန်းရမှတ်များနှင့်အတူနှစ်ဦးကို PKC က်ဘ်ဆိုက်များအပါအဝင်ΔFosBမျှ Tyr phosphorylation ကိုယ်စားလှယ်လောင်းက်ဘ်ဆိုက်များပါရှိသည်ပေမယ့်, ကအတော်ကြာ SER / Thr kinase သဘောတူညီမှုက်ဘ်ဆိုက်များဆံ့မထုတ်ဖော်သဖန်းသီး။ 2B) ။ ကွန်ပြူတာအသုံးချဇီဝဗေဒမှတဆင့်ဟောကိန်းထုတ်ထားတဲ့အတိုင်း, ΔFosBသာ SER သို့မဟုတ် Thr အကြွင်းအကျန်အပေါ် phosphorylated သည်လျှင်, ယင်း၏ phosphorylation သိသိသာသာ SER / Thr phosphatases ၏လှုပ်ရှားမှုအားဖြင့် modulated ရပါမည်။ ဒီယူဆချက်ကိုစမ်းသပ်ဖို့ကျနော်တို့နှင့်အတူတိုကျရိုကျ cortical ချပ်တံဆိပ်ကပ် 32oa တစ် SER / Thr ပရိုတိန်း phosphatase inhibitor ၏ရှေ့မှောက်တွင်သို့မဟုတ်မရှိခြင်းအတွက်, P-orthophosphate ။ မှာပြထားတဲ့အတိုင်း ပုံ 2C, oa တိုးပွါးတစ်ဦးကြီးများ (~2.5-ခွံ) ဖြစ်ပေါ်စေ 32P-ΔFosB။ ဒါဟာအစ (Fos ပရိုတိန်းအပါအဝင်အများအပြားချက်ချင်းအစောပိုင်းမျိုးဗီဇသွေးဆောင်ရန်၎င်း၏စွမ်းရည်မှ oa ၏ကင်ဆာသက်ရောက်မှုချိတ်ဆက်ယခင်အစီရင်ခံစာများနှင့်ကိုက်ညီသောအရာ, စုစုပေါင်းΔFosBအဆင့်ဆင့်အတွက်သေးငယ်တဲ့တိုးစေသောMiller က et al ။ , 1998; Choe et al ။ , 2004) ။ အဆိုပါအသားတင်ရလဒ် phosphorylated ΔFosBအဆင့်ဆင့်အတွက်သိသာထင်ရှားသောခြုံငုံတိုး (~60%) ဖြစ်ပါတယ်။

ကျနော်တို့ထို့နောက်စမ်းသပ်ကိုင်တွယ်ဖို့ပိုပြီးအာမင်နေသော PC12 ဆဲလ်၌ΔFosBဦးနှောက်တွင်တွေ့မြင်ကြောင်းဆင်တူတဲ့ phosphorylation ပုံစံပြခြင်းရှိမရှိစုံစမ်းစစ်ဆေး။ ကျနော်တို့ HSV-ΔFosBနှင့်အတူရောဂါကူးစက်မှတဆင့် PC12 ဆဲလ်တွေမှာရှိတဲ့ΔFosBထုတ်ဖော်ပြောဆိုခြင်းနှင့်ဇီဝြဖစ်အတူဆဲလ်တွေတံဆိပ်ကပ် 32oa ၏ရှေ့မှောက်တွင်သို့မဟုတ်မရှိခြင်းအတွက်, P-orthophosphate ။ HSV-ΔFosB-ကူးစက်ဆဲလ်ကနေပရိုတိန်း၏အောင်မြင်သောစကားရပ်နှင့် immunoprecipitative (ထို immunoblot အတွက်နှစ်ဦးစလုံးရှေ့မှောက်တွင်အားဖြင့်ပြသသဖန်းသီး။ 2D, အောက်ခြေ panel က) နှင့်အားနည်းချက်ကို-ကူးစက်ဆဲလ်တွေအတွက်ပျက်ကွက်တဲ့ ~35 KDA တီးဝိုင်းများ၏ autoradiograph (ထိပ် panel က) ။ ဦးနှောက်ထဲမှာလေ့လာတွေ့ရှိသည့်အတိုင်း oa စုစုပေါင်းΔFosBအဆင့်ဆင့်အတွက်သေးငယ်တဲ့တိုးပေမယ့်တစ်အများကြီးပိုမိုမြင့်မား (ခန့်မှန်းခြေအားဖြင့်နှစ်ဆ) တိုးစေသော 32ΔFosB phosphorylation အတွက်သိသာထင်ရှားသော (~50%) အသားတင်တိုးအတွက်ရရှိလာတဲ့, P-ΔFosB။ ထို့ပြင်ကွန်ပြူတာအသုံးချဇီဝဗေဒဟောကိန်းများနှင့်ကိုက်ညီတစ် Tyr phosphatase inhibitor နှင့်အတူ PC12 ဆဲလ်များ၏ကုသမှုသိသာထင်ရှားသောအပြောင်းအလဲများကိုဖြစ်ပေါ်ခဲ့ပါဘူး 32P-ΔFosBအဆင့်ဆင့် (Data ပြမပါ) ။ အတူတကွဤတွေ့ရှိချက်ΔFosBဦးနှောက်နှင့် PC12 ဆဲလ်တွေမှာရှိတဲ့ SER နှင့် / သို့မဟုတ် Thr အကြွင်းအကျန်အပေါ် phosphorylated ကြောင်းထင်ရှားခြင်းနှင့်နောက်ထပ်ΔFosB၏ phosphorylation နှင့်ပျက်စီးခြင်း profile များကိုလေ့လာရန်အတွက်အကောင်းတစ်ဆဲလ်ယဉ်ကျေးမှုစနစ်အဖြစ်အဆုံးစွန်အတည်ပြုပြောကြားခဲ့သည်။

CK2 သော်လည်းမ PKC သို့မဟုတ် CaMKII ΔFosB phosphorylates စသည်တို့အတွက်

အထက်တွင်ဖော်ပြခဲ့သည့်အတိုင်းΔFosBအမိုင်နိုအက်ဆစ် sequence ကို၏ခွဲခြမ်းစိတ်ဖြာ CK2, PKC နှင့် CaMKII phosphorylation ဆိုက်များအတွက်မြင့်မားသောခန့်မှန်းရမှတ်ဖော်ပြခဲ့တယ်။ ΔFosB phosphorylate စေခြင်းငှါဤအ kinases ၏ထားတဲ့ဆုံးဖြတ်ရန်ကျနော်တို့တစ်စီးရီးကောက်ယူ စသည်တို့အတွက် သန့် kinases နှင့်သန့် recombinant ΔFosBသုံးပြီး phosphorylation တုံ့ပြန်မှု။ မှာပြထားတဲ့အတိုင်း ပုံ 3Aယင်းသုံးကိုယ်စားလှယ်လောင်း kinases ၏, သာ CK2 သိသိသာသာထုံးစံ၌ΔFosB phosphorylated ။ ထို့အပြင်ခုနှစ်, အခြား kinases (ဥပမာ GSK3 နှင့် p70S6K) စမ်းသပ်ပြီးပေမယ့်သိသိသာသာΔFosB (Data ပြမဟုတ်) phosphorylate ပျက်ကွက်ခဲ့ကြသည်။ အချိန်သင်တန်းခွဲခြမ်းစိတ်ဖြာအားဖြင့် CK2 တုံ့ပြန်မှုများ၏အပိုဆောင်းစရိုက်လက္ခဏာတွေကဒီ kinase ΔFosB၏မှဲ့နှုန်းဖော့စဖိတ်၏ ~0.5 mol (များ၏ဆွဲသွင်းပါဝင် catalyze နိုင်သည်ကိုထုတ်ဖော်ပြသသဖန်းသီး။ 3B) ။ CK2 ΔFosB phosphorylate နိုငျသောအမှန်စင်စစ် စသည်တို့အတွက် တစ်ဦးစဉ်းစားဆင်ခြင်စရာ stoichiometry (~50%) မှတစ်ဦးဇီဝကမ္မသက်ဆိုင်ရာတုံ့ပြန်မှုရဲ့သဘောထားအကြံပြုချက်များဖြစ်ပါတယ်။ ကျနော်တို့ပြီးတော့စင်ကြယ်ΔFosB၏တိုးမြှင့်ပမာဏ၏ရှေ့တော်၌ CK2 incubating ဖွငျ့ဤတုံ့ပြန်မှုများ၏ kinetics လေ့လာခဲ့, ကြှနျုပျတို့ CK2 တစ်ဦးနှင့်အတူΔFosB phosphorylates ကြောင်းဆုံးဖြတ်သည် Vmax ကို 5.8 pmol ·မိ၏-1 ·μg-1 အင်ဇိုင်း၏တစ်ဦး KM 18.4 μmနှင့်တစ်ဦး၏ kကွောငျ 0.2 / s ကို (၏သဖန်းသီး။ 3C) ။ ဤအ kinetic parameters တွေကိုများအတွက်ရရှိသောတန်ဖိုးများထပ်မံဒီတုံ့ပြန်မှု၏ဇီဝကမ္မဆက်စပ်မှုထောက်ခံပါတယ်။ ဥပမာ, KM DARPP2 များအတွက် CK32 ၎င်း၏အကောင်းဆုံးလူသိများအလွှာတ 3.4 μmဖြစ်ပြီး, ၏ kကွောငျ ~0.3 / s ကို (ဖြစ်ပါတယ်Girault et al ။ , 1989); အဆိုပါ KM ~10-40 μm (ထံမှ ATP အပိုင်းအခြားများအတွက်Cochet et al ။ , 1983; ဆေးလ်ဗား-Neto et al ။ , 2002), နှင့် casein အဘို့အကြောင်း (~10-50 μmကနေလာနေကြပါတယ်Meggio et al ။ , 1977; Pyerin et al ။ , 1987) ။ အတူတူအဲဒီဒေတာΔFosB CK2 များအတွက်စစျမှနျသောအလွှာကြောင်းကိုညွှန်ပြ စသည်တို့အတွက်.

ပုံ 3 ။

ပိုကြီးတဲ့ဗားရှင်းကိုကြည့်ရန်:

ပုံ 3 ။

CK2 သော်လည်းမ PKC သို့မဟုတ် CaMKII ΔFosB phosphorylates စသည်တို့အတွက်။ အဆိုပါ autoradiograph (ထိပ် panel က) ကို phosphorylated ထုတ်ကုန်ကိုပြသလျက်, Coomassie-စွန်းဂျယ်လ် (အောက်ခြေ panel က) ကိုတုံ့ပြန်မှုအတွက်စုစုပေါင်းΔFosBပစ္စုပ္ပန်ပြသထားတယ်။ A, စင်ကြယ်စေ recombinant ΔFosBအကြောင်းမဲ့ခဲ့သည် စသည်တို့အတွက် (ပြနေကြသည်သုံးရာ၏) အမျိုးမျိုးသောကိုယ်စားလှယ်လောင်း kinases အားဖြင့် phosphorylation ။ B, အချိန်သင်တန်းနှင့် stoichiometric ဆန်းစစ်ခြင်းများပြုလုပ်ထားခြင်း CK2 ΔFosB phosphorylate နိုင်သည်ကိုညွှန်ပြ စသည်တို့အတွက် ~50% တစ် stoichiometry အတူ။ Cအဆိုပါ CK2 တုံ့ပြန်မှု၏ Kinetic ခွဲခြမ်းစိတ်ဖြာΔFosBတစ်စစျမှနျသောကြောင်းထင်ရှား စသည်တို့အတွက် အလွှာဟာ။ တုံ့ပြန်မှုများ၏ Linear တစ်ဦးကို double-အပြန်အလှန်ကြံစည်မှု (အောက်ခြေ) တွင်ပြသနေသည်, သို့သော် kinetic parameters တွေကိုပု Michaelis-Menten ကွေး (ထိပ်) မှဆင်းသက်လာခဲ့သည်။

CK2 နဂိုအတိုင်းဆဲလ်တွေမှာရှိတဲ့ΔFosB၏ phosphorylation နှင့်တည်ငြိမ်ရေး modulates

ΔFosB၏ CK2-mediated phosphorylation ၏ဇီဝကမ္မဆက်စပ်မှုအကဲဖြတ်ရန်ကျနော်တို့ကိုအသုံးပြုပြီးနှိုင်းယှဉ် phosphopeptide မြေပုံကောက်ယူ စသည်တို့အတွက် phosphorylated နှင့် PC12-ဆဲလ်-phosphorylated ΔFosB။ ၏ SDS-စာမကျြနှာမြားနှငျ့ဂျယ် elution ပြီးနောက် 32P-ΔFosB (အထံမှ စသည်တို့အတွက် တုံ့ပြန်မှုသို့မဟုတ်၏ immunoprecipitative ထံမှ 32P-label တပ်ထားသောဆဲလ်), ပရိုတိန်း trypsin နှင့်အတူကြေညက်ခဲ့ပါသည်, ထိုရရှိလာတဲ့ phosphopeptides Two-ရှုထောင်ခွဲခြာအကြောင်းမဲ့ခဲ့ကြသည်။ ဒါဟာဆန်းစစ်ပါ (CK2 တုံ့ပြန်မှုအနေဖြင့်အဓိက phosphopeptide PC12 ဆဲလ်တွေမှာရှိတဲ့ phosphorylated ΔFosBကနေနှစ်ခုအဓိက phosphopeptides တဦးနှင့်အတူ comigrated ကြောင်းထင်ရှားသဖန်းသီး။ 4A), အ PKC သို့မဟုတ် CaMKII ကနေရရှိလာတဲ့အတွက် phosphopeptides သော်လည်း (Data ပြမဟုတ်) တုံ့ပြန်မှုမဟုတ်ပြုလေ၏။ အဲဒီမှာ PC12 ဆဲလ်ကနေမြေပုံထဲမှာဒုတိယΔFosB phosphopeptide ပစ္စုပ္ပန်ခဲ့ပေမယ့်ဘာလို့လဲဆိုတော့ကျွန်တော်တစ်ဦးနှင့်ဆင်တူ phosphopeptide ထုတ်လုပ်ဖို့စမ်းသပ်ပြီးထားသော kinases မဆို၏နိုင်စွမ်းမရှိခြင်း၏ စသည်တို့အတွက်ကျနော်တို့လက်ရှိဒီဒုတိယ phosphopeptide အခြား phosphopeptide ကနေဒါမှမဟုတ်တူညီတဲ့ phosphorylation site ကိုင်တစ်ဦးကွဲပြား tryptic peptide ကိုကိုယ်စားပြုခြင်းရှိမရှိကွဲပြားခြားနားတဲ့ phosphorylation site ကိုပါရှိသည်ရှိမရှိမသိရပါဘူး။

ပုံ 4 ။

ပိုကြီးတဲ့ဗားရှင်းကိုကြည့်ရန်:

ပုံ 4 ။

CK2 နဂိုအတိုင်းဆဲလ်တွေမှာရှိတဲ့ΔFosB၏ phosphorylation နှင့်တည်ငြိမ်ရေး modulates ။ A, CK2 ပေမယ် PKC ဆဲလ်တွေမှာရှိတဲ့ΔFosB phosphorylate ဟန်ဘူး။ CK2 သို့မဟုတ် PKC အားဖြင့် phosphorylated ΔFosBနှစျယောကျရှုထောင် phosphopeptide မြေပုံ စသည်တို့အတွက် သို့မဟုတ်နဂိုအတိုင်း PC12 ဆဲလ်သည်။ မြှားတို့ကိုထို CK2-phosphorylated peptide ၏ comigration သော်လည်းမ PC12 ဆဲလ်ထံမှရရှိသောΔFosB phosphopeptides တဦးနှင့်အတူ PKC-phosphorylated တဦးတည်းပြသပါ။ B, PC12 ဆဲလ်တွေမှာရှိတဲ့ΔFosB phosphorylation အဆိုပါအစွမ်းထက် CK2 Active spermine (SP) နဲ့ဆဲလ်ကုသတိုးနှင့် CK2 inhibitor DRB နှင့်အတူကုသမှုအားဖြင့်ယုတ်လျော့နေသည်။ ဆနျ့ကငျြ, PC12 ဆဲလ်တွေမှာရှိတဲ့ΔFosB phosphorylation တစ် PKC Active (PMA) သို့မဟုတ် PKC-တိကျတဲ့ inhibitor calphostin-C ကို (Calph) တစ်ခုခုကိုနှင့်အတူကုသမှုကြောင့်ထိခိုက်မခံခဲ့ရပါဘူး။ တစ်ဦးကကိုယ်စားလှယ် autoradiogram (ထိပ် panel က) နှင့် immunoblot (အောက်ခြေ panel ကို) ပြသလျက်ရှိသည်။ ကို C-F ကို, ΔFosBတည်ငြိမ်ရေးအပေါ် CK2 လှုပ်ရှားမှု၏အကျိုးသက်ရောက်မှု။ အဆိုပါကိန်းဂဏန်းများΔFosBပျက်စီးခြင်း၏အချိန်သင်တန်း (နှင့်ကိုယ်စားလှယ် autoradiogram) ပြသပါ။ ယာယီΔFosBဖော်ပြ PC12 ဆဲလ် (pulse-Chase ဖို့ CK2 inhibitor DRB ၏မရှိခြင်းသို့မဟုတ်မျက်မှောက်၌ကောက်ယူစမ်းသပ်ချက်အကြောင်းမဲ့ခဲ့ကြသည်C), အ CK2 Active spermine (D), ဒါမှမဟုတ်ကျယ်ပြန့်ရောင်စဉ် kinase inhibitor ကို H-8 (E), အရာ DRB ၏ nonspecific သက်ရောက်မှုများအတွက်ထိန်းချုပ်ရန်အသုံးပြုခဲ့သည်။ F, ΔFosBတည်ငြိမ်ရေးအပေါ် CK2 ၏ catalytic subunit ချခေါက်၏အကျိုးသက်ရောက်မှု။ PC12 ဆဲလ်တစ် nontargeting siRNA (CTR) သို့မဟုတ် siRNA ဖြစ်စေနောက်ပိုင်းတွင်တစ်ဦးΔFosB plasmid နှင့်အတူ transfected ကြွက်CK2αနှင့် 24 ဇပစ်မှတ်ထားနှင့်အတူ transfected ခဲ့ကြသည်။ ထိပ် panel ကို CK2 နှင့်ΔFosBပရိုတိန်းပါဝင်မှုနှုန်းအပေါ် CK2 siRNA ၏အကျိုးသက်ရောက်မှုဖေါ်ပြခြင်းလုံးဆဲလ် lysates ၏ immunoblots သရုပ်ဖော်သည်။ β-tubulin များအတွက်သက်ဆိုင်ရာ immunoblot တစ်ဦးတင်ထိန်းချုပ်မှုအဖြစ်ပြသထားပါသည်။

နောက်ထပ်တစ်ဦးΔFosB kinase အဖြစ် CK2 ၏ဇီဝကမ္မဆက်စပ်မှုဖြေရှင်းရန်ကျနော်တို့ CK12 လှုပ်ရှားမှု modulate နှစ်ခုမူးယစ်ဆေးဝါးများနှင့်အတူΔFosB-ဖော်ပြ PC2 ဆဲလ်ကုသ။ မှာပြထားတဲ့အတိုင်း ပုံ 4B, ΔFosB phosphorylation (ဆဲလ်-permeable CK12 inhibitor DRB နှင့်အတူ PC2 ဆဲလ်များ၏ကုသမှုအားဖြင့်ယုတ်လျော့ခဲ့သည်Meggio et al ။ , 1990; Szyszka et al ။ , 1995), နှင့်အစွမ်းထက် CK2 Active ဖြစ်သိ polyamine spermine, (နဲ့အတူကုသမှုတိုးCochet နှင့် Chambaz, 1983; Meggio et al ။ , 1983) ။ အဆိုပါ PKC inhibitor calphostin-C မှာ (အတူ PC12 ဆဲလ်မတူဘဲ, ကုသမှုKobayashi et al ။ , 1989; Tamaoki et al ။ , 1990) သို့မဟုတ် PKC Active PMA (Schmidt နဲ့ Hecker, 1975; Beh et al ။ , 1989) ΔFosB phosphorylation အတွက်သိသာထင်ရှားသောအပြောင်းအလဲများကိုဖြစ်ပေါ်ခဲ့ပါဘူး။ PMA ၏ဖြစ်ရပ်မှာအနည်းငယ် (နှင့်သိသိသာသာမပါ) အတွက်ကိုတိုးမြှင့် 32P-ΔFosBဒီမူးယစ်ဆေးကြောင့်ဖြစ်ရတဲ့စုစုပေါင်းΔFosBအဆင့်ဆင့်အတွက်တိုးကတာဝန်ယူနိုင်; တကယ်တော့ကြောင့် (FosB အပါအဝင် phorbol Ester အများအပြား Fos မိသားစုပရိုတိန်း၏စကားရပ်သွေးဆောင်ကြောင်းအစီရင်ခံထားသည်Yoza et al ။ , 1992; Suh et al ။ , 2004) ။ တိကျသောဆဲလ်-permeable CaMKII inhibitor မီတာ-AIP (နဲ့အတူဆဲလ်ထို့ပြင်ကုသမှုIshida နှင့် Fujisawa, 1995; Stevens et al ။ , 1999) ကိုလည်း (Data ပြမပါ) ယုတ်လျော့ΔFosB phosphorylation ဖြစ်ပေါ်ခဲ့ပါဘူး။ အတူတကွဤရလဒ်များကိုကျွန်တော်တို့ရဲ့နှင့်ကိုက်ညီများမှာ စသည်တို့အတွက် တွေ့ရှိချက်များနှင့်နဂိုအတိုင်းဆဲလ်တွေမှာရှိတဲ့ΔFosBဖွယ်ရှိ CK2 သော်လည်းမ PKC သို့မဟုတ် CaMKII အားဖြင့် phosphorylated ကြောင်းဖော်ပြသည်။ CK2 တားစီးလုံးဝΔFosB phosphorylation တားဆီးမထားဘူးဆိုတဲ့အချက်ကိုပရိုတိန်းအတွက်အပိုဆောင်း phosphorylation က်ဘ်ဆိုက်များ၏တည်ရှိမှုဖော်ပြသည်။

ကျနော်တို့လာမယ့် CK2 ΔFosB၏လည်ပတ်ငွေကြေးကြောင့်နှင့်ဖြင့်ယင်း၏တည်ငြိမ်ရေးအတွက်အခန်းကဏ္ဍရှိမရှိဆန်းစစ်ခဲ့သည်။ ဒီအဆုံးကျနော်တို့ CK12 inhibitor ဒါမှမဟုတ် phosphorylation လေ့လာမှုမှာအသုံးပြုတဲ့ CK2 Active ဖြစ်စေနဲ့ကုသΔFosB-ဖော်ပြ PC2 ဆဲလ်တွေသုံးပြီးသွေးခုန်နှုန်း-Chase စမ်းသပ်ချက်ပြုလုပ်ခဲ့သည်။ မှာပြထားတဲ့အတိုင်း ပုံ 4Cအဆိုပါ CK2 inhibitor နှင့်အတူဆဲလ်များ၏ကုသမှု DRB biphasic တစ်ဦးထံမှအဆယိုယွင်း၏ရန်နီးကပ်လာသောကွေးရန်၎င်း၏ပျက်စီးခြင်းကွေး၏ပုံသဏ္ဍာန်အတွင်းအပြောင်းအလဲကသက်သေΔFosB၏လည်ပတ်ငွေကြေးကြောင့်နှုန်းအပေါ်သိသိသာသာအကျိုးသက်ရောက်မှုရှိခဲ့ပါတယ်။ ပြောင်းပြန်ဟာ CK2 Active spermine ၏ရှေ့မှောက်တွင်ပါ (Chase ၏ပထမဦးဆုံးနာရီအတွင်းပရိုတိန်းများစုစည်းနေခြင်းမှဦးဆောင်သောΔFosB၏ပျက်စီးခြင်းနှုန်းမှာတစ်ဦးသိသိသာသာလျော့နည်းသွားစေ၏သဖန်းသီး။ 4D).

အများအပြား kinase Active နှင့် inhibitors နှင့်အတူအမှုသည်အတိုင်း, spermine နှင့် DRB CK2 လှုပ်ရှားမှုများ၏မော်ဂျူအပြင်ဘက်တွင်ဇီဝဖြစ်စဉ်သက်ရောက်မှုရှိနိုင်ပါသည်။ တကယ်တော့, DRB (kinase -associated အဆိုပါကူးယူအချက် IIH (TFIIH) တားစီးပြခဲ့ပြီးYankulov et al ။ , 1995), အရာ RNA polymerase II ကို-mediated ကူးယူ၏တားစီးမှု။ ဒီသက်ရောက်မှုကိုပဋိသန္ဓေ ယူ. ΔFosB၏တည်ငြိမ်မှုကိုထိခိုက်စေနိုင်ကြောင်းသောကြောင့်, ငါတို့သည်ကျယ်ပြန့်ရောင်စဉ် kinase inhibitor ကို H-8 (များ၏အကျိုးသက်ရောက်မှုကိုသုံးသပ်Hidaka နှင့် Kobayashi, 1992) ΔFosBလည်ပတ်ငွေကြေးကြောင့်အပေါ် TFIIH-ဆက်စပ် kinase သော်လည်းမ CK200 (တားစီးဖို့လူသိများနေတဲ့အာရုံစူးစိုက်မှု (2 μm) မှာYankulov et al ။ , 1995) ။ မှာပြထားတဲ့အတိုင်း ပုံ 4E, H-8 နှင့်အတူကုသမှုΔFosB၏လည်ပတ်ငွေကြေးကြောင့်နှုန်းကိုမထိခိုက်ခဲ့ပါဘူး။ အလားတူရလာဒ်များကို H-7, TFIIH-ဆက်စပ် kinase သော်လည်းမ CK2 (Data ပြမဟုတ်) ဖြစ်စဉ်ကိုတားဆီးပေးပါတယ်တဲ့အာရုံစူးစိုက်မှုမှာအသုံးပြုသောအခြားကျယ်ပြန့်ရောင်စဉ် kinase inhibitor နှင့်အတူရယူခဲ့ကြသည်။ ဤရွေ့ကား data တွေကိုထပ်မံ DRB ကြောင့်ဖြစ်ရတဲ့ΔFosBတည်ငြိမ်ရေးအတွက်လျော့ချရေးအများဆုံးဖွယ်ရှိတွေကပေါ်ကနေ CK2 ၏တားစီးဖို့ဖြစ်ပါတယ်သောအနက်ကိုထောက်ခံပါတယ်။

နောက်ထပ်ΔFosBလည်ပတ်ငွေကြေးကြောင့်အတွက် CK2 ၏အခန်းကဏ္ဍကိုတည်ထောင်ရန်ကျနော်တို့ siRNA မှတဆင့် CK2 ချခေါက်၏အကျိုးဆက်များကိုစုံစမ်းစစ်ဆေး။ ကျနော်တို့ပထမဦးဆုံး siRNA ဒါမှမဟုတ်ကြွက် CK12 (CK2α) ၏ catalytic subunit ၏ mRNA နှင့် 2 ဇအကြာတွင်ΔFosBနှင့်အတူ transfected ပစ်မှတ်ထားတဲ့ siRNA (nontargeting) ထိန်းချုပ်မှုနှင့်အတူ transfected ခဲ့ PC24 ဆဲလ်တွေသုံးပြီး, ဤစမ်းသပ်ချက်ဖျော်ဖြေခဲ့ပါတယ်။ မှာပြထားတဲ့အတိုင်း ပုံ 4FအဆိုပါCK2α siRNA နှင့်အတူ transfection ထိထိရောက်ရောက်နဲ့အထူးသΔFosBအဆင့်ဆင့် (ထိပ် panel က) ထိခိုက်ခြင်းမရှိဘဲCK2αပရိုတိန်းပါဝင်မှုနှုန်းကိုဆင်းခေါက်။ သွေးခုန်နှုန်း-Chase ခွဲခြမ်းစိတ်ဖြာ CK2 ချခေါက်ပရိုတိန်း၏ပိုမြန်ပျက်စီးခြင်းအားဖြင့်သက်သေအဖြစ်ΔFosBလည်ပတ်ငွေကြေးကြောင့်နှုန်းမှာတစ်ဦးသိသိသာသာတိုးအတွက်ရလဒ်ကဖော်ပြတယ်။ CK2 activation အဘို့ခိုင်ခံ့ထောက်ခံမှုပေးသည်, ထိုမျဉ်းကွေး၏နှေးကွေးသောအဆင့်တိုးမြှင့်သော်လည်းဟန့်တား CK2 လှုပ်ရှားမှု (DRB ကုသမှုသို့မဟုတ် siRNA မှတဆင့်ရှိမရှိ), အ biphasic ကွေး၏နှေးကွေးသောနှုန်းအစိတ်အပိုင်းများ၏ပျောက်ဆုံးမှုအတွက်ΔFosBနှင့်ရလဒ်များ၏လည်ပတ်ငွေကြေးကြောင့်တိုးပွါးဆိုတဲ့အချက်ကို CK2 ΔFosBတည်ငြိမ်မှုကိုထိန်းညှိအတွက်အခန်းကဏ္ဍသောစိတ်ကူး။

CK2 Ser27 အပေါ်ΔFosB phosphorylates

CK2 အားဖြင့် phosphorylated ΔFosBပေါ်တွင်ဆိုဒ် (s) ကိုသိရှိနိုင်ဖို့စတင်ကျနော်တို့ CK2 အားဖြင့် phosphorylated recombinant ΔFosB၏ phospho-အမိုင်နိုအက်ဆစ်ခွဲခြမ်းစိတ်ဖြာကောက်ယူ စသည်တို့အတွက် နှင့်ΔFosB၏ PC12 ဆဲလ်တွေမှာရှိတဲ့ phosphorylated ။ ဤရွေ့ကားစမ်းသပ်ချက်ဖြစ်ရပ်နှစ်ခုစလုံးအတွက်တစ်ခုတည်းသော phospho-အမိုင်နိုအက်ဆစ်ရှာဖွေတွေ့ရှိကြောင်းထင်ရှား (phospho-SER ခဲ့သည်သဖန်းသီး။ 5A) ။ အဆိုပါ CK2 များအတွက်ရရှိသောအတူတကွ stoichiometry နှင့်အတူဤတွေ့ရှိချက်, စသည်တို့အတွက် phosphorylation တုံ့ပြန်မှု (~50%) (သဖန်းသီး။ 3B) နှင့် CK2 phosphopeptide မြေပုံပေါ်တွင်တစ်ဦးတည်းသာသိသာထင်ရှားသောအစက်အပြောက်၏ရှေ့မှောက်တွင် (သဖန်းသီး။ 4A), ΔFosB၏ CK2 phosphorylation ဖြစ်ကောင်းတစ်ခုတည်း serine ကျန်ကြွင်းကန့်သတ်ကြောင်းအကြံပြုထားသည်။ ဒါကနိဂုံးချုပ်အဆိုပါ phosphorylation သဘောတူညီမှု site ကိုခွဲခြမ်းစိတ်ဖြာနှင့်အတူတသမတ်တည်းဖြစ်တယ် (သဖန်းသီး။ 2B), CK27 များအတွက်တစ်ဦးတည်းသာကိုယ်စားလှယ်လောင်း serine, ဆိုလိုသည်မှာ, Ser2, ခန့်မှန်းရသော။ Taxonomic ခွဲခြမ်းစိတ်ဖြာ Ser27 အလွန်အမင်း Fos မိသားစုဝင်များ (အကြားဆင့်ကဲဖြစ်စဉ်မှတဆင့်ထိန်းသိမ်းထားကြောင်းထင်ရှားသဖန်းသီး။ 5B), ကအရေးပါသောဇီဝကမ္မ function ကိုကိုထမ်းစေခြင်းငှါအကြံပြုခြင်း။

ပုံ 5 ။

ပိုကြီးတဲ့ဗားရှင်းကိုကြည့်ရန်:

ပုံ 5 ။

CK2 Ser27 အပေါ်ΔFosB Phosphorylates ။ ACK2-phosphorylated ၏, Phosphoamino အက်ဆစ်ခွဲခြမ်းစိတ်ဖြာ (စသည်တို့အတွက်) နှင့် PC12 ဆဲလ်-phosphorylated ΔFosBဖြစ်ရပ်နှစ်ခုစလုံးအတွက် phosphorylated အဓိကကျန်ကြွင်း serine ဖြစ်ပါသည်, ကြောင်းဖေါ်ပြခြင်း။ B, FosB / ΔFosBအမိုင်နိုအက်ဆစ် sequence ကို၏ Cross-မျိုးစိတ်ခွဲခြမ်းစိတ်ဖြာလူ့ထံမှ zebrafish (မှောင်မိုက်မီးမောင်းထိုးပြ) မှ Fos မိသားစုအင်္ဂါတို့တွင် Ser27 မြင့်မားထိန်းသိမ်းရေးဖော်ပြခဲ့တယ်။ သို့သော်အနေအထား + ပု CK3 သဘောတူညီမှု site ကိုလိုအပ်သော 2 မှာအက်ဆစ်ကျန်ကြွင်း, (အလင်းမီးမောင်းထိုးပြ) ထိန်းသိမ်းထားခြင်းမရှိပါ။ C, HeLa ဆဲလ်ယာယီရိုင်း-type အမျိုးအစားΔFosB (WT) သို့မဟုတ်ΔFosBဖြစ်စေ Ala (S27A) နဲ့ Ser27 အစားထိုးမယ့်အချက် mutation ်နှင့်အတူ transfected ခဲ့ကြသည်။ ဆဲလ်ဇီဝြဖစ်နဲ့အတူတံဆိပ်ကပ်ခဲ့သည် 32PH သည်3PO4 နှင့်မော်တော်ယာဉ်နှင့်အတူသို့မဟုတ် CK2 သက်ဝင်စေဖို့ spermine (SP) နဲ့ဆက်ဆံခဲ့တယ်။ အဆိုပါရရှိသောΔFosB immunoprecipitative ၏ကိုယ်စားလှယ် autoradiogram (ထိပ် panel က) နှင့် immunoblot (အောက်ခြေ panel ကို) ပြသလျက်ရှိသည်။ လှောင်ပြောင်-transfected ဆဲလ် (vector) ၏ immunoprecipitative ပြသနေသည်။

Ser27 ΔFosBအတွက် phosphorylated ရှိမရှိဆုံးဖြတ်ရန်, ငါတို့ Ala ဤကျန်ကြွင်း mutated, နှင့်ပရိုတိန်း၏ phosphorylation status ကိုအပေါ်အကျိုးဆက်များခွဲခြမ်းစိတ်ဖြာ။ ဒီအဆုံးကျနော်တို့ယာယီ WT သို့မဟုတ် S27A Mutant ΔFosBဖြစ်စေထုတ်ဖော်ပြောဆိုဖို့ (ပိုမိုမြင့်မားထိရောက်မှုနှင့်အတူ transfected နိုင်သည့်) HeLa ဆဲလ်တွေကိုအသုံးပြုခဲ့သည်။ ခန့်မှန်းခြေအားဖြင့် 24 ဇ transfection ပြီးနောက်, ဆဲလ်ဇီဝြဖစ်နဲ့အတူတံဆိပ်ကပ်ခဲ့သည် 32P-orthophosphate နှင့်မြေတပြင်လုံး-ဆဲလ် lysates ကိုပြင်ဆင်ခဲ့ကြသည်။ immunoprecipitative နှင့် SDS-စာမကျြနှာကိုအောက်ပါ, 32P-ΔFosB immunoblotting အားဖြင့် autoradiography နှင့်စုစုပေါင်းΔFosBအားဖြင့်ရှာဖွေတွေ့ရှိခဲ့သည်။ မှာပြထားတဲ့အတိုင်း ပုံ 5C (အောက်ခြေ panel က) ဆဲလ်ဖြစ်စေ WT သို့မဟုတ် S27A Mutant ΔFosBအောင်မြင်စွာပရိုတိန်းထုတ်ဖော်ပြောဆိုနှင့်အတူ transfected သော်လည်း, ΔFosB, ထိုအားနည်းချက်ကို-transfected ဆဲလ်ထဲမှာ detected မခံခဲ့ရပါဘူး။ ကျနော်တို့ S27A mutation အတွက်သိသာထင်ရှားသော (~30%) လျှော့ချရေးဖြစ်ပေါ်စေကြောင်းတွေ့ရှိ 32P-ΔFosBအဆင့်ဆင့် (သဖန်းသီး။ 5C, သက်ရှိဆဲလ်ထဲမှာΔFosB Ser27 အပေါ် phosphorylated ကြောင်းညွှန်ပြထိပ်တန်း panel ကနှင့်ဂရပ်) ။ ဆဲလ်တွေမှာရှိတဲ့ Ser27 အမှန်ပင် CK2 အားဖြင့် phosphorylated ဖြစ်ပါတယ်ရှိမရှိတည်ထောင်ရန်ကြိုးပမ်းတှငျကြှနျုပျတို့ WT နှင့် S2A ΔFosB၏ phosphorylation modulate ဖို့ CK27 Active spermine များ၏စွမ်းရည်ကိုနှိုင်းယှဉ်။ ကျနော်တို့ PC12 ဆဲလ် (ယခင်ကလေ့လာတွေ့ရှိခဲ့ကြောင်းအဖြစ်သဖန်းသီး။ 4B), spermine နှင့်အတူ HeLa ဆဲလ်များ၏ကုသမှုကိုသိသိသာသာ WT ပရိုတိန်း၏ phosphorylation တိုးတက်လာခဲ့သည်။ ဒီအကျိုးသက်ရောက်မှုသိသိသာသာ S27A mutation အားဖြင့်လျော့ခဲ့ပါတယ်ဆိုတဲ့အချက်ကို (သဖန်းသီး။ 5C) ΔFosBအတွက် Ser27 CK2 များအတွက်ဇီဝကမ္မအလွှာသောအနက်ကိုထောက်ခံပါတယ်။

Ser27 ၏ Phosphorylation ΔFosB၏တည်ငြိမ်မှုကိုထိန်းညှိ

CK2 activated သောအခါ CK2 (inhibited နှင့်မြှင့်တင်ရန်သောအခါΔFosB၏တည်ငြိမ်မှုကိုလျော့နည်းသွားကြောင်းထူထောင်ဘဲလျက်သဖန်းသီး။ 4), နှင့် CK2 Ser27 အပေါ်ΔFosB phosphorylates ကြောင်း (သဖန်းသီး။ 5), ကြှနျုပျတို့သညျဤ site ၏ phosphorylation တားဆီးပရိုတိန်းမတည်မငြိမ်ဖြစ်စေတယ်သင့်ကြောင်းခန့်မှန်းခဲ့ပါတယ်။ HeLa ဆဲလ်ယာယီ WT သို့မဟုတ် S27A Mutant ΔFosBဖြစ်စေဖော်ပြနှင့်အတူကောက်ယူ Pulse-Chase စမ်းသပ်ချက်ဟောကိန်းထုတ်သကဲ့သို့, S27A mutation ΔFosB၏ပျက်စီးခြင်း၏နှုန်းမှာတစ်ဦးသိသိသာသာတိုးများနှင့်ပရိုတိန်း၏ထက်ဝက်-အသက်တာ၌တစ်ဦး concomitant ကျဆင်းခြင်းအတွက်ရလဒ်, ထိုထုတ်ဖော်ပြသ (သဖန်းသီး။ 6A) ။ ကျနော်တို့ဖြစ်လျှင်ဤစည်းမျဉ်းယန္တရားကိုလည်းပိုပြီးအာရုံခံဆဲလျကဲ့သို့သော PC12 ဆဲလ်အညီဖြစ်ပေါ်ခြင်းရှိမရှိစုံစမ်းစစ်ဆေး။ ဤရွေ့ကားစမ်းသပ်ချက် (ကြှနျုပျတို့ HeLa ဆဲလ်တွေအတွက်လေ့လာတွေ့ရှိခဲ့ကြောင်းသကဲ့သို့, S27A အမှတ် mutation (~12 ထံမှ ~11 ဇမှ) PC4 ဆဲလ်တွေမှာရှိတဲ့ΔFosB၏ထက်ဝက်-အသက်တာ၌သိသိသာသာကျဆင်းခြင်းကိုဖြစ်ပေါ်စေသည်, ထိုထုတ်ဖော်ပြသသဖန်းသီး။ 6B) ။ ဒီတည်မငြိမ်ဖြစ်စေ CK2 တားစီးနေဖြင့်စေဆင်တူသည်သို့မဟုတ်ခေါက်-Down ဆိုတဲ့အချက်ကို (သဖန်းသီး။ 4) Ser2 ၏ CK27-mediated phosphorylation ΔFosB၏တည်ငြိမ်မှုကိုထိန်းညှိသောစိတ်ကူးများအတွက်ထပ်မံထောက်ခံမှုပေးသည်။ ΔFosBပရိုတိန်းလည်ပတ်ငွေကြေးကြောင့် ASP mutation (S27D) အားတစ်ဦး phosphomimetic Ser27 သုံးပြီးရယူခဲ့ပါတယ်အပေါ် Ser27 phosphorylation ၏စည်းမျဉ်းအခန်းကဏ္ဍများအတွက်အပိုဆောင်းသက်သေအထောက်အထား။ ဒါကြောင့်အမိုင်နိုအက်ဆစ် 27 နှင့်ဖြင့်တစ်စိတ်တစ်ပိုင်းတူတဲ့ Ser27 ၏ phosphorylation မှာကြီးမားတဲ့အပျက်သဘောတရားစွဲဆို (carboxyl) အုပ်စုတစ်စုနေရာကြောင့် S27D mutation, phosphomimetic စဉ်းစားသည်။ မှာပြထားတဲ့အတိုင်း ပုံ 6Cအဆိုပါ S27D mutation အဆိုပါ S27A mutation ၏ဆန့်ကျင်ဘက်အကျိုးသက်ရောက်မှုကိုဖြစ်ပေါ်စေခြင်းနှင့် WT ပရိုတိန်းထက်သိသိသာသာပိုမိုတည်ငြိမ်တဲ့ပရိုတိန်းခဲ့သည်။ အလားတူပင် CK2 activation ပြီးနောက်ရရှိသောအကျိုးသက်ရောက်မှုမှ (သဖန်းသီး။ 4D), အ S27D mutation စုစည်းနေခြင်းအတွက်ရလဒ်နှင့်အရှင် Chase ၏ပထမဦးဆုံးနာရီအတွင်းΔFosBအဆင့်ဆင့်တိုးတက်လာခဲ့သည်။

ပုံ 6 ။

ပိုကြီးတဲ့ဗားရှင်းကိုကြည့်ရန်:

ပုံ 6 ။

Ser27 ၏ Phosphorylation ΔFosB၏တည်ငြိမ်မှုကိုထိန်းညှိ။ A, CΔFosB၏လည်ပတ်ငွေကြေးကြောင့်မှုနှုန်းအပေါ် Ser27 phosphorylation ၏အကျိုးသက်ရောက်မှုဖေါ်ပြခြင်း, Pulse-Chase ခွဲခြမ်းစိတ်ဖြာ။ အဆိုပါပျက်စီးခြင်းပရိုဖိုင်းနဲ့ခန့်မှန်းရိုင်း-type အမျိုးအစားΔFosB (WT) ၏ထက်ဝက်-ဘဝတွေကို, အ Ser27 Ala မှ Mutant (S27A), နှင့် ASP Mutant (S27D) ဖို့ phosphomimetic Ser27 ပြနေကြသည်။ အလားတူတွေ့ရှိချက် (HeLa ဆဲလ်တွေအတွက်ရရှိသောခဲ့ကြသည်A) နှင့် PC12 ဆဲလ် (B, C).

Ser27 phosphorylation ယင်း၏ proteasomal ပျက်စီးခြင်းကိုကာကွယ်ပေးနိုင်ခြင်းဖြင့်ΔFosBတည်ငြိမ်

Ser27 ၏ phosphorylation ΔFosBတည်ငြိမ်သောယန္တရား elucidating စတင်ကျနော်တို့ကို (proteasome inhibitors MG132 များ၏စွမ်းရည်ကိုလေ့လာPalombella et al ။ , 1994; Tsubuki et al ။ , 1996) နှင့် epoxomicin (Hanada et al ။ , 1992; ကင်မ် et al ။ , 1999) WT နှင့် S27A Mutant ΔFosB၏ပျက်စီးခြင်းမှုနှုန်း modulate ရန်။ သွေးခုန်နှုန်း-Chase စမ်းသပ်ချက်တစ်ခု recombinant HSV WT သို့မဟုတ် S12A ΔFosBဖြစ်စေဖော်ပြနှင့် DMSO သို့မဟုတ်နှစ်ခု proteasome inhibitors ၏တဦးတည်းဖြစ်စေနဲ့ကုသကူးစက် PC27 ဆဲလ်တွေသုံးပြီးကောက်ယူခဲ့ကြသည်။ ဤရွေ့ကားစမ်းသပ်ချက် (ထို WT ပရိုတိန်း၏ပျက်စီးခြင်းမှုနှုန်းနှစ်ခု proteasome inhibitors ၏ဖြစ်စေ၏ရှေ့မှောက်တွင်ဖို့အတော်လေးအာရုံမခံစားနိုင်သောဖြစ်ပါတယ်ပေမယ့်ကြောင်းထုတ်ဖော်ပြသသဖန်းသီး။ 7A), အ S27A Mutant ၏ (ဤမူးယစ်ဆေးဝါးများကိုမှအထိခိုက်မခံဖြစ်ပါသည်သဖန်းသီး။ 7B) ။ ဒါက WT ပရိုတိန်းနဲ့မတူပဲ, အ S27A Mutant proteasomal ပျက်စီးခြင်း၏ပစ်မှတ်သည်ကြောင်းဖော်ပြသည်။ အမှန်စင်စစ် MG132 သို့မဟုတ်အပြည့်အဝ epoxomicin ဖြစ်စေနှင့်အတူဆဲလ်များ၏ကုသမှုΔFosB၏ပျက်စီးခြင်းမှုနှုန်းအပေါ် S27A mutation ၏အကျိုးသက်ရောက်မှုပြောင်းပြန် MG27 များအတွက် ~4 ဇမှ ~9 ထံမှ S132A Mutant ၏ထက်ဝက်-အသက်တာ၌တစ်ဦးတိုးခြင်းဖြင့်သက်သေများနှင့်ရန် ~ epoxomicin များအတွက် 12 ဇ (သဖန်းသီး။ 7B) ။ အတူတကွဤတွေ့ရှိချက် Ser27 အပေါ်ΔFosB၏ phosphorylation proteasomal ပျက်စီးခြင်းကနေပရိုတိန်းကာကွယ်ပေးသည်နှင့်၎င်း၏ပုံမှန်မဟုတ်သောတည်ငြိမ်ရေးတို့အတွက်ထို့ကြောင့်မရှိမဖြစ်လိုအပ်သောကြောင်းဖော်ပြသည်။

ပုံ 7 ။

ပိုကြီးတဲ့ဗားရှင်းကိုကြည့်ရန်:

ပုံ 7 ။

Ser27 ၏ Phosphorylation ယင်း၏ proteasomal ပျက်စီးခြင်းကိုကာကွယ်ပေးနိုင်ခြင်းဖြင့်ΔFosBတည်ငြိမ်။ A, Bအဆိုပါပျက်စီးခြင်းပရိုဖိုင်းဖေါ်ပြခြင်း HSV-ကူးစက် PC12 ဆဲလ်များနှင့်ရိုင်း-type အမျိုးအစားΔFosB၏ခန့်မှန်းခြေတဝက်-ဘဝတွေကို (အတူ Pulse-Chase ခွဲခြမ်းစိတ်ဖြာA) သို့မဟုတ် S27A ΔFosB (B) နှစ်ခု proteasome inhibitors ၏ဖြစ်စေ၏မရှိခြင်းသို့မဟုတ်မျက်မှောက်၌ [MG132 နှင့် epoxomicin (Epoxo)] ။ တစ်ခုခုကို proteasome inhibitor နှင့်အတူဆဲလ်များ၏ကုသမှု S27A ΔFosB၏တည်ငြိမ်မှုသော်လည်း, မမူးယစ်ဆေးရိုင်း-type အမျိုးအစားΔFosB၏လည်ပတ်ငွေကြေးကြောင့်အပေါ်သိသိသာသာအကျိုးသက်ရောက်မှုရှိပါတယ်ဆိုတဲ့အချက်ကိုသတိပြုပါ။ Cရေရှည်ဦးနှောက် plasticity ပြေလည်အောင်ဆောင်ရွက်ပေးရန်ΔFosBများ၏စွမ်းရည်အတွက် Ser27 phosphorylation ၏အခန်းကဏ္ဍကိုများအတွက်မော်ဒယ်။ ပြီးတာနဲ့သွေးဆောင်, ΔFosBတစ်ဦးသောအဘို့ကို S2 ၏ CK27-mediated phosphorylation ခြင်းဖြင့်ဦးနှောက်အတွင်းတည်ငြိမ်နေပါတယ်။ ဤသည်မှာမျိုးရိုးဗီဇစကားရပ်များတွင်ကြာရှည်အပြောင်းအလဲများအတွက်အရာအလှည့်အတွက်ရလဒ်တွေကိုယင်း၏စုဆောင်းခြင်းအတွက်ရလဒ်များ။ မျိုးဗီဇစကားရပ်တွင်ဤတည်ငြိမ်အပြောင်းအလဲများကိုတည်ငြိမ်မူအကျင့်လိုက်လျောညီထွေဖြစ်အောင်ကူညီသည်။ ပြောင်းပြန်ဟာ SER / Thr အားဖြင့် S27 ၏ dephosphorylation အဆိုပါ proteasomal စက်ယန္တရားအားဖြင့်ပရိုတိန်းနှင့်၎င်း၏အပြောင်းအလဲနဲ့၏တည်မငြိမ်ဖြစ်စေများတွင် PP1 နှင့် / သို့မဟုတ် PP2A ရလဒ်များကို phosphatases ။

ယခင်ပုဒ်မnext ကိုပုဒ်မ

ဆွေးနွေးမှု

ပစ္စုပ္ပန်လေ့လာမှုတှငျကြှနျုပျတို့ΔFosB Full-အရှည် FosB နှင့်နှိုင်းယှဉ်ပါကတည်ငြိမ်စေသည်နှင့်အဘယ်သူ၏ဝက်ဘဝတွေကိုဆဲလ်ယဉ်ကျေးမှု၌အများဆုံးကိုအခြားသွေးဆောင်ကူးယူအချက်များကြောင့်တိုတောင်းဖြစ်နိုင်သည့်ဆဲလ်ယဉ်ကျေးမှုအတွက် ~10 ဇ၏တစ်ဝက်ဘဝရှိကြောင်းကိုပြသ မိနစ်အနည်းငယ်အဖြစ်ရခဲ 3 ဇကျော်လွန် (Hanns နှင့် Eisenman, 1984; Dobrazanski et al ။ , 1991; ရောဘတ်နှင့် Whitelaw, 1999; Ferrara et al ။ , 2003; Hirata et al ။ , 2004) ။ ထို့အပြင်ကျနော်တို့ΔFosBဦးနှောက်ထဲမှာ phosphorylated ဖြစ်ပါတယ်နှင့်၎င်း၏ phosphorylation အဆိုပါ PP1 / PP2A inhibitor okadaic အက်ဆစ်မှအထိခိုက်မခံကြောင်းကိုရှာပါ။ ကျွန်ုပ်တို့၏ဆဲလ်ယဉ်ကျေးမှုလေ့လာမှုများပရိုတိန်းတည်ငြိမ်ပိုမိုမြင့်မား CK2 လှုပ်ရှားမှုနှင့်အတူ, ΔFosB၏တည်ငြိမ်မှုကို CK2 အားဖြင့် modulated ကြောင်းဆန္ဒပြခဲ့ကြသည်။ နောက်ဆုံးအနေနဲ့ကျွန်တော်တို့ရဲ့တွေ့ရှိချက် CK2 အလွန်ထိန်းသိမ်းထား N ကို terminus serine (S27) ရက်နေ့တွင်ΔFosB phosphorylates နှင့် S27 ၏ phosphorylation proteasomal ပျက်စီးခြင်းထံမှΔFosBကာကွယ်ပေးသည်ကိုသရုပ်ပြကြောင်းအကြံပြုအပ်ပါသည်။ ကျနော်တို့ CK27 အားဖြင့် S2 အပေါ်ΔFosB၏ phosphorylation ΔFosB (များ၏လည်ပတ်ငွေကြေးကြောင့်၏အရေးပါသောစည်းမျဉ်းယန္တရားဖြစ်ပါတယ်မထွက်ရတဲ့မော်ဒယ်ထို့ကြောင့်အဆိုပြုသဖန်းသီး။ 7C) ။ အထူးသဖြင့်ဦးနှောက်ဒေသများတွင်ΔFosB၏တိုးမြှင့်အဆင့်ဆင့်တိုက်ရိုက်မြောက်မြားစွာအာရုံခံဗီဇထိန်းညှိရန်ပြခဲ့ကြသောကြောင့်, ΔFosB၏ထိုကဲ့သို့သော phosphorylation-mediated တည်ငြိမ်, function ကအရေးကြီးတယ် Vivo အတွက် နှင့် (နိဒါန်းကိုကြည့်ပါ) အများအပြားအာရုံကြောဆိုင်ရာစိတ်ရောဂါမမှန်၏တိရိစ္ဆာန်မော်ဒယ်များအတွက်အစွမ်းထက်အပြုအမူသက်ရောက်မှုကွိုးစားအားထုဖြစ်သည်။

phosphorylation ထိုကဲ့သို့သော CREB (Camp တုံ့ပြန်မှုဒြပ်စင် binding ပရိုတိန်း) ကဲ့သို့အချို့သောကူးယူအချက်များ, (များ၏မှတ်တမ်းလှုပ်ရှားမှုထိန်းညှိတဲ့အစာရှောင်ခြင်းနှင့် Reversible လုပ်နည်းလမ်းဖြစ်ပါတယ်ပေမယ့်Bohmann, 1990), ကူးယူအချက်များ၏ပျက်စီးခြင်းပြောင်းလဲပစ်စည်းမျဉ်းတစ်ခု ပို. ပင်အစွမ်းထက် (လျော့နည်းအလွယ်တကူနောက်ပြန်လှည်) ပုံစံ (ပေးပါသည်Desterro et al ။ , 2000) ။ အဘယ်သူ၏အလုပ်လုပ်တဲ့လှုပ်ရှားမှုဟာသူတို့ရဲ့ပျက်စီးခြင်း၏အဆင့်မှာစည်းမျဉ်းသတ်မှတ်တာဖြစ်ပါတယ်ကူးယူမှတ်တမ်းတင်အချက်များ (NFκBပါဝင်သည်Desterro et al ။ , 2000), က c-Myc (Sears et al ။ , 1999), နှင့်က c-Fos (Ferrara et al ။ , 2003), အခြားသူများအကြား။ က c-Fos (များအတွက်ပြသခဲ့ပြီးအဖြစ်အများအပြားဖြစ်ရပ်မှာတော့ phosphorylation တစ်ဦးကူးယူအချက်များ၏တည်ငြိမ်မှုကိုတစ် key ကိုထိန်းညှိဖြစ်ပါသည်Okazaki နှင့် Sagata, 1995; Tsurumi et al ။ , 1995), Fos-related ကိုပဲ-1 (Fra-1) (ဖလားကိုနှင့်မာရှယ်, 2003), Fra-2 (Manabe et al ။ , 2001), က c-ဇွန်လ (Fuchs et al ။ , 1996), JunB (Fuchs et al ။ , 1997), ATF2 (Fuchs et al ။ , 2000), နှင့် p53 (Buschmann et al ။ , 2001) ။ ကျွန်ုပ်တို့၏လေ့လာမှုများအရှင်သည်အဘယ်သူ၏အလုပ်လုပ်တဲ့လှုပ်ရှားမှုက၎င်း၏ phosphorylated-မှီခိုတည်ငြိမ်မှုမှတဆင့်စည်းမျဉ်းသတ်မှတ်တာဖြစ်ပါတယ်ကူးယူအချက်များ၏ဤစာရင်းΔFosBထည့်ပါ။

CK2 သည်နေရာအနှံ့တွင်ရှိပြီးတက်ကြွစွာတက်ကြွစွာပါဝင်သည့် Ser / Thr kinase ဖြစ်သည်။ ၎င်းသည်လက်ရှိအချိန်တွင်ဖော်ထုတ်နိုင်သည့်အလွှာ ၃၀၀ ရှိပြီးဆဲလ်သေခြင်းနှင့်ရှင်သန်ခြင်းအပါအ ၀ င်ဇီဝဗေဒဆိုင်ရာလုပ်ငန်းစဉ်များတွင်ပါ ၀ င်ပတ်သက်နေသည် (Litchfield, 2003; Unger et al ။ , 2004), ဆယ်လူလာစိတ်ဖိစီးမှုတုံ့ပြန်မှု (Yanagawa et al ။ , 1997; Kato et al ။ , 2003) နှင့် DNA ကိုပြုပြင်နှင့် chromatin ပြုပြင် (Barz et al ။ , 2003; Krohn et al ။ , 2003) ။ CK2 ၏ putative အလွှာဟာပိုပြီးထက်သုံးပုံတစ်ပုံ (မျိုးဗီဇစကားရပ်၏စည်းမျဉ်းစည်းကမ်းများတွင်ပါဝင်ပတ်သက်ပရိုတိန်းများမှာMeggio နှင့် Pinna, 2003) ။ တကယ်တော့, CK2 (ကထင်ရှားတဲ့နျူကလီးယား kinase ဖြစ်ပြထားပြီးKrek et al ။ , 1992) (ပြန်လည်သုံးသပ်တွေ့ ယု et al ။ , 2001) နှင့်အများအပြားကူးယူအချက်များ၏ bZIP domains များနှင့်အတူအပြန်အလှန်ရန် (ယာမာဂူချီ et al ။ , 1998) ။ CK2-mediated phosphorylation လည်း IkB အပါအဝင်များစွာသောပရိုတိန်း၏ပျက်စီးခြင်း (ကတိုးမြှင့်သို့မဟုတ်လျော့ကျလာဖြစ်စေ) (modulate ပြထားပြီးSchwarz et al ။ , 1996), PTEN (တောရက်စ်နှင့် Pulido, 2001), မှန်ဘီလူး connexin (ယဉ် et al ။ , 2000), chromatin-ဆက်စပ်ပရိုတိန်း HMG1 (Wisniewski et al ။ , 1999), နှင့်ထိုကဲ့သို့သော HMGB အဖြစ်အများအပြားကူးယူအချက်များ (Stemmer et al ။ , 2002), Myf-5 (ဆောင်းရာသီ et al ။ , 1997), နှင့်က c-Myc (Channavajhala နှင့် Seldin, 2002) ။ CK2 (ဦးနှောက်ထဲမှာအပေါများဆုံးဖြစ်ပြီးAlcazar et al ။ , 1988; Girault et al ။ , 1990), နှင့်၎င်း၏လှုပ်ရှားမှုအာရုံခံရှင်သန်ရပ်တည်ရေးအပါအဝင်, ဦးနှောက် function ကိုများစွာသောရှုထောင့်များတွင်ပတ်သက်သည်ဟုယူဆရခဲ့ပြီး (Boehning et al ။ , 2003), ကွဲပြားခြားနားမှု (Nuthall et al ။ , 2004), အိုင်းရုပ်သံလိုင်း function ကို (ဂျုံးစ်နှင့် Yakel, 2003; Bildl et al ။ , 2004), နှင့်ရေရှည်အလားအလာများနှင့်အာရုံခံ plasticity (Diaz-Nido et al ။ , 1992; Lieberman နှင့်မိုဒီ, 1999; Reikhardt et al ။ , 2003).

အာရုံခံ function ကို၏စည်းမျဉ်းစည်းကမ်းအတွက် CK2 ၏အခန်းကဏ္ဍကိုအဘို့ဤကြီးထွားလာသက်သေအထောက်အထားနေသော်လည်းနည်းနည်းင်း၏လုပ်ဆောင်မှုကိုထိန်းချုပ်ထားအဘယ်သို့သောအကြောင်းလူသိများသည်။ CK2 တိကျတဲ့အလွှာ phosphorylate ရန်၎င်း၏စွမ်းရည်၏စည်းမျဉ်းစည်းကမ်းက၎င်း၏ intracellular မူပြောင်းခြင်း (နျူကလိယ vs ဥပမာ cytosol) (ပြောင်းလဲမှုများအပေါ်အများအားဖြင့်မှီခိုအတူဖွဲ့စည်းအုပ်ချုပ်ပုံအခြေခံဥပဒေတက်ကြွဖြစ်ထင်နေသည်Ahmed ကနှင့် Tawfic, 1994; ယု et al ။ , 1999) ။ ဤအချက်အလက် (အချက်ပြမှုများနာတာရှည်ဆွပြီးနောက်ဦးနှောက်ထဲမှာΔFosBစုဆောင်းခြင်းသွေးဆောင်ရန်လိုအပ်နေကြတယ်ဆိုတာကိုရည်မှတ်အရေးပါသောမေးစရာသဖန်းသီး။ 7C) ။ တဦးတည်းလိုအပ်ချက်၏ထပ်ခါတလဲလဲ activation ဖြစ်ပါသည် fosB ΔFosB mRNA ၏မျိုးဗီဇနှင့် induction (ချန် et al ။ , 1995) ။ ကျွန်ုပ်တို့၏ဒေတာΔFosB၏ CK2 phosphorylation တစ်စက္ကန့် signal ကို, အမည်ရ, မျိုးဗီဇစကားရပ်အပေါ်ΔFosB၏ရေရှည်အကျိုးသက်ရောက်မှုများအဘို့ CK2 အားဖြင့်ပရိုတိန်း၏ phosphorylation လှုံ့ဆော်တဲ့ signal ကိုလိုအပ်မည်အကြောင်း, အကြံပြုခြင်း၎င်း၏တည်ငြိမ်ရေးတို့အတွက်အရေးပါကြောင်းဖော်ပြသည်။ ဒါဟာအချို့အမည်မသိယန္တရားသို့မဟုတ်နျူကလိယမှ၎င်း၏့စသဖြင့် CK2 ၏ activation ပါဝင်နိုင်ဘူး။ ထပ်ခါတလဲလဲဆွနှင့်အတူကဘေးဒဏ်သင့်အာရုံခံအတွက်မြင့်မားဖို့စုဆောင်းနိုင်အောင်တနည်းအားΔFosB၏ CK2 phosphorylation, ΔFosBပရိုတိန်းတစ်ခုစီကိုနှိုးဆွဖို့တုန့်ပြန်ဘာသာပြန်ထားသောပါသည်အတိုင်း, တစ်ဦးသောအဘို့ကို phosphorylated နှင့်ဖြင့်တည်ငြိမ်ရရှိထိုကဲ့သို့သော, ဖွဲ့စည်းပုံအခြေခံဥပဒေဖြစ်နိုင်သည်။

ကျွန်ုပ်တို့၏တွေ့ရှိချက် CK2 မတားစီးမ S27A mutation လုံးဝΔFosB phosphorylation တားဆီးနိုင်ခဲ့သောကြောင့် CK2 နှင့် S27, ဖြစ်ကောင်းΔFosB phosphorylation များအတွက်တာဝန်ရှိသည့်တစ်ခုတည်းသော kinase နှင့် site မဟုတ်ဖော်ပြသည်။ တူညီသောလက္ခဏာသက်သေအသုံးပြုပုံ phospho-ΔFosBအတွက် 27% လျှော့ချရေးအတွက် S30A mutation ရလဒ်များကိုဆိုတဲ့အချက်ကို S27 ပရိုတိန်းအပေါ်အဓိက phosphorylation site ကိုကြောင်းစောဒကတက်သည်။ ကျနော်တို့ΔFosBပေါ်ရှိအခြား putative kinases နှင့် phosphorylation က်ဘ်ဆိုက်များအားစုံစမ်းစစ်ဆေး, သို့ရာတွင်ဖြစ်ကြသည်။ နောက်ဆုံးတွင်က S27 ၏ phosphorylation နှင့်ဦးနှောက်အတွက်ΔFosBအတွက်အခြားမည်သည့် phosphorylation က်ဘ်ဆိုက်များခွဲခြမ်းစိတ်ဖြာရန်အဖြစ်ကောင်းစွာအရေးကြီးသောဖွစျလိမျ့မညျ Vivo အတွက် နာတာရှည်ဆွအမျိုးမျိုးပြီးနောက်ဥပမာ, အစုလိုက်အပြုံလိုက် spectrometry သို့မဟုတ် phosphospecific ပဋိ၏အသုံးပြုမှုမှတဆင့်။

အထက်တွင်ဖော်ပြခဲ့သည့်အတိုင်းΔFosBအတွက် S27 အလွန်အမင်းဆင့်ကဲဖြစ်စဉ်တလျှောက်လုံးနှင့်အခြား Fos မိသားစုပရိုတိန်းအကြားထိန်းသိမ်းထားသည်။ သို့သော် CK2 များအတွက်သဘောတူညီမှု site ကိုမဟုတျပါဘူး: မှာပြထားတဲ့အတိုင်း ပုံ 5Bသာ FosB / ΔFosB (နှင့် Zebrafish xenolog), မဟုတ်က c-Fos သို့မဟုတ် Fra-2 + 3, CK2 phosphorylation ၏အဓိကပစ်မှတ် (မှာအက်ဆစ်ကျန်ကြွင်းဝင်စားMarin et al ။ , 1986; Meggio et al ။ , 1994) ။ အခြားအ Fos မိသားစုပရိုတိန်းΔFosBကဲ့သို့တည်ငြိမ်မဟုတ်အဘယ်ကြောင့်ထို့ကြောင့် S2 အပေါ် CK27 phosphorylation ၏မရှိခြင်းကိုရှင်းပြလိမ့်မည်။ ΔFosBကဲ့သို့တူညီသော CK2 သဘောတူညီမှု site ကိုရှိပါတယ်ထားတဲ့ Full-အရှည် FosB, အလားတူတည်ငြိမ်မဟုတ်အဘယ်ကြောင့်သို့သော်ဤရှင်းပြမထားဘူး။ ကျနော်တို့အပြည့်အဝအရှည် FosB ဒီရှေးရိုးစွဲကျန်ကြွင်းအပေါ် CK2 အားဖြင့် phosphorylated ဖြစ်ပါတယ်ရှိမရှိမသိရပါဘူး။ FosB ၏တစ်ခုတည်းသောအစီရင်ခံစာများ (Skinner et al ။ , 1997) နှင့်က c-Fos (Okazaki နှင့် Sagata, 1995; ချန် et al ။ , 1996) phosphorylation ΔFosBအတွက်ပျက်ကွက်သောအရာသည်ဤပရိုတိန်း၏ C-terminal ကိုဒေသအတွက်ဆိုဒ်များကိုဖော်ပြရန်။ CK2 နေဖြင့်အပြည့်အဝအရှည် FosB နှင့်အခြား Fos မိသားစုပရိုတိန်း၏အလားအလာ phosphorylation တိုက်ရိုက်စုံစမ်းစစ်ဆေးမှုလိုအပ်သည်။ သူတို့ phosphorylated များမှာပင်လျှင်သို့သော်, အခြား Fos မိသားစုပရိုတိန်း (လျင်မြန်သောပျက်စီးခြင်းများအတွက်ပရိုတိန်းပစ်မှတ်ထားကြောင်း, သူတို့ကို C termini မှာ motif ဆံ့ဖို့လူသိများကြသည်Papavassiliou et al ။ , 1992; Jariel-Encontre et al ။ , 1997; Acquaviva et al ။ , 2002) ။ ဥပမာအားဖြင့်, ကအားလုံး Fos မိသားစုပရိုတိန်း၏ကို C terminus အတွက်ပစ္စုပ္ပန် ~21 အကြွင်းအကျန်များ၏လမ်းပိုင်း, ဒါပေမယ့်ΔFosBအတွက်ပျက်ကွက်, က c-Fos (များအတွက်မတည်ငြိမ်ခြင်းဒိုမိန်းအဖြစ်ပြုမူကြောင်းပြသလျက်ရှိသည်Acquaviva et al ။ , 2001) ။ ကျနော်တို့ (ဒီ sequence ကိုအလားတူ Full-အရှည် FosB destabilizes ပေမယ့်ကြောင်းတွေ့ရှိရCarl et al ။ , 2004), ΔFosB၌ဤဒိုမိန်း၏မရှိခြင်းအပြည့်အဝက၎င်း၏တည်ငြိမ်ဘို့အကောင့်မထားဘူး။ အဲဒီအစား, ဒီကို C terminus ဒိုမိန်းနှင့် Ser27 phosphorylation ၏မရှိခြင်း၏ပေါင်းစပ်ΔFosBနှင့် FosB အကြားတည်ငြိမ်မှုအတွက်ခန့်မှန်းခြေအားဖြင့်ငါးဆအထိကွာခြားချက်အဘို့အပြည့်အဝအကောင့်ပုံရသည်။

Fos မိသားစုပရိုတိန်း၏ပျက်စီးခြင်းရှုပ်ထွေးပြီးအပြည့်အဝနားလည်သဘောပေါက်သည်မဟုတ်ပေမယ့်, proteasomal ပျက်စီးခြင်း (ပါဝင်ပတ်သက်အဓိကလမ်းကြောင်းဖြစ်ဟန်ကယျတငျတျောမူခွငျး et al ။ , 1999; Acquaviva et al ။ , 2002; Ferrara et al ။ , 2003) ။ proteasomal inhibitors သိသိသာသာΔFosBပျက်စီးခြင်း၏နှုန်းပြောင်းလဲပစ်မထားတဲ့အတွက်ဤနေရာတွင်တင်ပြဒေတာ, သောငြင်းခုန်, အခြား Fos မိသားစုပရိုတိန်းနှင့်မတူဘဲΔFosBအဆိုပါ 26S proteasome evades, ဤသည်၎င်း၏တည်ငြိမ်အတွက်ဗဟိုအခန်းကဏ္ဍမှပါဝင်သည်။ (1) C-terminal ကိုမတည်ငြိမ်ခြင်းဒိုမိန်း၏မရှိခြင်းနှင့် (2) CK27 အားဖြင့် S2 ၏ phosphorylation: ထိုကြောင့်ငါတို့သည်ΔFosB၏တိုးမြှင့်တည်ငြိမ်မှုနှစ်ခုအဓိကအကြောင်းရင်းများများ၏ပေါင်းစပ်ဖို့ attribute ဖြစ်ပါတယ်မထွက်ရတဲ့အစီအစဉ်တင်ပြသည်။

အကျဉ်းချုပ်ထဲမှာ, ပစ္စုပ္ပန်လေ့လာမှုအဘယ်ကြောင့်ΔFosB, ချက်ချင်းအစောပိုင်းမျိုးဗီဇ၏ထုတ်ကုန်အဖြစ် mechanistic ထိုးထွင်းသိမြင်ထောက်ပံ့ fosBလူအပေါင်းတို့သည်အခြား Fos မိသားစုဝင်များတစ်ဦးအတော်လေးအသက်ရှည်ပရိုတိန်းနဲ့မတူပဲဖြစ်ပါသည်။ အခြားအ Fos မိသားစုပရိုတိန်းလျင်မြန်စွာပေမယ့်ယာယီလှုံ့ဆော်မှု-ကူးယူနားချင်းဆက်မှီပြေလည်အောင်ဆောင်ရွက်ပေးရန်ထင်နေကြသော်လည်း (မော်ဂန်နှင့် Curran, 1995), ΔFosB၏ဆွေမျိုးတည်ငြိမ်မှုပေါ်မှာနာတာရှည်ဆွခြင်းဖြင့်သွေးဆောင်ရှည်-ရေရှည်မှတ်တမ်းအပြောင်းအလဲများကိုပြေလည်အောင်ဆောင်ရွက်ပေးရန်နိုင်စွမ်းပေးအပ်။ ဤသည်ကဦးနှောက်ထဲမှာစဉ်ဆက်မပြတ်မော်လီကျူး switch အဖြစ်ΔFosB functions များ, တဖြည်းဖြည်းနာတာရှည်အလိုက်သင့်ပြောင်းလဲနေထိုင်သို့စူးရှသောတုံ့ပြန်မှုပြောင်းလဲသောအမြင်ထောက်ခံပါတယ်။ ΔFosB၏တည်ငြိမ်မှုများအတွက်ဗဟိုယန္တရားအဖြစ် Ser27 phosphorylation ၏ identification ΔFosB၏ function ကိုထိန်းညှိခြင်းနှင့်အားဖြင့်အာရုံကြောများနှင့်အမူအကျင့် plasticity အပေါ်ရေရှည်အကျိုးသက်ရောက်မှုများ modulate ဖို့နည်းလမ်း၏ဖွံ့ဖြိုးတိုးတက်မှုများအတွက်လမ်းသစ်ဖွင့်လှစ်။

ယခင်ပုဒ်မnext ကိုပုဒ်မ

အောက်ခြေမှတ်ချက်များ

  • နိုဝင်ဘာလ 21, 2005 ကိုလက်ခံရရှိခဲ့သည်။
  • တည်းဖြတ်မူဖေဖော်ဝါရီလ 21, 2006 ကိုလက်ခံရရှိခဲ့သည်။
  • လက်ခံဧပြီလ 2, 2006 ။
  • ဤလုပ်ငန်းကိုကျနော်တို့ EJN ဖို့အမျိုးသား Institute မှ PGU မှမူးယစ်ဆေးဝါးအလွဲသုံးမှု (NIDA) အမျိုးသားသုတေသနဝန်ဆောင်မှုဆုကိုပေါ် PGU မှ Schizophrenia နှင့်စီးပွားပျက်ကပ်လူငယ်သုတေသနဆုကိုအပေါ်သုတေသနများအတွက်အမျိုးသားမဟာမိတ်အဖွဲ့ကထောက်ခံနှင့်စိတ်ပိုင်းဆိုင်ရာကျန်းမာရေးနှင့် NIDA အမျိုးသားအင်စတီကျုကနေထောက်ပံ့ငွေခဲ့သည် အဆိုပါနဲ့သူ့ရဲ့အကူအညီနဲ့ဘို့ဒေါက်တာဂျိမ်းစ် Bibb ကျေးဇူးတင်ပါတယ် စသည်တို့အတွက် အဆိုပါ recombinant HSVs ၏ထုပ်ပိုးနှင့်အတူသူမ၏အကူအညီနဲ့များအတွက်ဇီဝဖြစ်စဉ်တံဆိပ်ကပ်ခြင်းအတွက်အသုံးပြုသည်ဦးနှောက်ချပ်၏ပြင်ဆင်မှုနှင့်ဒေါက်တာ Rachael Neve နဲ့သူ့ရဲ့အကူအညီနဲ့ဘို့ phosphorylation assay ဒေါက်တာသူ Ming-ဟူဟန်။
  • G. Rudenko ၏လက်ရှိလိပ်စာ - Life Sciences Institute နှင့်ဆေးဝါးဗေဒဌာန၊ Michigan တက္ကသိုလ်၊ ၀ ါရှင်တန်ရိပ်သာလမ်း 210 # 3163A, Ann Arbor, MI 48109-2216 ။
  • စာပေးစာယူအဲရစ်ဂျေ Nestler, 5323 ဟယ်ရီ Hines က Boulevard, Dallas မြို့, တက္ကဆပ် 75390-9070 မှကိုင်တွယ်ဖြေရှင်းသင့်ပါတယ်။ အီးမေးလ်: [အီးမေးလ်ကိုကာကွယ်ထားသည်]

ယခင်ပုဒ်မ

 

ကိုးကား

Acquaviva ကို C, Brockly က F, Ferrara P ကို, အကြီးအကဲ, G, ကယျတငျတျောမူခွငျးကို C, Jariel-Encontre ငါ Piechaczyk M က (2001) က c-Fos proto-oncoprotein ဂျီ (0) စဉ်အတွင်းစီစဉျ-S ကအဆင့်အကူးအပြောင်း၏လျင်မြန်သော proteasomal ပျက်စီးခြင်း၏ထိန်းချုပ်မှုပါဝင်ပတ်သက် C-terminal ကို tripeptide motif ၏ identification ။ Oncogene 20:7563-7572 ။

CrossRefMedline

Acquaviva ကို C, အကြီးအကဲ, G, Ferrara P ကို, Brockly က F, Jariel-Encontre ငါ Piechaczyk M က (2002) Fos မိသားစုပရိုတိန်းအဘို့အအကွိမျမြားစှာပျက်စီးခြင်းလမ်းကြောင်း။ အမ်းနယူးယော့ Acad သိပ္ပံ 973:426-434 ။

Medline

Ahmed ကငွေကျပ်, Tawfic S က (1994) ပရိုတိန်း kinase CK2 ၏ intracellular စည်းမျဉ်း၏ယန္တရား: လှုံ့ဆော်မှု-mediated subnuclear အသင်းအဖွဲ့များ၏အခန်းကဏ္ဍကို။ cell Mol Biol Res 40:539-545 ။

Medline

Alcazar တစ်ဦးကမာတင်အီးလိုပက်ဇ်-Fando J ကို, Salinas M က (1988) ဦးနှောက်ထဲကနေ casein kinase II ၏တစ်ဦးတိုးတက်လာသောသန့်စင်လုပ်ထုံးလုပ်နည်းနှင့်ဂုဏ်သတ္တိများ။ Neurochem Res 13:829-836 ။

CrossRefMedline

Andersson က M, Westin je, Cenci MA (2003) နာတာရှည် dopaminomimetic ကုသမှုပြတ်တောက်ပြီးနောက် striatal DeltaFosB ကဲ့သို့ immunoreactivity နှင့် prodynorphin mRNA အဆင့်ဆင့်၏အချိန်သင်တန်း။ EUR J ကို neuroscience 17:661-666 ။

CrossRefMedline

Barz T က, Ackermann K ကိုဒူဘွာ, G, Eils R ကို, Pyerin W က (2003) မျိုးရိုးဗီဇ-ကျယ်ပြန့်စကားရပ်ဖန်သားပြင် chromatin ပြုပြင်အတွက်ပရိုတိန်း kinase CK2 များအတွက်ကမ္ဘာလုံးဆိုင်ရာအခန်းကဏ္ဍဖော်ပြသည်။ J ကိုဆဲလ်သိပ္ပံ 116:1563-1577 ။

စိတ္တဇ / အခမဲ့အပြည့်အဝစာသား

Beh ငါ Schmidt က R ကို, Hecker, E (1989) HL-60 ဆဲလ်တွေမှာတွေ့ရှိ PKC နှစျယောကျ isozymes အဆိုပါ phorbol Ester ဘိလပ်မြေများက activation တစ်ဦးခြားနားချက်ကိုပြသ။ FEBS လက်တ 249:264-266 ။

Medline

Bildl W က, Strassmaier T က, Thurm H ကို, Andersen က J ကို, Eble S က, အိုလီဗာ: D, Knipper M က, မန်းက M, Schulte ဦး, Adelman JP, Fakler B ကို (2004) ပရိုတိန်း kinase CK2 သေးငယ်တဲ့အပြုအမူ Ca (2 +) နှင့်အတူ coassembled ဖြစ်ပါတယ် - activated K + လိုင်းများနှင့်ချန်နယ် Gates ထိန်းညှိ။ အာရုံခံဆဲလျ 43:847-858 ။

CrossRefMedline

Bing မှ, G, ဝမ် W က, Qi မေး, Feng တို့ Z ကို, Hudson P ကို, Jin က L ကို, Zhang ကဒဗလျူ, Bing မှ R ကို, ဟောင်ကောင် JS (1997) ရေရှည် Fos-related ကိုပဲ၏စကားရပ်နှင့်ကြွက် hippocampus နှင့် striatum အတွက်သိမ်းယူမှုနဲ့ဆက်စပ်မြစ်ဝကျွန်းပေါ် FosB ၏ယာယီစကားရပ်။ J ကို Neurochem 68:272-279 ။

Medline

Blom N ကို, Sicheritz-Ponten T က, Gupta R ကို, Gammeltoft S က, Brunak S က (2004) အမိုင်နိုအက်ဆစ် sequence ကိုကနေပရိုတိန်း၏ post ကို-translation glycosylation နှင့် phosphorylation ၏ခန့်မှန်းချက်။ Proteomics 4:1633-1649 ။

CrossRefMedline

Boehning: D, မွန်း, C, Sharma က S နဲ့, KJ, Hester ld, Ronnett GV, Shugar: D, Snyder SH မကောင်း (2003) heme oxygenase-2 ၏ CK2 phosphorylation အားဖြင့် activated carbon monoxide neurotransmission ။ အာရုံခံဆဲလျ 40:129-137 ။

CrossRefMedline

Bohmann: D (1990) ကူးယူမှတ်တမ်းတင်အချက် phosphorylation: signal ကို transduction နှင့်မျိုးဗီဇစကားရပ်၏စည်းမျဉ်းများအကြား link တစ်ခု။ ကင်ဆာဆဲလ် 2:337-344 ။

Medline

Buschmann T က, Potapova အိုဘား-Shira တစ်ဦးက, Ivanov VN, Fuchs SY, Henderson က S, Fried VA သို့, Minamoto T က, Alarcon-Vargas: D, Pincus MR, Gaarde WA, Holbrooke NJ, ရှိလောမြို့၌ Y ကို, Ronai Z ကို (2001) Thr-2 အပေါ် p53 ၏ဇွန်လ NH81-terminal ကို kinase phosphorylation စိတ်ဖိစီးမှုတုံ့ပြန် p53 တည်ငြိမ်နှင့်မှတ်တမ်းလှုပ်ရှားမှုများဘို့အရေးကြီးပါသည်။ Mol ဆဲလ် Biol 21:2743-2754 ။

စိတ္တဇ / အခမဲ့အပြည့်အဝစာသား

Carl TL, Ulery PG, Nestler EJ (2004) ထိန်းသိမ်းထားသော Fos မိသားစု C-terminal ဒိုမိန်းမရှိခြင်းသည် deltaFosB ၏ထူးခြားသောတည်ငြိမ်မှုကိုအထောက်အကူပြုသည်။ Soc neuroscience Abstr 30: 692.2 ။

Channavajhala P ကို, Seldin DC က (2002) lymphomagenesis အတွက်ပရိုတိန်း kinase CK2 နှင့်က c-Myc ၏ functional အပြန်အလှန်။ Oncogene 21:5280-5288 ။

CrossRefMedline

Chen က J ကို, Nye သူ, Kelz ကို MB, Hiroi N ကို, Nakabeppu Y ကို, မျှော်လင့်ခြင်း BT, Nestler EJ (1995) electroconvulsive ဖမ်းဆီးရမိခြင်းနှင့်ကင်းကုသနေဖြင့်မြစ်ဝကျွန်းပေါ် FosB နှင့် FosB တူသောပရိုတိန်း၏စည်းမျဉ်း။ Mol Pharmacol 48:880-889 ။

ြဒပ်မဲ့သော

Chen က J ကို, Kelz ကို MB, မျှော်လင့်ခြင်း BT, Nakabeppu Y ကို, Nestler EJ (1997) နာတာရှည် Fos-related antigen: နာတာရှည်ကုသမှုအားဖြင့်ဦးနှောက်ထဲမှာသွေးဆောင်ΔFosB၏တည်ငြိမ်မျိုးကွဲ။ J ကို neuroscience 17:4933-4941 ။

စိတ္တဇ / အခမဲ့အပြည့်အဝစာသား

Chen က RH အ, Juo ကို PC, Curran T က, Blenis J ကို (1996) C-terminus မှာက c-Fos ၏ Phosphorylation က၎င်း၏ပုံသဏ္ဌာန်ပြောင်းလဲလုပ်ဆောင်မှုကိုပိုကောင်းစေပါတယ်။ Oncogene 12:1493-1502 ။

Medline

Choe ES, Parelkar NK ကင်မ် JY, ချို HW, Kang HS, မော်စီတုန်း, L, ဝမ် JQ (2004) အဆိုပါပရိုတိန်း phosphatase 1 / 2A inhibitor okadaic အက်ဆစ် Vivo အတွက်ကြွက် striatum အတွက် CREB နှင့်ဆတ်-1 phosphorylation နှင့်က c-fos စကားရပ်တိုးပွားစေပါသည်။ J ကို Neurochem 89:383-390 ။

CrossRefMedline

Cochet ကို C, Chambaz EM (1983) Polyamine-mediated ပရိုတိန်း phosphorylations: intracellular polyamine အရေးယူမှုတစ်ခုဖြစ်နိုင်သမျှပစ်မှတ်။ Mol ဆဲလ် Endocrinol 30:247-266 ။

CrossRefMedline

Cochet ကို C, Feige JJ, Chambaz EM (1983) bovine အဆုတ်တစ်သျှူးနေအလွန်အမင်းသန့်, G အမျိုးအစား casein kinase ၏ Catalytic နှင့်မော်လီကျူးဂုဏ်သတ္တိများ။ Biochim Biophys Acta 743:1-12 ။

Medline

Colby CR, Whisler K ကို Steffen ကို C, Nestler EJ, ကိုယ်ပိုင် DW (2003) DeltaFosB ၏ Striatal ဆဲလ်အမျိုးအစား-တိကျတဲ့ overexpression ကင်းဘို့မက်လုံးပေးပိုကောင်းစေပါတယ်။ J ကို neuroscience 23:2488-2493 ။

စိတ္တဇ / အခမဲ့အပြည့်အဝစာသား

Daunais JB, ရောဘတ်, DC, McGinty JF (1993) ကိုကင်း Self-အုပ်ချုပ်ရေးကြွက် striatum အတွက် preprodynorphin, ဒါပေမယ့်မရက c-fos, mRNA တိုးပွားစေပါသည်။ NeuroReport 4:543-546 ။

Medline

Desterro JM, Rodriguez က MS, ဟေ RT ကို (2000) ပရိုတိန်းပျက်စီးခြင်းအားဖြင့်ကူးယူအချက်များ၏စည်းမျဉ်း။ cell Mol ဘဝကသိပ္ပံ 57:1207-1219 ။

CrossRefMedline

Diaz-Nido J ကို, Armas-Portela R ကို, Avila J ကို (1992) cytoplasmic casein kinase တိုးပွါး II ကို-type အမျိုးအစားလှုပ်ရှားမှု NIA မှ-103 neuroblastoma ဆဲလ်အတွင်းရှိ DNA ကိုပေါင်းစပ်တားစီးပြီးနောက် neurite outgrowth အတူ။ J ကို Neurochem 58:1820-1828 ။

Medline

di Maira, G, Salvi M က, Arrigoni, G, Marin, အို Sarno S က, Brustolon က F, Pinna LA က, Ruzzene M က (2005) ပရိုတိန်း kinase CK2 Akt / PKB phosphorylates နှင့် upregulates ။ cell မရဏကွဲပြားခြားနားသော 12:668-677 ။

CrossRefMedline

Dobrazanski P ကို, Noguchi T က, Kovary K ကို Rizzo, CA, Lazo PS, Bravo R ကို (1991) အဆိုပါ fosB ဗီဇနှစ်ယောက်စလုံးထုတ်ကုန် FosB နှင့်၎င်း၏အတိုပုံစံ FosB / SF, fibroblasts အတွက်မှတ်တမ်း Active ဖြစ်ကြသည်။ Mol ဆဲလ် Biol 11:5470-5478 ။

စိတ္တဇ / အခမဲ့အပြည့်အဝစာသား

Ferrara P ကို, Andermarcher အီး, အကြီးအကဲ, G, Acquaviva ကို C, Brockly က F, Jariel-Encontre ငါ Piechaczyk M က (2003) က c-Fos ပရိုတိန်း proteasomal ပျက်စီးခြင်းအဘို့တာဝန်ရှိအဆိုပါအခြေခံအဆောက်အဦးဆုံးအဖွတျစကားရပ်များ၏အခြေအနေများအရသိရသည်ကွာခြား။ Oncogene 22:1461-1474 ။

CrossRefMedline

Fuchs SY, Dolan, L, Davis က RJ, Ronai Z ကို (1996) Phosphorylation-မှီခိုဇွန် N-kinase အားဖြင့်က c-ဇွန် ubiquitination ၏ပစ်မှတ်ထား။ Oncogene 13:1531-1535 ။

Medline

Fuchs SY, Xie B, Adler V ကို, Fried VA သို့, Davis က RJ, Ronai Z ကို (1997) က c-ဇွန် NH2-terminal ကို kinases သူတို့ရဲ့ဆက်စပ်ကူးယူအချက်များ၏ ubiquitination ပစ်မှတ်ထား။ J ကို Biol Chem 272:32163-32168 ။

စိတ္တဇ / အခမဲ့အပြည့်အဝစာသား

Fuchs SY, Tappin ငါ Ronai Z ကို (2000) အဆိုပါ ATF2 ကူးယူအချက်၏တည်ငြိမ်မှုကို phosphorylation နှင့် dephosphorylation နေဖြင့်စည်းမျဉ်းသတ်မှတ်ထားသည်။ J ကို Biol Chem 275:12560-12564 ။

စိတ္တဇ / အခမဲ့အပြည့်အဝစာသား

Girault ဂျာ Hemmings HC Jr က Williams က KR, Nairn AC အ, Greengard P ကို (1989) casein kinase II က DARPP-32 တစ် dopamine- နှင့်စခန်း-စညျးမဉျြးစညျးကမျး phosphoprotein ၏ Phosphorylation ။ J ကို Biol Chem 264:21748-21759 ။

စိတ္တဇ / အခမဲ့အပြည့်အဝစာသား

Girault ဂျာ Hemmings HC Jr က Zorn SH, Gustafson EL, Greengard P ကို (1990) casein kinase II ကိုမှတူညီနေတဲ့ DARPP-32 serine kinase ၏နို့တိုက်သတ္တဝါငယ်တွေဟာဦးနှောက်ထဲမှာစရိုက်လက္ခဏာတွေ။ J ကို Neurochem 55:1772-1783 ။

Medline

Hanada M က, Sugawara K ကို Kaneta K ကို Toda က S, Nishiyama က Y, Tomita K ကို Yamamoto H ကို, Konishi M က, Oki T က (1992) Epoxomicin, ပိုးမွှားမူရင်းအသစ်တစ်ခု antitumor အေးဂျင့်။ J ကိုပဋိဇီဝဆေး (တိုကျို) 45:1746-1752 ။

Medline

Hanns SR, Eisenman RN (1984) neoplastic ဆဲလ်တွေမှာရှိတဲ့ differential ကိုစကားရပ်: လူ့က c-myc oncogene အားဖြင့် encoded ပရိုတိန်း။ Mol ဆဲလ် Biol 4:2486-2497 ။

စိတ္တဇ / အခမဲ့အပြည့်အဝစာသား

Hemmings HC Jr က Girault ဂျာ Williams က KR, LoPresti ကို MB, Greengard P ကို (1989) ARPP-21, dopamine-innervated ဦးနှောက်ဒေသများတွင်ကြွယ်ဝပြည့်စုံတစ်သိသိ amp-စည်းမျဉ်းသတ်မှတ် phosphoprotein (မစ္စတာ = 21,000) ။ နဂိုအတိုင်းဆဲလ်များနှင့်စသည်တို့အတွက်၎င်း၏ phosphorylation ၏ kinetic လေ့လာမှုများအတွက်သိသိ amp အားဖြင့် phosphorylated ဆိုက်၏အမိုင်နိုအက်ဆစ် sequence ကို။ J ကို Biol Chem 264:7726-7733 ။

Hidaka H ကို, Kobayashi R ကို (1992) ပရိုတိန်း kinase inhibitors ၏ဆေးဝါးဗေဒ။ Annu ဗြာ Pharmacol Toxicol 32:377-397 ။

CrossRefMedline

Hirata H ကို, Bessho Y ကို, Kokubu H ကို, Masamizu Y ကို, Yamada က S, Lewis က J ကို, Kageyama R ကို (2004) Hes7 ပရိုတိန်း၏မတည်ငြိမ်မှုဟာ somite segment နာရီများအတွက်အလွန်အရေးပါသည်။ နတ်မျိုးရိုးဗီဇ 36:750-754 ။

CrossRefMedline

Hiroi N ကို, Graybiel AM (1996) Atypical နှင့်ပုံမှန် neuroleptic ကုသသည့် striatum အတွက်ကူးယူအချက်စကားရပ်၏ကွဲပြားအစီအစဉ်များကိုသွေးဆောင်။ J ကို comp Neurol 374:70-83 ။

CrossRefMedline

B က, Kosofsky B, Hyman SE, Nestler EJ မျှော်လင့်ပါတယ် (1992) ချက်ချင်းအစောပိုင်းဗီဇစကားရပ်နှင့်နာတာရှည်ကင်းအားဖြင့်ကြွက်နျူကလိယ accumbens အတွက် binding က AP-1 ၏စည်းမျဉ်း။ proc Natl Acad သိပ္ပံယူအက်စ်အေ 89:5764-5768 ။

စိတ္တဇ / အခမဲ့အပြည့်အဝစာသား

BT, Kelz ကို MB, Duman RS, Nestler EJ မျှော်လင့်ပါတယ် (1994a) ပြောင်းလဲဖွဲ့စည်းမှုနှင့်ဝိသေသလက္ခဏာများနှင့်အတူဦးနှောက်ထဲမှာကြာရှည် AP-1 ရှုပ်ထွေးသော၏စကားရပ်ထဲမှာနာတာရှည် electroconvulsive ဖမ်းဆီးရမိ (လိမ်လည်မှုများ) ကုသမှုရလဒ်များကို။ J ကို neuroscience 14:4318-4328 ။

ြဒပ်မဲ့သော

BT, Nye သူ, Kelz ကို MB, ကိုယ်ပိုင် DW, Iadarola MJ, Nakabeppu Y ကို, Duman RS, Nestler EJ မျှော်လင့်ပါတယ် (1994b) နာတာရှည်ကိုကင်းနှင့်အခြားနာတာရှည်ကုသမှုအားဖြင့်ဦးနှောက်ထဲမှာပြောင်းလဲ Fos တူသောပရိုတိန်း၏ရေးစပ်ရှည်-တည်မြဲ AP-1 ရှုပ်ထွေးသော၏ induction ။ အာရုံခံဆဲလျ 13:1235-1244 ။

CrossRefMedline

Ishida တစ်ဦးက, Fujisawa H ကို (1995) အဆိုပါ autoinhibitory ဒိုမိန်းမှတဆင့် calmodulin-မှီခိုပရိုတိန်း kinase II ၏ stabilization ။ J ကို Biol Chem 270:2163-2170 ။

စိတ္တဇ / အခမဲ့အပြည့်အဝစာသား

Jariel-Encontre ငါကယျတငျတျောမူခွငျးကို C, Steff လေး, Pariat M က, Acquaviva ကို C, Furstoss အို Piechaczyk M က (1997) က c-fos နှင့်က c-jun ပျက်စီးခြင်းအဘို့ရှုပ်ထွေးယန္တရားများ။ Mol Biol ကိုယ်စားလှယ် 24:51-56 ။

CrossRefMedline

ဂျုံးစ်က S, Yakel JL (2003) Casein kinase ii (ပရိုတိန်း kinase ck2) ng5-3 ဆဲလ်တွေမှာရှိတဲ့ serotonin 108-ht (15) အဲဒီ receptor ရုပ်သံလိုင်း function ကိုထိန်းညှိ။ neuroscience 119:629-634 ။

CrossRefMedline

Kato T က Jr က Delhase M က, Hoffman ဟာတစ်ဦး, Karin M က (2003) CK2 ဟာခရမ်းလွန်တုံ့ပြန်မှုစဉ်အတွင်းအဲန်အက်ဖ်-kappaB activation များအတွက်တာဝန်ရှိတစ်ဦးက C-terminal ကို IkappaB kinase ဖြစ်ပါတယ်။ mol ဆဲလ် 12:829-839 ။

CrossRefMedline

Kelz ကို MB, Chen က J ကို, Carlezon WA Jr က Whisler K ကို Gilden L ကို, Beckmann လေး, Steffen ကို C, Zhang က YJ, Marotti L ကို, ကိုယ်ပိုင် DW, Tkatch T က, Baranauskas, G, Surmeier DJ သမား, Neve RL, Duman RS, Picciotto MR, Nestler EJ (1999) ဦးနှောက်ထဲမှာကူးယူအချက် deltaFosB ၏ expression ကိုကင်းမှ sensitivity ကိုထိန်းချုပ်သည်။ သဘာဝ 401:272-276 ။

CrossRefMedline

Kim က KB, Myung J ကို, သိန် N ကို, သင်္ဘောသား CM (1999) တိကျတဲ့နှင့်အာနိသင်သို့ထိုးထွင်းသိမြင်မှုကို: သဘာဝ epoxomicin ထုတ်ကုန်များနှင့် dihydroeponemycin အားဖြင့် Proteasome တားစီး။ Bioorg Med Chem လက်တ 9:3335-3340 ။

CrossRefMedline

Kobayashi အီး, Nakano H ကို, Morimoto က M, Tamaoki T က (1989) Calphostin ကို C (UCN-1028C), တစ်ဝတ္ထုပိုးမွှားဝင်း, ပရိုတိန်း kinase C. တစ်အလွန်အမင်းအစွမ်းထက်နှင့်သတ်သတ်မှတ်မှတ် inhibitor ဖြစ်ပါသည် ထဲကဓာတုပစ်စညျး Biophys Res Community 159:548-553 ။

CrossRefMedline

Krek W က, Maridor, G, Nigg EA ၏ (1992) Casein kinase II ကိုတစ်ဦးလွှမ်းမိုးနျူကလီးယားအင်ဇိုင်းဖြစ်ပါတယ်။ J ကိုဆဲလ် Biol 116:43-55 ။

စိတ္တဇ / အခမဲ့အပြည့်အဝစာသား

Krohn မိုင်, Stemmer ကို C, Fojan P ကို, Grimm R ကို, Grasser KD (2003) ပရိုတိန်း kinase CK2 ခရမ်းလွန်-ပျက်စီး DNA ကို၏အသိအမှတ်ပြုမှု inducing မြင့် mobility အုပ်စုတစ်စုဒိုမိန်းပရိုတိန်း SSRP1, phosphorylates ။ J ကို Biol Chem 278:12710-12715 ။

စိတ္တဇ / အခမဲ့အပြည့်အဝစာသား

Kumar ကတစ်ဦး, Choi KH, Renthal W က, Tsankova မိုင်, Theobald DEH, Truong HT, Russo SJ, LaPlant မေး, Whistler K ကို Neve RL, ကိုယ်ပိုင် DW, Nestler EJ (2005) Chromatin ပြုပြင် striatum အတွက်ကင်း-သွေးဆောင် plasticity အခြေခံအဓိကယန္တရားသည်။ အာရုံခံဆဲလျ 48:303-314 ။

CrossRefMedline

Lieberman DN, Modi ငါ (1999) Casein kinase-II ကို hippocampal အာရုံခံအတွက် NMDA ရုပ်သံလိုင်း function ကိုထိန်းညှိ။ နတ် neuroscience 2:125-132 ။

CrossRefMedline

Litchfield DW (2003) ပရိုတိန်း kinase CK2: ဘဝနှင့်သေခြင်း၏ဆယ်လူလာဆုံးဖြတ်ချက်များအတွက်ဖွဲ့စည်းပုံ, စည်းမျဉ်းများနှင့်အခန်းကဏ္ဍကို။ ထဲကဓာတုပစ်စညျး J ကို 369:1-15 ။

CrossRefMedline

Manabe T က, Kuramoto N ကို, Nakamichi N ကို, Aramachi K ကို Baba K ကို Hirai T က, Yoneyama M က, Yoneda Y ကို (2001) N-methyl- ဖော်ပြက c-Fos ပရိုတိန်း၏ degradationdmurine hippocampus ၏နျူကလီးယားပိုငျးအတွက် -aspartic အက်ဆစ်။ ဦးနှောက် Res 905:34-43 ။

Medline

Mandelzys တစ်ဦးက, Gruda MA, Bravo R ကို, မော်ဂန် JI (1997) တစ်ဦးဇွဲကောင်းကောင်းနဲ့ခြီးမွှောကျ 37 KDA fos-ဆက်စပ်ကိုပဲနှင့် kainic အက်ဆစ်-ကုသ fosB တရားမဝင်သောကြွက်၏ဦးနှောက်အတွက် AP-1 ကဲ့သို့ DNA ကို-binding လှုပ်ရှားမှုမရှိခြင်း။ J ကို neuroscience 17:5407-5415 ။

စိတ္တဇ / အခမဲ့အပြည့်အဝစာသား

Marin, အို Meggio က F, Marchiori က F, Borin, G, Pinna LA က (1986) ကြွက်အသည်း cytosol ထံမှ casein kinase-2 (TS) ၏ဆိုက်ကိုသတ်မှတ်ချက်။ မော်ဒယ် peptide အလွှာနှင့်အတူလေ့လာမှုတစ်ခု။ EUR J ကိုထဲကဓာတုပစ်စညျး 160:239-244 ။

McClung, CA, Nestler EJ (2003) CREB နှင့် DeltaFosB အားဖြင့်မျိုးရိုးဗီဇစကားရပ်များနှင့်ကင်းဆုလာဘ်၏စည်းမျဉ်း။ နတ် neuroscience 6:1208-1215 ။

CrossRefMedline

McClung, CA, Ulery PG, Perrotti LI, Zachary V ကို, Berton အို Nestler EJ (2004) DeltaFosB: ဦးနှောက်အတွက်ရေရှည်လိုက်လျောညီထွေများအတွက်မော်လီကျူး switch သည်။ ဦးနှောက် Res Mol ဦးနှောက် Res 132:146-154 ။

Medline

Meggio က F, Pinna LA က (2003) ပရိုတိန်း kinase CK2 တစ်ခုမှာ-တထောင်-and တဦးတည်းအလွှာ? FASEB J ကို 17:349-368 ။

စိတ္တဇ / အခမဲ့အပြည့်အဝစာသား

Meggio က F, Donella-Deana တစ်ဦးက, Pinna LA က, Moret V ကို (1977) ကြွက်အသည်းအားဖြင့် casein အပိုင်းအစများ၏ phosphorylation 'phosvitin kinase ။ ' FEBS လက်တ 75:192-196 ။

Medline

Meggio က F, Brunati လေး, Pinna LA က (1983) ယင်း၏ alpha- နှင့် beta ကို-subunits နှစ်ဦးစလုံးမှာအမျိုးအစား 2 casein kinase TS ၏ Autophosphorylation ။ ကွဲပြားခြားနားသော effectors ၏သြဇာလွှမ်းမိုးမှု။ FEBS လက်တ 160:203-208 ။

CrossRefMedline

Meggio က F, Shugar: D, Pinna LA က (1990) casein kinase-2 နှင့် casein kinase-1 ၏ inhibitors အဖြစ် Ribofuranosyl-benzimidazole အနကျအဓိပ်ပါယျ။ EUR J ကိုထဲကဓာတုပစ်စညျး 187:89-94 ။

Medline

Meggio က F, Marin, အို Pinna LA က (1994) ပရိုတိန်း kinase CK2 ၏အလွှာသတ်မှတ်ချက်။ cell Mol Biol Res 40:401-409 ။

Medline

Miller ကကို C, Zhang က M ကို, သူက Y, Zhao နှင့် J ကို, Pelletier JP, Martel-Pelletier J ကို, Di Battista ဂျေအေ (1998) AP-2 နှင့် CRE နျူကလီးယား binding ပရိုတိန်း၏ Co-ဆွ: လူ့ chondrocytes အတွက် phosphatase လှုပ်ရှားမှု okadaic အက်ဆစ်တားစီးနေဖြင့် cyclooxygenase-1 ဗီဇ၏မှတ်တမ်းသော induction ။ J ကိုဆဲလ်ထဲကဓာတုပစ်စညျး 69:392-413 ။

CrossRefMedline

Moratalla R ကို, Elibol B, Vallejo M က, Graybiel AM (1996) နာတာရှည်ကင်းကုသမှုနှင့်ဆုတ်ခွာစဉ်အတွင်း striatum အတွက်သွေးဆောင် Fos-ဇွန်ပရိုတိန်း၏စကားရပ်ထဲမှာ Network ကို-Level အပြောင်းအလဲများကို။ အာရုံခံဆဲလျ 17:147-156 ။

CrossRefMedline

မော်ဂန် JI, Curran T က (1995) ချက်ချင်း-အစောပိုင်းမျိုးဗီဇ: အပေါ်ဆယျနှစျ။ ခေတ်ရေစီးကြောင်း neuroscience 18:66-67 ။

CrossRefMedline

Nakabeppu Y ကို, Nathan D ကို (1991) Fos / Jun ကမှတ်တမ်းလှုပ်ရှားမှုဖြစ်စဉ်ကိုတားဆီးပေးပါတယ်ကြောင်း FosB ၏တစ်ဦးကသဘာဝကျကျဖြစ်ပေါ်ခြင်းကိုပုံစံ။ ကလာပ်စည်း 64:751-759 ။

CrossRefMedline

Nestler EJ, Barrot M က, ကိုယ်ပိုင် DW (2001) မြစ်ဝကျွန်းပေါ် FosB: စွဲတစ်ခုစဉ်ဆက်မပြတ်မော်လီကျူး switch သည်။ proc Natl Acad သိပ္ပံယူအက်စ်အေ 98:11042-11046 ။

စိတ္တဇ / အခမဲ့အပြည့်အဝစာသား

Neve RL, Howe JR, ဟောင်ကောင်က S, Kalb RG (1997) တစ်ဦး recombinant ရေယုန် simplex virus ကို အသုံးပြု. စသည်တို့နှင့် Vivo အတွက်မော်တာအာရုံခံထဲသို့အချိုမှု receptor subunit 1 ၏နိဒါန်း။ neuroscience 79:435-447 ။

CrossRefMedline

Nuthall HN, Joachim K ကို Stifani S က (2004) ပရိုတိန်း kinase CK239 အားဖြင့် Groucho / TLE1 ၏ serine 2 ၏ Phosphorylation အာရုံခံကွဲပြားခြားနားမှု၏တားစီးဘို့အရေးကြီးပါသည်။ Mol ဆဲလ် Biol 24:8395-8407 ။

စိတ္တဇ / အခမဲ့အပြည့်အဝစာသား

Okazaki K ကို Sagata N ကို (1995) အဆိုပါ MOS / MAP kinase လမ်းကြောင်း phosphorylation အားဖြင့်က c-Fos တည်ငြိမ်နှင့် NIH 3T3 ဆဲလ်တွေအတွက်၎င်း၏ပုံသဏ္ဌာန်ပြောင်းလဲလှုပ်ရှားမှုကြီးထွားများပြားစေ။ EMBO J ကို 14:5048-5059 ။

Medline

Palombella VJ, Rando OJ, Goldberg AL, Maniatis T က (1994) အဆိုပါ ubiquitin-proteasome လမ်းကြောင်းဟာအဲန်အက်ဖ်-Kappa B1 ရှေ့ပြေးပရိုတိန်းနှင့်အဲန်အက်ဖ်-Kappa ခ၏ activation processing ဘို့လိုအပ်ပါသည် ကလာပ်စည်း 78:773-785 ။

CrossRefMedline

Papavassiliou AG က, Treier M က, Chavrier ကို C, Bohmann: D (1992) က c-ဇွန်အပေါ်တစ်ဦး phosphorylation-မှီခို signal ကိုပစ်မှတ်ထားက c-Fos ၏ပျက်စီးခြင်း, ဒါပေမယ့်မရ v-Fos ။ သိပ္ပံ 258:1941-1944 ။

စိတ္တဇ / အခမဲ့အပြည့်အဝစာသား

Peakman MC, Colby ကို C, Perrotti LI, Tekumalla P ကို, Carl T က, Ulery P ကို, Chao J ကို, Duman ကို C, Steffen ကို C, Monteggia L ကို, Allen က MR, စတော့အိတ် JL, Duman RS, McNeish JD, Barrot M က, ကိုယ်ပိုင် DW, Nestler EJ , Schaeffer E ကို (2003) Transgene ကြွက်တွေမှာက c-ဇွန်၏အလွှမ်းမိုးအနုတ်လက္ခဏာ Mutant ၏သွေးဆောင်, ဦးနှောက်ဒေသ-တိကျတဲ့စကားရပ်ကိုကင်းမှ sensitivity ကိုလျော့နည်းစေပါသည်။ ဦးနှောက် Res 970:73-86 ။

CrossRefMedline

Perrotti LI, Hadeishi Y ကို, Ulery PG, Barrot M က, Monteggia L ကို, Duman RS, Nestler EJ (2004) နာတာရှည်စိတ်ဖိစီးမှုပြီးနောက်ဆုလာဘ်-related ဦးနှောက်ဖွဲ့စည်းပုံထဲမှာ DeltaFosB ၏ induction ။ J ကို neuroscience 24:10594-10602 ။

စိတ္တဇ / အခမဲ့အပြည့်အဝစာသား

Persico AM, Schindler CW, O'Hara BF, Brannock MT, Uhl GR (1993) ဦးနှောက်ကူးယူအချက်စကားရပ်: စူးရှခြင်းနှင့်နာတာရှည်စိတ်ကြွဆေးနှင့်ဆေးထိုးစိတ်ဖိစီးမှု၏အကျိုးသက်ရောက်မှုများ။ ဦးနှောက် Res Mol ဦးနှောက် Res 20:91-100 ။

Medline

Ploegh HL, Dunn BM (2000) Post ကို-translation ပြုပြင်မွမ်းမံ: phosphorylation နှင့် phosphatases ။ ခုနှစ်တွင်: ပရိုတိန်းသိပ္ပံလက်ရှိ protocols များ (Dunn BM, ed ။ ) စစ။ 13.01-13.02 ။ နယူးယောက်: Wiley နှင့်သား။

Pyerin W က, Burow အီး, Michaely K ကို Kubler: D, Kinzel V ကို (1987) အလွန်အမင်းသန့် phosvitin / casein kinase ယဉ်ကျေးမှုလူ့တဲ့ epithelial cells (HeLa) မှအမျိုးအစား II နှင့် ecto ပရိုတိန်း kinase စပ်လျဉ်း၏ Catalytic နှင့်မော်လီကျူးဂုဏ်သတ္တိများ။ Biol Chem Hoppe Seyler 368:215-227 ။

Medline

Reikhardt BA, Kulikova ဩဃ, Borisova GY, Aleksandrova IY, Sapronov NS (2003) ကြွက်များတွင်အသက်အရွယ်-related သတိမေ့ခြင်းအတွက် "ပရိုတိန်း kinase CK2-HMG14" စနစ်၏ status ။ neuroscience ပြုမူနေ Physiol 33:799-804 ။

Medline

ရောဘတ် BJ, Whitelaw ML (1999) အခြေခံ helix-ကွင်းဆက်-helix ၏ပျက်စီးခြင်း / Per-ARNT-SIM homology ဒိုမိန်းဒိုင်အောက်ဆင်းပါဘဲအဲဒီ receptor အဆိုပါ ubiquitin / proteasome လမ်းကြောင်းကနေတဆင့်။ J ကို Biol Chem 274:36351-36356 ။

စိတ္တဇ / အခမဲ့အပြည့်အဝစာသား

Rost B, Yachdav, G, လျူ J ကို (2004) အဆိုပါ PredictProtein server ကို။ Nucleic Acid Res 32:W321-W326 ။

စိတ္တဇ / အခမဲ့အပြည့်အဝစာသား

Rylski M က, Kaczmarek L ကို (2004) ဦးနှောက်ထဲမှာ AP-1 ပစ်မှတ်။ တပ်ဦး Biosci 9:8-23 ။

CrossRefMedline

Sahin B, Kansy JW, Nairn AC အ, Spychala J ကို, Ealick SE, Fienberg AA ကို, ဂရင်း RW, Bibb ဂျေအေ (2004) ပရိုတိန်း phosphorylation များအတွက်ပစ်မှတ်အဖြစ် recombinant mouse ကို adenosine kinase နှင့်အကဲဖြတ်၏မော်လီကျူးစရိုက်လက္ခဏာတွေ။ EUR J ကိုထဲကဓာတုပစ်စညျး 271:3547-3555 ။

Medline

ကယျတငျတျောမူခွငျးကို C, Aquaviva ကို C, Jariel-Encontre ငါ Ferrara P ကို, Pariat M က, Steff လေး, Carillo S က, Piechaczyk M က (1999) Vivo အတွက်က c-Fos, က c-ဇွန်လနှင့် p53 ပရိုတိန်းပျက်စီးခြင်းမှပံ့ပိုးမျိုးစုံ proteolytic လမ်းကြောင်းရှိပါသလား Mol Biol ကိုယ်စားလှယ် 26:45-51 ။

CrossRefMedline

Schmidt က R ကို, Hecker, E (1975) ပုံမှန်သိုလှောင်မှုအခြေအနေများအောက်တွင် phorbol Ester ၏ Autoxidation ။ ကင်ဆာ Res 35:1375-1377 ။

အခမဲ့အပြည့်အဝစာသား

Schwarz EM, ဗန် Antwerp: D, Verma ထားတဲ့ IM (1996) casein kinase II က IkappaBalpha ၏ဖွဲ့စည်းပုံအခြေခံဥပဒေ phosphorylation serine 293 မှာဦးစားဖြစ်ပေါ်: အခမဲ့ IkappaBalpha ၏ပျက်စီးခြင်းအဘို့လိုအပ်ချက်။ Mol ဆဲလ် Biol 16:3554-3559 ။

စိတ္တဇ / အခမဲ့အပြည့်အဝစာသား

Sears R ကို, Leone, G, DeGregori J ကို, Nevins JR (1999) Ras Myc ပရိုတိန်းတည်ငြိမ်မှုပိုကောင်းစေပါတယ်။ mol ဆဲလ် 3:169-179 ။

CrossRefMedline

ဆေးလ်ဗား-Neto MA, Fialho အီး, Paes MC, Oliveira PL, Masuda H ကို (2002) Rhodnius prolixus oocytes ကနေကိုစင်ကြယ်စေ kinase II ကို casein အားဖြင့် vitellin ၏သိသိဘေ့-လွတ်လပ်သော phosphorylation ။ အင်းဆက်ပိုးမွှားထဲကဓာတုပစ်စညျး Mol Biol 32:847-857 ။

CrossRefMedline

Skinner က M, Qu S က, Moore ကနေ C, ပညာသည် R ကို (1997) FosB ပရိုတိန်းများကမှတ်တမ်း activation နှင့်အသွင်ပြောင်းသည့် carboxyl-terminal ကိုဖွင့်သုံးဒိုမိန်း၏ phosphorylation လိုအပ်သည်။ Mol ဆဲလ် Biol 17:2372-2380 ။

စိတ္တဇ / အခမဲ့အပြည့်အဝစာသား

Stemmer ကို C, Schwander တစ်ဦးက, Bauw, G, Fojan P ကို, Grasser KD (2002) ပရိုတိန်း kinase CK2 differential သူတို့ရဲ့တည်ငြိမ်မှုနှင့် DNA ကို interaction ကပြောင်းလဲပစ်ပြောင်းဖူးမျိုးရိုးဗီဇကိုမြင့်မားသောရွေ့လျားအဖွဲ့ကို B ကို (HMGB) ပရိုတိန်း phosphorylates ။ J ကို Biol Chem 277:1092-1098 ။

စိတ္တဇ / အခမဲ့အပြည့်အဝစာသား

Stevens ငါ Derua R ကို, Rondelez အီး, Waelkens အီး, Merlevede W က, Goris J ကို (1999) cyk ၏ identification တစ် cyclin B2 kinase တစ်ဝတ္ထုကယ်လစီယမ် / calmodulin-မှီခိုပရိုတိန်း kinase II နှင့် Xenopus ကာလအတွင်းယင်း၏အခန်းကဏ္ဍကို oocyte ရငျ့ laevis အဖြစ်။ Exp ဆဲလ် Res 252:303-318 ။

CrossRefMedline

Suh HW, Choi အက်စ်အက်စ်, Lee က JK, Lee ကဟောင်ကောင်, ဟန် EJ, Lee က J ကို (2004) က c-fos နှင့်မူလတန်းယဉ် astrocytes အတွက် lipopolysaccharide နှင့် cytokines အားဖြင့်က c-jun ဗီဇစကားရပ်၏စည်းမျဉ်းစည်းကမ်း: PKA နှင့် PKC လမ်းကြောင်း၏အကျိုးသက်ရောက်မှု။ Arch Pharm Res 27:396-401 ။

Medline

Szyszka R ကို, Boguszewska တစ်ဦးက, Grankowski N ကို, Ballesta JP (1995) casein kinase-2 နှင့် 60S kinase: နှစ်ခု endogenous ပရိုတိန်း kinases အားဖြင့်သောတဆေးဆဲလ်ကနေရိုင်ဗိုဇုမ်းများအားအက်ဆစ်ပရိုတိန်း၏ differential phosphorylation ။ Acta Biochim Pol 42:357-362 ။

Medline

Tamaoki T က, Takahashi ငါ Kobayashi အီး, Nakano H ကို, Akinaga S က, ဆူဇူကီး K သည် (1990) Calphostin (UCN1028) နှင့် calphostin related ဒြပ်ပေါင်းများ, ပရိုတိန်း kinase C. ၏တိကျသောနှင့်အစွမ်းထက် inhibitors ၏အသစ်တစ်ခုလူတန်းစား Adv ဒုတိယအ Messenger ကို Phosphoprotein Res 24:497-501 ။

Medline

တောရက်စ် J ကို, Pulido R ကို (2001) အဆိုပါအကျိတ်နှိမ်နင်း PTEN က၎င်း၏က C terminus မှာပရိုတိန်း kinase CK2 အားဖြင့် phosphorylated ဖြစ်ပါတယ်။ ကမကထပြုခဲ့ပျက်စီးခြင်း proteasome- မှ PTEN တည်ငြိမ်ရေးတို့အတွက်ဂယက်ရိုက်။ J ကို Biol Chem 276:993-998 ။

စိတ္တဇ / အခမဲ့အပြည့်အဝစာသား

Tsubuki S က, Saito Y ကို, Tomioka က M, Ito က H ကို, Kawashima S က (1996) di-leucine နှင့် tri-leucine ၏ peptidyl aldehydes အားဖြင့် calpain နှင့် proteasome လှုပ်ရှားမှုများ differential တားစီး။ ဂျေထဲကဓာတုပစ်စညျး (တိုကျို) 119:572-576 ။

စိတ္တဇ / အခမဲ့အပြည့်အဝစာသား

Tsurumi ကို C, Ishida N ကို, Tamura T က, Kakizuka တစ်ဦးက, Nishida အီး, Okumura အီး, Kishimoto T က, Inagaki M က, Okazaki K ကို Sagata N ကို (1995) အဆိုပါ 26S proteasome အားဖြင့်က c-Fos ၏ပျက်စီးခြင်းက c-ဇွန်လနှင့်မျိုးစုံပရိုတိန်း kinases အားဖြင့်အရှိန်သည်။ Mol ဆဲလ် Biol 15:5682-5687 ။

စိတ္တဇ / အခမဲ့အပြည့်အဝစာသား

Unger GM က, Davis က AT, Slaton JW, Ahmed ကငွေကျပ် (2004) ဆဲလ်ရှင်သန်မှု၏စည်းကမ်းထိန်းသိမ်းရေးအဖြစ်ပရိုတိန်း kinase CK2: ကင်ဆာကုထုံးများအတွက်ဂယက်ရိုက်။ Curr ကင်ဆာဆေးဝါးပစ်မှတ် 4:77-84 ။

CrossRefMedline

ဖလားကိုအီး, မာရှယ် CJ (2003) ဓာတ်လှေကား ERK-MAP kinase လှုပ်ရှားမှုအူမကြီးကင်ဆာဆဲလ်တွေမှာရှိတဲ့ proteasomal ပျက်စီးခြင်းဆန့်ကျင် FOS မိသားစုဝင် FRA-1 ကာကွယ်ပေးသည်။ J ကိုဆဲလ်သိပ္ပံ 116:4957-4963 ။

စိတ္တဇ / အခမဲ့အပြည့်အဝစာသား

Werme M က, Messer ကို C, Olson L ကို, Gilden L ကို, Thoren P ကို, Nestler EJ, Brene S က (2002) ΔFosBဘီးပြေးထိန်းညှိ။ J ကို neuroscience 22:8133-8138 ။

စိတ္တဇ / အခမဲ့အပြည့်အဝစာသား

Whitmarsh AJ, Davis က RJ (2000) phosphorylation ဖွငျ့ကူးယူအချက် function ကို၏စည်းမျဉ်း။ cell Mol ဘဝကသိပ္ပံ 57:1172-1183 ။

CrossRefMedline

ဆောင်းရာသီ B, Kautzner ငါ Issinger ဩဃ, အာနိုးနာရီ (1997) နှစျခု putative ပရိုတိန်း kinase CK2 phosphorylation က်ဘ်ဆိုက်များ Myf-5 လှုပ်ရှားမှုများအတွက်အရေးကြီးလှသည်။ Biol Chem 378:1445-1456 ။

Medline

Wisniewski JR, Szewczuk Z ကို, Petri ငါ Schwanbeck R ကို, Renner ဦး (1999) kinase II ကို casein အားဖြင့်မြင့်မားသော mobility အုပ်စုတစ်စု 1 ပရိုတိန်း၏အက်ဆစ်အမြီး၏ဖွဲ့စည်းပုံအခြေခံဥပဒေ phosphorylation သူတို့ရဲ့ညီတည်ငြိမ်ရေးနှင့် DNA ကို binding တိကျတဲ့ပွောငျးလဲ။ J ကို Biol Chem 274:20116-20122 ။

စိတ္တဇ / အခမဲ့အပြည့်အဝစာသား

ယာမာဂူချီက Y, Wada T က, ဆူဇူကီးက F, Takagi T က, Hasegawa J ကို, Handa H ကို (1998) Casein kinase II ကိုတော်တော်များများကူးယူအချက်များ၏ bZIP domains များနှင့်အတူအပြန်အလှန်ဆက်သွယ်။ Nucleic Acid Res 26:3854-3861 ။

စိတ္တဇ / အခမဲ့အပြည့်အဝစာသား

Yanagawa T က, Yuki K ကို Yoshida H ကို, Bannai S က, Ishii T က (1997) macrophages အတွက် kinase II ကို-တူသောလှုပ်ရှားမှု casein အားဖြင့် A170 စိတ်ဖိစီးမှုပရိုတိန်း၏ Phosphorylation ။ ထဲကဓာတုပစ်စညျး Biophys Res Community 241:157-163 ။

CrossRefMedline

Yankulov K ကို Yamashita K ကိုရွိုင်း R ကို, Egly JM, Bentley DL (1995) အဆိုပါမှတ်တမ်း elongated inhibitor 5,6-dichloro-1-beta-d-ribofuranosylbenzimidazole ကူးယူအချက် IIH-ဆက်စပ်ပရိုတိန်း kinase ဖြစ်စဉ်ကိုတားဆီးပေးပါတယ်။ J ကို Biol Chem 270:23922-23925 ။

စိတ္တဇ / အခမဲ့အပြည့်အဝစာသား

ယန်းဂျေ, ပညာသည် RM, Tratner ငါ Verma ထားတဲ့ IM (1991) FosB တစ်ခုကအခြားရွေးချယ်စရာ spliced ​​ပုံစံ Fos ပရိုတိန်းများကမှတ်တမ်း activation နှင့်အသွင်ပြောင်းတဲ့အနုတ်လက္ခဏာထိန်းညှိသည်။ proc Natl Acad သိပ္ပံယူအက်စ်အေ 88:5077-5081 ။

စိတ္တဇ / အခမဲ့အပြည့်အဝစာသား

ယဉ် X ကို, Jedrzejewski PT, Jiang JX (2000) Casein kinase II ကိုမှန်ဘီလူး connexin 45.6 phosphorylates နှင့်၎င်း၏ပျက်စီးခြင်းအတွက်ပါဝင်ပတ်သက်သည်။ J ကို Biol Chem 275:6850-6856 ။

စိတ္တဇ / အခမဲ့အပြည့်အဝစာသား

Yoza ကယ်, Brooks JW, Mizel SB (1992) 1 နှင့် phorbol Ester interleukin အားဖြင့်ကို T-ဆဲလ် activation စဉ်အတွင်းအေပီသတင်းဌာန-1 ကူးယူအချက်အစိတ်အပိုင်းများ induction ။ cell ကြီးထွားကွဲပြားခြားနားသော 3:677-684 ။

ြဒပ်မဲ့သော

ယုက S, ဝမ် H ကို, Davis ကတစ်ဦး, Ahmed ကငွေကျပ် (2001) နျူကလီးယား matrix ကိုမှအချက်ပြ CK2 ၏အကျိုးဆက်များ။ Mol ဆဲလ်ထဲကဓာတုပစ်စညျး 227:67-71 ။

CrossRefMedline

ယုက S, Davis က AT, Guo က C, အစိမ်းရောင် je, Ahmed ကငွေကျပ် (1999) ယင်း၏ subunits ၏ယာယီ overexpression ပေါ်မှာနျူကလီးယား matrix ကိုမှပရိုတိန်း kinase CK2 ၏ပစ်မှတ်ထား Differential ။ J ကိုဆဲလ်ထဲကဓာတုပစ်စညျး 74:127-134 ။

CrossRefMedline

Zachary V ကို, Bolanos, CA, Selley DE, Theobald: D, Cassidy အမတ်, Kelz ကို MB, Shaw-Lutchmann T က, Berton အို Sim-Selley LJ, DiLeone RJ, Kumar ကတစ်ဦး, Nestler EJ (2006) ΔFosB: မော်ဖင်းအကိုက်အရေးယူအတွက်နျူကလိယ accumbens အတွက်ΔFosBများအတွက်မရှိမဖြစ်အခန်းကဏ္ဍ။ နတ် neuroscience 9:205-211 ။

CrossRefMedline

ဤဆောင်းပါးတွင်ကိုးကားဆောင်းပါးများ