Doświadczenie lekowe epigenetycznie steruje indukowalnością genu Fosb w jądrze szczura accumbens (2012)

UWAGI: Dowody, że deltafosb pozostawia ślady długo po wyzdrowieniu z uzależnienia. W szczególności uzależnienie powoduje zmiany epigenetyczne, które powodują znacznie szybszą indukcję deltafosbu w przypadku nawrotu. Wyjaśnia to, jak nawroty, nawet po latach, mogą szybko przerodzić się w stan pełnego uzależnienia.



J Neurosci. Rękopis autora; dostępny w PMC 2013 January 25.

 

Abstrakcyjny

ΔFosB, a Fosb produkt genowy jest indukowany w jądrze półleżącym (NAc) i skorupie ogoniastej (CPu) poprzez wielokrotne narażenie na narkotyki, takie jak kokaina. Ta indukcja przyczynia się do nieprawidłowych wzorców ekspresji genów i nieprawidłowości behawioralnych obserwowanych w przypadku powtarzanej ekspozycji na lek.

W tym miejscu oceniliśmy, czy zdalna historia ekspozycji na lek u szczurów może zmienić indukowalność Fosb gen wywołany kolejną ekspozycją na kokainę. Pokazujemy, że wcześniejsze chroniczne podawanie kokainy, po którym następuje przedłużone odstawienie, zwiększa indukowalność Fosb w NAc, o czym świadczy większa ostra indukcja mRNA ΔFosB i szybsza akumulacja białka ΔFosB po wielokrotnej ponownej ekspozycji na kokainę. Bez takiego zagruntowania Fosb indukcja była obserwowana w CPu, w rzeczywistości następująca ostra indukcja mRNA ΔFosB była tłumiona w CPu.

Te nienormalne wzorce Fosb ekspresja jest związana z modyfikacjami chromatyny na Fosb promotor genu. Wcześniejsze podawanie kokainy indukuje długotrwały wzrost wiązania polimerazy II RNA (Pol II) w miejscu Fosb promotor tylko w NAc, co sugeruje, że Pol II „opóźnia” liczby pierwsze Fosb do indukcji w tym regionie po ponownej ekspozycji na kokainę. Prowokacja kokainą wyzwala następnie uwolnienie Pol II z promotora genu, umożliwiając szybsze działanie Fosb transkrypcja. Prowokacja kokainą zmniejsza również represyjne modyfikacje histonów na Fosb promotor w NAc, ale zwiększa takie represyjne znaki i zmniejsza aktywujące znaki w CPu.

Wyniki te dostarczają nowych informacji na temat dynamiki chromatyny Fosb promotor i ujawnić nowatorski mechanizm zagruntowania Fosb indukcja w NAc po ponownej ekspozycji na kokainę.

Wprowadzenie

Uzależnienie od narkotyków charakteryzuje się kompulsywnym poszukiwaniem narkotyków i przyjmowaniem pomimo poważnych negatywnych konsekwencji (Kalivas i wsp., 2005; Hyman i wsp., 2006). Przewlekła ekspozycja na lek powoduje trwałe zmiany w ekspresji genów w prążkowiu brzusznym (lub jądrze półleżącym; NAc) i prążkowiu grzbietowym (lub skorupie ogoniastej; CPu), strukturach prążkowia zaangażowanych w nagradzanie leków i uzależnienie (Freeman i in., 2001; Robinson i Kolb, 2004; Shaham and Hope, 2005; Maze and Nestler, 2011). ΔFosB, skrócone i stabilne białko kodowane przez natychmiastowy wczesny gen, Fosb, jest dobrze scharakteryzowanym czynnikiem transkrypcyjnym indukowanym w NAc i CPu przez chroniczną ekspozycję na praktycznie wszystkie leki nadużywające, w których pośredniczy uwrażliwione reakcje behawioralne na powtarzane podawanie leku (Nestler, 2008). Nie wiadomo jednak, czy wcześniejsze przewlekłe narażenie na lek nadużywający zmienia późniejszą indukcję ΔFosB.

Ostatnio postawiliśmy hipotezę, że modyfikacje chromatyny w odpowiedzi na chroniczną ekspozycję na leki mogą zmienić indukowalność określonych genów w docelowych regionach mózgu (Robison i Nestler, 2011). Coraz więcej dowodów wskazuje, że nadużywanie leków po długotrwałym podawaniu zmienia strukturę i dostępność transkrypcyjną chromatyny poprzez liczne rodzaje modyfikacji, w tym fosforylację, acetylację i metylację ogonów histonowych. Nowsze prace w systemach hodowli komórek skupiły się na rekrutacji polimerazy RNA II (Pol II) do promotora „indukowalnych” genów przed ich ekspresją, przy czym Pol II wiąże się trwale z proksymalnymi regionami promotora i wokół miejsca rozpoczęcia transkrypcji (TSS ) w stanie „zablokowanym” (Core i Lis, 2008; Nechaev i Adelman, 2008). Uważa się, że aktywacja zablokowanego Pol II jest odpowiedzialna za jego ucieczkę z regionów promotora i TSS oraz transkrypcję tych „zagruntowanych” genów (Zeitlinger i in., 2007; Saha i in., 2011; Bataille i in., 2012).

Tutaj pokazujemy, że wcześniejsza chroniczna ekspozycja na kokainę, po której następuje przedłużony okres karencji, zmienia indukowalność Fosb gen do dalszego podawania kokainy, przy czym NAc jest przygotowywany do indukcji, podczas gdy CPu nie. Następnie identyfikujemy wyraźne sygnatury chromatyny na Fosb promotor genu w NAc i CPu, które są związane z taką nieprawidłową indukowalnością Fosb gen, w tym rekrutacja utkniętego Pol II w Fosb promotor proksymalny tylko w NAc, jak również zmiany w kilku aktywujących lub represyjnych modyfikacjach histonów w obu obszarach mózgu. Wyniki te dostarczają nowych informacji na temat dynamiki chromatyny Fosb promotor genu i po raz pierwszy wskazać mechanizm, za pomocą którego zatrzymuje się liczby pierwsze Pol II Fosb dla większej aktywacji w NAc po ponownej ekspozycji na kokainę.

Materiały i Metody

Zwierzęta

Samce szczurów Sprague Dawley (250 – 275 g; Charles River Laboratories), używane we wszystkich eksperymentach, były trzymane w parze w klimatyzowanym pomieszczeniu w cyklu 12 hr światło / ciemność (światła na 7 AM) z dostępem do żywności i woda ad libitum. Wszystkim zwierzętom wstrzykiwano dwa razy dziennie przez dziesięć dni kokainę (15 mg / kg, ip) lub sól fizjologiczną (ip) do ich klatek domowych. Doświadczenia na zwierzętach zostały zatwierdzone przez Institutional Animal Care and Use Committee (IACUC) na Mount Sinai.

Pomiary lokomotoryczne

Zwierzęta przyzwyczajano w komorze lokomocyjnej pierwszego dnia dla 1 hr, a następnie monitorowano aktywność lokomotoryczną po wstrzyknięciu soli fizjologicznej za pomocą Photobeam Activity System (San Diego Instruments). Po codziennym przyzwyczajeniu 1 w komorach lokomotorycznych codziennie podawano kokainę (15 mg / kg, ip) przez dni 2 i zwierzęta ponownie monitorowano pod kątem aktywności lokomotorycznej dla 1 hr.

Immunohistochemia

Zwierzęta poddano perfuzji 24 hr po ostatniej ekspozycji na lek. Immunoreaktywność ΔFosB / FosB wykryto jak opisano (Perrotti i wsp., 2004). Western blot potwierdził, że cała immunoreaktywność typu ΔFosB / FosB obserwowana 24 h lub dłużej po wstrzyknięciach kokainy odbijała ΔFosB, przy czym FosB był niewykrywalny (nie pokazano).

Izolacja RNA, odwrotna transkrypcja i PCR

Obustronne stemple 12 z NAc i grzbietowo-boczne / grzbietowo-przyśrodkowe CPu uzyskano jak opisano (Perrotti i wsp., 2004), zamrożone na suchym lodzie i przetworzone zgodnie z opublikowanymi protokołami (Covington i in., 2011). RFosB i mRNA FosB zmierzono stosując ilościową PCR (qPCR) ze specyficznymi dla izoform primerów ΔFosB i FosB (Alibhai i wsp., 2007). Poziomy mRNA ΔFosB i FosB znormalizowano do poziomów mRNA GAPDH, na które nie miała wpływu ekspozycja na kokainę (nie pokazano).

Western blotting

Uderzenia NAc i CPu zostały zebrane jak wyżej i przetworzone do Western blot zgodnie z opisem (Covington i in., 2011), stosując przeciwciała przeciwko ERK44 / 42 [kinaza regulowana sygnałem zewnątrzkomórkowym 44 / 42] i fosfoERK44 / 42 (pERK), AKT [protoonkogen grasiczaka] i p-AKT, SRF (współczynnik odpowiedzi surowicy) i pSRF, CREB [białko wiążące element odpowiedzi cAMP] i pCREB. Ilość białka przeniesionego na każdą ścieżkę znormalizowano do poziomów aktyny lub tubuliny, na które ekspozycja kokainy nie miała wpływu.

Immunoprecypitacja chromatyny (ChIP)

Świeżo wycięte stemple NAc i CPu przygotowano do ChIP zgodnie z opisem (Maze i wsp., 2010). Każdy warunek doświadczalny analizowano w trzech powtórzeniach od niezależnych grup zwierząt. Dla każdej próbki ChIP, dwustronne stemple NAc i CPu zebrano z pięciu szczurów (stemple 10). Przeciwciała stosowane do specyficznych modyfikacji histonów są takie same jak te opublikowane (Maze i wsp., 2010); przeciwciała przeciwko Pol II fosforylowane w Ser5 jego regionu powtórzenia domeny końca karboksylowego (CTD) (Pol II-pSer5) otrzymano z abcam 5131. Zaprojektowano cztery zestawy starterów ChIP Fosb (Lazo i in., 1992; Mandelzys i in., 1997): 1F: GTACAGCGGAGGTCTGAAGG, 1R: GAGTGGGATGAGATGCGAGT; 2F: CATCCCACTCGGCCATAG, 2R: CCACCGAAGACAGGTACTGAG; 3F: GCTGCCTTTAGCCAATCAAC, 3R: CCAGGTCCAAAGAAAGTCCTC; 4F: GGGTGTTTGTGTGTGAGTGG, 4R: AGAGGAGGCTGGACAGAACC. Poziomy modyfikacji chromatyny są porównywane z tymi dla wejściowego DNA, jak opisano (Maze i wsp., 2010).

Analiza statystyczna

Wszystkie podane wartości są średnią ± sem. Dane dotyczące aktywności lokomotorycznej i zliczania komórek analizowano za pomocą dwukierunkowej analizy ANOVA z traktowaniem i wstrzyknięciem jako czynnikami. Eksperymenty qPCR analizowano w poszczególnych punktach czasowych za pomocą jednokierunkowej analizy ANOVA z traktowaniem jako czynnikiem. Gdy zaobserwowano znaczące efekty główne (p <0.05), przeprowadzono testy post-hoc Bonferroniego w celu porównania ze zwierzętami, którym wcześniej nie podawano soli fizjologicznej (^ w liczbach) i zwierzętami, którym wcześniej nie podawano kokainy (* w liczbach). Niesparowane dwustronne testy t Studenta zastosowano do analizy Western blot i danych ChIP, z poprawkami na wielokrotne porównania.

wyniki

Większy Indukowalność Fosb u NAc, ale nie CPu u szczurów doświadczonych kokainą

Aby zbadać wpływ wcześniejszego przewlekłego przebiegu kokainy, a następnie przedłużającego się okresu wycofania, na indukowalność Fosb gen w odpowiedzi na kolejną prowokację kokainą, szczurom, którym wcześniej wstrzyknięto ip dwa razy dziennie solą fizjologiczną lub kokainą (15 mg / kg) w dniach 10 podawano dawki prowokacyjne leku po 28 dniach odstawienia (Ryc. 1A). Najpierw zmierzyliśmy reakcje lokomotoryczne w jednej grupie zwierząt, aby potwierdzić indukcję uczulenia narządów przez uprzednią ekspozycję na kokainę, oczekiwaną trwałą konsekwencję podawania leku. U szczurów doświadczonych kokainą i -nave nie wykazywały równoważnej podstawowej aktywności lokomotorycznej, z prowokacją kokainą u zwierząt nieleczonych lekami, zwiększając ich ruchliwość (Ryc. 1B. Powtarzane pomiary dwukierunkowej ANOVA, leczenie: F1,66 = 30.42, p <0.0001; wyzwanie kokainowe: F.2,66= 58.39, p <0.0001; leczenie x wyzwanie kokainowe: F.2,66= 8.56, p = 0.0005, Bonferroni po testach ^p <0.001). Ta prowokacja kokainą indukowała znacznie większą aktywność lokomotoryczną, tj. Uczulenie, u szczurów doświadczonych kokainą (testy po testach Bonferroniego * p <0.001).

Rysunek 1  

Wpływ wcześniejszej chronicznej ekspozycji na kokainę na aktywność lokomotoryczną i Fosb indukcja w NAc i CPu po ponownej ekspozycji na lek

Aby ocenić wpływ tego schematu leczenia wstępnego kokainą na ekspresję ΔFosB w NAc i CPu, zmierzono białko ΔFosB metodami immunohistochemicznymi 24 hr po zwierzętach nieleczonych kokainą i doświadczonych kokainą podawano codziennie kokainę 0, 1, 3 lub 6 zastrzyki (15 mg / kg; patrz Ryc. 1A). Jak wcześniej ustalono (Nye i wsp., 1995), Wstrzyknięcia kokainy 3 były wystarczające, aby znacząco indukować białko ΔFosB w NAc i CPu zwierząt nieleczonych lekiem i jego akumulacja pozostała znacząca po dniach 6 iniekcji kokainy (Rys 1C. Powtarzające się pomiary dwukierunkowej ANOVA, rdzeń NAc, leczenie: F1,28= 23.5, p <0.0001; wyzwanie kokainowe: F.3,28= 49.16, p <0.0001; leczenie x wyzwanie kokainowe: F.3,28= 6.83, p = 0.0014; Powłoka NAc, leczenie: F1,28= 18.69, p <0.0001; wyzwanie kokainowe: F.3,28= 31.52, p <0.0001; leczenie x wyzwanie kokainowe: F.3,28= 3.21, p <0.05; CPu, leczenie: F.1,28= 9.47, p <0.001; wyzwanie kokainowe: F.3,28= 19.74, p <0.0001; leczenie x wyzwanie kokainowe: F.3,28= 0.94, p> 0.05. W rdzeniu, powłoce i CPu NAc, testy końcowe Bonferroni ^p <0.05). U zwierząt doświadczonych kokainą nie było dowodów na utrzymującą się indukcję ΔFosB w NAc lub CPu po 28 dniach odstawienia, co jest zgodne z wcześniejszymi doniesieniami, że sygnał ΔFosB całkowicie zanika do tego punktu czasowego (Nye i wsp., 1995), powód, dla którego ten punkt czasowy został użyty w tym badaniu. Uderzające jest jednak to, że szczury doświadczone kokainą, które otrzymały iniekcje 3 lub 6 z kokainą, wykazywały znacznie większą indukcję białka ΔFosB w NAc, efekt widoczny zarówno w podregionach rdzenia i powłoki (Rys 1C. Posttesty Bonferroniego * p <0.05). W przeciwieństwie do tego, w CPu nie zaobserwowano takiej większej indukcji białka ΔFosB; zamiast tego, równoważną indukcję ΔFosB obserwowano w tym regionie po 3 lub 6 dniach iniekcji kokainy u szczurów, które nie były wcześniej kokainą i doświadczały (Rys 1C).

Aby uzyskać wgląd w zmiany transkrypcyjne występujące w NAc i CPu w odpowiedzi na prowokację kokainą, zbadaliśmy przebieg czasowy (45, 90 i 180 min) indukowalności transkryptów mRNA ΔFosB i FosB na pojedynczym wstrzyknięciu kokainy lub soli fizjologicznej na naiwne i doświadczone szczury po kokainie po 28 dniach odstawienia (patrz Ryc. 1A). W odniesieniu do prowokacji solą, prowokacja kokainą indukowała gwałtowny wzrost poziomów mRNA ΔFosB i FosB we wszystkich trzech punktach czasowych zarówno w NAc, jak i CPu zwierząt nieleczonych kokainą (Rys. 1D. Powtarzane pomiary jednokierunkowe ANOVA na punkt czasowy; Bonferroni po testach ^p <0.05). W NAc, zaobserwowaliśmy większą indukcję mRNA ΔFosB i FosB u zwierząt, które doświadczyły kokainy, w porównaniu ze zwierzętami, które nie otrzymały kokainy po prowokacji kokainą, przy czym efekt był znaczący po 90 minutach, podczas gdy dla kontrastu indukowalność mRNA ΔFosB i FosB w CPu była istotnie zmniejszył się u zwierząt doświadczonych kokainą (Rys. 1D. Bonferroni po testach %p = 0.08, * p <0.05).

Charakterystyka górnych ścieżek sygnałowych w NAc i CPu szczurów doświadczonych kokainą

Jedno możliwe wyjaśnienie zmienionej indukowalności Fosb gen w NAc i CPu po wcześniejszym przewlekłym przebiegu kokainy jest taki, że zdalna historia narażenia na kokainę może wywołać trwałe zmiany w szlakach sygnałowych, które znajdują się powyżej Fosb indukcja genu, tak że prowokacja kokainą indukuje gen w nieprawidłowym stopniu. Aby zbadać tę hipotezę, przeanalizowaliśmy dwa czynniki transkrypcyjne, SRF i CREB, które zostały ostatnio pokazane jako wymagane do indukcji kokainy ΔFosB w tych regionach mózgu (Vialou i wsp., 2012) wraz z wyjściowymi kinazami białkowymi, ERK i AKT, również zaangażowanymi w działanie kokainy (Valjent i wsp., 2000; Lu i wsp., 2006; Boudreau i in., 2009). Nie udało nam się wykryć żadnych zmian w całkowitym lub fosforylowanym poziomie tych różnych białek, które mogłyby wyjaśnić zmienioną indukowalność Fosb obserwowane, w tym brak zmian w SRF, CREB lub AKT (Rys. 2B, C). Brak zmiany pSRF i pCREB w NAc w odpowiedzi na prowokację kokainą jest zgodny z niedawnym raportem, który wykazał, że zarówno indukowane przez przewlekłą kokainę są znacząco (Vialou i wsp., 2012).

Rysunek 2  

Wpływ wcześniejszej chronicznej ekspozycji na kokainę na kaskady sygnalizacji molekularnej w górę w NAc i CPu

W NAc i CPu zwierząt nieleczonych lekiem, 20 min po początkowej ekspozycji na lek (Ryc. 2A), pojedyncza prowokacja kokainą obniżyła poziom pERK42 / 44 (Rys. 2B, C. Dwustronny test t Studenta: * p <0.05). Istnieją wcześniejsze doniesienia o zwiększonych poziomach pERK w tych regionach po ostrym zażyciu kokainy (Valjent i wsp., 2000). Trudno to porównać z innymi dokumentami analizującymi fosforylację ERK w NAc podczas wycofywania z powtarzanych wstrzyknięć kokainy (Boudreau i in., 2007; Shen i in., 2009), jak w naszym badaniu, pERK oceniano ilościowo po dniach odstawienia 28 i po prowokacji kokainą lub solą fizjologiczną. W stosunku do zwierząt nieżyjących narkotyków doświadczających kokainy po raz pierwszy, ponowna ekspozycja na kokainę u szczurów doświadczonych kokainą, po dniach odstawienia 28, spowodowała znaczny wzrost poziomów pERK42 / 44 w CPu (Rys. 2B, C. Dwustronny test t-studenta: * p <0.05).

Krajobraz chromatyny na Promotor genu Fosb w NAc i CPu szczurów doświadczonych kokainą

Następnie zbadaliśmy, czy zmiany w Fosb indukowalność genu jest związana ze zmianami w jego strukturze chromatyny. ChIP przeprowadzono na NAc i CPu przy użyciu przeciwciał skierowanych przeciwko trzem dobrze scharakteryzowanym formom modyfikacji histonów: trimetylacji Lys4 histonu H3 (H3K4me3) związanego z aktywacją genu oraz H3K27me3 i H3K9me2 i H28K1meXNUMX i HXNUMXKXNUMXmeXNUMX i HXNUMXKXNUMXmeXNUMX związanych z represją genów. Przeanalizowaliśmy naiwne i doświadczone szczury kokainy po dniach odstawienia XNUMX bez lub z prowokacją kokainą, ze zwierzętami badanymi XNUMX hr później (Ryc. 3A). W NAc nie stwierdziliśmy istotnych zmian w wiązaniu którejkolwiek z tych trzech modyfikacji histonowych Fosb promotor genu pod nieobecność prowokacji kokainą, chociaż wystąpił trend obniżenia poziomu H3K9me2 (Rys. 3B-D. Dwustronny test t-Studenta. #p = 0.2 w porównaniu z odpowiednimi kontrolami leku Naïve). Efekt ten stał się znaczący po prowokacji kokainą i był specyficzny dla proksymalnego regionu promotora genu (Rys 3C. * p <0.05). Podczas gdy poziomy H3K9me2 są bardzo niskie w niektórych genach, Fosb promotor genu wykazuje znaczące poziomy tego znaku w NAc w warunkach kontrolnych (Maze i wsp., 2010, dane nie pokazane). Natomiast w CPu odkryliśmy małe, ale znaczące zmniejszenie wiązania H3K4me3 i wzrost wiązania H3K27me3 w Fosb promotor przy braku wyzwania kokainowego, efekty utracone po wyzwaniu (Rys. 3D. * p <0.05).

Rysunek 3  

Wpływ wcześniejszej chronicznej ekspozycji na kokainę na epigenetyczne zalewanie Fosb gen w NAc i CPu

Następnie zbadaliśmy wiązanie Pol II do Fosb gen, oparty na najnowszych odkryciach w hodowli komórkowej, że zatrzymanie Pol II w TSS, które charakteryzuje się jego fosforylacją w Ser 5 w jego regionie powtarzania CTD, jest związane z pobudzaniem genów (patrz Wprowadzenie). W ten sposób przeanalizowaliśmy wiązanie Pol II-pSer5 do Fosb w czterech różnych regionach genu (Ryc. 3B). Analiza ta wykazała znaczne wzbogacenie Pol II-pSer5 w Fosb gen w jego proksymalnym regionie promotora i wokół jego TSS u NAc zwierząt doświadczonych kokainą, po długotrwałym odstawieniu, przy braku prowokacji kokainą w porównaniu z grupą kontrolną (Rys. 3E. * p <0.05). To wzbogacenie nie było widoczne w dwóch regionach ciała genów Fosb, zgodne z przeciągnięciem Pol II opisanym w prostszych systemach eksperymentalnych. Co ciekawe, po prowokacji kokainą wiązanie Pol II-pSer5 nadal wykazywało oznaki wzbogacenia, chociaż nie było już znacząco, w Fosb proksymalny region promotora (Rys. 3E. %p = 0.1), ale powrócił do poziomów kontroli w TSS. Wyniki w CPu były bardziej zmienne, bez wyraźnego wzorca wiązania Pol II-pSer5.

Dyskusja

Niniejsze badanie zapewnia nowy wgląd w trwałą regulację Fosb tygodnie po zaprzestaniu powtarzającej się ekspozycji na kokainę. Pokazujemy, że wcześniejsze chroniczne podawanie kokainy powoduje Fosb gen bardziej indukowalny w NAc, co skutkuje szybszą akumulacją ΔFosB po ponownej ekspozycji na lek. Biorąc pod uwagę przewagę dowodów, że indukcja ΔFosB w NAc pośredniczy w uczulonych reakcjach behawioralnych na kokainę (Nestler, 2008), nasze odkrycia ujawniają nowy mechanizm szybszego przywracania takich uczulonych odpowiedzi po przedłużającym się odstawieniu.

Wykazujemy, że zwiększona indukcja ΔFosB w NAc jest związana ze zmianami chromatyny w Fosb gen, od którego można by oczekiwać, że będzie większy. Tak więc, wykazaliśmy zwiększone wiązanie Pol II do proksymalnego promotora i regionów TSS genu, które są obecne po tygodniach wycofania 4 z wcześniejszego przewlekłego podawania kokainy. Takie wzbogacenie Pol II w TSS jest szybko tracone po prowokacji kokainą i Fosb indukcja, zgodna z modelem w hodowli komórkowej, który zatrzymał Pol II jest uwalniany z TSS po aktywacji genu (patrz Wprowadzenie). Prowokacja kokainą wywołuje również szybki spadek wiązania H3K9me2 - znaku represji genów - do Fosb promotor. W przeciwieństwie do tego, nie wykryliśmy trwałej indukcji kilku czynników transkrypcyjnych lub ich kinaz upstream, o których wiadomo, że pośredniczą Fosb indukcja kokainą. Wyniki te potwierdzają naszą hipotezę, że zwiększona indukcja ΔFosB w NAc odbywa się za pośrednictwem epigenetycznego primingu Fosb gen, a nie poprzez regulację w górę wydarzeń.

Bardzo różne wyniki uzyskano dla CPu. Nie było dowodów na to, że Pol II zwlekał Fosb u szczurów doświadczonych kokainą przed prowokacją kokainą, chociaż były małe, ale znaczące modyfikacje histonów zgodne z represją genów: zwiększone wiązanie H3K27me3 i zmniejszenie wiązania H3K4me3. Nie zaobserwowano również zmian w czynnikach transkrypcji w górę lub kinaz zgodnych ze zmniejszeniem Fosb indukcja. Wyniki te sugerują, że po przewlekłym podawaniu kokainy, modyfikacje epigenetyczne służą tłumieniu Fosb indukowalność genu w CPu, w przeciwieństwie do primingu obserwowanego w NAc. Jednakże, podczas gdy te efekty tłumią indukcję mRNA ΔFosB po ponownej ekspozycji na kokainę, nie ma straty w akumulacji białka ΔFosB. Mechanizm leżący u podstaw tego paradoksu wymaga teraz dalszych badań.

Bardziej ogólnie, nasze wyniki wspierają model, w którym zmiany w krajobrazie chromatyny w określonych genach w odpowiedzi na przewlekłe podawanie kokainy służą do zalewania lub stępienia tych genów w celu późniejszej indukcji po ponownej ekspozycji na lek. Takie zmiany chromatyny, które można postrzegać jako „blizny epigenetyczne”, zostałyby pominięte w analizach poziomów mRNA genów w stanie ustalonym. W ten sposób charakterystyka epigenomu uzależnienia zapowiada ujawnienie nowych informacji o molekularnej patogenezie zaburzenia, które można wydobywać w celu opracowania nowych metod leczenia.

Podziękowania

Praca ta była wspierana przez dotacje z Narodowego Instytutu Narkomanii.

Referencje

  • Alibhai IN, Zielona TA, Potashkin JA, Nestler EJ. Regulacja ekspresji mRNA fosB i DeltafosB: badania in vivo i in vitro. Brain Res. 2007;1143: 22-33. [Artykuł bezpłatny PMC] [PubMed]
  • Bataille AR, Jeronimo C, Jacques PE, Laramee L, Fortin ME, Forest A, Bergeron M, Hanes SD, Robert F. Cykl uniwersalnej polimerazy II CTD jest koordynowany przez złożone interakcje między kinazą, fosfatazą i enzymami izomerazy wzdłuż genów. Mol Cell. 2012;45: 158-170. [PubMed]
  • Boudreau AC, Reimers JM, Milovanovic M, Wolf ME. Receptory AMPA na powierzchni komórek w jądrze szczura zwiększają się podczas odstawiania kokainy, ale internalizują się po prowokacji kokainą w powiązaniu ze zmienioną aktywacją kinaz białkowych aktywowanych mitogenem. J Neurosci. 2007;27: 10621-10635. [Artykuł bezpłatny PMC] [PubMed]
  • Boudreau AC, Ferrario CR, Glucksman MJ, Wolf ME. Przekazywanie szlaków sygnałowych i nowe kinazy białkowe Substraty związane z behawioralnym uczuleniem na kokainę. J Neurochem. 2009;110: 363-377. [Artykuł bezpłatny PMC] [PubMed]
  • Core LJ, Lis JT. Regulacja transkrypcji przez pauzę promotorowo-proksymalną polimerazy RNA II. Science. 2008;319: 1791-1792. [Artykuł bezpłatny PMC] [PubMed]
  • Covington HE, 3rd, Maze I, Sun H, Bomze HM, DeMaio KD, Wu EY, Dietz DM, Lobo MK, Ghose S, Mouzon E, Neve RL, Tamminga CA, Nestler EJ. Rola represyjnej metylacji histonów w podatności na stres wywołanej kokainą. Neuron. 2011;71: 656-670. [Artykuł bezpłatny PMC] [PubMed]
  • Freeman WM, Nader MA, Nader SH, Robertson DJ, Gioia L, Mitchell SM, Daunais JB, Porrino LJ, Friedman DP, Vrana KE. Przewlekłe zmiany za pośrednictwem kokainy w jądrze naczelnych innych niż człowiek wyrażają ekspresję genów. J Neurochem. 2001;77: 542-549. [PubMed]
  • Hyman SE, Malenka RC, Nestler EJ. Neuronowe mechanizmy uzależnienia: rola uczenia i pamięci związanej z nagrodą. Annu Rev Neurosci. 2006;29: 565-598. [PubMed]
  • Kalivas PW, Volkow N, Seamans J. Niewykonalna motywacja w uzależnieniu: patologia w transmisji przed glutaminianem przedczołowo-półleżącym. Neuron. 2005;45: 647-650. [PubMed]
  • Lazo PS, Dorfman K, Noguchi T, Mattei MG, Bravo R. Struktura i mapowanie genu fosB. FosB obniża aktywność promotora fosB. Nucleic Acids Res. 1992;20: 343-350. [Artykuł bezpłatny PMC] [PubMed]
  • Lu L, Koya E, Zhai H, Hope BT, Shaham Y. Rola ERK w uzależnieniu od kokainy. Trendy Neurosci. 2006;29: 695-703. [PubMed]
  • Mandelzys A, Gruda MA, Bravo R, Morgan JI. Brak utrzymującego się podwyższonego poziomu antygenu związanego z fosgenem 37 kDa i aktywności wiązania DNA podobnego do AP-1 w mózgach myszy BB traktowanych kwasem zerowym. J Neurosci. 1997;17: 5407-5415. [PubMed]
  • Maze I, Nestler EJ. Epigenetyczny krajobraz uzależnienia. Ann NY Acad Sci. 2011;1216: 99-113. [Artykuł bezpłatny PMC] [PubMed]
  • Maze I, Covington HE, 3rd, Dietz DM, LaPlant Q, Renthal W, Russo SJ, Mechanik M, Mouzon E, Neve RL, Haggarty SJ, Ren Y, Sampath SC, Hurd YL, Greengard P, Tarachowski A, Schaefer A, Nestler EJ. Niezbędna rola metylotransferazy histonowej G9a w plastyczności indukowanej kokainą. Science. 2010;327: 213-216. [Artykuł bezpłatny PMC] [PubMed]
  • Nechaev S, Adelman K. Promotor-proximal Pol II: gdy przeciągnięcie przyspiesza. Cykl komórkowy. 2008;7: 1539-1544. [PubMed]
  • Nestler EJ. Przejrzeć. Transkrypcyjne mechanizmy uzależnienia: rola DeltaFosB. Philos Trans R Soc Lond B Biol Sci. 2008;363: 3245-3255. [Artykuł bezpłatny PMC] [PubMed]
  • Nye HE, Hope BT, Kelz MB, Iadarola M, Nestler EJ. Badania farmakologiczne regulacji przewlekłego indukowania antygenu związanego z FOS przez kokainę w prążkowiu i jądrze półleżącym. J Pharmacol Exp Ther. 1995;275: 1671-1680. [PubMed]
  • Perrotti LI, Hadeishi Y, Ulery PG, Barrot M, Monteggia L, Duman RS, Nestler EJ. Indukcja deltaFosB w strukturach mózgu związanych z nagrodą po przewlekłym stresie. J Neurosci. 2004;24: 10594-10602. [PubMed]
  • Robinson TE, Kolb B. Strukturalna plastyczność związana z narażeniem na przemoc. Neuropharmakologia 47 Suppl. 2004;1: 33-46. [PubMed]
  • Robison AJ, Nestler EJ. Transkrypcyjne i epigenetyczne mechanizmy uzależnienia. Nat Rev Neurosci. 2011;12: 623-637. [Artykuł bezpłatny PMC] [PubMed]
  • Saha RN, Wissink EM, Bailey ER, Zhao M, Fargo DC, Hwang JY, Daigle KR, Fenn JD, Adelman K, Dudek SM. Szybka transkrypcja łuku indukowana aktywnością i inne IEG opierają się na gotowej polimerazie RNA II. Nat Neurosci. 2011;14: 848-856. [Artykuł bezpłatny PMC] [PubMed]
  • Shaham Y, Hope BT. Rola neuroadaptacji w nawrotach w poszukiwaniu leków. Nat Neurosci. 2005;8: 1437-1439. [PubMed]
  • Shen HW, Toda S, Moussawi K, Bouknight A, Zahm DS, Kalivas PW. Zmieniona plastyczność kręgosłupa dendrytycznego u szczurów wycofanych z kokainy. J Neurosci. 2009;29: 2876-2884. [Artykuł bezpłatny PMC] [PubMed]
  • Valjent E, Corvol JC, strony C, Besson MJ, Maldonado R, Caboche J. Zaangażowanie kaskady kinazy regulowanej sygnałem pozakomórkowym dla właściwości nagradzających kokainę. J Neurosci. 2000;20: 8701-8709. [PubMed]
  • Zeitlinger J, Stark A, Kellis M, Hong JW, Nechaev S, Adelman K, Levine M, Young RA. Polimeraza RNA zatrzymuje się w genach kontroli rozwojowej w zarodku Drosophila melanogaster. Nat Genet. 2007;39: 1512-1516. [Artykuł bezpłatny PMC] [PubMed]
  • Vialou VF, Feng J, Robison AJ, Ferguson D, Scobie KN, Mazei-Robison M, Mouzon E, Nestler EJ. Do indukcji kokainy ΔFosB wymagane są czynnik odpowiedzi surowicy i białko wiążące element odpowiedzi cAMP. J Neurosci. 2012 przyjęty. [Artykuł bezpłatny PMC] [PubMed]