Nadekspresja DeltaFosB w jądrze półleżącym naśladuje fenotyp uzależnienia ochronnego, ale nie fenotyp ochronnej depresji wzbogacania środowiska (2014)

Front Behav Neurosci. 2014; 8: 297.

Opublikowane online Aug 29, 2014. doi:  10.3389 / fnbeh.2014.00297

PMCID: PMC4148937

Abstrakcyjny

Wzbogacenie środowiska wywołuje fenotypy uzależnienia ochronnego i depresji u szczurów. ΔFosB jest czynnikiem transkrypcyjnym, który reguluje nagrodę w mózgu i jest wywoływany przez stres psychiczny, a także narkotyki. Jednak rola ΔFosB w fenotypach ochronnych wzbogacania środowiska nie została dobrze zbadana. Tutaj wykazujemy, że ΔFosB jest regulowany w różny sposób u szczurów hodowanych w warunkach izolowanych (IC) w porównaniu z tymi w stanie wzbogaconym (EC) w odpowiedzi na stres związany z ograniczeniami lub kokainę.

Każdy stres przewlekły lub leczenie przewlekłą kokainą podwyższają poziomy białka FosB w jądrze półleżącym (NAc) szczurów IC, ale nie u szczurów EC z powodu już podwyższonej podstawowej akumulacji ΔFosB obserwowanej w warunkach EC.

Nadekspresja osFosB za pośrednictwem wirusów w powłoce NAc szczurów trzymanych w parze (tj. Niezależna od wzbogacenia / izolacji środowiska) zwiększa odpowiedź operanta na sacharozę, gdy motywuje ją głód, ale zmniejsza odpowiedź u nasyconych zwierząt. Ponadto nadekspresja ΔFosB zmniejsza samopodawanie kokainy, nasila wygaszanie poszukiwania kokainy i zmniejsza indukowane kokainą przywrócenie dożylnego podawania kokainy; wszystkie ustalenia behawioralne zgodne z fenotypem wzbogacania.

Natomiast nadekspresja ΔFosB nie zmieniała odpowiedzi szczurów trzymanych w parze w kilku testach zachowania związanego z lękiem i depresją.

Tak więc ΔFosB w Naśladowanie powłoki NAc fenotyp ochronnego uzależnienia, ale nie fenotyp ochronnej depresji wzbogacenia środowiska.

Słowa kluczowe: [przyrost]FosB, wzbogacenie środowiska, depresja, samodzielne podawanie kokainy, wirus związany z adenowirusem (AAV), nadekspresja

Wprowadzenie

Doświadczenie życiowe, zwłaszcza na wczesnym etapie życia, ma głęboki wpływ na zachowanie zwierząt przez całe życie. Środowisko odgrywa zasadniczą rolę w podatności i odporności na zaburzenia psychiczne u ludzi (Elisei i in., 2013; Akdeniz i in., 2014; Kato i Iwamoto, 2014; van Winkel i in., 2014). W modelach gryzoni stwierdzono, że życie w wzbogaconym środowisku od odsadzenia przez młodą dorosłość wywołuje ochronne uzależnienie i fenotypy depresji (Green i in., 2002, 2003, 2010; Laviola i in., 2008; Solinas i in., 2008, 2009; El Rawas i in., 2009; Thiel i in., 2009, 2010). W tym paradygmacie zwierzęta przypisuje się albo warunek wzbogacony (EC), w którym zwierzęta są trzymane w grupach i mają codzienny dostęp do nowych przedmiotów, albo izolowany stan (IC), w którym zwierzęta są trzymane pojedynczo bez nowości lub kontaktu społecznego. Zwierzęta hodowane w warunkach wzbogaconych, w tym kontakty społeczne, ćwiczenia i nowości, wykazują mniejsze wzmocnienie i poszukiwanie kokainy lub amfetaminy w paradygmacie podawania leku dożylnie (Green i in., 2002, 2010). Oprócz fenotypu uzależnienia taka ekspozycja na wzbogacenie wywołuje efekt podobny do antydepresyjnego w zwierzęcych modelach depresji (Green i in., 2010; Jha i in., 2011). W szczególności, wzbogacone zwierzęta wykazują zmniejszone zachowanie podobne do anhedonii w teście preferencji sacharozy, mniej wycofania społecznego w teście interakcji społecznych i mniej bezruchu w teście wymuszonego pływania (FST). Pomimo anty wzbogacania i antydepresyjnych efektów wzbogacania, mechanizmy leżące u podstaw tych ochronnych fenotypów wzbogacania środowiska pozostają nie do końca zrozumiałe, chociaż nasze wcześniejsze badania sugerowały rolę zmniejszonej aktywności czynnika transkrypcyjnego, CREB, w jądrze półleżącym (NAc ) pośrednicząc w niektórych skutkach wzbogacenia środowiska (Green i in., 2010; Larson i in., 2011). Tak więc celem tych badań nad hodowlą różnicową jest wykorzystanie podstawowego podejścia naukowego do zidentyfikowania molekularnych mechanizmów odporności, które można później przetłumaczyć na klinikę. Takie podejście jest środowiskowym odpowiednikiem dobrze ugruntowanych strategii genetycznych, takich jak selektywna hodowla (McBride i in., 2014).

Tutaj skupiamy się na innym czynniku transkrypcyjnym, ΔFosB, który jest indukowany w sposób wyraźny w NAc przez pewne formy stresu lub przez praktycznie wszystkie narkotyki, w tym kokainę, morfinę, alkohol, nikotynę i amfetaminę (Hope i in., 1992; Kelz i Nestler, 2000; Perrotti i in., 2004, 2008). Jako czynnik transkrypcyjny, ΔFosB dimeryzuje z białkami z rodziny Jun, korzystnie JunD, tworząc aktywny kompleks AP-1, który wiąże się z elementem odpowiedzi AP-1 w celu wzmocnienia lub represji transkrypcji jego docelowych genów (Nestler, 2001), chociaż nowe badania sugerują, że ΔFosB może również działać jako homodimer (Wang i in., 2012). Białko ΔFosB jest skróconą wariancją splicingu FosB gen, który powoduje, że białko ΔFosB nie ma dwóch C-końcowych domen degron, zapobiegając szybkiej degradacji białka osFosB obserwowanej w przypadku FosB i wszystkich innych białek z rodziny Fos. Ponieważ ΔFosB jest wyjątkowo stabilny w NAc, ΔFosB działa bardzo różnie w odpowiedzi na bodźce ostre w porównaniu z innymi białkami Fos. Przy wielokrotnym narażeniu na leki nadużywające lub stresujące białko ΔFosB stopniowo gromadzi się i utrzymuje przez kilka dni do tygodni, podczas gdy FosB i inne białka Fos są indukowane tylko przez krótki czas (godziny) i rozwijają osłabioną indukcję po kolejnej ekspozycji (Nestler i in., 2001; Nestler, 2008).

Znaczenie ΔFosB polega nie tylko na tym, że jest ono silnie indukowane przez narkotyki i stres, ale wykazano, że manipulacja ΔFosB w mózgu wpływa na zachowanie zwierząt. Selektywne indukowanie ΔFosB w neuronach kolczystych średnich dynorfin u dorosłych myszy zwiększa wrażliwość lokomotoryczną w odpowiedzi na ostrą i powtarzaną kokainę, jak również nagradzające reakcje na kokainę w paradygmacie preferencji warunkowego miejsca i wzmocnienie w paradygmacie samo-podawania (Kelz i in., 1999; Kelz i Nestler, 2000; Colby i in., 2003).

Chociaż fenotypy uzależnienia ochronnego i depresji opisano szczegółowo dla szczurów wzbogaconych w środowisko, możliwa rola ΔFosB w pośredniczeniu w tych fenotypach ochronnych nie została w pełni oceniona. Poprzednie badania wzbogacania środowiska wykazały, że w porównaniu ze standardowym środowiskiem (SE), wzbogacone środowisko zwiększa podstawowe poziomy ΔFosB zarówno w średnich kolczastych neuronach kolczastych D1, jak i D2 u myszy (Solinas i in., 2009; Lobo i in., 2013). Ponadto, wzbogacone szczury Wistar wykazały podwyższone wartości komórek ΔFosB dodatnich w NAc i korze przedczołowej w porównaniu do szczurów SE, co sugeruje możliwą rolę ΔFosB w fenotypie ochronnego uzależnienia od nikotyny (Venebra-Muñoz i in., 2014). Ponadto, nadekspresja ΔFosB w całym prążkowiu myszy zwiększa codzienne bieganie kół, co może być analogiczne do zwiększonej aktywności szczurów w środowisku wzbogaconym (Werme i in., 2002).

W obecnym badaniu postawiliśmy hipotezę, że: (1) wzbogacenie środowiska zwiększyłoby nagromadzenie podstawowych poziomów ΔFosB w NAc; i (2) ta akumulacja ΔFosB przyczyniłaby się do ochronnych skutków wzbogacenia środowiska.

Materiały i metody

Zwierzęta

W celu wzbogacenia środowiska samce szczurów Sprague-Dawley (Harlan, Houston, TX, USA) losowo przydzielono do obudowy EC lub IC od dnia poporodowego 21 do dnia 51. Szczury EC były trzymane w grupach (20 na klatkę) w dużej metalowej klatce (70 × 70 × 70 cm) z kilkoma twardymi przedmiotami z tworzywa sztucznego (zabawki dla dzieci, plastikowe pojemniki, rurki z PVC, itp.). Obiekty te zostały zastąpione nowymi obiektami i przekształcane codziennie w nowatorską konfigurację. Szczury IC trzymano pojedynczo w standardowych klatkach z poliwęglanu. Szczury pozostawały w tych warunkach podczas eksperymentów i wszystkie testy behawioralne i testy biochemiczne rozpoczęły się po 51 dniach życia (tj. Co najmniej 30 dni wzbogacenia / izolacji). W celu nadekspresji ΔFosB, samce szczurów Sprague-Dawley (Harlan, Houston, TX, USA) otrzymano w rozmiarze 225-250 g i trzymano w parach w standardowych klatkach poliwęglanowych przed wstrzyknięciem stereotaktycznie wektora wirusowego związanego z adenowirusami (AAV2) nadekspresja ΔFosB za pomocą zielonego białka fluorescencyjnego (GFP) lub po prostu GFP jako kontroli (patrz poniżej). Standardowa karma dla szczurów i woda były swobodnie dostępne dla wszystkich szczurów, z wyjątkiem testów behawioralnych i regulacji żywności. Wszystkie szczury utrzymywano w kontrolowanym środowisku (temperatura, 22 ° C; wilgotność względna, 50%; 12 h cykl światła / ciemności, światła na 600 h) w kolonii zatwierdzonej przez Stowarzyszenie Oceny i Akredytacji Opieki nad Zwierzętami Laboratoryjnymi (AAALAC) . Wszystkie eksperymenty były zgodne z Przewodnikiem NIH dotyczącym opieki nad zwierzętami laboratoryjnymi i korzystania z nich oraz z instytucjonalnym komitetem do spraw opieki nad zwierzętami Uniwersytetu w Teksasie.

Wzbogacanie środowiska to manipulacja złożona polegająca na nowości, kontaktach społecznych i ćwiczeniach. Obudowa parowa zapewnia kontakt społeczny, a zatem reprezentuje KE (patrz Przewodnik NIH). Zatem odpowiednia grupa kontrolna dla stanu z nowością, kontaktem społecznym i ćwiczeniami byłaby grupą bez nowości, kontaktów społecznych lub ćwiczeń, stanem IC. Szczury IC wykazują mniej objawów przewlekłego stresu niż szczury EC. W szczególności szczury EC mają powiększone nadnercza (Mlynarik i in., 2004), stępione odpowiedzi CORT (Stairs i in., 2011), osłabiona natychmiastowa wczesna indukcja genu (Zhang et al., rękopis w przygotowaniu) i akumulacja ΔFosB (Solinas i in., 2009; Lobo i in., 2013), wszystkie oznaki przewlekłego stresu (Crofton i in., w przeglądzie).

Stres psychologiczny

Wzbogacone i izolowane szczury umieszczono w jednorazowych miękkich plastikowych ogranicznikach dla gryzoni (DecapiCone®, Braintree Scientific Inc., MA, USA) dla 60 min dla 1 dnia (ostry) lub 9 dni (powtórzono). W przypadku testów mRNA o krótkiej ekspozycji szczury 30 (szczury 5 na grupę) zdekapitowano 30 min po rozpoczęciu ostatniego okresu stresu ograniczającego, mózgi szczurów wyekstrahowano i wycięto NAc w celu analizy mRNA. Do immunohistochemii szczury 12 poddano perfuzji solą fizjologiczną i 4% paraformaldehydem, wyekstrahowano mózgi, utrwalono w 4% paraformaldehydzie i przechowywano w 20% glicerolu w 1xPBS w 4 ° C. Mózgi szczurów krojono w 40 μm za pomocą zamrażającego mikrotomu. Mózgi zebrano 24 h po ostatnim stresie, aby umożliwić degradację białka FosB pełnej długości (Perrotti i in., 2008).

Dożylne zażywanie kokainy we własnym zakresie z wzbogaceniem środowiska

Wszczepienie dożylnego cewnika

Szczury znieczulono stosując ketaminę (100 mg / kg IP) i ksylazynę (10 mg / kg IP) i cewnik Silastic wstawiono i zabezpieczono w żyle szyjnej, opuszczając skórę na grzbiecie zwierzęcia. Każdego dnia cewniki infuzowano 0.1 ml sterylnego roztworu soli fizjologicznej zawierającego heparynę (30.0 U / ml), penicylinę G potas (250,000 U / ml) i streptokinazę (8000 IU / ml), aby zapobiec infekcji i utrzymać drożność cewnika przez cały czas trwania eksperymentów.

Samokontrola kokainy z wzbogaceniem środowiska

Dwadzieścia szczurów wzbogaconych i izolowanych 20 umieszczono w komorach operacyjnych 30 × 24 × 21 cm (Med-Associates, St. Albans, VT) i pozwolono im nacisnąć dźwignię do infuzji kokainy (0.5 mg / kg / wlew, podaż leku NIDA, Research Triangle Institute, NC, USA) lub sól fizjologiczna w ustalonym stosunku 1 (FR1) harmonogram 2 h na dzień w sumie 14 dni. Aby utrzymać podobne spożycie kokainy między grupami EC i IC, wystąpiło maksimum infuzji 30 na sesję. Zdolność przetwarzania tkanek była ograniczona do próbek 30, więc szczury z najniższej odpowiedzi z każdej grupy nie były przetwarzane, pozostawiając Ns 8 dla kokainy i 7 dla grup soli fizjologicznej. W związku z tym nie było różnic EC / IC w całkowitym spożyciu kokainy lub przebiegu wlewów między szczurami EC i IC. Mózgi szczurów wyekstrahowano 3 h po rozpoczęciu ostatniej sesji samopodawania i NAc wycięto pod kątem analizy mRNA i białka. Jedną stronę NAc zastosowano do Western blot, drugą stronę zastosowano do qPCR.

Bezwarunkowe podawanie kokainy z wzbogaceniem środowiska

Dla bezpośredniego porównania z wcześniej opublikowaną literaturą (Hope i in., 1994; Chen i in., 1995), EC (N = 12) i szczury IC (N = 12) wstrzyknięto solankę lub 20 mg / kg kokainy dootrzewnowej (IP) dla 1 dnia (ostre) lub 9 dni (powtórzono). Jedna próbka EC została utracona podczas przetwarzania. Grupa ostra otrzymywała zastrzyki soli fizjologicznej na dni 8 i jedno wstrzyknięcie kokainy w dniu 9, tak że wszystkie szczury otrzymały taką samą liczbę wstrzyknięć. Mózgi ekstrahowano 30 min po ostatnim wstrzyknięciu i NAc wycięto do analizy mRNA.

Oznaczenie ilościowe mRNA przy użyciu qPCR

RNA ekstrahowano przez homogenizację w RNA STAT-60 (Teltest, Friendswood, TX), oddzielając RNA od DNA i białka przy użyciu chloroformu i wytrącając całkowity RNA izopropanolem. Zanieczyszczający DNA usunięto (TURBO DNA-Free, Life Technologies, CA, USA), a 5 ug oczyszczonego RNA poddano odwrotnej transkrypcji do cDNA (SuperScript III First Strand Synthesis: Invitrogen katalog # 18080051). MRNA ΔFosB oznaczano ilościowo za pomocą ilościowej PCR w czasie rzeczywistym (Green SYBR: Applied Biosystems, Foster City, CA) na szybkim termocyklerze Applied Biosystems 7500 ze starterami zaprojektowanymi do wykrywania tylko ΔFosB (do przodu: AGGCAGAGCTGGAGTCGGAGAT; odwrotny: GCCGAGGACTTGAACTTCACTCG) i znormalizowano do zaprojektowanych starterów do wykrywania szczurzego GAPDH (do przodu: AACGACCCCTTCATTGAC; odwrotny: TCCACGACATACTCAGCAC). Wszystkie startery poddano walidacji i analizowano pod kątem swoistości i liniowości przed eksperymentami (Alibhai i in., 2007).

Western blot

Prawa strona NAc z kokainy lub samozasysającego EC szczurów IC i homogenizowano w buforze zawierającym sacharozę, bufor Hepes, fluorek sodu, 10% SDS i inhibitory proteazy i fosfatazy (Sigma-Aldrich: P-8340, P -2850, P-5726). Stężenie białka oceniano przy użyciu zestawu Pierce BCA Protein Assay Kit (Thermo Scientific, IL, USA). Ponieważ białko wyekstrahowane z jednego szczura nie było wystarczające do analizy, próbki 2 z tej samej grupy zebrano razem, tworząc próbki 4 dla każdej grupy. Próbki białka denaturowano przy 95 ° dla 5 min i prowadzono na żelu gradientowym poliakrylamidowym 10-20% (Criterion TGX, Bio-Rad Laboratories, CA, USA), a następnie przenoszono na membranę z fluorku poliwinylidenu (PVDF) (Millipore, MA, USA ). Membranę zablokowano blokerem klasy blottingu (beztłuszczowe mleko w proszku), inkubowano z pierwotnym przeciwciałem? FosB (królik, 1: 1000, # 2251, Cell Signaling Technology, MA, USA) i pierwszorzędowym przeciwciałem?-Aktyny (mysz, 1: 1000 , Cell Signaling Technology, MA, USA), przemywa się TBST, a następnie inkubuje z fluorescencyjnymi przeciwciałami drugorzędowymi (osioł anty-królik (780 nm), osioł anty-mysz (680 nm), 1: 15000, Li-Cor Biosciences, NE, USA). Następnie wykonano zdjęcia Western blot (Odyssey, Li-Cor Biosciences, NE, USA) i oznaczono poziomy białka za pomocą oprogramowania Odyssey.

Immunohistochemia

Na rysunek Figure11 (N = 3), komórki zawierające ΔFosB wizualizowano i zliczano przez znakowanie immunohistochemiczne ΔFosB w skrawkach NAc barwionych DAB (zestaw substratu peroksydazy DAB, Vector Laboratories, CA, USA). Mózgi wyekstrahowano, utrwalono, poddano krioprotekcji i pocięto na skrawki 40 μm zawierające NAc na mikrotomie ślizgowym zamrażającym (Leica Biosystems, IL, USA). Plastry pozostawały pływające i płukano 1xPBS, zanim wygaszono endogenne peroksydazy, przed blokowaniem 3% normalną surowicą kozią (Jackson ImmunoResearch, PA, USA) z 0.3% trytonem i awidyną D (Vector Laboratories, CA, USA). Plasterki NAc inkubowano z pierwszorzędowym przeciwciałem FosB przez noc (1: 1000, Santa Cruz Biotechnology, Dallas, TX, USA) z 3% kozią surowicą, 0.3% trytonem, 1xPBS i roztworem biotyny (Vector Laboratories, CA, USA). Chociaż to przeciwciało rozpoznaje zarówno FosB, jak i ΔFosB, wcześniejsze badania Western blot wykazały, że po 24 h po stymulacji, ogromna większość sygnału immunohistochemicznego składa się z ΔFosB, ponieważ FosB ulega degradacji na długo przed 24 h (Perrotti i in., 2008). Po płukaniu skrawki inkubowano z biotynylowanym kozim drugorzędowym przeciwciałem IgG (Vector Laboratories, CA, USA), surowicą kozią i 1xPBS. Następnie skrawki inkubowano z barwnikiem peroksydazy kompleks awidyna-biotyna (ABC) dla 15 min (Thermo Scientific, IL, USA). Na koniec osadzono plastry, odwodniono stosując etanol i CitriSolv (Fischer Scientific, MA, USA) i nakryto szkiełkiem nakrywkowym z DPX (Fisher Scientific). W celu zliczenia komórek skrawki pobierano od Bregma + 1.80 do + 1.44 od każdego zwierzęcia. Całkowitą liczbę immunopozytywnych komórek ΔFosB zliczono z czterech skrawków NAc z rdzenia i powłoki każdego szczura.

Rysunek 1  

stres i [przyrost]FosB u szczurów EC i IC. (OGŁOSZENIE) Reprezentatywne barwienie immunohistochemiczne DAB ΔFosB w powłoce NAc i rdzeniu IC (A i B) i WE (C i D) szczury z (B i D) i bez (A i C) powtarzający się stres (N = (MI) Ujęcie ilościowe ...

Nadekspresja wirusa związanego z adenowirusami [przyrost]FosB

Wektor oparty na AAV2, który eksprymuje ΔFosB i humanizowane renilla GFP (hrGFP; Winstanley i in., 2007, 2009,b) lub wektor kontrolny hrGFP (N = 10 każdy) wstrzyknięto obustronnie do NAc szczura. Ponieważ nie ma ludzi z IC, szczury trzymane w parze zastosowano zamiast szczurów IC w celu zwiększenia znaczenia społeczności naukowej poprzez wykazanie wpływu ΔFosB niezależny paradygmatu EC / IC. AAV eksprymujący hrGFP, ale nie wykazujący nadekspresji ΔFosB zastosowano jako kontrolę. Wyrażenie ΔFosB in vivo potwierdzono przez barwienie immunofluorescencyjne z pierwotnym przeciwciałem FosB (1: 200, Rabbit, Cell Signaling Technology, MA, USA). Wektory AAV wstrzyknięto do powłoki NAc obustronnie (1 μl / strona ponad 10 min) stosując współrzędne (AP = 1.7, L = 2.0, D = −6.5). Testy behawioralne rozpoczęły się 3 kilka tygodni po zabiegu stereotaktycznym. Dokładne umiejscowienie określono immunohistochemicznie po zakończeniu testów behawioralnych.

Neofobia sacharozy

Szczury z nadekspresją AfosB (N = 10) i szczury kontrolne (N = 8) były obsługiwane przez 1 tydzień przed rozpoczęciem testów zachowania. Aby przetestować zachowanie podobne do lęku, szczury oceniano pod kątem nowofobii do nowego smaku (sacharozy). Szczury rozdzielono na pojedyncze klatki i wodę usunięto w 1600 h. Standardowe butelki wody dla szczurów napełniono roztworem sacharozy 1% w / v w normalnej wodzie z kranu szczurów i zważono przed umieszczeniem na każdej klatce w 1800 h. Po 30 min butelki usunięto i ponownie zważono, a różnicę masy butelek sacharozy przed i po teście obliczono. Następnie sacharozę wymieniono na klatkach na dodatkowe dni 2, aby umożliwić szczurom zapoznanie się ze smakiem sacharozy przed testem preferencji sacharozy.

Podwyższony labirynt

Kolejny test zachowania podobnego do lęku, labirynt podwyższony plus (EPM), przetestowano w dniach 2 po neofobii sacharozy. EPM mierzy zmodyfikowane zachowanie wektora w środowisku nowym i wywołującym lęk (Green i in., 2008). Dwa zamknięte ramiona i dwa otwarte ramiona (Med Associates Inc., VT, USA) mierzące 12 × 50 cm były 75 cm nad podłogą i miały fotony przy wejściu każdego ramienia. Czas spędzony na otwartych ramionach monitorowano pod kątem 5 min za pomocą fotobamów przy użyciu oprogramowania Med-PC.

Zimne wypróżnienie wywołane stresem

W dniu po EPM zastosowano trzeci test lęku: defekacja w odpowiedzi na łagodnie stresujące środowisko (zimno). Klatki z poliwęglanu (33 × 17 × 13 cm) wstępnie schłodzono na lodzie przez 10 min. Szczury umieszczono w klatkach na lodzie przez 30 min i rejestrowano liczbę boli kałowych co 5 min.

Kontakt społeczny

Następnego dnia mierzono zachowanie podobne do depresji za pomocą testu interakcji społecznych. Szczury rozdzielono na 24 h przed badaniem. W dniu testu szczury umieszczono w nowatorskim środowisku (pojemnik z tworzywa sztucznego, 45 × 40 × 45 cm) z towarzyszem klatki i zachowanie było rejestrowane wideo dla 30 min. Ilość czasu, jaki para szczurów spędzała na pielęgnowaniu siebie, była mierzona przez ślepego badacza na stan szczurów.

Preferencja sacharozy

Po kontakcie społecznym test preferencji sacharozy wykorzystano jako model anhedonii. Szczury trzymane w parach rozdzielano w 1600 h na żywność, ale nie pozwalano na dostęp do wody dla 2 h. W 1800 h dwie wstępnie zważone butelki z wodą umieszczono na każdej klatce, jedną zawierającą wodę, a drugą 1% roztwór sacharozy w wodzie. Butelki wody umieszczono w normalnej pozycji, podczas gdy sacharozę umieszczono w odległości około 10 cm. Butelki usunięto i ponownie zważono po 15 min.

Aktywność lokomotoryczna

Trzy dni po preferencji sacharozy aktywność lokomotoryczną oceniano w warunkach normalnego światła przez umieszczenie szczurów w przezroczystych komorach z pleksiglasu (40 x 40 x 40 cm) z cienką warstwą podściółki, otoczoną dwiema matrycami fotobeamowymi 4 × 4, jeden 4 cm powyżej ziemia i jeden 16 cm nad ziemią, aby rejestrować poziomą amortyzację i aktywność pionową (wychów). Przebicia fotoniczne monitorowano pod kątem 2 h za pomocą zmodyfikowanego systemu aktywności otwartego pola (San Diego Instruments, CA, USA).

Test wymuszonego pływania

Ostatnim spontanicznym testem behawioralnym był FST, model wrażliwy na leki przeciwdepresyjne. Szczury umieszczano w cylindrze z pleksiglasu wypełnionym wodą w przybliżeniu 14 L o temperaturze pokojowej (24 ± 0.5 °) dla 15 min na sesji 1 i 5 min na sesji 2 następnego dnia. Szczury wysuszono i umieszczono z powrotem w klatkach domowych. Aktywność pływania rejestrowano wideo, a opóźnienie do pierwszego okresu bezruchu (1) i całkowity czas nieruchomy określono dla Sesji 2 przez badacza zaślepionego na warunki.

Odpowiedź reagenta sacharozy

Kontrolne szczury AAV i szczury z nadekspresją ΔFosB regulowano na 85% ciężaru swobodnego karmienia przez 7 dni. Wszystkie szczury przeszkolono w prasie prętowej dla peletek sacharozy (Bio-Serv, NJ, USA) według harmonogramu wzmocnienia FR1 dla sesji 15 min w kolejnych dniach 5. Szczurom następnie zapewniono swobodny dostęp do pożywienia przez 3 dni i ponownie pozwolono na prasowanie prętowe dla peletek sacharozy w harmonogramie FR1 dla 15 min, tym razem przy 100% ciężaru paszy swobodnej.

Samokontrola kokainy

Nabycie

Tydzień po operacji cewnika (jak opisano powyżej), wszystkie szczury (szczury kontrolne 7 i szczury 10 ΔFosB z nadekspresją, jeden szczur kontrolny utracono z operacji cewnika) umieszczono w komorach operacyjnych 30 × 24 × 21 cm (Med-Associates, St. Albans, VT) i pozwolono na samodzielne podawanie 0.2 mg / kg / dawkę jednostkową wlewu kokainy dla 2 h na sesję dla dni 4; następnie 0.5 mg / kg / wlew do 3 dni w harmonogramie FR1. Każdą infuzję dostarczano dożylnie w objętości 0.01 ml przez 5.8. Napar został zasygnalizowany przez podświetlenie dwóch lamp cue dla 20 s, co sygnalizowało okres czasu, w którym nie można było uzyskać dalszych wlewów.

Wygaśnięcie

Ponieważ przewlekła ekspozycja na kokainę przypuszczalnie wywoła akumulację ΔFosB u szczurów kontrolnych, co spowoduje, że szczury w obu warunkach wektorowych będą miały wysokie poziomy ΔFosB w mózgu, szczury były zamknięte w swoich klatkach domowych przez 4 dni bez samo-podawania, aby umożliwić Poziomy białka osFosB zmniejszają się u szczurów kontrolnych. Po abstynencji 4 szczury umieszczono w komorze operacyjnej i pozwolono na samodzielne podawanie soli fizjologicznej zamiast kokainy w schemacie FR1 dla sesji 1 h przez kolejne dni 3.

Naprawiono odpowiedź na dawkę

Każdemu szczurowi (kontrola i nadekspresja ΔFosB) pozwolono na samodzielne podawanie kokainy 0.00325, 0.0075, 0.015, 0.03, 0.06, 0.125, 0.25, 0.5 mg / kg / infuzję w porządku rosnącym w harmonogramie FR1 każdego dnia przez kolejne 5 dni. Szczury same podawały każdą dawkę kokainy przez 30 min.

Przywrócenie wywołane kokainą

Szczury przeszły procedurę przywracania w trakcie sesji. Szczury otrzymywały 0.5 mg / kg / infuzję w schemacie FR1 dla 60 min, a następnie 3 h ekstynkcji (z warunkowymi sygnałami kokainowymi). Następnie otrzymali zastrzyk IP (Green i in., 2010) kokainy jednej z pięciu dawek (0, 2.5, 5, 10 lub 20 mg / kg) w losowej kolejności dla każdego szczura w trakcie sesji przywracania 5. Ostatnia faza sesji 3 h polegała na przywróceniu odpowiedzi, ponownie z sygnałami kokainowymi, ale nadal bez infuzji kokainy. Po każdej sesji przywracania indukowanej kokainą szczury otrzymywały 2 dni interwencyjne wysokiej dawki (0.5 mg / kg / infuzję) kokainy w harmonogramie FR1 dla 2 h, aby utrzymać wysokie wskaźniki odpowiedzi w trakcie sesji. Podczas procesu samopodawania kokainy cewniki niektórych szczurów stopniowo traciły drożność; stąd w tej analizie wykorzystano dane szczurów kontrolnych 6 i szczurów z nadekspresją 7? FosB.

Analiza statystyczna

Przeprowadzono dwukierunkowe analizy wariancji (ANOVA) i dwukierunkowej ANOVA z powtarzanymi pomiarami w celu porównania czterech grup leczenia i zaplanowano porównania w celu porównania różnic między warunkami. Istotność między tylko dwoma warunkami analizowano za pomocą Studenta t-test. Wszystko t- dane testowe przeszły test normalności Shapiro-Wilka. Wszystkie dane wyrażono jako średnią ± SEM. Istotność statystyczna została ustalona na p <0.05. Wszystkie wzbogacone szczury w jednym eksperymencie były trzymane w jednej klatce, ale traktowane jako osobne osobniki, co dostarczało implikacji dotyczących potencjalnej pseudoreplikacji.

wyniki

Szczury EC wykazują wyższe poziomy podstawowe [przyrost]FosB w NAc niż szczury IC

W porównaniu ze szczurami IC, szczury EC mają znacznie większą liczbę komórek ΔFosB dodatnich w obu rdzeniach NAc (t(4) = -3.31, p <0.05) i muszlę (t(4) = -6.84, p <0.05) (ryc 1A, C, E, F), sugerując, że ton podstawowy ΔFosB jest wyższy u szczurów EC w porównaniu ze szczurami IC. Ponadto wyniki Western blot wykazały silną tendencję dla szczurów EC z solą fizjologiczną, które miały wyższy podstawowy poziom białka ΔFosB w NAc w porównaniu ze szczurami solnymi IC (t(6) = -2.03, p = 0.089; Postać Figure2A) 2A) przy użyciu testu dwustronnego. Jednak biorąc pod uwagę zwiększoną ekspresję na rysunkach 1A – F oraz wzrosty obserwowane w innych dokumentach (Solinas i in., 2009), jesteśmy pewni tego efektu. Wyniki testu Western blot sprawdzają również, że praktycznie cała immunoreaktywność FosB-podobna wykrywana immunohistochemicznie była ΔFosB, a nie FosB, która nie była wykrywalna w 24 h.

Rysunek 2  

Kokaina i [przyrost]FosB u szczurów EC i IC. (A – B) Średnie białko ΔFosB () i mRNA (B) poziom (± SEM) w NAc po dniach 14 samodzielnego podawania soli fizjologicznej lub kokainy u szczurów IC i EC (N = 7 – 8). Czerwone pasy w panelu a oznaczają ...

[przyrost]FosB jest różnie indukowany u szczurów EC i IC przez stres

Wystąpił znaczący główny efekt powtarzających się naprężeń ograniczających w obu powłokach (F(1, 8) = 16.6, P <0.005) i rdzeń (F(1, 8) = 7.9, P <0.05) NAc i główny efekt wzbogacenia środowiska w muszli (F(1, 8) = 22.3, P <0.005; Liczby 1A – F). Co ważniejsze, interakcja między stresem a wzbogacaniem środowiska była również istotna w obu powłokach (F(1, 8) = 25.6, P <0.01) i rdzeń (F(1, 8) = 6.7, P <0.05). Interakcja była taka, że ​​po wielokrotnym stresie unieruchamiającym liczba komórek ΔFosB dodatnich znacznie wzrosła u szczurów IC, podczas gdy liczba ta nie uległa zmianie u szczurów EC po wielokrotnym stresie.

Aby dokładniej zbadać, w jaki sposób ΔFosB jest dynamicznie regulowany przez stres ostry i powtarzany, oraz umożliwić porównanie z wcześniejszymi badaniami (Alibhai i in., 2007), indukcja ΔFosB mRNA badano z ostrym i powtarzającym się stresem powściągliwości (ryc (Figure1G) .1G). Istotny główny efekt stresu (F(2, 24) = 31.9, P <0.001) i wzbogacenie środowiska (F(1, 24) = 5.1, P <0.05). U szczurów IC mRNA ΔFosB było silnie indukowane po ostrym stresie przymusowym. Jednak przy powtarzającym się stresie indukcja mRNA ΔFosB była znacznie osłabiona w porównaniu z indukcją ostrą. Wystąpiła również znacząca interakcja (F(2, 24) = 4.6, P <0.05), co pokazuje, że ostra indukcja mRNA ΔFosB była mniejsza u szczurów EC w porównaniu ze szczurami IC. Zatem szczury EC mają wyższe poziomy podstawowe ΔFosB białko w NAc, ale mniej ΔFosB mRNA indukcja w odpowiedzi na ostry stresor.

[przyrost]FosB jest różnie indukowany przez kokainę u NAc szczurów EC i IC

Aby ustalić, czy szczury EC i IC reagują inaczej na kokainę, zbadaliśmy regulację białka osFosB i mRNA u szczurzego NAc po podaniu kokainy we własnym zakresie (ryciny 2A, B odpowiednio). Western blot ujawnił znaczący główny efekt kokainy (F(1, 12) = 24.9, P <0.001) i istotną interakcję (F(1,12) = 5.5, P <0.05). Interakcja była taka, że ​​ΔFosB wzrósł bardziej u szczurów IC niż u szczurów EC (ryc (Figure2A) .2A). W rzeczywistości, po podaniu kokainy poziomy białka ΔFosB były znacząco podwyższone tylko u szczurów IC. Jeśli chodzi o poziomy mRNA, wyniki qPCR ujawniły również istotny główny efekt kokainy (F(1, 26) = 47.1, P <0.001) i główny efekt wzbogacenia środowiska (F(1, 26) = 13.8, P <0.005). Chociaż ogólne poziomy były niższe u szczurów EC, obie grupy zwiększyły mRNA ΔFosB (ryc (Figure2B2B).

Chociaż dane dotyczące białek potwierdzają pierwotną hipotezę, postawiono hipotezę na podstawie rysunku Figure1G1G że szczury EC pokażą mniej mRNA indukcja niż izolowane szczury w powyższym eksperymencie kokainowym, co nie miało miejsca, prawdopodobnie dlatego, że Figure1G1G wykorzystał punkt czasowy 30 min, a eksperyment kokainowy wykorzystał punkt czasowy 3 h. Aby dokładniej zbadać hipotezę mRNA, zastosowano punkt czasowy 30 min, aby zbadać zarówno ostre, jak i powtarzane leczenie kokainą jako lepsze porównanie z figurą Figure1G.1G. Ponieważ ostre samopodawanie kokainy jest z natury problematyczne (tj. Uczenie się nabywania), szczurom EC i IC podawano ostre lub 9 dni powtarzających się nie warunkowych wstrzyknięć kokainy IP (20 mg / kg). Zgodnie z hipotezą istniał znaczący główny efekt wzbogacenia środowiska (F(1, 17) = 14.3, P <0.005), ale główny efekt leczenia kokainą (F(2, 17) = 3.4, P = 0.057) i interakcja (F(2, 17) = 3.4, P = 0.055) pokazał tylko silne trendy w teście dwustronnym. Jednak biorąc pod uwagę, że mieliśmy hipotezy kierunkowe z rysunku Figure1G, 1G, jesteśmy bardzo zadowoleni z naszej opinii, że szczury EC wykazują mniejszą indukcję niż szczury IC (ryc (Figure2C2C).

Nadmierna ekspresja [przyrost]FosB w powłoce NAc naśladuje ochronny fenotyp uzależnienia od wzbogacenia

Aby zbadać wpływ ΔFosB na zachowanie szczura niezależne od wzbogacenia / izolacji środowiska (tj. W celu uczynienia tych wyników bardziej odpowiednimi dla badań innych niż EC / IC), wirus związany z adenowirusem (AAV) zastosowano do nadekspresji ΔFosB dwustronnie w NAc nie wzbogacone szczury trzymane w parze. Zgodnie z naszymi wcześniejszymi badaniami, powłoka NAc jest najbardziej wrażliwa na kontrolę zachowania związanego z depresją i przyjmowaniem / poszukiwaniem leku, więc w tym badaniu wektory AAV wstrzyknięto do powłoki NAc (Green i in., 2006, 2008, 2010). Figury 3A, B przedstawiają reprezentatywną immunohistofluorescencję ΔFosB z wektorem kontrolnym (panel A; tj. endogenną ekspresję ΔFosB) i wektorem z nadekspresją ΔFosB (panel B) w powłoce NAc.

Rysunek 3  

Nadmierna ekspresja [przyrost]FosB w powłoce NAc naśladuje fenotyp ochronnego uzależnienia wzbogacania środowiska. (A – B) Reprezentatywna immunohistochemia ΔFosB dla kontroli hrGFP () i nadekspresja ΔFosB (B) Wektory AAV. ...

Po zatwierdzeniu miana in vivo ekspresja i ogólne rozmieszczenie wektora wirusowego, najpierw badaliśmy wpływ nadekspresji ΔFosB w modelach lękowych. Nadekspresja ΔFosB w powłoce NAc nie była wystarczająca do odtworzenia anksjogennego wpływu wzbogacenia środowiska w paradygmaty defekacji wywołane przez sacharozę i wywołane stresem zimna (dane nie pokazane). Ponadto nie miało to wpływu na EPM (dane nie pokazane). Ponieważ wzbogacenie środowiska wywołuje u szczurów działanie podobne do działania przeciwdepresyjnego, następnie przeprowadziliśmy testy związane z depresją na szczurach z nadekspresją ΔFosB. Wyniki podobne do modeli lękowych wykazały, że nadekspresja ΔFosB w powłoce NAc nie była wystarczająca do zmniejszenia zachowania podobnego do depresji w teście preferencji sacharozy, teście interakcji społecznych lub FST (dane nie pokazane).

W paradygmacie wzbogacania środowiska szczury EC wykazują niższą podstawową aktywność lokomotoryczną niż szczury IC (Bowling i in., 1993; Bowling and Bardo, 1994; Smith i in., 1997; Green i in., 2003, 2010). Aby zbadać wpływ nadekspresji ΔFosB w powłoce NAc, spontaniczną aktywność lokomotoryczną badano pod kątem 120 min. Przy użyciu dwustronnego testu wyniki ujawniły, że nadekspresja ΔFosB w powłoce NAc wytworzyła silną tendencję do obniżonej podstawowej aktywności lokomotorycznej u szczurów (Figura (Figure3C; 3C; t(16) = 1.84, p = 0.084). Pomimo tego, że nie są one dość istotne statystycznie w teście dwustronnym, dane te są nadal intrygujące, biorąc pod uwagę, że są zgodne z naszą wyraźną hipotezą kierunkową opartą na Green et al. (2010), co jest zgodne z efektem wzbogacenia środowiska.

IW przeciwieństwie do modeli depresji i lęków, nadekspresja ΔFosB w powłoce NAc była w stanie wytworzyć fenotyp podobny do EC w wielu paradygmatach uzależnienia / wzmocnienia. jaW teście samodzielnego podawania opryszczki sacharozy stwierdzono istotną interakcję między nadekspresją ΔFosB a motywacją głodu szczurów (F(1, 16) = 7.4, P <0.01). U szczurów nadekspresja ΔFosB w powłoce NAc była istotna jeszcze granulki sacharozy w warunkach zmotywowanych do głodu (tj. przy 85% masy ciała w karmieniu swobodnym), ale mniej peletek w warunkach niskiej motywacji (tj. 100% wolnego ciężaru paszy; Figure3D), 3D), który doskonale naśladuje fenotyp EC (Green i in., 2010).

W paradygmacie wzbogacania środowiska szczury EC wykazywały zmniejszone zachowania związane z poszukiwaniem kokainy przy wymieraniu i przywróceniu wywołanym kokainą (Green i in., 2010). Tak więc, mierzenie kokainy i poszukiwanie zachowania mierzono u szczurów z ekspresją ΔFosB, stosując dożylny paradygmat podawania kokainy. Jako model głodu alkoholowego paradygmat ekstynkcji kokainy ujawnił, że nadekspresja ΔFosB w powłoce NAc zmniejszyła zachowanie poszukiwanie lekur (F(1, 15) = 6.7, P <0.05; Postać Figure3E) .3E). Istotny był również główny efekt sesji (F(2, 30) = 74.0, P <0.001). W przypadku odpowiedzi podtrzymującej zgodnie ze schematem FR1 wystąpił istotny główny wpływ dawki (F(7, 105) = 222.6, P <0.001) i istotną interakcję (F(7, 105) = 2.3, P <0.05) w łącznym spożyciu kokainy. Charakter interakcji był taki, że różnice były widoczne tylko przy wyższych dawkach kokainy (ryc (Figure3F) .3F). Wreszcie, w przywróceniu wywołanym kokainą istniał znaczący główny efekt dawki (F(4, 44) = 15.5, P <0.001) i trendu głównego efektu nadekspresji ΔFosB przy użyciu testu dwustronnego (F(1, 11) = 4.1, P = 0.067). Jednak biorąc pod uwagę hipotezę kierunkową Greena i in. (2010) oraz statystycznie istotne i spójne wyniki w liczbach 3D, E, F, jest prawdopodobne, że ΔFosB zmniejsza przywrócenie (rysunek (Figure3G) .3G). Odpowiadanie na dawkę 10 mg / kg było znacznie niższe dla szczurów eksprymujących ΔFosB. Wyniki jako całość wskazują, że nadekspresja ΔFosB w powłoce szczurzej NAc zmniejsza przyjmowanie kokainy i poszukiwanie zachowania, co jest zgodne z behawioralnymi skutkami wzbogacenia środowiska.

Dyskusja

Na podatność osób na uzależnienie i depresję duży wpływ mają czynniki środowiskowe. Wzbogacenie środowiska jest paradygmatem, który manipuluje środowiskiem życia zwierząt, wywołując efekty ochronne przeciwko wielu stanom psychicznym. ΔFosB odgrywa kluczową rolę w regulacji funkcji nagrody w wielu regionach mózgu, w tym w NAc i prążkowiu grzbietowym (Koob i in., 1998; Mądry, 1998; Wallace i inni, 2008; Grueter i in., 2013; Pitchers i in., 2013). W ramach tego projektu badaliśmy dynamiczną regulację ΔFosB przez stres ograniczający i kokainę u szczurów wzbogaconych i izolowanych. Główne ustalenia tego projektu to:

(1) Szczury EC miały podwyższone poziomy ΔFosB w NAc na początku badania w porównaniu ze szczurami IC;

(2) tylko szczury IC gromadzą dodatkowe białko ΔFosB z powtarzającym się stresem;

(3) szczury EC wykazują osłabioną indukcję mRNA ΔFosB po stresie lub kokainie; i

(4) nadekspresja ΔFosB w NAc szczurów trzymanych w parach naśladuje fenotyp ochronnego uzależnienia, ale nie fenotyp ochronnej depresji.

Można się spodziewać na podstawie opublikowanej literatury, która pokazuje, że transgeniczne myszy z nadekspresją ΔFosB wykazują zwiększoną wrażliwość na nagrodę kokainową i samopodawanie w niskich dawkach leku (Kelz i in., 1999; Colby i in., 2003; Vialou i in., 2010; Robison i in., 2013), że szczury z nadekspresją ΔFosB w obecnym eksperymencie wykazywałyby zwiększoną skłonność do samodzielnego podawania i poszukiwania kokainy. IJednak w obecnych eksperymentach nadekspresja ΔFosB w powłoce NAc zmniejszyła spożycie kokainy i poszukiwanie kokainy podczas wyginięcia i przywrócenia, co wskazuje na zmniejszoną motywację do kokainy. Rozbieżność może wynikać z faktu, że transgeniczne myszy wyrażały ΔFosB w całym prążkowiu, ale tylko w komórkach dynorphin + (Colby i in., 2003). W obecnym eksperymencie ΔFosB nadeksprymowano przez wektor AAV, który infekuje neurony dynorphin + i enkefalin +. Po drugie, obecne badanie skupiło się raczej na skorupie NAc niż na całym regionie prążkowia.

Oprócz fenotypu uzależnienia wzbogacenie środowiska wywołuje u szczurów profile przeciwdepresyjne i podobne do lęku (Green i in., 2010; Vialou i in., 2010). W obecnym badaniu nadekspresja ΔFosB w NAc nie przyniosła efektów w żadnej z trzech depresji lub trzech testów lękowych. Chociaż istnieje wiele możliwych czynników, które mogą przyczynić się do ΔFosB naśladujących uzależnienie od wzbogacania, ale nie fenotyp depresji, możliwe jest, że powłoka NAc jest bardziej dominująca w zachowaniach związanych z uzależnieniem, podczas gdy zachowania związane z depresją mogą być bardziej odporne na inne regiony. Obecne odkrycia są sprzeczne z badaniami w Myszy gdzie nadekspresja ΔFosB w NAc (gdzie nie można wiarygodnie odróżnić powłoki od rdzenia) wywołała silne efekty podobne do antydepresyjnych w kilku testach behawioralnych (Vialou i in., 2010). Jedną z możliwych przyczyn jest to, że łatwiej jest zobaczyć wpływ ΔFosB na ciężkie stresowe modele behawioralne, takie jak stres społeczny. W bieżącym badaniu nadekspresji badano zachowanie podobne do depresji przy braku ciężkiego stresora.

Konsekwentnie w trakcie tego badania, wysokie podstawowe poziomy ΔFosB (np. Z wzbogacenia, powtarzanego stresu lub kokainy) korelowały ze słabszą późniejszą indukcją ΔFosB. Może to stanowić efekt pułapowy, bez dalszej indukcji poza podwyższonymi poziomami podstawowymi białka. Możliwe jest również, że skumulowane poziomy ΔFosB mogą sprzężyć zwrotnie, hamując dalszą indukcję mRNA ΔFosB po stresie lub kokainie jako pętli ujemnego sprzężenia zwrotnego. Na przykład, ESzczury C miały wysokie poziomy ΔFosB i wykazywały osłabioną indukcję ΔFosB po stresie lub kokainie. Podkreśla to ujemną korelację między poziomami białka ΔFosB i jego indukcją mRNA. Negatywne sprzężenie zwrotne ΔFosB odpowiada również za osłabioną indukcję ΔFosB z powtarzającym się stresem u szczurów IC.

Żeby było jasne, nie twierdzimy, że paradygmat wzbogacania środowiska ma bezpośrednie znaczenie translacyjne, ponieważ bardzo niewiele dzieci wychowuje się w prawdziwym ubóstwie (należy zauważyć, że deprywacja społeczno-ekonomiczna nie oznacza deprywacji środowiskowej). Użyteczność tego paradygmatu polega na tym, że jest to nielekowa, niechirurgiczna, niegenetyczna manipulacja, która wytwarza ochronne fenotypy behawioralne dla uzależnienia i depresji, które można wykorzystać w środowisku kontrolowanym przez laboratorium jako podstawowe narzędzie naukowe do identyfikacji mechanizmów molekularnych podstawowa odporność na choroby psychiczne. Wcześniejsze badania szczegółowo opisywały fenotypy behawioralne (Bowling i in., 1993; Bowling and Bardo, 1994; Bardo i in., 1995; Green i in., 2002, 2003; El Rawas i in., 2009) i nowsze badania (Solinas i in., 2009; Green i in., 2010; Lobo i in., 2013), wraz z obecnym badaniem, dostarczają wskazówek co do mechanizmów transkrypcyjnych leżących u podstaw tych fenotypów behawioralnych. Dalsze docelowe geny transkrypcyjne / białka wytwarzające fenotypy ochronne są obecnie badane (Fan i in., 2013,b; Lichti i in., 2014).

Nasza konceptualizacja wzbogacania środowiska polega na tym, że wzbogacenie jest kontinuum z izolacją na najniższym poziomie i pełnym wzbogaceniem na wysokim poziomie. „Pełne ”wzbogacenie w tym przypadku definiuje się jako środowisko, w którym badani są narażeni na nowości, nie zagrażające kontakty społeczne z konspecjalistami, i są dozwolone miejsce i przedmioty do ćwiczeń. Twszystkie trzy czynniki reprezentują złożony warunek „wzbogacenia”, ponieważ każda z nich nagradza i każda uwalnia dopaminę w NAc, i jako taka aktywuje wspólne obwody neurobiologiczne (Louilot i in., 1986; Calcagnetti i Schechter, 1992; Crowder and Hutto, 1992; Rebec i in., 1997; Bevins i in., 2002). W tej konceptualizacji izolację uważa się za grupę kontrolną, ponieważ reprezentuje ona brak manipulacji (tj. Wzbogacenie; Crofton i in., W przeglądzie). Możliwe są jednak inne konceptualizacje. W jednej alternatywnej konceptualizacji kontinuum jest takie samo, ale grupa izolacji jest grupą eksperymentalną, a grupa wzbogacona jest kontrolą. jan tego modelu, pozbawiając podmioty normalnego wzbogacenia is rzeczywista manipulacja. IW tym przypadku zamiast twierdzić, że wzbogacanie jest ochronne, można powiedzieć, że izolacja nadaje podatność. Trzecia konceptualizacja zakłada, że ​​nie ma kontinuum, a wzbogacenie i izolacja to dwie zasadniczo różne manipulacje. W tym widoku wzbogacenie i izolacja powinny być oddzielone i oba w porównaniu z kontrolą z parą. Brak powszechnego konsensusu co do natury wzbogacenia stanowi ograniczenie paradygmatu, ale zapewnia kierunek dla przyszłych badań. Niezależnie od tego, wyniki tych eksperymentów są mocne niezależnie od późniejszej interpretacji.

Środowisko i doświadczenia życiowe mają silny wpływ na rozwój i ekspresję wielu stanów psychicznych. Zrozumienie mechanizmu uzależnienia ochronnego i fenotypów depresji wzbogacania środowiska dotyczy fundamentalnego pytania w badaniach zaburzeń psychicznych - mianowicie wkładu środowiskowego w podatność lub odporność na warunki psychiatryczne. Niniejsze badanie podkreśla znaczenie ΔFosB w regulowaniu zachowań związanych z uzależnieniami. W przyszłych badaniach działanie ΔFosB i jego działanie aktywujące i hamujące na określone geny docelowe muszą być dalej badane w ramach modelu wzbogacania środowiska.

Finansowanie i ujawnianie

Yafang Zhang, żaden; Elizabeth J. Crofton, brak; Dingge Li, żaden; Mary Kay Lobo, żadna; Xiuzhen Fan, brak; Eric J. Nestler, R37DA007359; Thomas A. Green, DA029091.

Oświadczenie o konflikcie interesów

Autorzy oświadczają, że badanie zostało przeprowadzone przy braku jakichkolwiek powiązań handlowych lub finansowych, które mogłyby być interpretowane jako potencjalny konflikt interesów.

Podziękowanie

Eksperymenty te zostały sfinansowane z grantu National Institute on Drug Abuse, DA029091 i R37DA007359. Kokaina dostarczona przez National Institute on Drug Abuse.

Referencje

  1. Akdeniz C., Tost H., Meyer-Lindenberg A. (2014). Neurobiologia społecznego ryzyka środowiskowego dla schizofrenii: ewoluująca dziedzina badań. Soc. Psychiatria Psychiatr. Epidemiol. 49, 507 – 517 10.1007 / s00127-014-0858-4 [PubMed] [Cross Ref]
  2. Alibhai IN, Green TA, Potashkin JA, Nestler EJ (2007). Regulacja ekspresji mRNA fosB i DeltafosB: badania in vivo i in vitro. Brain Res. 1143, 22 – 33 10.1016 / j.brainres.2007.01.069 [Artykuł bezpłatny PMC] [PubMed] [Cross Ref]
  3. Bardo MT, Bowling SL, Rowlett JK, Manderscheid P., Buxton ST, Dwoskin LP (1995). Wzbogacenie środowiska osłabia uczulenie narządu ruchu, ale nie uwalnianie dopaminy in vitro indukowane przez amfetaminę. Pharmacol. Biochem. Behav. 51, 397 – 405 10.1016 / 0091-3057 (94) 00413-d [PubMed] [Cross Ref]
  4. Bevins RA, Besheer J., Palmatier MI, Jensen HC, Pickett KS, Eurek S. (2002). Kondycjonowanie miejsca nowego obiektu: procesy behawioralne i dopaminergiczne w ekspresji nagrody nowości. Behav. Brain Res. 129, 41 – 50 10.1016 / s0166-4328 (01) 00326-6 [PubMed] [Cross Ref]
  5. Bowling SL, Bardo MT (1994). Lokomotoryczne i nagradzające działanie amfetaminy w wzbogaconych, społecznych i izolowanych szczurach hodowanych. Pharmacol. Biochem. Behav. 48, 459 – 464 10.1016 / 0091-3057 (94) 90553-3 [PubMed] [Cross Ref]
  6. Bowling SL, Rowlett JK, Bardo MT (1993). Wpływ wzbogacenia środowiska na stymulowaną amfetaminą aktywność ruchową, syntezę dopaminy i uwalnianie dopaminy. Neuropharmacology 32, 885 – 893 10.1016 / 0028-3908 (93) 90144-r [PubMed] [Cross Ref]
  7. Calcagnetti DJ, Schechter MD (1992). Kondycjonowanie miejsca ujawnia satysfakcjonujący aspekt interakcji społecznych u młodych szczurów. Physiol. Behav. 51, 667 – 672 10.1016 / 0031-9384 (92) 90101-7 [PubMed] [Cross Ref]
  8. Chen J., Nye HE, Kelz MB, Hiroi N., Nakabeppu Y., Hope BT, et al. (1995). Regulacja delta FosB i białek podobnych do FosB za pomocą napadów drgawkowych i kokainy. Mol. Pharmacol. 48, 880 – 889 [PubMed]
  9. Colby CR, Whisler K., Steffen C., Nestler EJ, Self DW (2003). Nadekspresja DeltaFosB specyficzna dla komórek prążkowia zwiększa zachętę do kokainy. J. Neurosci. 23, 2488 – 2493 [PubMed]
  10. Crowder WF, Hutto CW (1992). Środki kondycjonujące miejsce operacyjne badane za pomocą dwóch wzmacniaczy nielekowych. Pharmacol. Biochem. Behav. 41, 817 – 824 10.1016 / 0091-3057 (92) 90233-6 [PubMed] [Cross Ref]
  11. Elisei S., Sciarma T., Verdolini N., Anastasi S. (2013). Odporność i zaburzenia depresyjne. Psychiatr. Danub. 25 (Suppl. 2), S263 – S267 [PubMed]
  12. El Rawas R., Thiriet N., Lardeux V., Jaber M., Solinas M. (2009). Wzbogacenie środowiska zmniejsza korzyści, ale nie aktywizujące działanie heroiny. Psychopharmacology (Berl) 203, 561 – 570 10.1007 / s00213-008-1402-6 [PubMed] [Cross Ref]
  13. Fan X., Li D., Lichti CF, Green TA (2013a). Dynamiczna proteomika jądra półleżącego w odpowiedzi na ostry stres psychologiczny u szczurów wzbogaconych w środowisko i izolowanych. PLoS One 8: e73689 10.1371 / journal.pone.0073689 [Artykuł bezpłatny PMC] [PubMed] [Cross Ref]
  14. Fan X., Li D., Zhang Y., Green TA (2013b). Różnicowa regulacja fosfoproteomów półleżących jądra u szczurów wzbogaconych w środowisko i izolowanych w odpowiedzi na ostry stres. PLoS One 8: e79893 10.1371 / journal.pone.0079893 [Artykuł bezpłatny PMC] [PubMed] [Cross Ref]
  15. Green TA, Alibhai IN, Hommel JD, Dileone RJ, Kumar A., ​​Theobald DE, et al. (2006). Indukcja indukowanej cAMP wczesna ekspresja represora w jądrze półleżącym przez stres lub amfetamina zwiększa reakcje behawioralne na bodźce emocjonalne. J. Neurosci. 26, 8235 – 8242 10.1523 / jneurosci.0880-06.2006 [PubMed] [Cross Ref]
  16. Green TA, Alibhai IN, Roybal CN, Winstanley CA, Theobald DE, Birnbaum SG, et al. (2010). Wzbogacenie środowiska wywołuje fenotyp behawioralny, w którym pośredniczy aktywność wiązania cyklicznego elementu odpowiedzi monofosforanu adenozyny (CREB) w jądrze półleżącym. Biol. Psychiatria 67, 28 – 35 10.1016 / j.biopsych.2009.06.022 [Artykuł bezpłatny PMC] [PubMed] [Cross Ref]
  17. Green TA, Alibhai IN, Unterberg S., Neve RL, Ghose S., Tamminga CA, i in. (2008). Indukcja aktywujących czynników transkrypcyjnych (ATF) ATF2, ATF3 i ATF4 w jądrze półleżącym i ich regulacja zachowania emocjonalnego. J. Neurosci. 28, 2025 – 2032 10.1523 / jneurosci.5273-07.2008 [PubMed] [Cross Ref]
  18. Green TA, Cain ME, Thompson M., Bardo MT (2003). Wzbogacenie środowiska zmniejsza nadmierną aktywność nikotyny u szczurów. Psychopharmacology (Berl) 170, 235 – 241 10.1007 / s00213-003-1538-3 [PubMed] [Cross Ref]
  19. Green TA, Gehrke BJ, Bardo MT (2002). Wzbogacenie środowiska obniża dożylne podawanie samców amfetaminy u szczurów: funkcje odpowiedzi na dawkę dla schematów o stałym i progresywnym stosunku. Psychopharmacology (Berl) 162, 373 – 378 10.1007 / s00213-002-1134-y [PubMed] [Cross Ref]
  20. Grueter BA, Robison AJ, Neve RL, Nestler EJ, Malenka RC (2013). ΔFosB moduluje różnicowo funkcję jądra półleżącego bezpośrednio i pośrednio. Proc. Natl. Acad. Sci. USA 110, 1923 – 1928 10.1073 / pnas.1221742110 [Artykuł bezpłatny PMC] [PubMed] [Cross Ref]
  21. Hope B., Kosofsky B., Hyman SE, Nestler EJ (1992). Regulacja natychmiastowej wczesnej ekspresji genu i wiązanie AP-1 w jądrze szczura accumbens przez chroniczną kokainę. Proc. Natl. Acad. Sci. USA 89, 5764 – 5768 10.1073 / pnas.89.13.5764 [Artykuł bezpłatny PMC] [PubMed] [Cross Ref]
  22. Hope BT, Nye HE, Kelz MB, Self DW, Iadarola MJ, Nakabeppu Y., et al. (1994). Indukcja długotrwałego kompleksu AP-1 złożonego ze zmienionych białek podobnych do Fos w mózgu przez przewlekłe leczenie kokainą i innymi przewlekłymi metodami. Neuron 13, 1235 – 1244 10.1016 / 0896-6273 (94) 90061-2 [PubMed] [Cross Ref]
  23. Jha S., Dong B., Sakata K. (2011). Zabieg wzbogacony w środowisko odwraca zachowanie przypominające depresję i przywraca zmniejszoną neurogenezę hipokampa i poziomy białka czynnika neurotroficznego pochodzącego z mózgu u myszy pozbawionych ekspresji przez promotor IV. Przeł. Psychiatria 1: e40 10.1038 / tp.2011.33 [Artykuł bezpłatny PMC] [PubMed] [Cross Ref]
  24. Kato T., Iwamoto K. (2014). Kompleksowa metylacja DNA i analiza hydroksymetylacji w ludzkim mózgu i jej wpływ na zaburzenia psychiczne. Neuropharmacology 80, 133 – 139 10.1016 / j.neuropharm.2013.12.019 [PubMed] [Cross Ref]
  25. Kelz MB, Chen J., Carlezon WA, Whisler K., Gilden L., Beckmann AM, et al. (1999). Ekspresja czynnika transkrypcyjnego deltaFosB w mózgu kontroluje wrażliwość na kokainę. Nature 401, 272 – 276 10.1038 / 45790 [PubMed] [Cross Ref]
  26. Kelz MB, Nestler EJ (2000). deltaFosB: przełącznik molekularny leżący u podstaw długoterminowej plastyczności neuronów. Curr. Opin. Neurol. 13, 715 – 720 10.1097 / 00019052-200012000-00017 [PubMed] [Cross Ref]
  27. Koob GF, Sanna PP, Bloom FE (1998). Neurobiologia uzależnienia. Neuron 21, 467 – 476 [PubMed]
  28. Larson EB, Graham DL, Arzaga RR, Buzin N., Webb J., Green TA, et al. (2011). Nadekspresja CREB w skorupie jądra półleżącego zwiększa wzmocnienie kokainy u samopodobnych szczurów. J. Neurosci. 31, 16447 – 16457 10.1523 / JNEUROSCI.3070-11.2011 [Artykuł bezpłatny PMC] [PubMed] [Cross Ref]
  29. Laviola G., Hannan AJ, Macrì S., Solinas M., Jaber M. (2008). Wpływ wzbogaconego środowiska na modele zwierzęce chorób neurodegeneracyjnych i zaburzeń psychicznych. Neurobiol. Dis. 31, 159 – 168 10.1016 / j.nbd.2008.05.001 [PubMed] [Cross Ref]
  30. Lichti CF, Fan X., angielski RD, Zhang Y., Li D., Kong F., et al. (2014). Wzbogacenie środowiska zmienia ekspresję białka, jak również odpowiedź proteomiczną na kokainę w jądrze półleżącym szczura. Z przodu. Behav. Neurosci. 8: 246 10.3389 / fnbeh.2014.00246 [Artykuł bezpłatny PMC] [PubMed] [Cross Ref]
  31. Lobo MK, Zaman S., Damez-Werno DM, Koo JW, Bagot RC, Dinieri JA, et al. (2013). Indukcja ΔFosB w podtypach kolczastego neuronu prążkowia w odpowiedzi na przewlekłe bodźce farmakologiczne, emocjonalne i optogenetyczne. J. Neurosci. 33, 18381 – 18395 10.1523 / JNEUROSCI.1875-13.2013 [Artykuł bezpłatny PMC] [PubMed] [Cross Ref]
  32. Louilot A., Le Moal M., Simon H. (1986). Różnicowa reaktywność neuronów dopaminergicznych w jądrze półleżącym w odpowiedzi na różne sytuacje behawioralne. Badanie woltamperometryczne in vivo na swobodnie poruszających się szczurach. Brain Res. 397, 395 – 400 10.1016 / 0006-8993 (86) 90646-3 [PubMed] [Cross Ref]
  33. McBride WJ, Kimpel MW, Mcclintick JN, Ding ZM, Edenberg HJ, Liang T., et al. (2014). Zmiany w ekspresji genów w rozszerzonym ciele migdałowatym po piciu alkoholu podobnego do binge przez młodzież szczurów preferujących alkohol (P). Pharmacol. Biochem. Behav. 117, 52 – 60 10.1016 / j.pbb.2013.12.009 [Artykuł bezpłatny PMC] [PubMed] [Cross Ref]
  34. Mlynarik M., Johansson BB, Jezova D. (2004). Wzbogacone środowisko wpływa na odpowiedź kory nadnerczy na prowokację immunologiczną i ekspresję genu receptora glutaminianu w hipokampie szczura. Ann. NY Acad. Sci. 1018, 273 – 280 10.1196 / annals.1296.032 [PubMed] [Cross Ref]
  35. Nestler EJ (2001). Neurobiologia molekularna uzależnienia. Rano. J. Addict. 10, 201 – 217 10.1080 / 105504901750532094 [PubMed] [Cross Ref]
  36. Nestler EJ (2008). Przejrzeć. Transkrypcyjne mechanizmy uzależnienia: rola DeltaFosB. Philos. Trans. R. Soc. Lond. B Biol. Sci. 363, 3245 – 3255 10.1098 / rstb.2008.0067 [Artykuł bezpłatny PMC] [PubMed] [Cross Ref]
  37. Nestler EJ, Barrot M., Self DW (2001). DeltaFosB: trwały molekularny przełącznik uzależnienia. Proc. Natl. Acad. Sci. USA 98, 11042 – 11046 10.1073 / pnas.191352698 [Artykuł bezpłatny PMC] [PubMed] [Cross Ref]
  38. Perrotti LI, Hadeishi Y., Ulery PG, Barrot M., Monteggia L., Duman RS i in. (2004). Indukcja deltaFosB w strukturach mózgu związanych z nagrodą po przewlekłym stresie. J. Neurosci. 24, 10594 – 10602 10.1523 / jneurosci.2542-04.2004 [PubMed] [Cross Ref]
  39. Perrotti LI, Weaver RR, Robison B., Renthal W., Maze I., Yazdani S., et al. (2008). Wyraźne wzory indukcji DeltaFosB w mózgu przez narkotyki. Synapse 62, 358 – 369 10.1002 / syn.20500 [Artykuł bezpłatny PMC] [PubMed] [Cross Ref]
  40. Dzbanki KK, Vialou V., Nestler EJ, Laviolette SR, Lehman MN, Coolen LM (2013). Nagroda naturalna i lekowa działa na wspólne mechanizmy plastyczności nerwów z ΔFosB jako kluczowym mediatorem. J. Neurosci. 33, 3434 – 3442 10.1523 / jneurosci.4881-12.2013 [Artykuł bezpłatny PMC] [PubMed] [Cross Ref]
  41. Rebec GV, Christensen JR, Guerra C., Bardo MT (1997). Regionalne i czasowe różnice w wypływie dopaminy w czasie rzeczywistym w jądrze półleżącym podczas nowości wolnego wyboru. Brain Res. 776, 61 – 67 10.1016 / s0006-8993 (97) 01004-4 [PubMed] [Cross Ref]
  42. Robison AJ, Vialou V., Mazei-Robison M., Feng J., Kourrich S., Collins M., et al. (2013). Zachowawcze i strukturalne odpowiedzi na przewlekłą kokainę wymagają pętli sprzężenia zwrotnego obejmującej ΔFosB i zależną od wapnia / kalmoduliny kinazę białkową II w jądrze półleżącym. J. Neurosci. 33, 4295 – 4307 10.1523 / jneurosci.5192-12.2013 [Artykuł bezpłatny PMC] [PubMed] [Cross Ref]
  43. Smith JK, Neill JC, Costall B. (1997). Warunki mieszkaniowe po odsadzeniu wpływają na behawioralne skutki kokainy i d-amfetaminy. Psychopharmacology (Berl) 131, 23 – 33 10.1007 / s002130050261 [PubMed] [Cross Ref]
  44. Solinas M., Chauvet C., Thiriet N., El Rawas R., Jaber M. (2008). Odwrócenie uzależnienia od kokainy przez wzbogacenie środowiska. Proc. Natl. Acad. Sci. USA 105, 17145 – 17150 10.1073 / pnas.0806889105 [Artykuł bezpłatny PMC] [PubMed] [Cross Ref]
  45. Solinas M., Thiriet N., El Rawas R., Lardeux V., Jaber M. (2009). Wzbogacanie środowiska we wczesnych etapach życia zmniejsza behawioralne, neurochemiczne i molekularne skutki kokainy. Neuropsychofarmakologia 34, 1102 – 1111 10.1038 / npp.2008.51 [PubMed] [Cross Ref]
  46. Schody DJ, Prendergast MA, Bardo MT (2011). Wywołane przez środowisko naturalne różnice w blokowaniu przez kortykosteron i receptor glikokortykosteroidowy amfetaminy u szczurów. Psychopharmacology (Berl) 218, 293 – 301 10.1007 / s00213-011-2448-4 [Artykuł bezpłatny PMC] [PubMed] [Cross Ref]
  47. Thiel KJ, Pentkowski NS, Peartree NA, Painter MR, Neisewander JL (2010). Środowiskowe warunki życia wprowadzone podczas wymuszonej abstynencji zmieniają zachowanie poszukiwania kokainy i ekspresję białka Fos. Neuroscience 171, 1187 – 1196 10.1016 / j.neuroscience.2010.10.001 [Artykuł bezpłatny PMC] [PubMed] [Cross Ref]
  48. Thiel KJ, Sanabria F., Pentkowski NS, Neisewander JL (2009). Przeciwzapalne efekty wzbogacania środowiska. Int. J. Neuropsychopharmacol. 12, 1151 – 1156 10.1017 / s1461145709990472 [Artykuł bezpłatny PMC] [PubMed] [Cross Ref]
  49. van Winkel M., Peeters F., Van Winkel R., Kenis G., Collip D., Geschwind N., et al. (2014). Wpływ zmienności genu BDNF na wrażliwość na stres społeczny i wpływ buforowania pozytywnych emocji: replikacja i rozszerzenie interakcji gen-środowisko. Eur. Neuropsychofarmakol. 24, 930 – 938 10.1016 / j.euroneuro.2014.02.005 [PubMed] [Cross Ref]
  50. Venebra-Muñoz A., Corona-Morales A., Santiago-García J., Melgarejo-Gutiérrez M., Caba M., García-García F. (2014). Wzbogacone środowisko osłabia samopodawanie nikotyny i indukuje zmiany w ekspresji ΔFosB w korze przedczołowej szczura i jądrze półleżącym. Neuroreport 25, 694 – 698 10.1097 / wnr.0000000000000157 [PubMed] [Cross Ref]
  51. Vialou V., Robison AJ, Laplant QC, Covington HE, Dietz DM, Ohnishi YN i in. (2010). DeltaFosB w obwodach nagrody mózgowej pośredniczy w odporności na stres i odpowiedzi przeciwdepresyjne. Nat. Neurosci. 13, 745 – 752 10.1038 / nn.2551 [Artykuł bezpłatny PMC] [PubMed] [Cross Ref]
  52. Wallace DL, Vialou V., Rios L., Carle-Florence TL, Chakravarty S., Kumar A., ​​et al. (2008). Wpływ DeltaFosB w jądrze zalega na zachowania związane z nagrodami naturalnymi. J. Neurosci. 28, 10272 – 10277 10.1523 / jneurosci.1531-08.2008 [Artykuł bezpłatny PMC] [PubMed] [Cross Ref]
  53. Wang Y., Cesena TI, Ohnishi Y., Burger-Caplan R., Lam V., Kirchhoff PD, et al. (2012). Badanie przesiewowe małych cząsteczek identyfikuje regulatory czynnika transkrypcji ΔFosB. ACS Chem. Neurosci. 3, 546 – 556 10.1021 / cn3000235 [Artykuł bezpłatny PMC] [PubMed] [Cross Ref]
  54. Werme M., Messer C., Olson L., Gilden L., Thorén P., Nestler EJ, et al. (2002). Delta FosB reguluje pracę kół. J. Neurosci. 22, 8133 – 8138 [PubMed]
  55. Winstanley CA, Bachtell RK, Theobald DE, Laali S., Green TA, Kumar A., ​​et al. (2009a). Zwiększona impulsywność podczas odstawiania kokainy z samopodawania: rola DeltaFosB w korze oczodołowo-czołowej. Cereb. Cortex 19, 435 – 444 10.1093 / cercor / bhn094 [Artykuł bezpłatny PMC] [PubMed] [Cross Ref]
  56. Winstanley CA, Green TA, Theobald DE, Renthal W., LaPlant Q., DiLeone RJ, et al. (2009b). Indukcja DeltaFosB w korze oczodołowo-czołowej nasila uczulenie narządu ruchu, pomimo osłabienia zaburzeń funkcji poznawczych powodowanych przez kokainę. Pharmacol. Biochem. Behav. 93, 278 – 284 10.1016 / j.pbb.2008.12.007 [Artykuł bezpłatny PMC] [PubMed] [Cross Ref]
  57. Winstanley CA, LaPlant Q., Theobald DE, Green TA, Bachtell RK, Perrotti LI, et al. (2007). Indukcja DeltaFosB w korze oczodołowo-czołowej pośredniczy w tolerancji na indukowane kokainą zaburzenia poznawcze. J. Neurosci. 27, 10497 – 10507 10.1523 / jneurosci.2566-07.2007 [PubMed] [Cross Ref]
  • Wise RA (1998). Aktywacja leków ścieżek nagrody w mózgu. Uzależnienie od alkoholu uzależnionego od narkotyków 51, 13 – 22 10.1016 / s0376-8716 (98) 00063-5 [PubMed] [Cross Ref]