DeltaFosB pośrednio reguluje aktywność promotora Cck (2010)

Brain Res. 2010 May 6; 1329: 10 – 20.

Opublikowane online 2010 March 11. doi:  10.1016 / j.brainres.2010.02.081

PMCID: PMC2876727

John F. Enwright, III,1 Megan Wald,1 Madison Paddock,1 Elizabeth Hoffman,1 Rachel Arey,2 Scott Edwards,2 Sade Spencer,2 Eric J. Nestler,3 i Colleen A. McClung2, *

Informacje o autorze ► Informacje o prawach autorskich i licencji ►

Ostateczna, zredagowana wersja tego artykułu jest dostępna pod adresem brain Res

Zobacz inne artykuły w PMC, że cytować opublikowany artykuł.

Idź do:

Abstrakcyjny

Niektóre z ważnych zmian biochemicznych, strukturalnych i behawioralnych wywołanych przewlekłą ekspozycją na narkotyki wydają się być mediowane przez wysoce stabilny czynnik transkrypcyjny ΔFosB. Poprzednie prace wykazały, że nadekspresja ΔFosB u myszy w tygodniach 2 prowadzi do wzrostu ekspresji wielu genów w prążkowiu, z których większość jest później obniżana po tygodniach ekspresji ΔFosB po 8. Co ciekawe, dużą liczbę tych genów zwiększono również u myszy z nadekspresją czynnika transkrypcji CREB. Z tego badania nie było jednak jasne, czy krótkoterminowe ΔFosB reguluje te geny za pośrednictwem CREB. Tutaj stwierdzamy, że tygodnie 2 nadekspresji ΔFosB zwiększają ekspresję CREB w prążkowiu, efekt, który rozprasza się przez tygodnie 8. Wczesna indukcja jest związana ze zwiększonym wiązaniem CREB do pewnych docelowych promotorów genów w tym regionie mózgu. Zaskakująco, jeden gen, który był podejrzanym celem CREB na podstawie poprzednich raportów, cholecystokinina (Cck), nie był kontrolowany przez CREB w prążkowiu. Aby dokładniej zbadać regulację Cck po nadekspresji ΔFosB potwierdziliśmy, że krótkotrwała nadekspresja ΔFosB zwiększa oba Cck aktywność promotora i ekspresja genu. Zwiększa również aktywność wiązania w domniemanym miejscu wiązania CREB (CRE) w Cck promotor. Jednakże, podczas gdy miejsce CRE jest niezbędne dla normalnej podstawowej ekspresji Cck, nie jest wymagany do indukcji ΔFosB Cck. Podsumowując, wyniki te sugerują, że chociaż krótkotrwała indukcja ΔFosB zwiększa ekspresję CREB i aktywność w pewnych promotorach genów, nie jest to jedyny mechanizm, dzięki któremu geny są regulowane w górę w tych warunkach.

Słowa kluczowe: jądro półleżące, transkrypcja, uzależnienie

Idź do:

WPROWADZENIE

Chroniczna ekspozycja na narkotyki powoduje zmiany biochemiczne i strukturalne w kilku regionach mózgu. Uważa się, że zmiany te obejmują zmiany w profilach ekspresji genów w układzie mezolimbicznym. System ten składa się z neuronów dopaminergicznych, które wystają z brzusznego obszaru nakrywkowego (VTA) w śródmózgowiu do średnich neuronów kolczastych w jądrze półleżącym (NAc) (prążkowiu brzusznym), jak również wielu innych obszarach mózgu. Zaproponowano zmiany aktywności dwóch czynników transkrypcyjnych, białka wiążącego element odpowiedzi cAMP (CREB) i ΔFosB (białko z rodziny Fos), aby pośredniczyć w wielu zmianach biochemicznych, strukturalnych i behawioralnych obserwowanych w przypadku chronicznej ekspozycji na narkotyki ( zrecenzowany przez Nestler, 2005).

CREB jest wszechobecnym czynnikiem transkrypcyjnym, który jest członkiem rodziny CREB / ATF. Homodimery CREB wiążą się z odmianami sekwencji CRE (konsensus: TGACGTCA) występującymi w promotorach wielu genów. Fosforylacja CREB (głównie w serynie 133, chociaż zidentyfikowano inne miejsca) może być stymulowana przez kilka kaskad sygnalizacyjnych, w tym te za receptorami dopaminy (Cole i in., 1995). Po fosforylacji w serynie 133, CREB rekrutuje koaktywator białka wiążącego CREB (CBP) lub pokrewne białka prowadzące do zwiększonej ekspresji genów (omówione przez Johannessen i in., 2004). Przewlekła ekspozycja na opiaty lub leki psychostymulujące nadużywanie wywołuje przejściowy wzrost aktywności CREB w jądrze półleżącym (Barrot i wsp., 2002; Shaw-Lutchman i wsp., 2002, 2003), adaptacja, która ma na celu zmniejszenie nagradzających właściwości tych leków i przyczynienie się do negatywnego stanu emocjonalnego odstawienia leku (Nestler, 2005).

LUważa się, że trwające adaptacje leków do nadużywania są częściowo mediowane przez ΔFosB, wysoce stabilny wariant połączenia FosB (Nestler i wsp., 1999; McClung i wsp., 2004; Nestler, 2008). Członkowie rodziny Fos dimeryzują z członkami rodziny Jun, tworząc kompleks aktywatora białka 1 (AP-1). Kompleksy transkrypcyjne AP-1 wiążą się z odmianami elementu odpowiedzi AP-1 (konsensus: TGACTCA) w celu regulacji transkrypcji (przegląd przez Chinenov i Kerppola, 2001). Podczas gdy ostra ekspozycja na narkotyki prowadzi do krótkotrwałej indukcji (godziny) członków rodziny Fos (jak również zwiększonej aktywności CREB), powtarzana ekspozycja na lek prowadzi do akumulacji wysoce stabilnej ΔFosB (Hope i wsp., 1994; Perrotti i wsp., 2008), którego wyrażenie utrzymuje się przez kilka tygodni.

Bi-transgeniczne myszy indukujące nadmierną ekspresję ΔFosB lub CREB w prążkowiu dorosłym wykazują wiele fenotypów biochemicznych i behawioralnych obserwowanych u zwierząt narażonych wielokrotnie na psychostymulanty lub inne narkotyki. ZAAnaliza zmian ekspresji genów u tych zwierząt transgenicznych pozwoliła zidentyfikować liczne geny zwiększone przez krótkotrwałą (2 tygodnie) nadekspresję ΔFosB, zmiany związane z jednoczesnym zmniejszeniem nagrody za lek. Zmiany w ekspresji genów i odpowiedzi behawioralnej przy krótkotrwałym ΔFosB były znacząco podobne do tych obserwowanych u zwierząt z nadekspresją CREB w tygodniach 2 lub 8 (McClung i Nestler, 2003). W uderzającym kontraście, długotrwała nadekspresja (tygodnie 8) ΔFosB zmniejszyła ekspresję wielu z tych samych genów i doprowadziła do wzrostu nagrody za lek (Kelz i wsp., 1999; McClung i Nestler, 2003).

Jednym genem zidentyfikowanym w tych badaniach jest cholecystokinina (Cck), neuropeptyd wytwarzany w kilku regionach mózgu, w tym w prążkowiu (Hokfelt i in., 1980). CCK może modulować transmisję dopaminergiczną (Vaccarino, 1992), bierze udział w nagradzaniu i wzmacnianiu narkotyków (Josselyn i in., 1996; Josselyn i in., 1997; Hamilton i in., 2000; Beinfeld i in., 2002; Rotzinger i in., 2002) i jest indukowany w prążkowiu przez chroniczną kokainę (Ding i Mocchetti, 1992). Dodatkowo Cck wykazano, że promotor reaguje zarówno na kompleksy CREB, jak i AP-1 (Haun i Dixon, 1990; Deavall i in., 2000; Hansen, 2001). Ponieważ wiele genów (w tym Cck), które wykazały zwiększoną ekspresję zarówno po CREB, jak i krótkoterminowej ekspresji ΔFosB były znane lub podejrzewane o docelowe geny CREB (McClung i Nestler, 2003), chcieliśmy ustalić, czy krótkoterminowa ekspresja ΔFosB prowadzi do regulacji tych genów (z naciskiem na Cck) poprzez regulację CREB lub poprzez bardziej złożone mechanizmy regulacji genów.

Idź do:

WYNIKI

Nadekspresja ΔFosB przejściowo zwiększa poziomy CREB

Zastosowaliśmy Western blotting w celu zbadania, czy nadekspresja ΔFosB zwiększa poziomy białka CREB w prążkowiu myszy. Do tego badania wykorzystaliśmy bi-transgeniczne myszy (linia 11A), które niosą zarówno transgen NSE-tTA, jak i transgen TetOp-ΔFosB. W przypadku braku doksycykliny myszy te wykazują silny wzrost ekspresji ΔFosB w neuronach dodatnich dynorfiny w prążkowiu (Kelz i wsp., 1999). Ta metoda nadekspresji ΔFosB została obszernie udokumentowana i pozwala na specyficzną dla regionu nadekspresję, która jest podobna do indukcji ΔFosB obserwowanej u zwierząt narażonych na przewlekłą kokainę (Hope i wsp., 1994; Kelz i wsp., 1999). Stwierdziliśmy, że u myszy 11A z nadekspresją ΔFosB, poziomy białka CREB były znacząco zwiększone po tygodniach ekspresji 2 i poziomy te powróciły do ​​wartości wyjściowych po tygodniach ekspresji 8 (Rysunek 1A, n = 8). Aby określić, czy zmiany w poziomach CREB z krótkotrwałą nadekspresją ΔFosB mogą być replikowane w innym systemie, przejściowo wykazaliśmy nadekspresję ΔFosB w komórkach PC12 i stwierdziliśmy, że poziomy CREB wzrosły znacząco (p <0.05) w porównaniu z kontrolami (Rysunek 1B, n = 4). Wyniki te pokazują, że krótkoterminowa ekspresja ΔFosB zwiększa poziomy białka CREB.

Rysunek 1

Rysunek 1

Poziom CREB wzrasta wraz z nadekspresją ΔFosB. Analiza Western blot lizatów () prążki myszy od myszy 11A wyłączone z dox dla 2 lub 8 tygodni lub (B) Komórki PC12 nadeksprymujące ΔFosB. Dane w A są pokazane jako procent zmiany w porównaniu dox w porównaniu ...

Zarówno ΔFosB, jak i CREB wiążą się z promotorami specyficznych genów docelowych w prążkowiu po krótkotrwałej nadekspresji ΔFosB

Zastosowaliśmy testy ChIP (immunoprecypitacja chromatyny) tkanki prążkowia w celu określenia, czy wiązanie ΔFosB lub CREB występowało w pewnych promotorach genu docelowego i czy to wiązanie było zwiększone po krótkotrwałej nadekspresji ΔFosB. Przeanalizowaliśmy wiązanie na stronie BDNF i Cck promotory, ponieważ oba geny są silnie regulowane w górę po krótkotrwałej nadekspresji ΔFosB, nadekspresji CREB lub przewlekłym leczeniu kokainą (McClung i Nestler, 2003). Przeanalizowaliśmy również wiązanie na stronie CDK5 promotor, ponieważ jest znanym bezpośrednim celem ΔFosB (Chen i wsp., 2000; Bibb i wsp., 2001; Kumar i wsp., 2005). W końcu zmierzyliśmy wiązanie na prodynorfina promotor, ponieważ poprzednie badania wykazały, że mogą być związane zarówno przez ΔFosB, jak i CREB w różnych warunkach (Andersson i in., 2001; Zachariou i wsp., 2006).

Analizę ChIP przeprowadzono na prążkowiu z myszy 11A z nadekspresją ΔFosB w tygodniach 2 przy użyciu przeciwciał rozpoznających CREB lub ΔFosB. W normalnych warunkach odkryliśmy, że ΔFosB wiąże się z CDK5 i prodynorfina promotory, podczas gdy nie ma wykrywalnego wiązania na BDNF or Cck organizatorzy (Tabela 1). Ponadto nadekspresja ΔFosB zwiększała wiązanie ΔFosB w pozycji CDK5 promotor, ale nie w prodynorfina promotor. Następnie dokonaliśmy pomiaru wiązania CREB w tych promotorach i stwierdziliśmy, że CREB wiąże się z CDK5, BDNF i prodynorfina promotorów, ale nie do Cck promotora, w normalnym prążkowiu i że nadekspresja ΔFosB w tygodniach 2 zwiększa wiązanie CREB w BDNF i prodynorfina promotorzy, ale nie CDK5 promotor. Podsumowując, wyniki te pokazują, że ΔFosB i CREB mogą zarówno wiązać się z pewnymi promotorami genów, takimi jak prodynorfina i CDK5jednakże wiązanie CREB jest specyficzne dla innych promotorów, takich jak BDNF. Ponadto, nadekspresja ΔFosB prowadzi do wzrostu wiązania ΔFosB w pewnych promotorach, jak można było oczekiwać, ale także do wiązania CREB ze specyficznymi promotorami, zgodnie z indukowaną przez ΔFosB indukcją CREB obserwowaną w tym punkcie czasowym.

Tabela 1

Tabela 1

Wiązanie przypuszczalnych białek regulatorowych z różnymi promotorami u myszy z nadekspresją ΔFosB przez dwa tygodnie.

Wcześniejsze prace wykazały, że zmiany w ekspresji genów indukowane przez długotrwałą nadekspresję ΔFosB są związane z modyfikacjami chromatyny, w szczególności z acetylacją histonu H3, w specyficznych promotorach genów (Kumar i wsp., 2005). Aby określić, czy może to wyjaśniać zmiany w ekspresji genu po krótszym czasie nadekspresji ΔFosB, mierzyliśmy wiązanie acetylowanego histonu H3 (modyfikacja histonu związana z aktywną transkrypcyjnie chromatyną) lub metylowanego histonu H3 (Lys9, modyfikacja histonu związana z transkrypcją nieaktywna chromatyna). Odkryliśmy, że nadekspresja ΔFosB dla tygodni 2 nie powodowała żadnych zmian w wiązaniu acetylowanego H3 w żadnym z badanych promotorów genów (Tabela 1). Znaleźliśmy znaczący spadek wiązania metylowanego histonu H3 w prodynorfina promotor, ale bez wiązania na Cck promotor i brak zmian w wiązaniu CDK5 i BDNF promotory, sugerując, że nie jest to ogólny mechanizm, za pomocą którego ΔFosB w krótkim okresie reguluje ekspresję genów. Byliśmy zaskoczeni i zainteresowani faktem, że nie znaleźliśmy żadnych różnic w naszych testach ChIP, które mogłyby wyjaśniać wzrost Cck ekspresja mRNA u myszy 11A po tygodniach ekspresji ΔFosB po 2 i postanowiono dalej badać ten mechanizm.

Krótkoterminowy ΔFosB wzrasta Cck ekspresja w wielu systemach

Charakterystyka mikromacierzy bi-transgenicznych myszy 11A z nadekspresją ΔFosB w prążkowiu wykazała, że Cck poziomy ekspresji wzrastają po tygodniach nadekspresji 2, a następnie stopniowo zmniejszają się z dłuższymi okresami ekspresji ΔFosB (Rysunek 2A, n = 3). Zatwierdziliśmy ten efekt dla Cck stosując PCR w czasie rzeczywistym na oddzielnej grupie zwierząt w tygodniach 2 i 8 i stwierdzili, że wyniki w dwóch punktach czasowych są podobne do analizy mikromacierzy (dane nie pokazane).

Rysunek 2

Rysunek 2

Krótkoterminowa nadekspresja ΔFosB wzrasta Cck Ekspresja genu. (A) Cck Ekspresja mRNA w prążkowiu po nadekspresji ΔFosB u myszy 11A w tygodniach 1, 2, 4 lub 8. Analizę mikromacierzy przeprowadzono na próbkach prążkowia i Cck poziomy ...

Aby dokładniej zbadać zdolność ΔFosB do regulacji Cck ekspresji użyliśmy komórek PC12 przejściowo transfekowanych a Cckplazmid reporterowy lucyferazy i plazmid ekspresyjny ΔFosB lub równa ilość pCDNA. Zarówno dwa (n = 5-9), jak i trzy (n = 11-13) dni nadekspresji ΔFosB spowodowały znaczący wzrost Cckekspresja lucyferazy. Dodatkowo, trzy dni nadekspresji ΔFosB spowodowały znacznie więcej Cckindukcja lucyferazy w porównaniu do dwóch dni nadekspresji (Rysunek 2B). Nadekspresja ΔFosB nie indukowała ekspresji konstruktu lucyferazy bez promotora (dane nie pokazane). W żadnych warunkach leczenia nie było zmniejszenia Cckwidoczna aktywność lucyferazy. Wyniki te pokazują, że krótkoterminowa ekspresja ΔFosB zwiększa aktywność Cck promotor i pozostawia bez odpowiedzi mechanizm, dzięki któremu długotrwała nadekspresja ΔFosB tłumi Cck wyrażenie.

Nadekspresja ΔFosB zwiększa wiązanie w domniemanym miejscu wiązania CREB w Cck promotor

Nasze analizy to odkryły Cck ekspresja wzrasta po krótkotrwałym wyrażeniu ΔFosB, jednak nasze testy ChIP wykazały, że ani CREB, ani ΔFosB nie wiążą się z Cck promotor. Aby ustalić, czy są jakieś zmiany w wiązaniu białka w Cck promotor po nadekspresji ΔFosB, zastosowaliśmy testy przesunięcia ruchliwości elektroforetycznej (EMSA) z sondą zawierającą domniemane miejsce podobne do CRE obecne w Cck promotor. Stosując ekstrakty jądrowe z prążkowia myszy 11A z nadekspresją ΔFosB w tygodniach 2, stwierdziliśmy wzrost wiązania z przypuszczalnym miejscem CRE w Cck promotor (Rysunek 3 A, C, n = 4). Co ciekawe, myszy 11A z nadekspresją ΔFosB dla 8 tygodni, które wykazują spadek Cck ekspresja wykazała również zwiększone wiązanie w tym miejscu (Rysunek 3B, C, n = 4). Dla porównania zbadaliśmy wiązanie do konsensusowego miejsca CRE u myszy z nadekspresją ΔFosB w tygodniach 2 i stwierdziliśmy silne wiązanie CRE w ekstraktach prążkowia, ale brak wzrostu wiązania po indukcji ΔFosB (Rysunek 3F, n = 4). Tak więc, pomimo indukowanego przez ΔFosB wzrostu całkowitego poziomu CREB obserwowanego w tym punkcie czasowym, wyniki te są zgodne z naszymi testami ChIP, które wykazują, że zwiększone wiązanie CREB w promotorach po nadekspresji ΔFosB jest specyficzne tylko dla pewnych genów i nie jest zjawiskiem globalnym . Aby ustalić, czy CREB jest powiązany z Cck w naszej analizie EMSA, wykonaliśmy testy supershift z przeciwciałem specyficznym dla CREB. Zgodnie z naszymi testami ChIP nie znaleźliśmy żadnego wiązania CREB z a Cck sonda zawierająca domniemane miejsce CRE w testach EMSA, podczas gdy CREB znacząco wiązał i przesuwał konsensusowe miejsce CRE (Rysunek 3D, E, n = 4). Aktywność wiązania DNA w Cck na promotor nie wpływało również przeciwciało przeciwko ΔFosB (dane nieprzedstawione), w warunkach pokazanych w kilku wcześniejszych badaniach, aby zablokować wiązanie ΔFosB z bona fide miejscami AP-1 (Hope et al., 1994a, 1994b; Chen i wsp., 1995, Hiroi i wsp., 1998). Przeprowadziliśmy również testy ChIP na prążkowiu zwierząt 11A po tygodniach ekspresji ΔFosB po 8 i nadal nie znaleźliśmy wiązania CREB lub ΔFosB w Cck promotor (dane nie pokazane). Zatem ekspresja ΔFosB prowadzi do zwiększenia wiązania białka w Cck promotor po tygodniach ekspresji 2 i 8; jednak tożsamość tych czynników pozostaje nieznana.

Rysunek 3

Rysunek 3

Wiązanie białka w Cck promotor. (A, B) Test przesunięcia ruchliwości elektroforetycznej przy użyciu Cck Miejsce przypominające CRE z tkanką prążkowia od zwierząt z nadekspresją ΔFosB dla 2 tygodni (A) lub 8 tygodni (B). W (A), rywalizacja z nadmiarem nieznakowanego zawodnika ...

Przypuszczalne miejsce CRE w Cck promotor nie jest odpowiedzialny za zwiększoną aktywność promotora

Odkąd znaleźliśmy wzrost wiązania białek przy użyciu fragmentu Cck promotor, który zawiera przypuszczalne miejsce CRE, po nadekspresji ΔFosB, chcieliśmy ustalić, czy to miejsce jest konieczne dla zwiększenia Cck ekspresja po nadekspresji ΔFosB. Aby przetestować tę możliwość, transfekowaliśmy komórki PC12 za pomocą Cck-lazmidaza plazmidowa zawierająca nienaruszone miejsce przypominające CRE lub zawierająca mutację w miejscu, która zniosłaby wszelką interakcję z CREB. Co ciekawe, mutacja w miejscu podobnym do CRE zmniejszyła się podstawowa Cck aktywność promotora 32% (Rysunek 4A, n = 9), ale nie wpłynęło na Cck indukcja promotora przez nadekspresję ΔFosB (Rysunek 4B, n = 11-13). Sugeruje to, chociaż Cck promotor wymaga nienaruszonego miejsca podobnego do CRE dla pełnej aktywności podstawowej, zwiększona aktywność promotora indukowana przez nadekspresję ΔFosB nie wymaga sekwencji podobnej do CRE.

Rysunek 4

Rysunek 4

W ramach projektu Cckpodobny do CRE nie jest konieczny Cck indukcja ΔFosB. (A) CckAktywność -lucyferazy mierzono 2 dni po transfekcji albo normalną Cck-lucyferaza lub taka, w której miejsce podobne do CRE zostało zmutowane. * p <0.05, XNUMX (B) Cck-lucyferaza ...

cFos wiąże się z Cck promotor

Poprzednie badania wykazały, że cFos mRNA wzrasta z krótkotrwałą ekspresją ΔFosB, jednak po przedłużonej ekspresji ΔFosB zdolność leczenia kokainy do indukowania cFos w prążkowiu jest zmniejszona (McClung i Nestler, 2003; Renthal i in., 2008). Dlatego może być możliwe, że cFos przyczynia się do wzrostu Cck wyrażenie po krótkotrwałej ekspresji ΔFosB. Przeprowadziliśmy testy ChIP z przeciwciałem specyficznym dla cFos i zmierzono wiązanie cFos w punkcie Cck promotor zi bez krótkotrwałej ekspresji ΔFosB. Podczas gdy odkryliśmy, że cFos wiąże się z Cck promotor, wiązanie to nie zwiększyło znacząco po nadekspresji ΔFosB (Rysunek 5, n = 5). Sugeruje to, że ponieważ cFos wiąże Cck promotor, może przyczynić się do ogólnej regulacji Cck wyrażenie, ale prawdopodobnie nie bierze udziału w regulacji Cck promotor ΔFosB.

Rysunek 5

Rysunek 5

cFos wiąże się z Cck promotor. Testy immunoprecypitacji chromatyny przeprowadzono ze specyficznym przeciwciałem dla cFos przy użyciu tkanki prążkowia z myszy z nadekspresją ΔFosB albo na dox, albo po tygodniach usuwania Xx do 2. Przeprowadzono analizę PCR w czasie rzeczywistym ...

Idź do:

DYSKUSJA

Badanie to potwierdza i poszerza wcześniejsze ustalenia pokazujące, że ΔFosB reguluje ekspresję genów w prążkowiu i stwierdzamy, że robi to poprzez wiele mechanizmów po krótkotrwałej ekspresji. Pokazujemy, że po tygodniach nadekspresji 2 ΔFosB wiąże się bezpośrednio z promotorami w niektórych genach, co prowadzi do zmian w ekspresji (tj. CDK5). Ponadto zwiększa poziomy białka CREB, efekt obserwowany w hodowanych komórkach, a także w prążkowiu, co prowadzi do zwiększonego wiązania CREB w innych promotorach genów (tj. dynorfin i BDNF). W poprzednim badaniu odkryliśmy, że krótkotrwała nadekspresja ΔFosB w prążkowiu prowadzi do wielu tych samych zmian ekspresji genów, które występują, gdy CREB jest nadeksprymowane i prowadzi do podobnych reakcji behawioralnych w pomiarach preferencji kokainy (McClung i Nestler, 2003). Zatem niniejsze odkrycie, że ΔFosB prowadzi do indukcji CREB, jak również wiązania CREB do pewnych promotorów genów, pomaga wyjaśnić, dlaczego tak wiele zmian ekspresji genów było wspólnych dla tych dwóch czynników transkrypcyjnych.

Indukcja CREB przez ΔFosB jest interesująca, ponieważ wykazano, że leki nadużywające indukują zmiany poziomów CREB w fosforylowanej seryny 133 (Mattson i in., 2005) i zwiększyć transkrypcję za pośrednictwem CRE (Barrot i wsp., 2002; Shaw-Lutchman i wsp., 2002, 2003), bez zmiany ogólnego poziomu CREB. Możliwe, że zmiany poziomów CREB mogą być przemijające, a zatem łatwo przeoczyć w innych badaniach. W naszych rękach widzieliśmy indukowane kokainą wzrosty mRNA CREB w poszczególnych eksperymentach, jednak efekt ten jest bardzo zmienny (obserwacja niepublikowana). Ponieważ zarówno transgeniczne myszy 11A, jak i komórki PC-12 wykazują indukcję CREB po krótkotrwałej nadekspresji ΔFosB, sugeruje to, że CREB jest rzeczywiście indukowany przez ΔFosB (lub cel ΔFosB), zapewniając kolejny mechanizm wyjaśniający zmiany w genie wywołane lekiem wyrażenie.

Zaskakująco stwierdziliśmy, że ani CREB, ani ΔFosB nie wiążą się z Cck mimo to promotor Cck ekspresja jest wyraźnie zwiększona po krótkotrwałej ekspresji ΔFosB. Cck jest obfitym neuropeptydem wyrażanym zarówno w VTA, jak i NAc (Hokfelt i in., 1980) i prawdopodobnie bierze udział w reakcjach behawioralnych na narkotyki (Josselyn i in., 1996; Josselyn i in., 1997; Hamilton i in., 2000; Beinfeld i in., 2002; Rotzinger i in., 2002). W testach hodowli komórkowej Cck promotor został obszernie scharakteryzowany i wykazano, że reaguje na członków rodziny CREB i AP-1 (przeglądowi przez Hansen, 2001). Haun i Dixon (1990) wykazali, że kompleksy AP-1 mogą wiązać się z Cck Strona podobna do CRE in vitroi później pokazano, używając komórek neuroblastoma SK-N-MC, że mutacja w miejscu podobnym do CRE zmniejszyła odpowiedź promotora na nadekspresjonowane cFos / cJun (Rourke i in., 1999). Rzeczywiście, również się zwiększyliśmy Cck aktywność promotora (Rysunek 2) i wiązanie na lub wokół elementu podobnego do CRE (Rysunek 3) po nadekspresji ΔFosB, innego członka rodziny AP-1, ale nie znajdujemy bezpośredniego wiązania ΔFosB z Cck promotor in vivo or in vitro, nawet po nadekspresji.

Wiele pracy wykazało rolę CREB w regulacji Cck aktywność promotora. The Cck Miejsce podobne do CRE jest zachowane u kręgowców (Hansen, 2001), aw niektórych testach hodowli komórkowych, zarówno kompleksy CREB, jak i AP-1 wiążą się z tym miejscem i są niezbędne dla Cck aktywność promotora (Haun i Dixon, 1990; Deavall i in., 2000; Hansen, 2001). Dodatkowo kilka znanych aktywatorów Cck wykazano, że ekspresja (w tym bFGF, PACAP, peptony i depolaryzacja) działa poprzez CREB (Hansen i in., 1999; Deavall i in., 2000; Bernard i in., 2001; Gevrey i in., 2002; Hansen i in., 2004). Nasz CckDane dotyczące genu reporterowego lucyferazy potwierdzają istotną rolę w przypadku CRE-like w regulacji Cck aktywność promotora, ponieważ mutacja tego miejsca zmniejsza podstawowe Cck aktywność promotora i Cck- ekspresja lluferoidazy indukowana przez VP16-CREB, konstytutywnie aktywną formę CREB, zostaje utracona, gdy to miejsce jest zmutowane (obserwacja niepublikowana). Dlatego byliśmy zaskoczeni, że CREB nie wydaje się wiązać z Cck promotor w ekstraktach prążkowia albo na linii podstawowej, albo na krótkotrwałej nadekspresji ΔFosB, gdy poziomy CREB są zwiększone. To dowodzi, że poziomy CREB per se nie są jedynym czynnikiem określającym ilość wiązania na tej stronie, a to jest wspierane przez pracę innych (Cha-Molstad i in., 2004). Od promotorów innych, wcześniej zidentyfikowanych genów docelowych CREB, takich jak BDNF i prodynorfina, wiązało CREB, jesteśmy pewni naszego odkrycia, że ​​CREB nie wiąże się z Cck promotor w ekstraktach jądrowych prążkowia. Ponadto indukcja CckAktywność -lucyferazy ΔFosB nie była zależna od nienaruszonego miejsca podobnego do CRE, co sugeruje, że ΔFosB nie reguluje Cck ekspresja poprzez regulację bezpośredniego wiązania CREB do Cck promotor.

Nasza niezdolność do wykrywania CREB wchodzących w interakcje z Cck promotor jest wspierany przez Renthal i in. (2009), który zastosował metodę chipową ChIP, aby przyjrzeć się globalnym zmianom w fosforylowanym CREB (pCREB) i wiązaniu ΔFosB w prążkowiu po przewlekłej ekspozycji na kokainę. W tych doświadczeniach kompleksy DNA-białko poddano immunoprecypitacji z przeciwciałami ΔFosB lub pCREB, a wytrącone DNA po znakowaniu hybrydyzowano z mikromacierzą promotora. Podczas gdy wiele wcześniej scharakteryzowanych genów docelowych CREB zostało zidentyfikowanych za pomocą tego podejścia (np. BDNF, prodynorfina), Cck nie został zidentyfikowany. Ponadto wykazano, że wiązanie CREB do zgodnego miejsca CRE różni się znacznie między hodowanymi liniami komórkowymi (Cha-Molstad i in., 2004). Wszystkie poprzednie badania, które odkryły interakcje CREB z Cck promotor prowadzono w hodowli komórkowej (nie w mózgu, z którego pochodziły nasze próbki EMSA i ChIP) i stosowano testy przesunięcia żelu w celu zbadania interakcji białko-DNA. Podczas gdy EMSA może ocenić potencjał czynnika do wiązania się z sekwencją DNA, testy ChIP dostarczają nowatorskiego spojrzenia na te interakcje in vivo. Ponadto wiele danych pokazuje albo indukcję Cck aktywność promotora lub wiązanie CREB do Cck promotor uzyskano z komórek stymulowanych przez czynniki takie jak peptony (Bernard i in., 2001), depolaryzacja (Hansen i in., 2004), lub różne aktywatory wewnątrzkomórkowych kaskad sygnalizacyjnych, w tym cAMP i ERK (Hansen i in., 1999). W naszych eksperymentach jedynym używanym „bodźcem” była nadekspresja ΔFosB, która jest wystarczająca do wywołania Cck wyrażenie. Podsumowując, sugeruje to, że CREB może wiązać się z (i potencjalnie regulować) Cck promotor jest silnie zależny od typu komórki i aktywacji poszczególnych szlaków sygnałowych. Dodatkowo Cck Element promotorowy podobny do CRE (przynajmniej w nieindukowanych komórkach PC12 i prążkowiu myszy) nie jest bezpośrednim celem CREB ani ΔFosB. Co ciekawe, regulacja FosB ekspresja CREB jest również specyficzna dla typu komórki i rodzaju stymulacji. Badanie Anderssona i wsp. stwierdzili, że wstrzyknięcie antysensownych oligonukleotydów CREB do prążkowia myszy częściowo hamowało indukcję FosB po podaniu kokainy (Andersson i in., 2001). Jednak odkryli również, że zdolność L-Dopy do indukowania FosB na ekspresję prążkowia uszkodzonego 6-OHDA nie miała wpływu obecność antysensownych oligonukleotydów CREB.

Ponieważ CREB i ΔFosB wydają się pośrednio regulować Cck promotor i zmiany w strukturze chromatyny zostały udokumentowane w odpowiedzi na różne bodźce, które indukują ΔFosB (Tsankova i in., 2004; Kumar i wsp., 2005; Renthal i in., 2008), stwierdziliśmy, że ΔFosB może pośrednio modulować aktywność promotora poprzez zmianę struktury chromatyny. Jednak u myszy z nadekspresją ΔFosB w tygodniach 2 nie było zmiany w acetylacji histonu H3 w Cck promotor (Tabela 1). Jest to wspierane przez dane chipu ChIP z Renthal i in. (2009), który zgłosił brak zmiany acetylowanego wiązania H3 na Cck promotor u myszy narażonych na przewlekłą kokainę. Od Cck promotor jest aktywny w prążkowiu, nie spodziewano się ani nie zaobserwowano żadnego represyjnego wiązania metylowanego histonu H3. Co ciekawe, nie zaobserwowaliśmy również żadnych zmian z powodu nadekspresji ΔFosB w acetylowanym wiązaniu H3 w BDNF promotor (który wykazywał zwiększone wiązanie CREB) lub na CDK5 i prodynorfina promotory (które wykazały zwiększone wiązanie ΔFosB). Ponieważ istnieje mnóstwo modyfikacji histonów związanych ze zmianami aktywności promotora (przegląd przez Rando i Chang, 2009), prawdopodobnie istnieją inne modyfikacje chromatyny, które wiążą się z indukcją tych genów. Każda modyfikacja pojedynczej chromatyny, chociaż często predykcyjna poziom aktywności promotora, może nie zmieniać się podczas aktywacji konkretnego genu. W przyszłych pracach interesujące byłoby spojrzenie na inne potencjalne zmiany w strukturze chromatyny wokół Cck promotor po nadekspresji ΔFosB. Co ciekawe, chroniczna kokaina (prawdopodobnie przez Wykazano, że indukcja ΔFosB indukuje ekspresję deacetylaz histonów sirtuiny 1 i 2, klasy III, które wydają się zmieniać fizjologię neuronów, sygnalizację ERK i reakcje behawioralne na kokainę (Renthal i in., 2009). Indukcja deacetylazy histonowej miałaby zdolność do jednoczesnej regulacji ekspresji dużej liczby genów przez globalne zmiany w strukturze chromatyny.

Jeden z możliwych kandydatów Cck regulacją po nadekspresji ΔFosB był członek rodziny AP-1 cFos. Ekspresja cFos jest regulowana przez CREB (Sheng i in., 1990; Impey i in., 2004), i wzrasta nadekspresja cFos (zgodna z nadekspresją jej partnera wiążącego cJun) Cck aktywność promotora (Rourke i in., 1999). Dlatego też zwiększone poziomy CREB z powodu krótkotrwałej nadekspresji ΔFosB mogą zwiększać poziomy cFos i powodować zwiększone wiązanie z Cck Strona podobna do CRE. cfos mRNA jest indukowany u myszy po dwóch tygodniach nadekspresji ΔFosB (McClung i Nestler, 2003) i zmniejszyła się u myszy narażonych na przewlekłą kokainę lub długotrwałą nadekspresję ΔFosB (Renthal i in., 2008). Tutaj stwierdzamy, że cFos wiąże się bezpośrednio z Cck promotor w tkance prążkowia, jednak nadekspresja ΔFosB nie zwiększa znacząco wiązania. Sugeruje to, że chociaż cFos może być związane z regulowaniem Cck ogólnie rzecz biorąc, zmiana wiązania samego cFos nie jest mechanizmem, za pomocą którego ΔFosB reguluje Cck wyrażenie. Możliwe jest jednak, że ΔFosB może indukować albo posttranslacyjne zmiany w cFos (np. Zmieniona fosforylacja) albo indukować ekspresję partnera wiążącego (takiego jak cJun) lub białka koaktywatora. Jednakże, ponieważ nienaruszone miejsce przypominające CRE (które wcześniej wykazano, że jest miejscem wiązania kompleksów AP-1, patrz Haun i Dixon, 1990) nie jest wymagane dla zwiększonych Cck aktywność promotora obserwowana przy nadekspresji ΔFosB (ocenianej w naszych eksperymentach z genem reporterowym), ma uzasadnienie, że ΔFosB regulują również inne czynniki działające trans.

W ramach projektu Cck fragment promotora stosowany w naszych eksperymentach z genem reporterowym lucyferazy zawiera konserwowane miejsce wiązania Sp1 i E-box (przegląd przez Hansen, 2002). W szczególności wykazano, że sekwencje E-box wiążą liczne czynniki transkrypcyjne (omówione przez Forrest i McNamara, 2004). Używając komórek PC12, widzieliśmy, że mutacja E-boxu maleje Cck aktywność promotora, ale nie zmienia odpowiedzi promotora na ΔFosB (dane nie pokazane). Co ciekawe, a CckReporter zawierający lucyferazę zawierający mutacje w miejscu CRE i E-box nie ma wykrywalnej aktywności podstawowej i nie odpowiada na nadekspresję ΔFosB (obserwacja niepublikowana). Inny potencjalny mediator akcji ΔFosB na Cck promotorem są ATF, o których wiadomo, że niektóre formy są indukowane w prążkowiu przez przewlekłą ekspozycję psychostymulującą (Green i wsp., 2008). Nie znaleźliśmy jednak dowodów na indukcję ΔFosB tych ATF (dane nie pokazane), a ATF nie wiązałyby się ze zmutowanym miejscem CRE-podobnym na Cck promotor.

Jedynym zastrzeżeniem tego badania jest to, że używamy systemu bi-transgenicznego do nadekspresji ΔFosB, a zatem należy zachować ostrożność w rysowaniu podobieństw między tym paradygmatem a podawaniem przewlekłej kokainy. Jednak myszy transgeniczne 11A dają wyjątkową możliwość przyjrzenia się specyficznym efektom ΔFosB w prążkowiu, ponieważ nadekspresja jest ograniczona do tego regionu mózgu (Chen i wsp., 1998), podczas gdy podawanie kokainy wywołuje zmiany w wielu innych obszarach mózgu, które mogą pośrednio wpływać na prążkowie. Ponadto w kilku badaniach udokumentowano podobne fenotypy behawioralne i molekularne u myszy 11A w porównaniu ze zwierzętami nietransgenicznymi leczonymi przewlekłą kokainą (Kelz i wsp., 1999; McClung i Nestler, 2003; Renthal i in., 2009). Do tego, Bibb i in. (2001) zgłaszali podobne poziomy prążkowia Cdk5 indukcja mRNA i białka w tym samym szczepie 11A w porównaniu do leczonych kokainą, nietransgenicznych myszy z miotu, jak również podobne zmiany w celach CDK5, p35 i DARPP-32.

Podsumowując, stwierdzamy, że krótkoterminowa ekspresja ΔFosB prowadzi do indukcji genów w prążkowiu poprzez wiele mechanizmów. Obejmują one bezpośrednie wiązanie promotora, indukcję białka CREB i aktywność, modyfikację chromatyny, oprócz szlaków, które jeszcze nie zostały określone.

Idź do:

EKSPERYMENTALNE PROCEDURY

Zwierzęta

W tym badaniu stosowano męskie bi-transgeniczne zwierzęta 11A (NSE-tTA x TetOP-ΔFosB) i charakteryzowano je w Kelz i wsp., 1999. W celu nadekspresji ΔFosB myszy usuwano z doksycykliny pomiędzy 3 i 6 w wieku tygodni, podczas gdy myszy kontrolne utrzymywano na doksycyklinie. Wszystkie myszy były trzymane w grupach i utrzymywane w cyklu 12: 12 light / dark, światła na 7 am i światła wyłączone na 7 pm, z ad lib dostęp do żywności i wody. Wszystkie eksperymenty na myszach były zgodne z protokołami zatwierdzonymi przez Komitet ds. Opieki nad Zwierzętami i Stosowania w University of Texas Southwestern Medical Center w Dallas.

Plazmidy reporterowe i ekspresyjne

The wildtype (WT) Cck reporter promotor-lucyferaza przygotowano przez wstawienie fragmentu PCR o około 200 bp do wektora pGL3-luc (Promega). Fragment ten otrzymano z mysiego genomowego DNA (startery: 5 'TATCCTCATTCACTGGGACGC 3' w górę i 5 'TACCTTTGGATGGGGAAATCG 3' w dół) i początkowo wstawiono do wektora pGEM-T Easy (Promega, #A1360). Fragment promotora następnie klonowano do miejsc enzymu restrykcyjnego Kpn1 / Xho1 pGL3-luc.

Aby utworzyć mutację punktową CRE w Cck promotor, mutagenny starter skierowany przeciwko wcześniej zgłoszonemu miejscu podobnemu do CRE (starter sensowny: 5'CGTGTCCTGCTGGACTGAGCTCGCACTGGGTAAACA 3 ', starter antysensowny: 5'CTGTTTACCCAGTGCGCGCTGAGTCCAGCAGGACACGTCCTGCTGGACTGAGCTCGCACTGGGTAAACA 3', starter antysensowny: 3.1'CTGTTTACCCAGTGCGCGCTGAGTCCAGCAGGACACGik XNUMX ') został użyty w połączeniu z zestawem do mutacji zmiany Quagene (instrukcja zmiany) . Spowoduje to konwersję zgłoszonej witryny podobnej do CRE (ACTGCGTCAGC) do ACTGAGCTCC. Wszystkie plazmidy reporterowe zostały potwierdzone przez sekwencjonowanie DNA. Plazmid ekspresyjny ΔFosB zawiera sekwencję ΔFosB o pełnej długości wstawioną w miejsce wielokrotnego klonowania pCDNA XNUMX i został opisany wcześniej (Ulery i Nestler, 2007).

Hodowla komórkowa i transfekcja DNA

Komórki guza chromochłonnego szczura (PC12) utrzymywano w zmodyfikowanej pożywce Eagle'a F-12 firmy Dulbecco, uzupełnionej 10% surowicą końską, 5% płodową surowicą bydlęcą i 1% penicyliną / streptomycyną w 37 ° C i 5% CO2. Komórki transfekowano przez elektroporację przy użyciu elektroporatora BTX 360 (350 V, 0 omów i 850 μF) w 800 μl soli fizjologicznej buforowanej fosforanem Dulbecco w kuwetach z 4 mm szczeliną z 10 μg reportera i 5 μg konstruktu ekspresyjnego. Do normalizacji całkowitej ilości DNA zastosowano pusty wektor plazmidowy (pCDNA). Po transfekcji komórki hodowano na 35 mm szalkach pokrytych kolagenem przez wskazany czas.

Testy na lucyferazę

Dwa lub trzy dni po transfekcji komórki przemywano 3 razy w soli fizjologicznej buforowanej fosforanem Dulbecco, poddawano lizie (przy użyciu 25 mM glicyloglicyny, 15 mM MgSO4, 4 mM EGTA, 1% Triton X-100, pH 7.8, 1 mM DTT), zebrano i oczyszczono przez wirowanie. 30 μL lizatu połączono z 140 μL buforem do oznaczania lucyferazy (25 mM glikyloglicyna, 15 mM MgSO4, 4 mM EGTA, 1 mM DTT, 1 mM ATP, 1 mM fosforan potasu, 1 mM koenzym A, pH 7.8). Aktywność luminescencji mierzono za pomocą czytnika fluorescencji mikropłytek FLx-800 po automatycznym wstrzyknięciu lucyferyny 40 μL 1 mM na studzienkę. Aktywność lucyferazy normalizowano do całkowitej zawartości białka, jak określono za pomocą testu białkowego BioRad.

Test przesunięcia ruchliwości elektroforetycznej

Ekstrakty jądrowe z obustronnych plastrów prążkowia z bi-transgenicznych myszy 11A (które utrzymywały lub wyłączyły doksycyklinę w tygodniach 2 lub 8) (McClung i Nestler, 2003) zostały przygotowane zgodnie z Huang i Walters (1996). 32Wyznakowane P dwuniciowe sondy oligonukleotydowe przygotowano przy użyciu protokołu systemu Promega Gel Shift Assay (#E3300) i sondy oczyszczono stosując kolumny Roche Quick Spin. Konsensusowe sekwencje sond CRE i AP-1 pochodziły z Promega (odpowiednio #E328A i E320B) i Cck Sekwencje CRE były (sens Cck-CRE: CTAGCGAGCTCTGGACTGCGTCAGCACTGGGTGCA; Cck-CRE antysensowny: CCCAGTGCTGACGCAGTCCAGAGCTCGCTAGCTTT).

Reakcje wiązania i elektroforezę przeprowadzono stosując modyfikacje procedury systemu Promega Gel Shift Assay (#E3300). 50,000 CPM znakowanej sondy połączono z 10 μg ekstraktem jądrowym z prążkowia. Zimne kompetycyjne DNA lub przeciwciała dodano przed wprowadzeniem znakowanych radioaktywnie sond. Do eksperymentów supershift zastosowano 2 μg przeciwciała CREB (Upstate Biotechnology # 06-083). Reakcje poddano elektroforezie na żelach poliakrylamidowych 4%, wysuszono i poddano ekspozycji na błonę (stosując ekrany intensyfikujące dla 1 godziny do 2 dni).

Immunoblotting

W przypadku komórek PC12 35 mm płytki transfekowanych komórek przemyto lodowato zimną solanką buforowaną fosforanem Dulbecco i przygotowano lizaty w lodowatym buforze lizującym RIPA (50 mM Tris pH 7.4, 5 mM NaCl, 5 mM EDTA, 1% deoksycholan, 1 % Triton X-100, 0.1% dodecylosiarczan sodu) zawierające inhibitory proteazy. Po sonikacji, sklarowaniu i oznaczeniu białka Bradforda, lizaty poddano pełnej denaturacji i 50 µg każdej próbki poddano elektroforezie na 10% żelach poliakryloamidowych SDS. Białka przenoszono na błonę PVDF, blokowano przez 1 godzinę w 3% odtłuszczonym mleku w proszku w soli fizjologicznej buforowanej Tris zawierającej 0.1% Tween-20 (mleko TBS-T) i badano przez noc w 4 ° C z przeciwciałami pierwotnymi (CREB- Upstate Biotechnology # 06-083, używany w 1: 1,000; GAPDH-Sigma # G8795, używany w 1:80,000 1) rozcieńczony w mleku TBS-T. Po wielokrotnym przemyciu w TBS-T, bloty badano przez jedną godzinę w temperaturze pokojowej przy użyciu drugorzędowych przeciwciał sprzężonych z fosfatazą alkaliczną (Sigma) rozcieńczonych 5,000: 170 w mleku TBS-T. Po wielokrotnym przemyciu solanką buforowaną Tris, reakcję barwną przeprowadzono zgodnie z instrukcjami BioRad (# 6432-XNUMX). Błony suszono przez noc, skanowano na płaskim skanerze i wykonano densytometrię przy użyciu ImageJ (patrz poniżej).

W przypadku ekstraktów prążkowia przeprowadzono testy Western blot, jak wcześniej opublikowano (Hope i wsp., 1994). Tkankę usunięto z pozbawionych głowy myszy, umieszczono na lodzie i pocięto na macierz mózgową o grubości 1 mm. Następnie wykonano stemple tkankowe i zamrożono w -80 ° C do momentu użycia. Tkankę sonikowano na lodzie w buforze modyfikowanym detergentem zawierającym zarówno fosfatazę, jak i inhibitory proteazy (Roche, Sigma). Po sonikacji próbki denaturowano we wrzącej wodzie i wirowano przy 15,000xg dla minut 15; supernatant następnie zbierano i przetwarzano; ilości stężenia białka następnie oznaczono ilościowo stosując test Bradforda (Bio-Rad). Próbki prowadzono na żelu 10% akrylamid / bisakrylamid, przenoszono na błonę PVDF, blokowano w mleku 5% i inkubowano z pierwszorzędowymi przeciwciałami (Anti-CREB, Upstate, Lake Placid, NY). Bloty następnie wizualizowano stosując system chemiluminescencji (Pierce). Wszystkie próbki znormalizowano do GAPDH (Fitzgerald, Concord, MA). Wykonano krzywe standardowe, aby upewnić się, że jesteśmy w liniowym zakresie testu.

Analiza densytometryczna

Dla immunoblotów PC12 przeprowadzono analizę densytometryczną przy użyciu ImageJ z kalibracją Rodbard. Średni sygnał tła odejmowano od każdego pomiaru i obliczano stosunek sygnału CREB do GAPDH dla każdej próbki. W przypadku immunoblotów prążkowia i analizy EMSA zastosowano Scion Image 1.62c z odejmowaniem tła.

Immunoprecypitacja chromatyny (ChIP)

Testy ChIP przeprowadzono zgodnie z metodami Tsankova i in. (2004) i Kumar i in. (2005). W skrócie, dwustronne próbki prążkowia od myszy 11A utrzymywanych na doksycyklinie lub bez doksycykliny sieciowano 1% formaldehydem, a sieciowanie wygaszano glicyną (końcowe stężenie 0.125 M). Próbki te pochodziły z całych wycinków mózgu pobranych na poziomie jądra półleżącego z usuniętą korą. Chromatynę ścinano do fragmentów około 0.2 do 1 kb przez sonikację, oczyszczano kulkami z białkiem G (Thermo Scientific # 22852), a próbki wejściowe zamrażano w -80 ° C. Do każdego wytrącenia używano od 60 do 100 μg chromatyny. Zastosowano 5-10 μg każdego przeciwciała pierwotnego (CREB: Upstate Biotechnology # 06-863, ΔFosB: Santa Cruz Biotechnology # SC-48x, acetylowane H3: Upstate Biotechnology # 06-599, metylowane H3 (LYS9): Cell Signaling Technology, cFos: Santa Cruz Biotechnology # SC-7202x). Kompleksy przeciwciało-chromatyna poddano immunoprecypitacji za pomocą perełek z białkiem G plus zgodnie z instrukcjami producenta (Thermo Scientific # 22852). Po odwrotnym sieciowaniu próbek wejściowych i wytrąconych, każdą próbkę poddano ilościowej reakcji PCR (qPCR). Zastosowanie wszystkich tych przeciwciał dla ChIP zostało gruntownie sprawdzone (Tsankova i in., 2004; Kumar i wsp., 2005; Renthal i in., 2009).

Poziomy wiązania białka w każdym interesującym promotorze genu określono przez pomiar ilości związanego DNA przez qPCR (Applied Biosystems (ABI) Prism 7700, Foster City, CA). Wkład lub całkowity DNA (nieimmunoprecypitowany) i immunoprecypitowany DNA amplifikowano w trzech powtórzeniach w obecności SYBR Green (Applied Biosystems, CA). Wartości Ct z każdej próbki otrzymano za pomocą oprogramowania Sequence Detector 1.1. Względną kwantyfikację matrycowego DNA przeprowadzono stosując metodę ΔΔCt (Tsankova i in., 2004). Zastosowano startery: promotor BDNF 4: CTTCTGTGTGCGTGAATTTGCT; Promotor AGTCCACGAGAGGGCTCCA CDK5: GCTGAAGCTGTCAGGAGGTC; GTGCCCCGCTCTTGTTATTA promotor Cck: CTTGGGCTAGCCTCATTCACTG; TTAAATAGCTCCTCCCGGTTCG Promotor Prodynorphin: GGCTTCCTTGTGCTTCAGAC; GCGCTGTTTGTCACTTTCAA.

Analiza statystyczna

Wszystkie dane przedstawiono jako średnie ± błąd standardowy średniej. Różnicę statystyczną określono za pomocą dwustronnego testu t-Studenta (p <0.05). Gdy dokonywano wielokrotnych porównań, wartości p korygowano za pomocą poprawki Bonferroniego.

Idź do:

Podziękowania

Chcielibyśmy podziękować Willowi Renthalowi i Arvindowi Kumarowi za pomocne dyskusje. Chcielibyśmy również podziękować NIDA za finansowanie tych eksperymentów.

Idź do:

Przypisy

Zastrzeżenie wydawcy: Jest to plik PDF z nieedytowanym manuskryptem, który został zaakceptowany do publikacji. Jako usługa dla naszych klientów dostarczamy tę wczesną wersję manuskryptu. Rękopis zostanie poddany kopiowaniu, składowi i przeglądowi wynikowego dowodu, zanim zostanie opublikowany w ostatecznej formie cytowania. Należy pamiętać, że podczas procesu produkcyjnego mogą zostać wykryte błędy, które mogą wpłynąć na treść, a wszystkie zastrzeżenia prawne, które odnoszą się do czasopisma, dotyczą.

Warunki klasyfikacji:

Sekcja: #1 Cellular and Molecular Biology of Nervous systems

Idź do:

Referencje

  1. Andersson M, Konradi C, Cenci MA. Białko wiążące element odpowiedzi cAMP jest wymagane dla ekspresji genu zależnej od dopaminy w nienaruszonym, ale nie odwieszonym prążkowiu dopaminy. J Neurosci. 2001; 21: 9930 – 43. [PubMed]
  2. Barrot M., Olivier JD, Perrotti LI, DiLeone RJ, Berton O, Eisch AJ, Impey S, Storm DR, Neve RL, Yin JC, Zachariou V, Nestler EJ. Aktywność CREB w powłoce jądra półleżącego kontroluje bramkowanie reakcji behawioralnych na bodźce emocjonalne. Proc Natl Acad Sci US A. 2002; 99: 11435 – 40. [Artykuł bezpłatny PMC] [PubMed]
  3. Beinfeld MC, Connolly KJ, Pierce RC. Leczenie kokainą zwiększa cholecystokininę pozakomórkową (CCK) w jądrze półleżącym skorupy obudzonych, swobodnie poruszających się szczurów, co jest wzmocnione u szczurów, które są uczulone na kokainę. J Neurochem. 2002; 81: 1021 – 7. [PubMed]
  4. Bernard C, Sutter A, Vinson C, Ratineau C, Chayvialle J, Cordier-Bussat M. Peptony stymulują transkrypcję genu cholecystokininy jelitowej za pomocą cyklicznych czynników wiążących element odpowiedzi monofosforanu adenozyny. Endokrynologia. 2001; 142: 721 – 9. [PubMed]
  5. Bibb JA, Chen J, Taylor JR, Svenningsson P, Nishi A, Snyder GL, Yan Z, Sagawa ZK, Ouimet CC, Nairn AC, Nestler EJ, Greengard P. Efekty przewlekłej ekspozycji na kokainę są regulowane przez białko neuronalne Cdk5. Natura. 2001; 410: 376 – 80. [PubMed]
  6. Cha-Molstad H, Keller DM, Yochum GS, Impey S, Goodman RH. Specyficzne dla typu komórki wiązanie czynnika transkrypcyjnego CREB z elementem odpowiedzi cAMP. Proc Natl Acad Sci US A. 2004; 101: 13572 – 7. [Artykuł bezpłatny PMC] [PubMed]
  7. Chen J, Nye HE, Kelz MB, Hiroi N, Nakabeppu Y, Hope BT, Nestler EJ. Regulacja delta FosB i białek podobnych do FosB za pomocą napadów drgawkowych i kokainy. Mol Pharmacol. 1995; 48: 880 – 9. [PubMed]
  8. Chen J, Kelz MB, Zeng G, Sakai N, Steffen C, Shockett PE, Picciotto MR, Duman RS, Nestler EJ. Zwierzęta transgeniczne z indukowalną, ukierunkowaną ekspresją genów w mózgu. Mol Pharmacol. 1998; 54: 495 – 503. [PubMed]
  9. Chen J, Zhang Y, Kelz MB, Steffen C, Ang ES, Zeng L, Nestler EJ. Indukcja kinazy zależnej od cyklin 5 w hipokampie przez przewlekłe napady drgawkowe: rola ΔFosB. J Neurosci. 2000; 20: 8965 – 71. [PubMed]
  10. Chinenov Y, Kerppola TK. Bliskie spotkania wielu rodzajów: interakcje Fos-Jun, które pośredniczą w specyficzności regulacyjnej transkrypcji. Onkogen. 2001; 20: 2438 – 52. [PubMed]
  11. Cole RL, Konradi C, Douglass J, Hyman SE. Adaptacja neuronalna do amfetaminy i dopaminy: molekularne mechanizmy regulacji genu prodynorfiny w prążkowiu szczura. Neuron. 1995; 14: 813 – 23. [PubMed]
  12. Deavall DG, Raychowdhury R, ​​Dockray GJ, Dimaline R. Kontrola transkrypcji genu CCK przez PACAP w komórkach STC-1. Am J Physiol Gastrointest Liver Physiol. 2000; 279: G605 – 12. [PubMed]
  13. Ding XZ, Mocchetti I. Regulacja dopaminergiczna zawartości mRNA cholecystokininy w prążkowiu szczura. Brain Res Mol Brain Res. 1992; 12: 77 – 83. [PubMed]
  14. Forrest S, rodzina czynników transkrypcyjnych McNamary C. Id i tworzenie zmian naczyniowych. Arterioscler Thromb Vasc Biol. 2004; 24: 2014 – 20. [PubMed]
  15. Gevrey JC, Cordier-Bussat M, Némoz-Gaillard E, Chayvialle JA, Abello J. Co-wymóg cyklicznych AMP i wapniowych kinaz białkowych do aktywacji transkrypcyjnej genu cholecystokininy przez hydrolizaty białkowe. J Biol Chem. 2002; 277: 22407 – 13. [PubMed]
  16. Green TA, Alibhai IN, Unterberg S, Neve RL, Ghose S, Tamminga CA, Nestler EJ. Indukcja aktywujących czynników transkrypcyjnych (ATF) ATF2, ATF3 i ATF4 w jądrze półleżącym i ich regulacja zachowania emocjonalnego. J Neurosci. 2008; 28: 2025 – 32. [PubMed]
  17. Hamilton ME, Redondo JL, Freeman AS. Przepełnienie dopaminy i cholecystokininy w jądrze półleżącym szczura w odpowiedzi na ostre podawanie leku. Synapsa. 2000; 38: 238 – 42. [PubMed]
  18. Hansen TV, Rehfeld JF, Nielsen FC. Szlaki sygnałowe kinazy białkowej aktywowanej mitogenami i kinazy białkowej A stymulują transkrypcję cholecystokininy poprzez aktywację białka wiążącego element cyklicznej adenozyny 3 ', 5'-monofosforanowej. Mol Endocrinol. 1999; 13: 466–75. [PubMed]
  19. Hansen TV, Nielsen FC. Regulacja transkrypcji genu cholecystokininy neuronalnej. Scand J Clin Lab Invest Suppl. 2001; 234: 61 – 7. [PubMed]
  20. Hansen TV. Transkrypcja genu cholecystokininy: elementy promotora, czynniki transkrypcyjne i szlaki sygnałowe. Peptydy. 2001; 22: 1201 – 11. [PubMed]
  21. Hansen TV, Rehfeld JF, Nielsen FC. KCl i forskolina synergistycznie zwiększają ekspresję genu cholecystokininy poprzez aktywację współrzędnych CREB i koaktywatora CBP. J Neurochem. 2004; 89: 15 – 23. [PubMed]
  22. Haun RS, Dixon JE. Wzmacniacz transkrypcji niezbędny do ekspresji genu cholecystokininy szczura zawiera sekwencję identyczną z elementem -296 ludzkiego genu c-fos. J Biol Chem. 1990; 265: 15455 – 63. [PubMed]
  23. Hiroi N, Marek GJ, Brown JR, Ye H, Saudou F, Vaidya VA, Duman RS, Greenberg ME, Nestler EJ. Istotna rola genu fosB w molekularnych, komórkowych i behawioralnych działaniach przewlekłych napadów drgawkowych. J Neurosci 1998. 1998; 18: 6952 – 62. [PubMed]
  24. Hokfelt T, Rehfeld JF, Skirboll L, Ivemark B, Goldstein M, Markey K. Dowody na współistnienie dopaminy i CCK w neuronach mezo-limbicznych. Natura. 1980; 285: 476 – 8. [PubMed]
  25. Hope BT, Kelz MB, Duman RS, Nestler EJ. Leczenie przewlekłego napadu elektrowstrząsowego (ECS) powoduje ekspresję długotrwałego kompleksu AP-1 w mózgu o zmienionym składzie i charakterystyce. J Neurosci. 1994; 14: 4318 – 28. [PubMed]
  26. Hope BT, Nye HE, Kelz MB, Self DW, Iadarola MJ, Nakabeppu Y, Duman RS, Nestler EJ. Indukcja długotrwałego kompleksu AP-1 złożonego ze zmienionych białek podobnych do Fos w mózgu przez przewlekłe leczenie kokainą i innymi przewlekłymi metodami. Neuron. 1994; 13: 1235 – 44. [PubMed]
  27. Huang KX, Walters JR. Dopaminergiczna regulacja aktywności wiązania DNA transkrypcyjnego AP-1 w prążkowiu szczura. Neuroscience. 1996; 75: 757 – 75. [PubMed]
  28. Impey S, McCorkle SR, Cha-Molstad H, Dwyer JM, Yochum GS, Boss JM, McWeeney S, Dunn JJ, Mandel G, Goodman RH. Definiowanie regulonu CREB: analiza obejmująca cały genom regionów regulujących czynnik transkrypcyjny. Komórka. 2004; 119: 1041 – 54. [PubMed]
  29. Johannessen M, Delghandi MP, Moens U. Co włącza CREB? Sygnał komórki. 2004; 16: 1211 – 27. [PubMed]
  30. Josselyn SA, Vaccarino FJ. Przeciwne działanie antagonistów CCK (A) i CCK (B) na rozwój warunkowej aktywności u szczurów. Behav Pharmacol. 1996; 7: 505 – 512. [PubMed]
  31. Josselyn SA, De Cristofaro A, Vaccarino FJ. Dowody na udział receptora CCK (A) w nabywaniu uwarunkowanej aktywności wytwarzanej przez kokainę u szczurów. Brain Res. 1997; 763: 93 – 102. [PubMed]
  32. Kelz MB, Chen J, Carlezon WA, Jr., Whisler K, Gilden L, Beckmann AM, Steffen C, Zhang YJ, Marotti L, Self DW, Tkatch T, Baranauskas G, Surmeier DJ, Neve RL, Duman RS, Picciotto MR , Nestler EJ. Ekspresja czynnika transkrypcyjnego deltaFosB w mózgu kontroluje wrażliwość na kokainę. Natura. 1999; 401: 272 – 6. [PubMed]
  33. Kumar A, Choi KH, Renthal W, Tsankova NM, Theobald DE, Truong HT, Russo SJ, Laplant Q, Sasaki TS, Whistler KN, Neve RL, Self DW, Nestler EJ. Przebudowa chromatyny jest kluczowym mechanizmem leżącym u podstaw plastyczności indukowanej kokainą w prążkowiu. Neuron. 2005; 48: 303 – 14. [PubMed]
  34. Mattson BJ, Bossert JM, Simmons DE, Nozaki N, Nagarkar D, Kreuter JD, Hope BT. Indukowana kokainą fosforylacja CREB w jądrze półleżącym szczurów uwrażliwionych na kokainę jest możliwa dzięki wzmocnionej aktywacji kinazy związanej z sygnałem pozakomórkowym, ale nie kinazy białkowej A. J Neurochem. 2005; 95: 1481 – 94. [PubMed]
  35. McClung CA, Nestler EJ. Regulacja ekspresji genów i nagrody kokainowej przez CREB i DeltaFosB. Nat Neurosci. 2003; 6: 1208 – 15. [PubMed]
  36. McClung CA, Ulery PG, Perrotti LI, Zachariou V, Berton O, Nestler EJ. DeltaFosB: molekularny przełącznik do długoterminowej adaptacji w mózgu. Brain Res Mol Brain Res. 2004; 132: 146 – 54. [PubMed]
  37. Nestler EJ, Kelz MB, Chen JS. ΔFosB: molekularny mediator długoterminowej plastyczności neuronalnej i behawioralnej. Brain Res. 1999; 835: 10 – 17. [PubMed]
  38. Nestler EJ. Czy istnieje wspólna molekularna ścieżka uzależnienia? Nat Neurosci. 2005; 8: 1445 – 9. [PubMed]
  39. Nestler EJ. Transkrypcyjne mechanizmy uzależnienia: rola DeltaFosB. Philos Trans R Soc Lond B Biol Sci. 2008; 363: 3245 – 55. [Artykuł bezpłatny PMC] [PubMed]
  40. Perrotti LI, Weaver RR, Robison B, Renthal W, Maze I, Yazdani S, Elmore RG, Knapp DJ, Selley DE, Martin BR, Sim-Selley L, Bachtell RK, Self DW, Nestler EJ. Wyraźne wzory indukcji DeltaFosB w mózgu przez narkotyki. Synapsa. 2008; 62: 358 – 69. [Artykuł bezpłatny PMC] [PubMed]
  41. Rando OJ, Chang HY. Widoki struktury chromatyny w całym genomie. Annu Rev Biochem. 2009; 78: 245 – 71. [Artykuł bezpłatny PMC] [PubMed]
  42. Renthal W, Carle TL, Maze I, Covington HE, 3rd., Truong HT, Alibhai I, Kumar A, Montgomery RL, Olson EN, Nestler EJ. Delta FosB pośredniczy w odczulaniu epigenetycznym genu c-fos po przewlekłej ekspozycji na amfetaminę. J Neurosci. 2008; 28: 7344 – 9. [Artykuł bezpłatny PMC] [PubMed]
  43. Renthal W, Kumar A, Xiao G, Wilkinson M, Covington HE, 3rd, Maze I, Sikder D, Robison AJ, LaPlant Q, Dietz DM, Russo SJ, Vialou V, Chakravarty S, Kodadek TJ, Stack A, Kabbaj M, Nestler EJ. Analiza genomowa regulacji chromatyny przez kokainę ujawnia rolę sirtuin. Neuron. 2009; 62: 335 – 48. [Artykuł bezpłatny PMC] [PubMed]
  44. Rotzinger S, Bush DE, Vaccarino FJ. Cholecystokinina modulująca mezolimbiczną funkcję dopaminy: regulacja zmotywowanych zachowań. Pharmacol Toxicol. 2002; 91: 404 – 13. [PubMed]
  45. Rourke IJ, Hansen TV, Nerlov C, Rehfeld JF, Nielsen FC. Negatywna współpraca między zestawionymi elementami E-box i cAMP / TPA w promotorze genu cholecystokininy. FEBS Lett. 1999; 448: 15 – 8. [PubMed]
  46. Shaw-Lutchman TZ, Barrot M, Wallace T, Gilden L, Zachariou V, Impey S, Duman RS, Storm D, Nestler EJ. Regionalne i komórkowe mapowanie transkrypcji za pośrednictwem CRE podczas wytrącania morfiny przez naltrekson. J Neurosci. 2002; 22: 3663 – 3672. [PubMed]
  47. Shaw-Lutchman TZ, Impey S, Storm D, Nestler EJ. Regulacja transkrypcji za pośrednictwem CRE w mózgu myszy przez amfetaminę. Synapsa. 2003; 48: 10 – 7. [PubMed]
  48. Sheng M, McFadden G, Greenberg ME. Depolaryzacja błony i wapń indukują transkrypcję c-fos poprzez fosforylację czynnika transkrypcyjnego CREB. Neuron. 1990; 4: 571 – 82. [PubMed]
  49. Tsankova NM, Kumar A, Nestler EJ. Modyfikacje histonów w regionach promotora genu w hipokampie szczura po ostrych i przewlekłych napadach drgawkowych. J Neurosci. 2004; 24: 5603 – 10. [PubMed]
  50. Ulery PG, Nestler EJ. Regulacja aktywności transkrypcyjnej DeltaFosB przez fosforylację Ser27. Eur J Neurosci. 2007; 25: 224 – 30. [PubMed]
  51. Vaccarino FJ. Nucleus accumbens interakcje dopaminy-CCK w nagrodach psychostymulujących i związanych z nimi zachowaniach. Neurosci Biobehav Rev. 1992; 18: 207 – 14. [PubMed]
  52. Zachariou V, Bolanos CA, Selley DE, Theobald D, Cassidy MP, Kelz MB, Shaw-Lutchmann T, Berton O, Sim-Selley LJ, DiLeone RJ, Kumar A, Nestler EJ. ΔFosB: Istotna rola ΔFosB w jądrze półleżącym w działaniu morfiny. Natura Neurosci. 2006; 9: 205 – 11. [PubMed]