Regulacja stabilności DeltaFosB przez fosforylację (2006)

J Neurosci. 2006 May 10;26(19):5131-42.

Ulery PG, Rudenko G, Nestler EJ.

Źródło

Katedra Psychiatrii, Centrum Podstawowej Neurologii, Uniwersytet Teksasu Południowo-Zachodnie Centrum Medyczne, Dallas, Teksas 75390-9070, USA.

Abstrakcyjny

Czynnik transkrypcyjny DeltaFosB (określany również jako FosB2 lub FosB [forma krótka]) jest ważnym mediatorem długoterminowej plastyczności indukowanej w mózgu przez przewlekłą ekspozycję na kilka rodzajów bodźców psychoaktywnych, w tym nadużywanie, stres i napady drgawkowe . Wyraźną cechą DeltaFosB jest to, że po indukcji utrzymuje się w mózgu przez stosunkowo długie okresy czasu przy braku dalszej stymulacji. Mechanizmy leżące u podstaw tej pozornej stabilności pozostają jednak nieznane. Tutaj pokazujemy, że DeltaFosB jest względnie stabilnym czynnikiem transkrypcyjnym, z okresem półtrwania wynoszącym w przybliżeniu 10 hw hodowli komórkowej. Ponadto pokazujemy, że DeltaFosB jest fosfoproteiną w mózgu i że fosforylacja wysoce konserwowanej reszty seryny (Ser27) w DeltaFosB chroni ją przed degradacją proteasomalną. Udostępniamy kilka linii dowodów sugerujących, że w tej fosforylacji pośredniczy kinaza kazeinowa 2. Odkrycia te stanowią pierwszy dowód na to, że DeltaFosB jest fosforylowany i wykazują, że fosforylacja przyczynia się do jego stabilności, która jest podstawą jego zdolności do pośredniczenia w długotrwałych adaptacjach w mózgu.

Wprowadzenie

Czynnik transkrypcyjny ΔFosB, również oznaczony FosB2 lub FosB [forma krótka], jest skróconym wariantem C-końca skróconego wczesnego genu fosb (Dobrazanski i in., 1991; Nakabeppu i Nathans, 1991; Yen i wsp., 1991). Podobnie jak FosB pełnej długości, ΔFosB ma domenę podstawową wiążącą DNA i suwak leucynowy, przez który dimeryzuje z białkami Jun, tworząc aktywator białkowo-1 (AP-1) kompleksy czynników transkrypcyjnych, które regulują ekspresję wielu genów (Morgan i Curran, 1995; Rylski i Kaczmarek, 2004). Pomimo braku części domeny transaktywacyjnej znajdującej się na C-końcu FosB, ΔFosB działa zarówno jako silny aktywator transkrypcji i represor w hodowanych komórkach, jak iw mózgu (Dobrazanski i in., 1991; Nakabeppu i Nathans, 1991; Chen i wsp., 1997; McClung i Nestler, 2003; Kumar i wsp., 2005).

ΔFosB jest indukowany do wysokiego poziomu w sposób specyficzny dla regionu w mózgu po przewlekłej, ale nie ostrej ekspozycji na różne bodźce psychoaktywne, w tym stres, niektóre zmiany chorobowe, leki przeciwpsychotyczne i przeciwdepresyjne, narkotyki i naturalne nagrody (Hope i in., 1994b; Hiroi i Graybiel, 1996; Moratalla i wsp., 1996; Bing i in., 1997; Mandelzys i in., 1997; Kelz i wsp., 1999; Werme i wsp., 2002; Andersson i in., 2003; Colby i wsp., 2003; Peakman i wsp., 2003; Perrotti i wsp., 2004; Zachariou i wsp., 2006). Indukcja ΔFosB była związana bezpośrednio z funkcjonalnym wpływem kilku z tych bodźców na mózg. Utrzymywanie się ΔFosB nawet przy braku dodatkowej stymulacji odróżnia go od wszystkich innych czynników transkrypcyjnych z rodziny Fos, które są indukowane szybko w odpowiedzi na ostre bodźce, rozpadają się z powrotem do poziomów podstawowych w ciągu kilku godzin i ogólnie wykazują odczulanie po przewlekłej stymulacji (Hope i wsp., 1992; Daunais i in., 1993; Persico i in., 1993; Hiroi i Graybiel, 1996; Perrotti i wsp., 2004). Czyni to ΔFosB atrakcyjnym kandydatem do pośredniczenia w niektórych długotrwałych zmianach w ekspresji genów, które leżą u podstaw stabilnych adaptacji neuronalnych spowodowanych przez pewne przewlekłe bodźce.

Ponieważ przedłużona obecność ΔFosB występuje przy braku dalszej indukcji jej mRNA (Chen i wsp., 1995) spekulowaliśmy, że w przeciwieństwie do pełnej długości FosB i wszystkich innych białek z rodziny Fos, które są wewnętrznie niestabilne, ΔFosB może być niezwykle stabilnym czynnikiem transkrypcyjnym (Hope i in., 1994b; Chen i wsp., 1997; Nestler i wsp., 2001; McClung i wsp., 2004). Ponadto analiza immunoblottingu tkanki mózgowej ostrej i przewlekłej stymulowanej sugerowała, że ​​ΔFosB przesuwa się w sposób widoczny Mr (masa cząsteczkowa) z N33 kDa w stanie ostrym do ∼35 – 37 kDa podczas leczenia przewlekłego (Hope i in., 1994a; Chen i wsp., 1995). Ponieważ nie ma dowodów na istnienie dodatkowych mRNA, które mogłyby kodować te różne izoformy, spekulowaliśmy dalej, że ΔFosB jest modyfikowany potranslacyjnie i być może to przyczynia się do jego niezwykłej stabilności. Do tej pory nie odnotowano jednak żadnych analiz biochemicznych obrotu lub modyfikacji potranslacyjnych ΔFosB. Celem niniejszego badania było określenie, czy ΔFosB jest fosfoproteiną i czy fosforylacja odgrywa rolę w jej stabilności.

Poprzednia sekcjaNastępny rozdział

Materiały i Metody

Linie komórkowe ssaków i konstrukty DNA.

Komórki PC12 (Clontech, Mountainview, CA) hodowano w wysoko glukozowej pożywce DMEM zawierającej l-glutaminę (L-Gln) i uzupełniono 5% płodową surowicą bydlęcą (FBS), 10% surowicą końską (obie z Invitrogen, Carlsbad, CA) , 100 U / ml penicyliny i 100 μg / ml streptomycyny (obie z Sigma-Aldrich, St. Louis, MO). Komórki HeLa (American Type Culture Collection, Manassas, VA) hodowano w wysoko glukozowej pożywce DMEM zawierającej L-Gln i uzupełniono 10% FBS, penicyliną i streptomycyną. Obie linie komórkowe utrzymywano w 37 ° C w wilgotnym 5% CO2 atmosfera.

W celu przejściowych transfekcji DNA, komórki PC12 lub HeLa wysiano na płytki sześciostudzienkowe (pokryte kolagenem I dla komórek PC12), tak aby następnego dnia osiągnąć 90-100% konfluencji, a następnie transfekowano przy użyciu Lipofectamine 2000 (Invitrogen). W niektórych eksperymentach (patrz Ryc. 1-7), ΔFosB był przejściowo wyrażany w komórkach PC12 przez zakażenie rekombinowanym wirusem opryszczki pospolitej (HSV).

CDNA ΔFosB i FosB otrzymano z naszych własnych konstruktów pTetop (Chen i wsp., 1997) i subklonuje do wektora pcDNA3.1 (Invitrogen). Te konstrukty pcDNA3.1-ΔFosB / FosB zastosowano do ekspresji w komórkach ssaków i jako matrycę do ukierunkowanej mutagenezy. Rekombinowaną HSV-ΔFosB przygotowano jak opisano wcześniej (Neve i in., 1997), a preparat miał miano ∼1 × 108 pfu / ml.

Eksperymenty pościgowe.

W przybliżeniu 24 h po infekcji / transfekcji, komórki (PC12 lub HeLa) w sześciostudzienkowych płytkach przemyto dwa do trzech razy 2 ml PBS i inkubowano w 37 ° C dla ∼1 h w 2 ml DMEM bez metanu (Invitrogen) uzupełniony 5% dializował FBS (Hyclone, Logan, UT) w celu wyczerpania wewnątrzkomórkowych puli Met i Cys. Pod koniec tego okresu „głodu” dodano leki (jeśli komórki miały być leczone) i komórki oznaczono (puls) 12 – 25 μCi z 35S Protein Labeling Mix (PerkinElmer, Wellesley, MA) dla ∼1 h w 37 ° C do oznaczenia wszystkich nowo zsyntetyzowanych białek. Znacznik promieniotwórczy usunięto następnie przez przemycie komórek dwa do trzech razy 2 ml PBS i 35Obserwowano białka znakowane S (pościg) zastępując pożywkę „zimną” (nieradioaktywną) pożywką uzupełnioną 5% FBS i zbierając komórki w różnych punktach czasowych. W trakcie pościgu utrzymywano zabiegi komórkowe. Wszystkie dane z tych eksperymentów pokazują podobne początkowe ilości różnych białek, aby zoptymalizować porównanie ich wskaźników obrotu.

Zwierzęta i przewlekłe napady drgawkowe.

Dorosłe samce szczurów Sprague Dawley (200-300 g; Charles River Laboratories, Kingston, RI) były leczone raz dziennie napadami drgawkowymi (ECS) dla 7-9 d. ECS przeprowadzono zgodnie z wcześniejszym opisem (Hope i in., 1994a) za pomocą Ugo Basile (Comerio VA, Włochy) Jednostka ECS z następującymi ustawieniami: częstotliwość, impulsy 100 / s; impuls z, 0.5 ms; czas trwania wstrząsu, 1.0 s; i prąd, 75 mA. Zwierzęta poddane kontroli pozorowanej traktowano równolegle, stosując elektrody z klipsem usznym bez prądu elektrycznego.

32 Etykietowanie metaboliczne P.

Do znakowania wycinków mózgu szczury dekapitowano, mózgi szybko wycinano i przygotowywano wycinki kory czołowej 300 μm za pomocą mikroklikera DSK (Ted Pella, Redding, CA). Skrawki inkubowano w plastikowych probówkach w 2 ml sztucznego CSF ​​z niedoborem fosforanu (ACSF) i utrzymywano w 30 ° C przy ciągłym delikatnym bulgotaniu O2/WSPÓŁ2 mieszanka (Hemmings i in., 1989). Plastry (dwie skrawki na probówkę) znakowano 1.3 mCi dla 8-10 hw obecności lub nieobecności kwasu okadaikowego (100 ng / ml). Pod koniec tej inkubacji skrawki przepłukano co najmniej trzy razy zimnym ACSF, a następnie homogenizowano przez sonikację w 250 μl zimnego testu radioimmunoprecypitacyjnego (RIPA) [PBS, pH 7.4, 150 mm NaCl, 1% (v / v ) Igepal, 0.5% (wag./obj.) Deoksycholan sodu, 0.1% (wag./obj.) SDS, 1 mm EDTA] uzupełniony przed użyciem SDS do 0.6%, koktajl inhibitora proteazy dla komórek ssaczych (stosowany w 5 μl / ml; Sigma-Aldrich), koktajle inhibitorów fosfatazy I i II (stosowane w 1: 100; Sigma-Aldrich), 1 mm PMSF i 2% glicerolu. Homogenaty następnie gotowano przez 15 min i oczyszczono przez wirowanie przy 15,000 × g dla 15 min. Stężenie białka w otrzymanych supernatantach oceniano stosując test białkowy BCA (Pierce, Holmdel, NJ).

Dla 32Znakowanie P hodowanych komórek, N24 h po infekcji / transfekcji, komórki przemyto dwa do trzech razy pożywką wolną od fosforanu i inkubowano w tej pożywce dla? 1 h. Po tym okresie głodu 0.2 – 0.3 mCi z 32PH3PO4 (PerkinElmer) dodano do każdej studzienki, a komórki oznaczono dla 4 – 12 h w zależności od rodzaju eksperymentu (patrz rys. 1 – 7 dla specyfikacji). Komórki następnie przemyto trzy razy PBS i poddano lizie na lodzie przez 15 min z 50 μl uzupełnionego buforu RIPA. Lizaty zbierano przez zdrapywanie i przepuszczano razy 10 przez igłę 25 ga w celu ścinania DNA, gotowano przez 10 min i wirowano przy obrotach 15,000 dla 15-30 min w 4 ° C. Oczyszczone lizaty (supernatanty) przeniesiono do nowej probówki i przeprowadzono test białka BCA (Pierce). Wszystkie figury tych eksperymentów pokazują podobne ilości białek całkowitego dzikiego typu (WT) i S27A ΔFosB w celu optymalizacji porównań ich względnych poziomów fosforylacji.

Chemikalia i zabiegi hodowli komórkowej.

Kwas okadaikowy (OA; Sigma-Aldrich) rozpuszczono w etanolu i zastosowano w końcowym stężeniu 100 ng / ml. 5,6-Dichloro-1-β-d-rybofuranozylobenzimidazol (DRB; Biomol, Plymouth Meeting, PA) rozpuszczono w dimetylosulfotlenku (DMSO; Sigma-Aldrich) i zastosowano w hodowli komórkowej przy końcowym stężeniu 50 μm. Spermine (Sigma-Aldrich) rozpuszczono w wodzie i zastosowano w końcowym stężeniu 200 μm. Calphostin-C (Biomol) rozpuszczono w DMSO i zastosowano w 0.2 μm, podczas gdy mirystan 12-octan forbolu 13 (PMA; Promega, Madison, WI) rozpuszczono w DMSO i zastosowano w 0.1 μm. mirystoilowany peptyd hamujący związany z autocamtide-2 (m-AIP; Biomol) rozpuszczono w wodzie i zastosowano w końcowym stężeniu 1 i 10 μm. Inhibitory kinaz białkowych o szerokim spektrum H-7 i H-8 (Biomol) rozpuszczono w wodzie i zastosowano w końcowym stężeniu, odpowiednio, 150 i 200 μm. MG132 (Calbiochem, San Diego, CA) i epoksomycyna (Peptides International, Louisville, KY) zostały rozpuszczone w DMSO i użyte w końcowym stężeniu odpowiednio 12.5 i 7.5 μm. We wszystkich eksperymentach, DMSO (nośnik) dodawano do komórek w miarę potrzeby, aby utrzymać stałą ilość DMSO w całym traktowaniu. Dla 32Eksperymenty z etykietowaniem P leki zostały dodane bezpośrednio przed etykietą i przechowywane przez pozostały okres etykietowania. W przypadku eksperymentów z pościgiem pulsowym, leki dodawano w czasie „głodu” Cys / Met, utrzymywanego przez okres etykietowania, a następnie dodawano z powrotem do pożywki pościgowej. Inhibitory proteasomów podawano co 3-4 h w trakcie całego cyklu, aby skompensować szybki obrót tych peptydów.

Immunoprecypitacja osFosB, immunoblotting i autoradiografia.

W przypadku immunoprecypitacji lizaty rozcieńczono 1: 5 zwykłym RIPA, aby obniżyć stężenie SDS do 0.1% przed kontynuowaniem immunoprecypitacji (IP). Aby ograniczyć niespecyficzne wiązanie, lizaty najpierw usunięto przez immunoprecypitację z nieimmunizowaną IgG i białkiem G-Sepharose (Sigma-Aldrich) przez co najmniej 4 h. OsFosB następnie poddano immunoprecypitacji z oczyszczonych lizatów przy użyciu koziego przeciwciała poliklonalnego, które rozpoznaje wewnętrzny epitop obecny zarówno w FosB, jak i osFosB (SC-48G; Santa Cruz Biotechnology, Santa Cruz, CA) przy 0.5 – 1 μg IgG na 10 μg białka lizatu (50 – 300 μg białka całkowitego) w całkowitej objętości 0.5 ml. IP delikatnie mieszano w 4 ° C na rotorze przez co najmniej 8 h, a następnie dodano 15 μl białka G-Sepharose i zmieszano IP przez co najmniej kolejny 4 h. IP granulowano przez wirowanie w 3000 × g dla 3 – 5 min w 4 ° C, przemyć trzy razy 0.5 ml zimnego zwykłego RIPA i dwa razy zimnym PBS zawierającym 0.1% Tween 20. Następnie IP ponownie zawieszono w 0.5 ml zimnego PBS, przeniesiono, osadzono w nowej probówce, a następnie immunoprecypitowane białka wymyto przez dodanie 15-25 μl 2 × redukującego buforu próbki białka Laemmli. Ten protokół IP spowodował specyficzne i skuteczne wytrącanie praktycznie wszystkich ΔFosB w lizacie. Immunoprecypitowane białka poddano SDS-PAGE przez załadowanie całego IP na żel 12.5% Tris-HCl Criterion (Bio-Rad, Hercules, CA), a następnie przeniesiono na PVDF lub nitrocelulozę. Po przeniesieniu membranę wysuszono na powietrzu i 32P- i 35Prążki białek znakowanych S obserwowano przez autoradiografię przy użyciu autoradiograficznego filmu Kodak (Rochester, NY), a także przez fosforyzowanie przy użyciu Storm (Amersham Biosciences, Piscataway, NJ) PhosphorImager. Całkowity (niefosforylowany i fosforylowany) ΔFosB w lizatach komórkowych lub homogenatach mózgu wykrywano przez immunoblotting albo immunoprecypitowanego białka (przy użyciu tej samej membrany stosowanej do wykrywania 32Białko znakowane P) lub równe ilości białka lizat / homogenat poddane SDS-PAGE i przeniesione na PVDF lub nitrocelulozę. Membranę najpierw blokowano przez inkubację z 1% (w / v) suchym mlekiem beztłuszczowym (Bio-Rad) w PBS uzupełnionym 0.1% (v / v) Tween 20 (Sigma) dla 1 h w 25 ° C. Membranę następnie immunoblotowano przez noc w 4 ° C z naszym własnym króliczym przeciwciałem poliklonalnym anty-FosB wytworzonym przeciwko aminokwasom 1-16 z FosB / ΔFosB (stosowanym w 1: 10,000). Po pierwotnej inkubacji błony przemywano czterokrotnie dla 5 min buforem blokującym, a następnie inkubowano w 25 ° C dla ∼1 hz kozim anty-króliczym IgG sprzężonym z peroksydazą chrzanową (stosowaną w 1: 5000 w buforze blokującym, z Vector Laboratories, Burlingame, CA). Membrany następnie przemyto trzykrotnie dla 10 min buforem blokującym i jeden raz dla 5 min z PBS. Pasma białka całkowitego FosB wizualizowano na filmie Kodak MR przez zwiększoną chemiluminescencję (Pierce) i / lub przez wykrywanie fluorescencji przy użyciu odczynników ECL-Plus (Amersham Biosciences) i Storm PhosphorImager.

Nadekspresja i oczyszczanie rekombinowanego ΔFosB z komórek owadzich.

ΔFosB nadeksprymowano w komórkach owadzich Sf9 jako białko znakowane heksa-His na końcu N (N-His (6) ΔFosB) stosując bakulowirusowy system ekspresyjny Bac-to-Bac (Invitrogen) i postępując zgodnie z instrukcjami producenta. W skrócie, cDNA ΔFosB (reszty 2-237) poprzedzone powinowactwem do N-końcowego znacznika MGHHHHHHAG subklonowano w wektorze pFASTBacTM1, który wykorzystano do wytworzenia rekombinowanego bakulowirusa. Komórki Sf9 zakażono rekombinowanym wirusem, a N-His (6) ΔFosB oczyszczono z lizatów komórkowych za pomocą kilku etapów chromatograficznych, w tym chromatografii powinowactwa przy użyciu kolumny niklowej (Qiagen, Valencia, CA), wymiany anionów przy użyciu kolumny mono-Q (Amersham Biosciences) i wykluczenie wielkości przy użyciu kolumny do filtracji żelowej (Amersham Biosciences).

In vitro badania fosforylacji.

In vitro reakcje fosforylacji dla przebiegu czasowego i analizy stechiometrycznej przeprowadzono w objętości 30 μl zawierającej substrat 10 μm (N-His (6) ΔFosB lub substrat kontroli dodatniej), 250 μm ATP i 1 μCi / μl [γ-32P] ATP, bufor dostarczany przez producenta kinazy i jedną z następujących kinaz: CK2 (20 ng / μl; Upstate, Charlottesville, VA), CaMKII (10 ng / μl; Upstate), PKC (1.6 ng / μl; Calbiochem) lub p70S6K (2.5 mU / μl; Upstate). Reakcje przebiegu czasowego przeprowadzono przez usunięcie porcji 5 μl z roztworu reakcyjnego w wyznaczonych punktach czasowych i dodanie równej objętości buforu do próbek białka XemumX redukującego białko Laemmli. Parametry kinetyczne Michaelisa-Mentena dla reakcji CK4 określono w empirycznie określonych liniowych warunkach stanu ustalonego. Reakcje te przeprowadzono dla 2 min w objętości 15 μl zawierającej enzym 10 ng / μl, 2 μm ATP, 250 μCi / μl [γ-32P] ATP i stężenia N-His (6) ΔFosB w zakresie od 2.5 – 30 μm. Wszystkie reakcje przeprowadzono w 30 ° C w łaźni wodnej. Po SDS-PAGE i barwieniu żelu za pomocą Bio-Safe Coomassie (Bio-Rad), żel wysuszono i 32Włączanie fosforanu P oceniano za pomocą analizy obrazu fosforowego (patrz poniżej, Kwantyfikacja danych, obliczenia i statystyki).

Mapa dwuwymiarowego fosfopeptydu i analiza kwasu fosfoaminowego.

Obie te analizy przeprowadzono w sposób opisany przez Ploegh i Dunn (2000). W skrócie, zawierające suche fragmenty żelu 32ΔFosB z etykietą P (z in vitro reakcje lub z immunoprecypitatów komórek znakowanych metabolicznie), wycięto, ponownie uwodniono, przemyto i poddano trawieniu trypsyną. Supernatant zawierający produkty trawienia trypsyną liofilizowano i liofilizat przemyto kilka razy i ponownie zawieszono w 10 μl buforu do elektroforezy, pH 1.9. Próbkę (3 μl) naniesiono na płytkę celulozowej chromatografii cienkowarstwowej (TLC) (Analtech, Newark, DE) i rozdzielono w jednym wymiarze za pomocą elektroforezy, a drugi wymiar metodą wstępnej TLC. Powstałe mapy fosfopeptydów wizualizowano za pomocą autoradiografii i obrazowania fosforowego. W celu analizy kwasu fosfoaminowego, 2 μl trawienia trypsynowego, które ponownie zawieszono w buforze do elektroforezy, dalej rozszczepiono przez hydrolizę HCl przy 105 ° C przez 25 min w 3 m HCl pod N2 atmosfera. Reakcję zatrzymano przez sześciokrotne rozcieńczenie w wodzie i mieszaninę liofilizowano. Liofilizat ponownie zawieszono w 5 μl buforu do elektroforezy, pH 1.9, i nakraplano na celulozową płytkę TLC wraz ze standardami fosfo-Ser, -Thr i -Tyr. Elektroforezę przeprowadzono ponad połowę długości płytki TLC stosując bufor do elektroforezy, pH 1.9, a następnie płytkę przeniesiono do buforu pH 3.5 i przeprowadzono elektroforezę do zakończenia. Wzorce kwasu fosfoaminowego uwidoczniono przez rozpylenie płytki TLC za pomocą roztworu ninhydryny 1% (obj./obj.) W acetonie, a 32Próbki aminokwasów znakowanych P wizualizowano zarówno autoradiografią, jak i obrazowaniem fosforowym.

wywołane siRNA obniżenie CK2α.

Zastosowaliśmy metodę interferencji RNA, aby selektywnie znokautować poziomy CK2 (Di Maira i in., 2005). Komórki PC12 wysiano na 6-studzienkowych płytkach pokrytych kolagenem I, aby osiągnąć ence70-80% konfluencji następnego dnia, gdy zostały przejściowo transfekowane 20 nm (stężenie końcowe) albo nieargetującego siRNA lub siRNA skierowanego w stronę mRNA katalitycznego Podjednostka α Rat CK2, stosując 5 μl środka transfekcyjnego SilentFectin (Bio-Rad) i postępując zgodnie z instrukcjami producenta. Około 24 h później komórki przejściowo transfekowano plazmidem ΔFosB, jak stwierdzono powyżej. Około 24 h później (N48 h po transfekcji siRNA), komórki poddano albo 32P etykietowanie metaboliczne lub analiza impulsów, jak opisano powyżej. Poniżej cztery siRNA CK2α stosowano podobne wyniki: 5'P-CAAACUAUAAUCGUACAUCUU3 ', 5'P-UCAAUCAU-GACAUUAUGCGUU3', 5'P-UAGUCAUAUAAAUCUUCCGUU3 ', 5'P-AAAUCCCUG ACAUCAUAUUUU3 "(Dharmacon, Lafayette, CO). Jako kontrolę negatywną użyliśmy Tłumik kontrola negatywna # 3 siRNA z Ambion (Austin, TX). Stopień nokautu CK2 monitorowano przez immunoblotting przy użyciu przeciwciała poliklonalnego anty-CK2 (katalog # 06-873 z Upstate) przez noc w rozcieńczeniu 1: 1000. β-Tubulinę zastosowano jako kontrolę ładowania i wykryto przeciwciałem monoklonalnym (katalog # 05-661 z Upstate) przez noc w rozcieńczeniu 1: 20,000.

Mutageneza ukierunkowana.

Mutację Ser27 do Ala lub Asp przeprowadzono za pomocą zestawu Quick Change Site-Directed Mutagenesis (Stratagene, La Jolla, CA) i postępując zgodnie z instrukcjami producenta. Aby wprowadzić mutacje Ser27 w mysim białku ΔFosB, zastosowano następujące startery do mutagenezy. Ser27 do Ala: (starter wsteczny) 5′GCCGAAGGAGTCCACCGAAGCCAGGTACTGAGACTCGGCGGAGGG3 ′. Ser27 do Asp (starter do przodu) 5′CCCTCCGCCGAGTCTCAGTACCTGGATTCGGTGGACTCCTTCGGC3 ′. Zmutowane zasady są pogrubione, a kodon Ser27 jest pochylony.

Bioinformatyka.

Potencjalne miejsca fosforylacji i kinazy dla ΔFosB przeszukano przez poddanie sekwencji białka mysiego wyspecjalizowanym bazom danych, w tym ProSite (http://www.expasy.org/prosite/), PredictProtein (Rost i in., 2004) i NetPhosK (Blom i in., 2004).

Kwantyfikacja danych, obliczenia i statystyki.

Ilość białka obecnego w membranie PVDF lub nitrocelulozy oznaczono ilościowo za pomocą Storm PhosphorImager i towarzyszącego oprogramowania ImageQuant (Amersham Biosciences / Molecular Dynamics). W badaniach hodowli komórkowej i fosforylacji wycinka mózgu wartości uzyskane dla 32Białko znakowane P następnie podzielono przez wartości otrzymane dla całkowitej ΔFosB i wyrażono jako stosunek. w in vitro badania fosforylacji, ilość 32ΔFosB znakowane P na mol ΔFosB (stechiometria) obliczono jak opisano wcześniej (Sahin i in., 2004). Wszystkie pomiary zostały wykonane w zakresie liniowości używanego przyrządu. Parametry kinetyczne obliczono za pomocą modelu Michaelisa-Mentena, przy czym V = Vmax[S] / ([S]+KM) i Vmax = k2[ESuma]. Półtrwania (t1 / 2) ΔFosB i FosB zostały oszacowane na podstawie wykresów impulsów (przy użyciu regresji nieliniowej, która najlepiej pasowała do punktów danych) i odpowiadają czasowi, w którym ilość pozostałego białka wynosi 50% oryginału. Na wszystkich figurach przedstawione wyniki są reprezentatywne dla co najmniej dwóch do trzech niezależnych eksperymentów. Na wszystkich wykresach przedstawione dane są średnimi ± SEM (3 ≤ n ≤16). Istotność statystyczną różnic oceniano za pomocą niesparowanego t test, poprawiony dla wielokrotnych porównań i gwiazdkami wskazują p ≤ 0.05.

Poprzednia sekcjaNastępny rozdział

wyniki

ΔFosB jest niezwykle stabilnym czynnikiem transkrypcyjnym

Chociaż spekulowaliśmy wcześniej, że ΔFosB jest względnie stabilnym czynnikiem transkrypcyjnym (Nestler i wsp., 2001), nie przeprowadzono dotychczas bezpośredniej analizy profilu obrotu białka. Aby odpowiedzieć na to pytanie, przeprowadziliśmy eksperymenty z impulsowym pościgiem przy użyciu komórek PC12, które były szeroko stosowane jako linia komórkowa podobna do neuronów, w której ΔFosB był przejściowo wyrażany przez zakażenie rekombinowanym wirusem opryszczki zwykłej (HSV-ΔFosB). Nowo syntetyzowane białka były znakowane metabolicznie 35S-Met / Cys i rozkład degradacji 35ΔFosB z etykietą S (35S-ΔFosB) monitorowano przez immunoprecypitację z lizatów komórkowych otrzymanych w różnych punktach czasowych po usunięciu znakowanych radioaktywnie aminokwasów. Analiza immunoprecypitatów metodą SDS-PAGE i autoradiografii wykazała, że ​​okres półtrwania ΔFosB w komórkach PC12 wynosi ∼10 h (Rys. 1). Odkrycia te pokazują, że okres półtrwania ΔFosB jest wyższy niż w przypadku większości indukowalnych czynników transkrypcyjnych (patrz Dyskusja), w tym FosB pełnej długości, którego okres półtrwania w hodowli komórkowej określono jako ∼90 min (Dobrazanski i in., 1991; Carle i in. 2004). Ponadto warto zauważyć, że degradacja ΔFosB nie pasuje do krzywej wykładniczego pierwszego stopnia rozpadu, ale raczej jest dwufazowa, zaczynając od wolniejszej szybkości degradacji. Sugeruje to istnienie więcej niż jednego gatunku ΔFosB i / lub więcej niż jednej ścieżki degradacji.

Rysunek 1.

Zobacz większą wersję:

Rysunek 1.

ΔFosB jest niezwykle stabilnym czynnikiem transkrypcyjnym. Okres półtrwania ΔFosB to N10 hw hodowli komórkowej. OsFosB eksprymowano w komórkach PC12 przez infekcję HSV-ΔFosB lub przejściową transfekcję plazmidem zawierającym ΔFosB, a komórki poddawano eksperymentom pościgu pulsacyjnego, jak opisano w Materiałach i Metodach. Równoważne wyniki otrzymano niezależnie od metody zastosowanej do nadekspresji ΔFosB. Figura przedstawia przebieg czasowy (i reprezentatywny autoradiogram) degradacji ΔFosB. Dane wykreślono jako średnią ± SEM co najmniej pojedynczych punktów danych 15 uzyskanych z co najmniej pięciu niezależnych doświadczeń. Dla porównania wskazany jest okres półtrwania pełnej długości FosB.

ΔFosB jest fosfoproteiną w mózgu

Postawiliśmy hipotezę, że potranslacyjna modyfikacja ΔFosB może przyczynić się do jej pozornej stabilności. Ponieważ wykazano, że fosforylacja moduluje aktywność czynników transkrypcyjnych na wiele sposobów, w tym ich stabilność (przegląd, patrz Desterro i in., 2000; Whitmarsh i Davis, 2000), zbadaliśmy, czy ΔFosB jest fosfoproteiną. W tym celu ekspresję ΔFosB indukowano w mózgu szczura za pomocą przewlekłego ECS, leczenia znanego z wywoływania wysokich poziomów ΔFosB, szczególnie w korze czołowej (Hope i in., 1994a). Jeden dzień po ostatnim leczeniu ECS, gdy poziomy ΔFosB pozostają wysokie, przygotowano cienkie płaty czołowe kory i metabolicznie oznaczono 32P-ortofosforan. Równoległy zestaw plastrów nie był radioznakowany, a te zostały użyte do wykrycia całkowitego poziomu ΔFosB. Po immunoprecypitacji ze specyficznym przeciwciałem anty-FosB / ΔFosB i oddzieleniu immunoprecypitowanych białek przez SDS-PAGE, fosforylowano 32ΔFosB znakowane P wykryto przez autoradiografię, podczas gdy całkowitą ΔFosB wykryto metodą immunoblottingu. Analiza ta wykazała, że ​​ΔFosB jest fosforylowany w mózgu, o czym świadczy specyficzny 32P-znakowany prążek ∼35 kDa obecny w przewlekle leczonych próbkach mózgu, ale jest praktycznie niewykrywalny w kontrolnych pozornie traktowanych (Rys. 2A). Jest to zgodne z faktem, że przy braku przewlekłej stymulacji podstawowe poziomy ΔFosB są bardzo niskie. Specyficzność reakcji immunoprecypitacji ilustruje brak sygnału w nieimmunizowanym osadzie IgG.

Rysunek 2.

Zobacz większą wersję:

Rysunek 2.

ΔFosB jest fosfoproteiną w mózgu. A, ΔFosB jest fosforylowany w mózgu. Endogenne ΔFosB indukowano w mózgu szczura przez przewlekłe leczenie ECS, jak opisano w Materiałach i Metodach. Przednie płaty korowe były metabolicznie znakowane 32PH3PO4 przez kilka godzin. Po homogenizacji plastrów ΔFosB poddano immunoprecypitacji i fosforylowano ΔFosB (32P-ΔFosB) wykryto za pomocą autoradiografii (panel górny). Całkowitą ΔFosB w nieradioaktywnych immunoprecypitatach wykrywano metodą immunoblottingu (dolny panel). Jako kontrole negatywne pokazano immunoprecypitat zwierzęcia pozornie leczonego i IgG nieimmunologicznego. B, Kandydujące miejsca fosforylacji i kinazy z odpowiednimi wynikami predykcyjnymi dla mysiej sekwencji białka FosB uzyskano za pomocą analizy bioinformatycznej. Miejsca kandydujące z wyższymi wynikami predykcyjnymi są wyróżnione w sekwencji białka i wymienione w tabeli. Domena wiążąca DNA (podstawowa) i suwak leucyny są wytłuszczone w sekwencji białka. C, D, Fosforylacja ΔFosB jest zwiększona przez inhibitor OA fosfatazy Ser / Thr. C, 32Poziomy P-ΔFosB w immunoprecypitatach z czołowych plastrów korowych znakowanych pod nieobecność (Ctr) lub obecność 100 ng / ml OA (wykres i górny panel) wykryto za pomocą autoradiografii. Dolny panel pokazuje całkowitą ΔFosB wykrytą w immunoprecypitatach z nieznakowanych plastrów metodą immunoblottingu. D, Komórki PC12 zakażono HSV-ΔFosB lub HSV-LacZ (wektor) i znakowano metabolicznie za pomocą 32PH3PO4 w nieobecności (Ctr) lub obecności 100 ng / ml OA. 32Poziomy P-ΔFosB w immunoprecypitatach wykryto za pomocą autoradiografii (wykres, górny panel). Dolny panel pokazuje całkowitą ΔFosB wykrytą w lizatach komórkowych przez immunoblotting.

Jako pierwszy krok w kierunku wyjaśnienia, która kinaza (y) i miejsce (a) są zaangażowane w fosforylację ΔFosB, poddaliśmy jego sekwencję aminokwasową kilku analizom bioinformatycznym. Ujawniło to, że chociaż ΔFosB nie zawiera miejsc kandydujących do fosforylacji Tyr, zawiera kilka miejsc konsensusowych kinaz Ser / Thr, w tym trzy miejsca CaMKII, trzy miejsca CK2 i dwa miejsca PKC o bardzo wysokich wynikach przewidywania fosforylacji (Rys. 2B). Jeśli, jak przewiduje bioinformatyka, ΔFosB jest fosforylowany tylko na resztach Ser lub Thr, to jego fosforylacja powinna być znacząco modulowana przez aktywność fosfataz Ser / Thr. Aby przetestować tę hipotezę, oznaczyliśmy plastry korowe czołowe 32P-ortofosforan w obecności lub pod nieobecność OA, inhibitora fosfatazy białkowej Ser / Thr. Jak pokazano w Rysunek 2C, OA spowodowało duży (∼2.5-krotny) wzrost 32P-ΔFosB. Wywołało to również niewielki wzrost całkowitych poziomów ΔFosB, co jest zgodne z wcześniejszymi doniesieniami łączącymi rakotwórcze działanie OA z jego zdolnością do indukowania kilku wczesnych genów, w tym białek Fos (Miller i in., 1998; Choe i in., 2004). Wynik netto jest znaczącym ogólnym wzrostem (N60%) w fosforylowanych poziomach ΔFosB.

Następnie zbadaliśmy, czy w komórkach PC12, które są bardziej podatne na manipulacje eksperymentalne, ΔFosB wykazał wzór fosforylacji podobny do obserwowanego w mózgu. Eksprymowaliśmy ΔFosB w komórkach PC12 przez infekcję HSV-ΔFosB i metabolicznie znakowaliśmy komórki 32P-ortofosforan w obecności lub nieobecności OA. Udaną ekspresję i immunoprecypitację białka z komórek zakażonych HSV-osFosB wykazuje obecność obu w immunoblot (Rys. 2D, dolny panel) i autoradiogram (górny panel) pasma N35 kDa, nieobecne w komórkach zakażonych wektorem. Jak zaobserwowano w mózgu, OA spowodował niewielki wzrost całkowitych poziomów ΔFosB, ale znacznie wyższy (około dwukrotnie) wzrost w 32P-ΔFosB, powodując znaczący (∼50%) wzrost netto fosforylacji ΔFosB. Ponadto, zgodnie z przewidywaniami bioinformatycznymi, leczenie komórek PC12 inhibitorem fosfatazy Tyr nie spowodowało istotnych zmian w 32Poziomy P-ΔFosB (dane nie pokazane). Odkrycia te ujawniły, że ΔFosB jest fosforylowany na resztach Ser i / lub Thr w mózgu i komórkach PC12 i potwierdził, że jest to dobry system hodowli komórkowej, w którym można dalej badać profile fosforylacji i degradacji ΔFosB.

CK2, ale nie PKC lub CaMKII fosforyluje ΔFosB in vitro

Jak opisano powyżej, analiza sekwencji aminokwasowej ΔFosB ujawniła wysokie wyniki predykcyjne dla miejsc fosforylacji CK2, PKC i CaMKII. Aby określić, która z tych kinaz może fosforylować ΔFosB, przeprowadziliśmy serię in vitro reakcje fosforylacji przy użyciu oczyszczonych kinaz i oczyszczonego rekombinowanego ΔFosB. Jak pokazano w Rysunek 3Aspośród trzech kandydujących kinaz tylko CK2 fosforylował ΔFosB w znaczący sposób. Ponadto przetestowano kilka innych kinaz (np. GSK3 i p70S6K), ale nie udało się znacząco fosforylować ΔFosB (dane nie pokazane). Dodatkowa charakterystyka analizy reakcji CK2 w czasie wykazała, że ​​ta kinaza może katalizować wbudowywanie ∼0.5 mola fosforanu na mol ΔFosB (Rys. 3B). Fakt, że CK2 może fosforylować ΔFosB in vitro do znacznej stechiometrii (∼50%) sugeruje fizjologicznie istotną reakcję. Następnie zbadaliśmy kinetykę tej reakcji przez inkubację CK2 w obecności rosnących ilości oczyszczonej ΔFosB i ustaliliśmy, że CK2 fosforyluje ΔFosB za pomocą Vmax 5.8 pmol · min-1 · Μg-1 enzymu, a KM 18.4 μm i a kjak 0.2 / s (Rys. 3C). Wartości uzyskane dla tych parametrów kinetycznych dodatkowo potwierdzają fizjologiczne znaczenie tej reakcji. Na przykład KM CK2 dla DARPP32, jednego z najbardziej znanych podłoży, to 3.4 μm, a kjak to ∼0.3 / s (Girault i in., 1989); KM dla zakresów ATP od ∼10 – 40 μm (Cochet i in., 1983; Silva-Neto i in., 2002), a dla kazeiny waha się od ∼10 – 50 μm (Meggio i in., 1977; Pyerin i in., 1987). Razem dane te wskazują, że ΔFosB jest bona fide substratem dla CK2 in vitro.

Rysunek 3.

Zobacz większą wersję:

Rysunek 3.

CK2, ale nie PKC lub CaMKII fosforyluje ΔFosB in vitro. Autoradiogram (górny panel) pokazuje fosforylowany produkt, a żel barwiony Coomassie (dolny panel) pokazuje całkowitą ΔFosB obecną w reakcji. A, Oczyszczono rekombinowaną ΔFosB in vitro fosforylacja przez różne kandydujące kinazy (z których trzy są pokazane). B, Przebieg czasu i analizy stechiometryczne wskazują, że CK2 może fosforylować ΔFosB in vitro ze stechiometrią ∼50%. C, Analiza kinetyczna reakcji CK2 ujawniła, że ​​ΔFosB jest bona fide in vitro substrat. Linearyzacja reakcji jest pokazana na wykresie podwójnej odwrotności (na dole), ale parametry kinetyczne wyprowadzono z krzywej Michaelisa-Mentena (góra).

CK2 moduluje fosforylację i stabilność ΔFosB w nienaruszonych komórkach

Aby ocenić fizjologiczne znaczenie fosforylacji ΔFosB za pośrednictwem CK2, przeprowadziliśmy porównawcze mapowanie fosfopeptydów przy użyciu in vitro fosforylowana i fosforylowana przez komórki PC12 ΔFosB. Po SDS-PAGE i elucji żelu 32P-ΔFosB (z in vitro reakcje lub immunoprecypitat 32Komórki wyznakowane P), białko trawiono trypsyną, a powstałe fosfopeptydy poddano dwuwymiarowej separacji. Analiza ta wykazała, że ​​główny fosfopeptyd z reakcji CK2 wyemigrował z jednym z dwóch głównych fosfopeptydów z ΔFosB ufosforylowanych w komórkach PC12 (Rys. 4A), podczas gdy fosfopeptydy wynikające z reakcji PKC lub CaMKII (dane nie pokazane) nie. Na mapie z komórek PC12 był drugi fosfopeptyd ΔFosB, ale z powodu niezdolności żadnej z kinaz, które testowaliśmy, do wytworzenia podobnego fosfopeptydu in vitroobecnie nie wiemy, czy ten drugi fosfopeptyd zawiera miejsce fosforylacji inne niż inne fosfopeptydy lub czy reprezentuje odrębny peptyd trypsynowy zawierający to samo miejsce fosforylacji.

Rysunek 4.

Zobacz większą wersję:

Rysunek 4.

CK2 moduluje fosforylację i stabilność ΔFosB w nienaruszonych komórkach. A, CK2, ale nie PKC wydaje się fosforylować ΔFosB w komórkach. Dwuwymiarowe mapy fosfopeptydów osFosB fosforylowanych przez CK2 lub PKC in vitro lub przez nienaruszone komórki PC12. Strzałki pokazują migrację peptydu fosforylowanego CK2, ale nie fosforylowanego PKC z jednym z fosfopeptydów ΔFosB uzyskanych z komórek PC12. B, Fosforylacja ΔFosB w komórkach PC12 jest zwiększona przez traktowanie komórek silną sperminą aktywatora CK2 (SP) i zmniejszoną przez traktowanie DRB inhibitorem CK2. W przeciwieństwie do tego, fosforylacja ΔFosB w komórkach PC12 nie ulegała wpływowi traktowania aktywatorem PKC (PMA) lub inhibitorem specyficznym wobec PKC, kalfostyną-C (Calph). Przedstawiono reprezentatywny autoradiogram (górny panel) i immunoblot (dolny panel). C – F, Wpływ aktywności CK2 na stabilność ΔFosB. Figury przedstawiają przebieg czasowy (i reprezentatywny autoradiogram) degradacji ΔFosB. Komórki PC12 przejściowo wyrażające ΔFosB poddano eksperymentom pościgu pulsacyjnego prowadzonego przy braku lub w obecności inhibitora CK2 DRB (C), aktywator CK2 spermine (D), lub inhibitor kinazy o szerokim spektrum H-8 (E), który został użyty do kontroli niespecyficznych efektów DRB. F, Wpływ wybicia podjednostki katalitycznej CK2 na stabilność ΔFosB. Komórki PC12 transfekowano nieargetującym siRNA (Ctr) lub siRNA nakierowanym na szczurze CK2α i 24 h później transfekowano plazmidem ΔFosB. Górny panel przedstawia immunobloty lizatów całych komórek, pokazując wpływ siRNA CK2 na poziomy białka CK2 i ΔFosB. Odpowiednia immunoblot dla β-tubuliny jest pokazany jako kontrola obciążenia.

W celu dalszego zajęcia się fizjologicznym znaczeniem CK2 jako kinazy ΔFosB, leczyliśmy komórki PC12 eksprymujące ΔFosB za pomocą dwóch leków, które modulują aktywność CK2. Jak pokazano w Rysunek 4B, Fosforylacja ΔFosB była zmniejszona przez traktowanie komórek PC12 przepuszczalnym przez komórkę inhibitorem CK2 DRB (Meggio i in., 1990; Szyszka i in., 1995) i zwiększone przez traktowanie sperminą poliaminową, o której wiadomo, że jest silnym aktywatorem CK2 (Cochet i Chambaz, 1983; Meggio i in., 1983). Natomiast leczenie komórek PC12 za pomocą inhibitora PKC, kalfostyny-C (Kobayashi i in., 1989; Tamaoki i in., 1990) lub aktywator PKC PMA (Schmidt i Hecker, 1975; Beh i in., 1989) nie spowodował znaczących zmian w fosforylacji ΔFosB. W przypadku PMA nieznaczny (i nieistotny) wzrost 32P-ΔFosB można wyjaśnić wzrostem całkowitych poziomów ΔFosB spowodowanych przez ten lek; w rzeczywistości donoszono, że estry forbolu indukują ekspresję kilku białek z rodziny Fos, w tym FosB (Yoza i in., 1992; Suh i in., 2004). Ponadto leczenie komórek specyficznym inhibitorem CaMKII przepuszczalnym dla komórek m-AIP (Ishida i Fujisawa, 1995; Stevens i in., 1999) również nie spowodował zmniejszenia fosforylacji ΔFosB (dane nie pokazane). Razem wyniki te są zgodne z naszymi in vitro wyniki i wskazują, że w nienaruszonych komórkach ΔFosB jest prawdopodobnie fosforylowany przez CK2, ale nie przez PKC lub CaMKII. Fakt, że hamowanie CK2 nie zapobiega całkowicie fosforylacji ΔFosB, wskazuje na istnienie dodatkowych miejsc fosforylacji w białku.

Następnie zbadaliśmy, czy CK2 odgrywa rolę w obrocie ΔFosB, a tym samym w jego stabilności. W tym celu przeprowadziliśmy eksperymenty z pulsacją przy użyciu komórek PC12 eksprymujących ΔFosB traktowanych inhibitorem CK2 lub aktywatorem CK2 stosowanym w badaniu fosforylacji. Jak pokazano w Rysunek 4C, traktowanie komórek inhibitorem CK2 DRB miało znaczący wpływ na szybkość obrotu ΔFosB, o czym świadczy zmiana kształtu jego krzywej degradacji, od dwufazowej do krzywej bliższej rozkładowi wykładniczemu. I odwrotnie, obecność sperminy aktywatora CK2 spowodowała znaczne zmniejszenie szybkości degradacji ΔFosB, co doprowadziło do akumulacji białka w pierwszych godzinach pościgu (Rys. 4D).

Podobnie jak w przypadku wielu aktywatorów i inhibitorów kinaz, spermina i DRB mogą mieć efekty metaboliczne poza modulacją aktywności CK2. W rzeczywistości wykazano, że DRB hamuje kinazę związaną z czynnikiem transkrypcyjnym IIH (TFIIH) (Yankulov i in., 1995), co powoduje zahamowanie transkrypcji za pośrednictwem polimerazy RNA II. Ponieważ efekt ten może wpływać na stabilność ΔFosB, przeanalizowaliśmy wpływ inhibitora kinazy H-8 o szerokim spektrum (Hidaka i Kobayashi, 1992) na obrót ΔFosB przy stężeniu (200 μm) znanym z hamowania kinazy związanej z TFIIH, ale nie z CK2 (Yankulov i in., 1995). Jak pokazano w Rysunek 4E, leczenie H-8 nie wpłynęło na wskaźnik obrotu ΔFosB. Podobne wyniki otrzymano dla H-7, innego inhibitora kinazy o szerokim spektrum, stosowanego w stężeniu, które hamuje kinazę związaną z TFIIH, ale nie CK2 (dane nie pokazane). Dane te potwierdzają interpretację, że zmniejszenie stabilności ΔFosB powodowane przez DRB jest najprawdopodobniej związane z hamowaniem CK2.

Aby dokładniej ustalić rolę CK2 w obrocie ΔFosB, zbadaliśmy konsekwencje wybicia CK2 przez siRNA. Przeprowadziliśmy te eksperymenty z użyciem komórek PC12, które najpierw transfekowano kontrolnym (niedocelowym) siRNA lub siRNA, który celuje w mRNA katalitycznej podjednostki szczurzego CK2 (CK2α) i 24 h później transfekowanego ΔFosB. Jak pokazano w Rysunek 4F, transfekcja siRNA CK2α skutecznie i specyficznie znokautowała poziomy białka CK2α bez wpływu na poziomy ΔFosB (górny panel). Analiza pulsacyjna wykazała, że ​​wybicie CK2 spowodowało znaczny wzrost szybkości obrotu ΔFosB, o czym świadczy szybsza degradacja białka. Fakt, że hamowanie aktywności CK2 (czy to przez traktowanie DRB, czy siRNA) zwiększa obrót ΔFosB i powoduje zanik składowej o wolnej szybkości krzywej dwufazowej, podczas gdy aktywacja CK2 zwiększa powolną fazę krzywej, zapewnia silne wsparcie pomysł, że CK2 odgrywa rolę w regulacji stabilności ΔFosB.

CK2 fosforyluje ΔFosB na Ser27

Aby rozpocząć identyfikację miejsca (miejsc) na ΔFosB fosforylowanym przez CK2, przeprowadziliśmy analizę fosfo-aminokwasową rekombinowanego ΔFosB fosforylowanego przez CK2 in vitro i ΔFosB fosforylowany w komórkach PC12. Eksperymenty te ujawniły, że w obu przypadkach jedynym wykrytym fosfoaminokwasem był fosfo-Ser (Rys. 5A). To odkrycie wraz ze stechiometrią uzyskaną dla CK2 in vitro reakcja fosforylacji (N50%) (Rys. 3B) oraz obecność tylko jednego znaczącego miejsca na mapie fosfopeptydów CK2 (Rys. 4A) sugeruje, że fosforylacja ΔFosB CK2 jest prawdopodobnie ograniczona do pojedynczej reszty seryny. Wniosek ten jest zgodny z analizą miejsca zgodnego z fosforylacją (Rys. 2B), która przewidywała tylko jedną kandydującą serynę, tj. Ser27, dla CK2. Analiza taksonomiczna wykazała, że ​​Ser27 jest wysoce konserwatywny dzięki ewolucji wśród członków rodziny Fos (Rys. 5B), sugerując, że może ona pełnić ważną funkcję fizjologiczną.

Rysunek 5.

Zobacz większą wersję:

Rysunek 5.

CK2 Phosphorylates ΔFosB na Ser27. A, Analiza fosfoaminokwasów fosforylowanej CK2 (in vitro) i ΔFosB fosforylowany przez komórki PC12 wykazujący, że w obu przypadkach główną resztą fosforylowaną jest seryna. B, Analiza krzyżowa sekwencji aminokwasowej FosB / ΔFosB ujawniła wysoką konserwację Ser27 wśród członków rodziny Fos od człowieka do danio pręgowanego (ciemne podświetlenie). Jednak kwasowa reszta w pozycji + 3, która jest wymagana dla konsensusowego miejsca CK2, nie jest konserwowana (jasne światło). C, Komórki HeLa przejściowo transfekowano ΔFosB typu dzikiego (WT) lub ΔFosB zawierający mutację punktową w celu podstawienia Ser27 Ala (S27A). Komórki były znakowane metabolicznie 32PH3PO4 i traktowany nośnikiem lub sperminą (SP), aby aktywować CK2. Przedstawiono reprezentatywny autoradiogram (panel górny) i immunoblot (panel dolny) uzyskanych immunoprecypitatów ΔFosB. Pokazano immunoprecypitat komórek pozornie transfekowanych (wektor).

Aby określić, czy Ser27 jest fosforylowany w ΔFosB, zmutowaliśmy tę resztę do Ala i przeanalizowaliśmy konsekwencje na status fosforylacji białka. W tym celu wykorzystaliśmy komórki HeLa (które można transfekować z większą wydajnością), aby przejściowo wyrazić mutanta WT lub S27A ΔFosB. Około 24 h po transfekcji komórki znakowano metabolicznie 32Przygotowano p-ortofosforan i lizaty całokomórkowe. Po immunoprecypitacji i SDS-PAGE, 32P-ΔFosB wykrywano przez autoradiografię i całkowitą ΔFosB przez immunoblotting. Jak pokazano w Rysunek 5C (dolny panel), ΔFosB nie został wykryty w komórkach transfekowanych wektorem, podczas gdy komórki transfekowane mutantem WT lub S27A osFosB z powodzeniem eksprymowały białko. Odkryliśmy, że mutacja S27A spowodowała znaczne (∼30%) zmniejszenie 32Poziomy P-ΔFosB (Rys. 5C, górny panel i wykres), wskazując, że w żywych komórkach ΔFosB jest fosforylowany na Ser27. W celu ustalenia, czy w komórkach Ser27 rzeczywiście jest fosforylowana przez CK2, porównano zdolność sperminy aktywatora CK2 do modulowania fosforylacji WT i S27A ΔFosB. Jak zaobserwowaliśmy wcześniej w komórkach PC12 (Rys. 4B), traktowanie komórek HeLa sperminą znacząco zwiększyło fosforylację białka WT. Fakt, że efekt ten był znacznie zmniejszony przez mutację S27A (Rys. 5C) popiera interpretację, że Ser27 w ΔFosB jest fizjologicznym substratem dla CK2.

Fosforylacja Ser27 reguluje stabilność ΔFosB

Po ustaleniu, że stabilność ΔFosB jest zmniejszona, gdy CK2 jest hamowany i wzmacniany, gdy aktywowany jest CK2 (Rys. 4), i że CK2 fosforyluje ΔFosB na Ser27 (Rys. 5) przewidzieliśmy, że zapobieganie fosforylacji tego miejsca powinno destabilizować białko. Eksperymenty pościgowe prowadzone z komórkami HeLa przejściowo wyrażającymi mutant WT lub S27A ΔFosB ujawniły, że zgodnie z przewidywaniami mutacja S27A spowodowała znaczny wzrost szybkości degradacji ΔFosB i jednoczesne zmniejszenie okresu półtrwania białka (Rys. 6A). Następnie zbadaliśmy, czy ten mechanizm regulacyjny występuje również w bardziej podobnej do neuronów linii komórkowej PC12. Eksperymenty te ujawniły, że, jak zaobserwowaliśmy w komórkach HeLa, mutacja punktowa S27A powoduje dramatyczny spadek okresu półtrwania ΔFosB w komórkach PC12 (z ∼11 do ∼4 h) (Rys. 6B). Fakt, że ta destabilizacja jest podobna do tej spowodowanej hamowaniem CK2 lub powaleniem (Rys. 4) zapewnia dalsze wsparcie dla idei, że fosforylacja Ser2 za pośrednictwem CK27 reguluje stabilność ΔFosB. Dodatkowe dowody na rolę regulacyjną fosforylacji Ser27 w obrocie białka ΔFosB uzyskano stosując mutację fosfomimetyczną Ser27 na Asp (S27D). Mutacja S27D jest uważana za fosfomimetyczną, ponieważ umieszcza dużą ujemnie naładowaną grupę (karboksylową) w aminokwasie 27, a tym samym częściowo naśladuje fosforylację Ser27. Jak pokazano w Rysunek 6C, mutacja S27D spowodowała przeciwny efekt mutacji S27A i spowodowała białko znacznie bardziej stabilne niż białko WT. Podobnie do efektu uzyskanego po aktywacji CK2 (Rys. 4D), mutacja S27D spowodowała akumulację, a zatem zwiększyła poziomy ΔFosB podczas pierwszych godzin pościgu.

Rysunek 6.

Zobacz większą wersję:

Rysunek 6.

Fosforylacja Ser27 reguluje stabilność ΔFosB. A, C, Analiza pościgu pokazująca wpływ fosforylacji Ser27 na szybkość obrotu ΔFosB. Przedstawiono profil degradacji i szacowane okresy półtrwania ΔFosB typu dzikiego (WT), mutanta Ser27 dla mutanta Ala (S27A) i mutanta fosfomimetycznego Ser27 na Asp (S27D). Te same wyniki uzyskano w komórkach HeLa (A) i komórki PC12 (B, C).

Fosforylacja Ser27 stabilizuje ΔFosB, zapobiegając jego degradacji proteasomalnej

Aby rozpocząć wyjaśnianie mechanizmu, dzięki któremu fosforylacja Ser27 stabilizuje ΔFosB, zbadaliśmy zdolność inhibitorów proteasomu MG132 (Palombella i in., 1994; Tsubuki i in., 1996) i epoksomycyna (Hanada i in., 1992; Kim i wsp., 1999) modulować szybkość degradacji ΔFosB mutanta WT i mutanta S27A. Eksperymenty pościgowe przeprowadzono z użyciem komórek PC12 zakażonych rekombinowanym HSV eksprymującym WT lub S27A ΔFosB i traktowanych DMSO lub jednym z dwóch inhibitorów proteasomu. Eksperymenty te ujawniły, że chociaż szybkość degradacji białka WT jest względnie niewrażliwa na obecność któregokolwiek z dwóch inhibitorów proteasomu (Rys. 7A), mutant S27A jest wrażliwy na te leki (Rys. 7B). Wskazuje to, że w przeciwieństwie do białka WT, mutant S27A jest celem degradacji proteasomów. Rzeczywiście, traktowanie komórek MG132 lub epoksomycyną całkowicie odwróciło efekt mutacji S27A na szybkość degradacji ΔFosB, o czym świadczy wzrost okresu półtrwania mutanta S27A z ∼4 do ∼9 h dla MG132 i ∼ 12 h dla epoksomycyny (Rys. 7B). Odkrycia te wskazują, że fosforylacja ΔFosB na Ser27 chroni białko przed degradacją proteasomową, a zatem jest niezbędna dla jego niezwykłej stabilności.

Rysunek 7.

Zobacz większą wersję:

Rysunek 7.

Fosforylacja Ser27 stabilizuje ΔFosB, zapobiegając jego degradacji proteasomalnej. A, B, Analiza cyklu pulsacyjnego z zakażonymi HSV komórkami PC12 wykazującymi profil degradacji i szacowany okres półtrwania ΔFosB typu dzikiego (A) lub S27A ΔFosB (B) pod nieobecność lub w obecności któregokolwiek z dwóch inhibitorów proteasomu [MG132 i epoksomycyna (Epoxo)]. Należy zwrócić uwagę na fakt, że żaden lek nie ma znaczącego wpływu na obrót ΔFosB typu dzikiego, podczas gdy leczenie komórek dowolnym inhibitorem proteasomu spowodowało stabilizację S27A ΔFosB. C, Model roli fosforylacji Ser27 w zdolności ΔFosB do pośredniczenia w długoterminowej plastyczności mózgu. Po indukcji część ΔFosB jest stabilizowana w mózgu przez fosforylację S2 za pośrednictwem CK27. Powoduje to jego akumulację, co z kolei prowadzi do długotrwałych zmian w ekspresji genów. Te stabilne zmiany w ekspresji genów przyczyniają się do stabilnych adaptacji behawioralnych. Odwrotnie, defosforylacja S27 przez fosfatazy Ser / Thr PP1 i / lub PP2A powoduje destabilizację białka i jego przetwarzanie przez maszynerię proteasomalną.

Poprzednia sekcjaNastępny rozdział

Dyskusja

W niniejszym badaniu wykazaliśmy, że ΔFosB ma okres półtrwania ∼10 h w hodowli komórkowej, co czyni go stabilnym w porównaniu z FosB pełnej długości i większością innych indukowalnych czynników transkrypcyjnych, których okresy półtrwania w hodowli komórkowej mogą być tak krótkie jako kilka minut i rzadko przekracza 3 h (Hann i Eisenman, 1984; Dobrazanski i in., 1991; Roberts i Whitelaw, 1999; Ferrara i in., 2003; Hirata i in., 2004). Ponadto stwierdzamy, że ΔFosB jest fosforylowany w mózgu i że jego fosforylacja jest wrażliwa na inhibitor PP1 / PP2A, kwas okadaikowy. Nasze badania hodowli komórkowej wykazują, że stabilność ΔFosB jest modulowana przez CK2, z wyższą aktywnością CK2 stabilizującą białko. Wreszcie nasze odkrycia sugerują, że CK2 fosforyluje ΔFosB na wysoce konserwowanej serynie N-końcowej (S27) i wykazuje, że fosforylacja S27 chroni ΔFosB przed degradacją proteasomalną. Dlatego proponujemy model, w którym fosforylacja ΔFosB na S27 przez CK2 jest krytycznym mechanizmem regulacyjnym obrotu ΔFosB (Rys. 7C). Taka stabilizacja osFosB za pośrednictwem fosforylacji jest funkcjonalnie ważna, ponieważ wykazano, że zwiększone poziomy ΔFosB w poszczególnych regionach mózgu bezpośrednio regulują liczne geny neuronalne in vivo oraz wywierania silnego wpływu behawioralnego na modele zwierzęce kilku zaburzeń neuropsychiatrycznych (patrz Wprowadzenie).

Chociaż fosforylacja jest szybkim i odwracalnym sposobem regulacji aktywności transkrypcyjnej niektórych czynników transkrypcyjnych, takich jak CREB (białko wiążące element odpowiedzi cAMP) (Bohmann, 1990), modulowanie degradacji czynników transkrypcyjnych zapewnia jeszcze silniejszą (mniej trudną do odwrócenia) formę regulacji (Desterro i in., 2000). Czynniki transkrypcyjne, których aktywność funkcjonalna jest regulowana na poziomie ich degradacji, obejmują NFκB (Desterro i in., 2000), c-Myc (Sears i in., 1999) i c-Fos (Ferrara i in., 2003), pośród innych. W wielu przypadkach fosforylacja jest kluczowym regulatorem stabilności czynnika transkrypcyjnego, jak wykazano dla c-Fos (Okazaki i Sagata, 1995; Tsurumi i in., 1995), Antygen związany z Fos-1 (Fra-1) (Vial i Marshall, 2003), Fra-2 (Manabe i in., 2001), c-Jun (Fuchs i in., 1996), JunB (Fuchs i in., 1997), ATF2 (Fuchs i in., 2000) i p53 (Buschmann i in., 2001). Nasze badania dodają zatem ΔFosB do tej listy czynników transkrypcyjnych, których aktywność funkcjonalna jest regulowana przez jej zależną od fosforylacji stabilność.

CK2 jest wszechobecną i konstytutywnie aktywną kinazą Ser / Thr, która ma> 300 rzekomych substratów zidentyfikowanych do tej pory i jest zaangażowana w wiele procesów biologicznych, w tym śmierć i przeżycie komórki (Litchfield, 2003; Unger i in., 2004), komórkowe odpowiedzi stresowe (Yanagawa i in., 1997; Kato i in., 2003) oraz naprawa DNA i przebudowa chromatyny (Barz i in., 2003; Krohn i in., 2003). Ponad jedna trzecia domniemanych substratów CK2 to białka zaangażowane w regulację ekspresji genów (Meggio i Pinna, 2003). W rzeczywistości wykazano, że CK2 jest znaczącą kinazą jądrową (Krek i in., 1992) (do przeglądu, patrz Yu i in., 2001) i do interakcji z domenami bZIP kilku czynników transkrypcyjnych (Yamaguchi i in., 1998). Wykazano również, że fosforylacja za pośrednictwem CK2 moduluje degradację (zwiększając ją lub zmniejszając) wielu białek, w tym IkB (Schwarz i in., 1996), PTEN (Torres i Pulido, 2001), soczewka connexin (Yin i wsp., 2000), białko związane z chromatyną HMG1 (Wiśniewski i in., 1999) oraz kilka czynników transkrypcyjnych, takich jak HMGB (Stemmer i in., 2002), Myf-5 (Winter i in., 1997) i c-Myc (Channavajhala i Seldin, 2002). CK2 jest najbardziej obfity w mózgu (Alcazar i in., 1988; Girault i in., 1990), a jego aktywność jest zaangażowana w wiele aspektów funkcjonowania mózgu, w tym przeżycie neuronów (Boehning i in., 2003), różnicowanie (Nuthall i in., 2004), funkcja kanału jonowego (Jones i Yakel, 2003; Bildl i in., 2004) oraz długotrwałe wzmocnienie i plastyczność neuronalna (Diaz-Nido i in., 1992; Lieberman i Mody, 1999; Reikhardt i in., 2003).

Pomimo rosnących dowodów na rolę CK2 w regulacji funkcji neuronalnych, niewiele wiadomo na temat tego, co kontroluje jego aktywność. Uważa się, że CK2 jest konstytutywnie aktywny, z regulacją jego zdolności do fosforylacji specyficznych substratów polegających głównie na zmianach w jego lokalizacji wewnątrzkomórkowej (np. Cytosol vs jądro) (Ahmed i Tawfic, 1994; Yu i in., 1999). Ta informacja rodzi ważne pytanie dotyczące tego, jakie sygnały są wymagane do wywołania akumulacji ΔFosB w mózgu po przewlekłej stymulacji (Rys. 7C). Jednym z wymagań jest powtarzająca się aktywacja fosB gen i indukcja mRNA ΔFosB (Chen i wsp., 1995). Nasze dane wskazują, że fosforylacja ΔFosB przez CK2 jest krytyczna dla jego stabilności, co sugeruje, że drugi sygnał może być wymagany do długoterminowego wpływu ΔFosB na ekspresję genu, a mianowicie, sygnał, który stymuluje fosforylację białka przez CK2. Może to obejmować aktywację CK2 przez jakiś nieznany mechanizm lub jego translokację do jądra. Alternatywnie, fosforylacja ΔFosB przez CK2 może być konstytutywna, tak że gdy białko ΔFosB ulega translacji w odpowiedzi na każdy bodziec, jego część ulega fosforylacji i tym samym stabilizuje, tak że przy powtarzanej stymulacji gromadzi się ona do wysokich poziomów w dotkniętych neuronach.

Nasze odkrycia pokazują, że CK2 i S27 prawdopodobnie nie są jedyną kinazą i miejscem odpowiedzialnym za fosforylację ΔFosB, ponieważ ani hamowanie CK2, ani mutacja S27A nie były w stanie całkowicie zapobiec fosforylacji ΔFosB. Z tego samego powodu fakt, że mutacja S27A powoduje zmniejszenie 30% fosfo-ΔFosB, dowodzi, że S27 jest głównym miejscem fosforylacji na białku. Niemniej jednak badamy inne przypuszczalne miejsca kinaz i fosforylacji na ΔFosB. Ostatecznie ważne będzie również przeanalizowanie fosforylacji S27 i wszelkich innych miejsc fosforylacji w ΔFosB w mózgu in vivo po różnych rodzajach przewlekłej stymulacji, na przykład za pomocą spektrometrii mas lub fosfospecyficznych przeciwciał.

Jak wspomniano powyżej, S27 w ΔFosB jest wysoce konserwatywny podczas ewolucji i wśród innych białek z rodziny Fos. Jednak strona zgodna dla CK2 nie jest: jak pokazano na Rysunek 5B, tylko FosB / ΔFosB (i ksenolog Danio pręgowanego), ale nie c-Fos lub Fra-2, posiadają resztę kwasową przy + 3, kluczowym wyznaczniku fosforylacji CK2 (Marin i in., 1986; Meggio i in., 1994). Zatem brak fosforylacji CK2 na S27 może wyjaśniać, dlaczego inne białka z rodziny Fos nie są tak stabilne jak ΔFosB. Nie wyjaśnia to jednak, dlaczego FosB pełnej długości, który ma takie samo miejsce konsensusu CK2 jak ΔFosB, nie jest podobnie stabilizowany. Nie wiemy, czy FosB pełnej długości jest fosforylowany przez CK2 na tej konserwowanej pozostałości. Jedyne raporty FosB (Skinner i in., 1997) i c-Fos (Okazaki i Sagata, 1995; Chen i wsp., 1996) fosforylacja opisuje miejsca w C-końcowym regionie tych białek, które nie występuje w ΔFosB. Potencjalna fosforylacja białek FosB pełnej długości i innych białek z rodziny Fos przez CK2 wymaga bezpośredniego badania. Wiadomo jednak, że nawet jeśli są fosforylowane, inne białka z rodziny Fos zawierają motywy na swoich końcach C, które celują w białka w celu szybkiej degradacji (Papavassiliou i in., 1992; Jariel-Encontre i in., 1997; Acquaviva i in., 2002). Na przykład wykazano, że odcinek reszt ∼21 obecnych na C-końcu wszystkich białek z rodziny Fos, ale nieobecny w ΔFosB, działa jako domena destabilizująca dla c-Fos (Acquaviva i in., 2001). Odkryliśmy, że chociaż ta sekwencja podobnie destabilizuje FosB pełnej długości (Carle i in., 2004), brak tej domeny w ΔFosB nie uwzględnia w pełni jej stabilizacji. Przeciwnie, połączenie braku tej domeny C-końca i fosforylacji Ser27 wydaje się w pełni odpowiadać w przybliżeniu pięciokrotnej różnicy stabilności między ΔFosB i FosB.

Chociaż degradacja białek z rodziny Fos jest złożona i nie do końca poznana, degradacja proteasomalna wydaje się być głównym zaangażowanym szlakiem (Salvat i in., 1999; Acquaviva i in., 2002; Ferrara i in., 2003). Przedstawione tutaj dane, w których inhibitory proteasomów nie zmieniają znacząco szybkości degradacji ΔFosB, dowodzą, że w przeciwieństwie do innych białek z rodziny Fos ΔFosB uchyla się od proteasomu 26S, co odgrywa główną rolę w jego stabilizacji. Dlatego proponujemy schemat, w którym zwiększoną stabilność ΔFosB można przypisać połączeniu dwóch głównych czynników: (1) braku domeny destabilizującej na C-końcu i (2) fosforylacji S27 przez CK2.

Podsumowując, niniejsze badanie dostarcza mechanistycznego wglądu w to, dlaczego ΔFosB, produkt bezpośredniego wczesnego genu fosB, jest, w przeciwieństwie do wszystkich innych członków rodziny Fos, stosunkowo długowiecznym białkiem. Chociaż uważa się, że inne białka z rodziny Fos pośredniczą w szybkim, ale przejściowym sprzęganiu transkrypcji bodźców (Morgan i Curran, 1995), względna stabilność ΔFosB nadaje mu zdolność do pośredniczenia w długotrwałych zmianach transkrypcyjnych indukowanych przez przewlekłą stymulację. Potwierdza to pogląd, że ΔFosB działa jako trwały przełącznik molekularny w mózgu, stopniowo przekształcając ostre reakcje w chroniczne adaptacje. Identyfikacja fosforylacji Ser27 jako centralnego mechanizmu stabilności ΔFosB otwiera nowe możliwości opracowania środków do regulacji funkcji ΔFosB, a tym samym modulowania jej długoterminowych skutków na plastyczność neuronalną i behawioralną.

Poprzednia sekcjaNastępny rozdział

Przypisy

  • Otrzymano listopad 21, 2005.
  • Wersja otrzymała luty 21, 2006.
  • Zaakceptowano April 2, 2006.
  • Praca ta została wsparta przez National Alliance for Research on Schizophrenia and Depression Young Investigator Award dla PGU, National Institute of Drug Abuse (NIDA) National Research Service Award dla PGU oraz granty od Narodowego Instytutu Zdrowia Psychicznego i NIDA dla EJN We dziękuję Dr. Jamesowi Bibbowi za pomoc w in vitro testy fosforylacji, dr Ming-Hu Han za pomoc w przygotowaniu wycinków mózgu używanych do etykietowania metabolicznego, a dr Rachael Neve za pomoc w pakowaniu rekombinowanych HSV.
  • Obecny adres G. Rudenko: Life Sciences Institute and Department of Pharmacology, University of Michigan, 210 Washtenaw Avenue # 3163A, Ann Arbor, MI 48109-2216.
  • Korespondencję należy kierować do Erica J. Nestlera, 5323 Harry Hines Boulevard, Dallas, TX 75390-9070. E-mail: [email chroniony]

Poprzednia sekcja

 

Referencje

Acquaviva C, Brockly F, Ferrara P, Bossis G, Salvat C, Jariel-Encontre I, Piechaczyk M (2001) Identyfikacja C-końcowego motywu tripeptydu biorącego udział w kontroli szybkiej degradacji proteasomów protoonkoproteiny c-Fos podczas przejścia fazowego G (0) -to-S. onkogenu 20:7563-7572.

CrossRefMedline

Acquaviva C, Bossis G, Ferrara P, Brockly F, Jariel-Encontre I, Piechaczyk M (2002) Wiele szlaków degradacji dla białek z rodziny Fos. Ann NY Acad Sci 973:426-434.

Medline

Ahmed K, Tawfic S (1994) Mechanizm wewnątrzkomórkowej regulacji kinazy białkowej CK2: rola asocjacji podnuklearnej za pośrednictwem bodźców. Cell Mol Biol Res 40:539-545.

Medline

Alcazar A, Martin E, Lopez-Fando J, Salinas M. (1988) Ulepszona procedura oczyszczania i właściwości kinazy kazeinowej II z mózgu. Neurochem Res 13:829-836.

CrossRefMedline

Andersson M, Westin JE, Cenci MA (2003) Przebieg czasowy immunoreaktywności typu DeltaFosB prążkowia i poziom mRNA prodynorfiny po zaprzestaniu przewlekłego leczenia dopaminomimetycznego. Eur J Neurosci 17:661-666.

CrossRefMedline

Barz T, Ackermann K, Dubois G, Eils R, Pyerin W (2003) Ekrany ekspresji całego genomu wskazują na globalną rolę kinazy białkowej CK2 w przebudowie chromatyny. J Cell Sci 116:1563-1577.

Streszczenie / BEZPŁATNY pełny tekst

Beh I, Schmidt R, Hecker E (1989) Dwa izozymy PKC występujące w komórkach HL-60 wykazują różnicę w aktywacji przez TPA estru forbolu. FEBS Lett. 249:264-266.

Medline

Bildl W, Strassmaier T, Thurm H, Andersen J, Eble S, Oliver D, Knipper M, Mann M, Schulte U, Adelman JP, Fakler B (2004) Kinaza białkowa CK2 jest połączona z małym przewodnictwem Ca (2 +) - aktywowanymi kanałami K + i reguluje bramkowanie kanałów. Neuron 43:847-858.

CrossRefMedline

Bing G, Wang W, Qi Q, Feng Z, Hudson P, Jin L, Zhang W, Bing R, Hong JS (1997) Długotrwała ekspresja antygenu związanego z Fos i przejściowa ekspresja delta FosB związana z napadami w hipokampie i prążkowiu szczura. J. Neurochem 68:272-279.

Medline

Blom N, Sicheritz-Ponten T, Gupta R, Gammeltoft S, Brunak S (2004) Przewidywanie glikozylacji potranslacyjnej i fosforylacji białek z sekwencji aminokwasowej. proteomika 4:1633-1649.

CrossRefMedline

Boehning D, Moon C, Sharma S, Hurt KJ, Hester LD, Ronnett GV, Shugar D, Snyder SH (2003) Neurotransmisja tlenku węgla aktywowana przez fosforylację CK2 oksygenazy hemowej-2. Neuron 40:129-137.

CrossRefMedline

Bohmann D (1990) Fosforylacja czynnika transkrypcyjnego: związek między transdukcją sygnału a regulacją ekspresji genów. Komórki nowotworowe 2:337-344.

Medline

Buschmann T, Potapova O, Bar-Shira A, Ivanov VN, Fuchs SY, Henderson S, Fried VA, Minamoto T, Alarcon-Vargas D, Pincus MR, Gaarde WA, Holbrook NJ, Shiloh Y, Ronai Z (2001) Końcowa fosforylacja kinazy p2 na Thr-53 na Jun NH81 jest ważna dla stabilizacji p53 i aktywności transkrypcyjnych w odpowiedzi na stres. Mol Cell Biol 21:2743-2754.

Streszczenie / BEZPŁATNY pełny tekst

Carle TL, Ulery PG, Nestler EJ (2004) Brak konserwatywnej domeny C-końcowej rodziny Fos przyczynia się do wyjątkowej stabilności deltaFosB. Soc Neurosci Abstr 30: 692.2.

Channavajhala P, Seldin DC (2002) Funkcjonalne oddziaływanie kinazy białkowej CK2 i c-Myc w limfomagenezie. onkogenu 21:5280-5288.

CrossRefMedline

Chen J, Nye HE, Kelz MB, Hiroi N, Nakabeppu Y, Hope BT, Nestler EJ (1995) Regulacja delta FosB i białek podobnych do FosB za pomocą napadów drgawkowych i kokainy. Mol Pharmacol 48:880-889.

Abstrakcyjny

Chen J, Kelz MB, Hope BT, Nakabeppu Y, Nestler EJ (1997) Przewlekłe antygeny związane z Fos: stabilne warianty ΔFosB indukowane w mózgu w wyniku leczenia przewlekłego. J Neurosci 17:4933-4941.

Streszczenie / BEZPŁATNY pełny tekst

Chen RH, Juo PC, Curran T, Blenis J (1996) Fosforylacja c-Fos na C-końcu zwiększa jego aktywność transformującą. onkogenu 12:1493-1502.

Medline

Choe ES, Parelkar NK, Kim JY, Cho HW, Kang HS, Mao L, Wang JQ (2004) Inhibitor fosfatazy białkowej 1 / 2A kwas okadaikowy zwiększa fosforylację CREB i Elk-1 oraz ekspresję c-fos w prążkowiu szczura in vivo. J. Neurochem 89:383-390.

CrossRefMedline

Cochet C, Chambaz EM (1983) Fosforylacje białek za pośrednictwem poliamin: możliwy cel dla wewnątrzkomórkowego działania poliamin. Mol Cell Endocrinol 30:247-266.

CrossRefMedline

Cochet C, Feige JJ, Chambaz EM (1983) Właściwości katalityczne i molekularne wysoce oczyszczonej kinazy kazeinowej typu G z bydlęcej tkanki płucnej. Biochim Biophys Acta 743:1-12.

Medline

Colby CR, Whisler K, Steffen C, Nestler EJ, Self DW (2003) Nadekspresja DeltaFosB specyficzna dla komórek prążkowia zwiększa zachętę do kokainy. J Neurosci 23:2488-2493.

Streszczenie / BEZPŁATNY pełny tekst

Daunais JB, Roberts DC, McGinty JF (1993) Samo-podawanie kokainy zwiększa preprodynorfinę, ale nie c-fos, mRNA w prążkowiu szczura. NeuroReport 4:543-546.

Medline

Desterro JM, Rodriguez MS, Hay RT (2000) Regulacja czynników transkrypcyjnych przez degradację białka. Cell Mol Life Sci 57:1207-1219.

CrossRefMedline

Diaz-Nido J, Armas-Portela R, Avila J (1992) Wzrost aktywności cytoplazmatycznej kinazy kazeinowej II towarzyszy wzrostowi neurytów po zahamowaniu syntezy DNA w komórkach nerwiaka niedojrzałego NIA-103. J. Neurochem 58:1820-1828.

Medline

Di Maira G, Salvi M, Arrigoni G, Marin O, Sarno S, Brustolon F, Pinna LA, Ruzzene M (2005) Kinaza białkowa CK2 fosforyluje i reguluje Akt / PKB. Cell Death Differ 12:668-677.

CrossRefMedline

Dobrazanski P, Noguchi T, Kovary K, Rizzo CA, Lazo PS, Bravo R (1991) Oba produkty genu fosB, FosB i jego krótka forma, FosB / SF, są aktywatorami transkrypcji w fibroblastach. Mol Cell Biol 11:5470-5478.

Streszczenie / BEZPŁATNY pełny tekst

Ferrara P, Andermarcher E, Bossis G, Acquaviva C, Brockly F, Jariel-Encontre I, Piechaczyk M (2003) Strukturalne determinanty odpowiedzialne za degradację proteasomów c-Fos różnią się w zależności od warunków ekspresji. onkogenu 22:1461-1474.

CrossRefMedline

Fuchs SY, Dolan L, Davis RJ, Ronai Z (1996) Zależne od fosforylacji ukierunkowanie ubikwitynacji c-Jun przez N-kinazę Jun. onkogenu 13:1531-1535.

Medline

Fuchs SY, Xie B, Adler V, Fried VA, Davis RJ, Ronai Z (1997) Kinazy terminalne c-Jun NH2 ukierunkowane na ubikwitynację związanych z nimi czynników transkrypcyjnych. J Biol Chem 272:32163-32168.

Streszczenie / BEZPŁATNY pełny tekst

Fuchs SY, Tappin I, Ronai Z (2000) Stabilność czynnika transkrypcyjnego ATF2 jest regulowana przez fosforylację i defosforylację. J Biol Chem 275:12560-12564.

Streszczenie / BEZPŁATNY pełny tekst

Girault JA, Hemmings HC Jr, Williams KR, Nairn AC, Greengard P (1989) Fosforylacja DARPP-32, fosfoproteiny regulowanej dopaminą i cAMP, przez kinazę kazeinową II. J Biol Chem 264:21748-21759.

Streszczenie / BEZPŁATNY pełny tekst

Girault JA, Hemmings HC Jr, Zorn SH, Gustafson EL, Greengard P (1990) Charakterystyka w mózgu ssaków kinazy serynowej DARPP-32 identycznej z kinazą kazeinową II. J. Neurochem 55:1772-1783.

Medline

Hanada M, Sugawara K, Kaneta K, Toda S, Nishiyama Y, Tomita K, Yamamoto H, Konishi M, Oki T (1992) Epoksomycyna, nowy środek przeciwnowotworowy pochodzenia mikrobiologicznego. J Antibiot (Tokio) 45:1746-1752.

Medline

Hann SR, Eisenman RN (1984) Białka kodowane przez ludzki onkogen c-myc: zróżnicowana ekspresja w komórkach nowotworowych. Mol Cell Biol 4:2486-2497.

Streszczenie / BEZPŁATNY pełny tekst

Hemmings HC Jr, Girault JA, Williams KR, LoPresti MB, Greengard P (1989) ARPP-21, fosfoproteina regulowana cyklicznym AMP (Mr = 21,000) wzbogacona w regiony mózgu unerwione dopaminą. Sekwencja aminokwasowa miejsca fosforylowanego przez cykliczne AMP w nienaruszonych komórkach i badania kinetyczne jego fosforylacji in vitro. J Biol Chem 264:7726-7733.

Hidaka H, ​​Kobayashi R (1992) Farmakologia inhibitorów kinazy białkowej. Annu Rev Pharmacol Toxicol 32:377-397.

CrossRefMedline

Hirata H, Bessho Y, Kokubu H, Masamizu Y, Yamada S, Lewis J, Kageyama R (2004) Niestabilność białka Hes7 jest kluczowa dla zegara segmentacji somitów. Nat Genet 36:750-754.

CrossRefMedline

Hiroi N, Graybiel AM (1996) Nietypowe i typowe leczenie neuroleptyczne indukuje różne programy ekspresji czynnika transkrypcyjnego w prążkowiu. J Comp Neurol 374:70-83.

CrossRefMedline

Hope B, Kosofsky B, Hyman SE, Nestler EJ (1992) Regulacja natychmiastowej wczesnej ekspresji genu i wiązanie AP-1 w jądrze szczura accumbens przez chroniczną kokainę. Proc Natl Acad Sci USA 89:5764-5768.

Streszczenie / BEZPŁATNY pełny tekst

Hope BT, Kelz MB, Duman RS, Nestler EJ (1994a) Leczenie przewlekłego napadu elektrowstrząsowego (ECS) powoduje ekspresję długotrwałego kompleksu AP-1 w mózgu o zmienionym składzie i charakterystyce. J Neurosci 14:4318-4328.

Abstrakcyjny

Hope BT, Nye HE, Kelz MB, Self DW, Iadarola MJ, Nakabeppu Y, Duman RS, Nestler EJ (1994b) Indukcja długotrwałego kompleksu AP-1 złożonego ze zmienionych białek podobnych do Fos w mózgu przez przewlekłe leczenie kokainą i innymi przewlekłymi metodami. Neuron 13:1235-1244.

CrossRefMedline

Ishida A, Fujisawa H (1995) Stabilizacja kinazy białkowej II zależnej od kalmoduliny przez domenę autoinhibitującą. J Biol Chem 270:2163-2170.

Streszczenie / BEZPŁATNY pełny tekst

Jariel-Encontre I, Salvat C, Steff AM, Pariat M, Acquaviva C, Furstoss O, Piechaczyk M (1997) Złożone mechanizmy degradacji c-fos i c-jun. Mol Biol Rep 24:51-56.

CrossRefMedline

Jones S, Yakel JL (2003) Kinaza kazeinowa ii (kinaza białkowa ck2) reguluje funkcję kanału receptora serotoniny 5-ht (3) w komórkach ng108-15. Neuroscience 119:629-634.

CrossRefMedline

Kato T Jr, Delhase M, Hoffmann A, Karin M (2003) CK2 jest C-końcową kinazą IkappaB odpowiedzialną za aktywację NF-kappaB podczas odpowiedzi UV. Mol Cell 12:829-839.

CrossRefMedline

Kelz MB, Chen J, Carlezon WA Jr, Whisler K, Gilden L, Beckmann AM, Steffen C, Zhang YJ, Marotti L, Self DW, Tkatch T, Baranauskas G, Surmeier DJ, Neve RL, Duman RS, Picciotto MR, Nestler EJ (1999) Ekspresja czynnika transkrypcyjnego deltaFosB w mózgu kontroluje wrażliwość na kokainę. Natura 401:272-276.

CrossRefMedline

Kim KB, Myung J, Sin N, Crews CM (1999) Hamowanie proteasomu przez naturalne produkty epoksomycyna i dihydroeponemycyna: wgląd w specyficzność i moc. Bioorg Med Chem Lett 9:3335-3340.

CrossRefMedline

Kobayashi E, Nakano H, Morimoto M, Tamaoki T (1989) Calphostin C (UCN-1028C), nowy związek mikrobiologiczny, jest bardzo silnym i swoistym inhibitorem kinazy białkowej C. Biochem Biophys Res Commun 159:548-553.

CrossRefMedline

Krek W, Maridor G, Nigg EA (1992) Kinaza kazeinowa II jest głównie enzymem jądrowym. J Cell Biol 116:43-55.

Streszczenie / BEZPŁATNY pełny tekst

Krohn NM, Stemmer C, Fojan P, Grimm R, Grasser KD (2003) Kinaza białkowa CK2 fosforyluje białko domeny SSRP1 o wysokiej ruchliwości, indukując rozpoznawanie DNA uszkodzonego przez UV. J Biol Chem 278:12710-12715.

Streszczenie / BEZPŁATNY pełny tekst

Kumar A, Choi KH, Renthal W, Tsankova NM, Theobald DEH, Truong HT, Russo SJ, LaPlant Q, Whistler K, Neve RL, Self DW, Nestler EJ (2005) Przebudowa chromatyny jest kluczowym mechanizmem leżącym u podstaw plastyczności indukowanej kokainą w prążkowiu. Neuron 48:303-314.

CrossRefMedline

Lieberman DN, Mody I (1999) Kinaza kazeinowa II reguluje funkcję kanału NMDA w neuronach hipokampa. Nat Neurosci 2:125-132.

CrossRefMedline

Litchfield DW (2003) Kinaza białkowa CK2: struktura, regulacja i rola w komórkowych decyzjach życia i śmierci. Biochem J 369:1-15.

CrossRefMedline

Manabe T, Kuramoto N, Nakamichi N, Aramachi K, Baba K, Hirai T, Yoneyama M, Yoneda Y (2001) Degradacja białka c-Fos wyrażana przez N-metylo-d-kwas asparaginowy we frakcjach jądrowych mysiego hipokampa. brain Res 905:34-43.

Medline

Mandelzys A, Gruda MA, Bravo R, Morgan JI (1997) Brak utrzymującego się podwyższonego poziomu antygenu związanego z fosgenem 37 kDa i aktywności wiązania DNA podobnego do AP-1 w mózgach myszy BB traktowanych kwasem zerowym. J Neurosci 17:5407-5415.

Streszczenie / BEZPŁATNY pełny tekst

Marin O, Meggio F, Marchiori F, Borin G, Pinna LA (1986) Swoistość miejscowa kinazy kazeinowej-2 (TS) z cytozolu z wątroby szczura. Badanie z modelowymi substratami peptydowymi. Eur J Biochem 160:239-244.

McClung CA, Nestler EJ (2003) Regulacja ekspresji genów i nagrody kokainowej przez CREB i DeltaFosB. Nat Neurosci 6:1208-1215.

CrossRefMedline

McClung CA, Ulery PG, Perrotti LI, Zachariou V, Berton O, Nestler EJ (2004) DeltaFosB: molekularny przełącznik do długoterminowej adaptacji w mózgu. Brain Res Mol Brain Res 132:146-154.

Medline

Meggio F, Pinna LA (2003) Tysiąc i jeden substrat kinazy białkowej CK2? FASEB J 17:349-368.

Streszczenie / BEZPŁATNY pełny tekst

Meggio F, Donella-Deana A, Pinna LA, Moret V (1977) Fosforylacja frakcji kazeiny przez „kinazę foswitynową” wątroby szczura. FEBS Lett. 75:192-196.

Medline

Meggio F, Brunati AM, Pinna LA (1983) Autofosforylacja kinazy kazeinowej typu 2 TS zarówno w podjednostkach alfa, jak i beta. Wpływ różnych efektorów. FEBS Lett. 160:203-208.

CrossRefMedline

Meggio F, Shugar D, Pinna LA (1990) Pochodne rybofuranozylobenzimidazolu jako inhibitory kinazy kazeinowej-2 i kinazy kazeinowej-1. Eur J Biochem 187:89-94.

Medline

Meggio F, Marin O, Pinna LA (1994) Specyficzność substratu kinazy białkowej CK2. Cell Mol Biol Res 40:401-409.

Medline

Miller C, Zhang M, He Y, Zhao J, Pelletier JP, Martel-Pelletier J, Di Battista JA (1998) Indukcja transkrypcyjna genu cyklooksygenazy-2 przez hamowanie aktywności fosfatazy przez kwas okadaikowy w ludzkich chondrocytach: ko-stymulacja białek wiążących jądro AP-1 i CRE. J Cell Biochem 69:392-413.

CrossRefMedline

Moratalla R, Elibol B, Vallejo M, Graybiel AM (1996) Zmiany na poziomie sieci w ekspresji indukowalnych białek Fos-Jun w prążkowiu podczas przewlekłego leczenia i odstawienia kokainy. Neuron 17:147-156.

CrossRefMedline

Morgan JI, Curran T. (1995) Natychmiastowe wczesne geny: dziesięć lat później. Trendy Neurosci 18:66-67.

CrossRefMedline

Nakabeppu Y, Nathans D. (1991) Naturalnie występująca skrócona forma FosB, która hamuje aktywność transkrypcyjną Fos / Jun. Komórka 64:751-759.

CrossRefMedline

Nestler EJ, Barrot M, Self DW (2001) Delta FosB: trwały molekularny przełącznik uzależnienia. Proc Natl Acad Sci USA 98:11042-11046.

Streszczenie / BEZPŁATNY pełny tekst

Neve RL, Howe JR, Hong S, Kalb RG (1997) Wprowadzenie podjednostki receptora glutaminianu 1 do neuronów ruchowych in vitro i in vivo przy użyciu rekombinowanego wirusa opryszczki zwykłej. Neuroscience 79:435-447.

CrossRefMedline

Nuthall HN, Joachim K, Stifani S (2004) Fosforylacja seryny 239 z Groucho / TLE1 przez kinazę białkową CK2 jest ważna dla hamowania różnicowania neuronów. Mol Cell Biol 24:8395-8407.

Streszczenie / BEZPŁATNY pełny tekst

Okazaki K, Sagata N (1995) Szlak kinazy Mos / MAP stabilizuje c-Fos przez fosforylację i zwiększa jego aktywność transformacyjną w komórkach NIH 3T3. EMBO J 14:5048-5059.

Medline

Palombella VJ, Rando OJ, Goldberg AL, Maniatis T (1994) Szlak ubikwityna-proteasom jest wymagany do przetwarzania białka prekursorowego NF-kappa B1 i aktywacji NF-kappa B. Komórka 78:773-785.

CrossRefMedline

Papavassiliou AG, Treier M, Chavrier C, Bohmann D (1992) Ukierunkowana degradacja c-Fos, ale nie v-Fos, przez sygnał zależny od fosforylacji na c-Jun. nauka 258:1941-1944.

Streszczenie / BEZPŁATNY pełny tekst

Peakman MC, Colby C, Perrotti LI, Tekumalla P, Carle T, Ulery P, Chao J, Duman C, Steffen C, Monteggia L, Allen MR, Stock JL, Duman RS, McNeish JD, Barrot M, Self DW, Nestler EJ , Schaeffer E (2003) Indukowalna, specyficzna dla regionu mózgu ekspresja dominującego negatywnego mutanta c-Jun u myszy transgenicznych zmniejsza wrażliwość na kokainę. brain Res 970:73-86.

CrossRefMedline

Perrotti LI, Hadeishi Y, Ulery PG, Barrot M, Monteggia L, Duman RS, Nestler EJ (2004) Indukcja DeltaFosB w związanej z nagrodami strukturze mózgu po przewlekłym stresie. J Neurosci 24:10594-10602.

Streszczenie / BEZPŁATNY pełny tekst

Persico AM, Schindler CW, O'Hara BF, Brannock MT, Uhl GR (1993) Ekspresja czynnika transkrypcji mózgu: skutki ostrej i przewlekłej amfetaminy i stresu zastrzykowego. Brain Res Mol Brain Res 20:91-100.

Medline

Ploegh HL, Dunn BM (2000) Modyfikacja potranslacyjna: fosforylacja i fosfatazy. W: Aktualne protokoły w nauce o białkach (Dunn BM, wyd.) Str. 13.01–13.02. Nowy Jork: Wiley and Sons.

Pyerin W, Burow E, Michaely K, Kubler D, Kinzel V (1987) Katalityczne i molekularne właściwości wysoko oczyszczonej kinazy foswityny / kazeiny typu II z ludzkich komórek nabłonkowych w hodowli (HeLa) i związek z kinazą białkową ekto. Biol Chem Hoppe Seyler 368:215-227.

Medline

Reikhardt BA, Kulikova OG, Borisova GY, Aleksandrova IY, Sapronov NS (2003) Stan systemu „kinazy białkowej CK2-HMG14” w amnezji związanej z wiekiem u szczurów. Neurosci Behav Physiol 33:799-804.

Medline

Roberts BJ, Whitelaw ML (1999) Degradacja podstawowego receptora dioksynowego w domenie homologicznej helisa-pętla-helisa / Per-ARNT-Sim poprzez szlak ubikwityna / proteasom. J Biol Chem 274:36351-36356.

Streszczenie / BEZPŁATNY pełny tekst

Rost B, Yachdav G, Liu J (2004) Serwer PredictProtein. Nucleic Acids Res 32:W321–W326.

Streszczenie / BEZPŁATNY pełny tekst

Rylski M, Kaczmarek L (2004) Cele Ap-1 w mózgu. Front Biosci 9:8-23.

CrossRefMedline

Sahin B, Kansy JW, Nairn AC, Spychala J, Ealick SE, Fienberg AA, Greene RW, Bibb JA (2004) Charakterystyka molekularna rekombinowanej mysiej kinazy adenozynowej i ocena jako cel fosforylacji białka. Eur J Biochem 271:3547-3555.

Medline

Salvat C, Aquaviva C, Jariel-Encontre I, Ferrara P, Pariat M, Steff AM, Carillo S, Piechaczyk M (1999) Czy istnieje wiele szlaków proteolitycznych przyczyniających się do degradacji białka c-Fos, c-Jun i p53 in vivo? Mol Biol Rep 26:45-51.

CrossRefMedline

Schmidt R, Hecker E (1975) Autoutlenianie estrów forbolu w normalnych warunkach przechowywania. Cancer Res 35:1375-1377.

BEZPŁATNY pełny tekst

Schwarz EM, Van Antwerp D, Verma IM (1996) Konstytutywna fosforylacja IkappaBalpha przez kinazę kazeinową II zachodzi preferencyjnie w serynie 293: wymóg degradacji wolnego IkappaBalpha. Mol Cell Biol 16:3554-3559.

Streszczenie / BEZPŁATNY pełny tekst

Sears R, Leone G, DeGregori J, Nevins JR (1999) Ras zwiększa stabilność białka Myc. Mol Cell 3:169-179.

CrossRefMedline

Silva-Neto MA, Fialho E, Paes MC, Oliveira PL, Masuda H (2002) Fosforylacja witeliny przez niezależną od nukleotydów cykliczną kinazę kazeinową II oczyszczona z oocytów Rhodnius prolixus. Insect Biochem Mol Biol 32:847-857.

CrossRefMedline

Skinner M, Qu S, Moore C, Wisdom R (1997) Aktywacja transkrypcyjna i transformacja przez białko FosB wymagają fosforylacji domeny aktywacyjnej na końcu karboksylowym. Mol Cell Biol 17:2372-2380.

Streszczenie / BEZPŁATNY pełny tekst

Stemmer C, Schwander A, Bauw G, Fojan P, Grasser KD (2002) Kinaza białkowa CK2 różnicuje fosforylację chromosomalnych białek kukurydzy o wysokiej ruchliwości grupy B (HMGB) modulujących ich stabilność i interakcje DNA. J Biol Chem 277:1092-1098.

Streszczenie / BEZPŁATNY pełny tekst

Stevens I, Derua R, Rondelez E, Waelkens E, Merlevede W, Goris J (1999) Identyfikacja cyk, kinazy B2 cykliny, jako nowej kinazy białkowej II zależnej od wapnia / kalmoduliny i jej roli podczas dojrzewania oocytów Xenopus laevis. Exp Cell Res 252:303-318.

CrossRefMedline

Suh HW, Choi SS, Lee JK, Lee HK, Han EJ, Lee J (2004) Regulacja ekspresji genu c-fos i c-jun przez lipopolisacharyd i cytokiny w pierwotnych hodowanych astrocytach: wpływ szlaków PKA i PKC. Arch Pharm Res 27:396-401.

Medline

Szyszka R, Boguszewska A, Grankowski N, Ballesta JP (1995) Różnicowa fosforylacja rybosomalnych białek kwasowych z komórek drożdży przez dwie endogenne kinazy białkowe: kinaza kazeinowa-2 i kinaza 60S. Acta Biochim Pol 42:357-362.

Medline

Tamaoki T, Takahashi I, Kobayashi E, Nakano H, Akinaga S, Suzuki K (1990) Calphostin (UCN1028) i związki związane z kalfostyną, nowa klasa specyficznych i silnych inhibitorów kinazy białkowej C. Adv Drugi Messenger Phosphoprotein Res 24:497-501.

Medline

Torres J, Pulido R (2001) Supresor guza PTEN jest fosforylowany przez kinazę białkową CK2 na swoim C-końcu. Implikacje dla stabilności PTEN w degradacji za pośrednictwem proteasomu. J Biol Chem 276:993-998.

Streszczenie / BEZPŁATNY pełny tekst

Tsubuki S, Saito Y, Tomioka M, Ito H, Kawashima S (1996) Różnicowe hamowanie aktywności kalpainy i proteasomu przez aldehydy peptydylowe di-leucyny i tri-leucyny. J Biochem (Tokio) 119:572-576.

Streszczenie / BEZPŁATNY pełny tekst

Tsurumi C, Ishida N, Tamura T, Kakizuka A, Nishida E, Okumura E, Kishimoto T, Inagaki M, Okazaki K, Sagata N (1995) Degradacja c-Fos przez proteasom 26S jest przyspieszana przez c-Jun i wiele kinaz białkowych. Mol Cell Biol 15:5682-5687.

Streszczenie / BEZPŁATNY pełny tekst

Unger GM, Davis AT, Slaton JW, Ahmed K (2004) Kinaza białkowa CK2 jako regulator przeżycia komórek: implikacje dla terapii nowotworowej. Curr Cancer Drug Targets 4:77-84.

CrossRefMedline

Vial E, Marshall CJ (2003) Podwyższona aktywność kinazy ERK-MAP chroni członka rodziny FOS FRA-1 przed degradacją proteasomów w komórkach raka okrężnicy. J Cell Sci 116:4957-4963.

Streszczenie / BEZPŁATNY pełny tekst

Werme M, Messer C, Olson L, Gilden L, Thoren P, Nestler EJ, Brene S (2002) ΔFosB reguluje pracę koła. J Neurosci 22:8133-8138.

Streszczenie / BEZPŁATNY pełny tekst

Whitmarsh AJ, Davis RJ (2000) Regulacja funkcji czynnika transkrypcyjnego przez fosforylację. Cell Mol Life Sci 57:1172-1183.

CrossRefMedline

Winter B, Kautzner I, Issinger OG, Arnold HH (1997) Dwa przypuszczalne miejsca fosforylacji kinazy białkowej CK2 są ważne dla aktywności Myf-5. Biol Chem 378:1445-1456.

Medline

Wiśniewski JR, Szewczuk Z, Petry I, Schwanbeck R, Renner U (1999) Konstytutywna fosforylacja kwaśnych ogonów białek 1 o wysokiej ruchliwości przez kinazę kazeinową II zmienia ich konformację, stabilność i specyficzność wiązania DNA. J Biol Chem 274:20116-20122.

Streszczenie / BEZPŁATNY pełny tekst

Yamaguchi Y, Wada T, Suzuki F, Takagi T, Hasegawa J, Handa H (1998) Kinaza kazeinowa II oddziałuje z domenami bZIP kilku czynników transkrypcyjnych. Nucleic Acids Res 26:3854-3861.

Streszczenie / BEZPŁATNY pełny tekst

Yanagawa T, Yuki K, Yoshida H, Bannai S, Ishii T (1997) Fosforylacja białka stresu A170 przez aktywność kinazy kazeinowej II w makrofagach. Biochem Biophys Res Commun 241:157-163.

CrossRefMedline

Yankulov K, Yamashita K, Roy R, Egly JM, Bentley DL (1995) Inhibitor wydłużenia transkrypcji 5,6-dichloro-1-beta-d-ribofuranosylobenzimidazol hamuje kinazę białkową związaną z czynnikiem transkrypcyjnym IIH. J Biol Chem 270:23922-23925.

Streszczenie / BEZPŁATNY pełny tekst

Yen J, Wisdom RM, Tratner I, Verma IM (1991) Alternatywna splatana forma FosB jest negatywnym regulatorem aktywacji transkrypcji i transformacji przez białka Fos. Proc Natl Acad Sci USA 88:5077-5081.

Streszczenie / BEZPŁATNY pełny tekst

Yin X, Jędrzejewski PT, Jiang JX (2000) Kinaza kazeinowa II fosforyluje koneksynę soczewkową 45.6 i bierze udział w jej degradacji. J Biol Chem 275:6850-6856.

Streszczenie / BEZPŁATNY pełny tekst

Yoza BK, Brooks JW, Mizel SB (1992) Indukcja składników czynnika transkrypcyjnego AP-1 podczas aktywacji komórek T przez interleukinę 1 i estry forbolu. Wzrost komórek różni się 3:677-684.

Abstrakcyjny

Yu S, Wang H, Davis A, Ahmed K (2001) Konsekwencje sygnalizacji CK2 do macierzy jądrowej. Mol Cell Biochem 227:67-71.

CrossRefMedline

Yu S, Davis AT, Guo C, Green JE, Ahmed K (1999) Różnicowe ukierunkowanie kinazy białkowej CK2 na macierz jądrową po przejściowej nadekspresji jej podjednostek. J Cell Biochem 74:127-134.

CrossRefMedline

Zachariou V, Bolanos CA, Selley DE, Theobald D, Cassidy MP, Kelz MB, Shaw-Lutchmann T, Berton O, Sim-Selley LJ, DiLeone RJ, Kumar A, Nestler EJ (2006) ΔFosB: zasadnicza rola ΔFosB w jądrze półleżącym w działaniu morfiny. Nat Neurosci 9:205-211.

CrossRefMedline

artykuły cytujące ten artykuł

  • Zachowawcze i strukturalne reakcje na przewlekłą kokainę wymagają pętli sprzężenia zwrotnego angażującej {Delta} FosB i kinazę białkową zależną od wapnia / kalmoduliny II w powłoce Nucleus Accumbens Journal of Neuroscience, 6 March 2013, 33(10):4295-4307
  • Nadmierna ekspresja w surowicy {Delta} FosB Powtarza przewlekłe ruchy mimowolne wywoływane przez lewodopę Journal of Neuroscience, 26 May 2010, 30(21):7335-7343
  • Abstrakcyjny
  • Pełny tekst
  • Pełny tekst (PDF)
  • Abstrakcyjny
  • Pełny tekst
  • Pełny tekst (PDF)
  • Abstrakcyjny
  • Pełny tekst
  • Pełny tekst (PDF)
  • Abstrakcyjny
  • Pełny tekst
  • Pełny tekst (PDF)
  • Transkrypcyjne mechanizmy uzależnienia: rola {delta} FosB Filozoficzne transakcje Royal Society B: Biological Sciences, 12 października 2008, 363(1507):3245-3255
  • Utrzymująca się podatność na przywracanie zachowań związanych z poszukiwaniem metamfetaminy w zmutowanych myszach z neurobakteriami pochodzenia glejowego Dziennik FASEB, 1 July 2007, 21(9):1994-2004
  • Czynnik transkrypcyjny białka aktywującego-1 w karcynogenezie nabłonka oddechowego Badania nad rakiem molekularnym, 1 luty 2007, 5(2):109-120