Czynnik odpowiedzi na surowicę sprzyja odporności na przewlekły stres społeczny poprzez indukcję DeltaFosB. (2010)

UWAGI: Chociaż zarówno stres, narkotyki, jak i pewne nagrody naturalne powodują akumulację DeltaFosB, stres aktywuje różne komórki niższego szczebla, a później różne receptory i geny. Innymi słowy, uzależnienia i odporność na stres zależą od zasadniczo różnych mechanizmów

PEŁNE BADANIE

J Neurosci. 2010 Oct 27; 30 (43): 14585-92.

Vialou V, Maze I, Renthal W, LaPlant QC, Watts EL, Mouzon E, Ghose S, Tamminga CA, Nestler EJ.

Źródło

Fishberg Department of Neuroscience, Mount Sinai School of Medicine, Nowy Jork, New York 10029, USA.

Abstrakcyjny

Mechanizmy molekularne leżące u podstaw adaptacji neuronalnej wywołanej stresem i lekiem nie są w pełni zrozumiałe. Jedną cząsteczką biorącą udział w takich adaptacjach jest ΔFosB, czynnik transkrypcyjny, który gromadzi się w jądrze gryzonia półleżącym (NAc), kluczowym regionie nagrody mózgowej, w odpowiedzi na albo chroniczny stres albo powtarzające się narażenie na narkotyki. Tmechanizmy transkrypcji w górę kontrolujące indukcję ΔFosB przez te bodźce środowiskowe pozostają nieuchwytne. Tutaj identyfikujemy zależny od aktywności czynnik transkrypcyjny, czynnik odpowiedzi surowicy (SRF), jako nowatorski mediator stresu, ale nie kokaina-, indukowane ΔFosB. SRF jest obniżony w NAc zarówno depresyjnych pacjentów ludzkich, jak i myszy przewlekle narażonych na stres społeczny. To obniżenie poziomu SRF jest nieobecne u odpornych zwierząt. Dzięki zastosowaniu indukowanej mutagenezy wykazujemy, że indukowana stresem indukcja ΔFosB, która występuje głównie u myszy sprężystych, zależy od ekspresji SRF w tym regionie mózgu. Ponadto, swoista dla NAc genetyczna delecja SRF promuje wiele fenotypów prodepresantowych i proanksowych i czyni zwierzęta bardziej wrażliwymi na szkodliwe skutki przewlekłego stresu. Natomiast wykazujemy, że SRF nie odgrywa roli w akumulacji ΔFosB w NAc w odpowiedzi na chroniczną ekspozycję na kokainę. Ponadto, swoiste dla NAC knock-out SRF nie ma wpływu na zachowania indukowane kokainą, co wskazuje, że przewlekły stres społeczny i powtarzająca się ekspozycja na kokainę regulują akumulację ΔFosB i wrażliwość behawioralną poprzez niezależne mechanizmy.

Wprowadzenie

Jądro półleżące (NAc), kluczowy region nagrody mózgowej, jest ważne dla integracji wejść czuciowych i poznawczych, które kierują zachowaniami motywacyjnymi w odpowiedzi na bodźce środowiskowe (Nestler i Carlezon, 2006; Sesack and Grace, 2010). NAc jest również zaangażowany w zaburzenia behawioralne związane z uzależnieniem od narkotyków i depresją. W związku z tym wykazano, że celowanie w NAc z głęboką stymulacją mózgu łagodzi zachowania podobne do depresji i uzależnień zarówno u ludzi, jak i gryzoni (Schlaepfer i in., 2008; Vassoler i in., 2008; Heinze i in., 2009; Kuhn et al., 2009).

Powtarzająca się ekspozycja na narkotyki lub stres wywołuje zmienione wzory ekspresji genów w NAc, potencjalnie leżące u podstaw przewlekłości uzależnienia i depresji (Berton i in., 2006; Krishnan i in., 2007; Maze i in., 2010; Vialou i in. ., 2010). Co ciekawe, czynnik transkrypcyjny ΔFosB, produkt splicingowy genu fosB, akumuluje się w NAc w odpowiedzi na powtarzaną ekspozycję na lek lub stres (Nestler, 2008; Perrotti i in., 2008; Vialou i in., 2010). ΔFosB zaproponowano jako potencjalny przełącznik molekularny kierujący przejściem od używania narkotyków rekreacyjnych do chronicznie uzależnionego stanu (Nestler i in., 1999; McClung i in., 2004; Renthal i in., 2009), ponieważ jego akumulacja w NAc nasila nagradzanie odpowiedzi na kilka narkotyków. Ostatnio wyjaśniono rolę indukcji ΔFosB w NAc po przewlekłym stresie społecznym (Nikulina i in., 2008; Vialou i in., 2010): ΔFosB promuje reakcje aktywnego radzenia sobie ze stresującymi bodźcami i zwiększa odporność. Chociaż indukcja ΔFosB zachodzi w sposób zależny od bodźca, mechanizmy odpowiedzialne za indukowaną lekiem i stresem akumulację ΔFosB w NAc pozostają nieznane.

Czynnik odpowiedzi surowicy (SRF) jest czynnikiem transkrypcyjnym wymaganym do zależnej od aktywności aktywacji transkrypcyjnej kilku wczesnych genów, w tym c-fos, fosb, Egr1 i Arc (Knöll i Nordheim, 2009). Niedawne badania wykazały wpływ SRF na właściwości morfologiczne i cytoarchitektoniczne neuronów, w tym regulację aktywności synaps i tworzenie obwodów w mózgu dorosłego (Knöll i Nordheim, 2009). Te odkrycia skłoniły nas do zbadania, czy SRF jest funkcjonalnie regulowany przez przewlekłą ekspozycję na leki odurzające lub stres, a także potencjalny wpływ takiej regulacji na indukcję ΔFosB w tych warunkach.

W tym miejscu opisujemy nowy mechanizm, dzięki któremu regulacja w dół SRF w NAc promuje prodepresyjne i lękowe fenotypy, ostatecznie zwiększając podatność zwierzęcia na szkodliwe skutki przewlekłego stresu. W tych efektach pośredniczy częściowo utrata indukcji ΔFosB w NAc u zestresowanych zwierząt. Obserwowane spadki ekspresji SRF i ΔFosB w tkance NAc po śmierci uzyskane od pacjentów z depresją potwierdzają znaczenie naszych odkryć dla ludzkiej depresji. Co ciekawe, ten mechanizm kontrolujący akumulację ΔFosB wydaje się być specyficzny dla stresu: przewlekła ekspozycja na kokainę nie ma wpływu na ekspresję SRF, delecja SRF z NAc nie ma wpływu na akumulację ΔFosB po przewlekłej ekspozycji na kokainę, a taka delecja SRF nie ma wpływu na kokainę. wywołane zachowania. Ta nowatorska zależność między SRF i ΔFosB w kontekście stresu może stanowić ważny mechanizm homeostatyczny regulujący wrażliwość jednostki na przewlekły stres.

Materiały i Metody

Zwierzęta

We wszystkich eksperymentach behawioralnych i biochemicznych wykorzystano ośmiotygodniowe samce myszy C57BL / 6J (Jackson Laboratory). Wszystkie zwierzęta przyzwyczajono do obiektu dla zwierząt przez co najmniej 1 tydzień przed manipulacjami eksperymentalnymi i utrzymywano je w 23 – 25 ° C w cyklu 12 h światło / ciemność (światła od 7: 00 AM do 7: 00 PM) z ad libitum dostęp do żywności i wody. Eksperymenty przeprowadzono zgodnie z wytycznymi Society for Neuroscience i instytucjonalnego komitetu do spraw opieki i stosowania zwierząt w Mount Sinai School of Medicine.

Do eksperymentów kokainowych [Western blotting i ilościowa immunoprecypitacja chromatyny (ChIP)], wykorzystano 8-do 10-tygodniowych samców myszy C57BL / 6J. Zwierzęta otrzymały siedem codziennych dootrzewnowych wstrzyknięć soli fizjologicznej lub kokainy (20 mg / kg kokainy-HCl; Sigma). Myszy stosowano 24 h po ostatnim zabiegu. Do eksperymentów behawioralnych myszy były pojedynczo trzymane w pooperacyjnej operacji i leczone dootrzewnowo 10 mg / kg (uczulenie na ruch lokomocyjny) lub 7.5 mg / kg (preferencyjna warunkowa lokalizacja) kokaina-HCl, jak opisano poniżej.

Myszy Srffl / fl generowano jak opisano wcześniej (Ramanan i in., 2005). Knock-out specyficzny dla NAc Srf osiągnięto przez zastrzyk stereotaktyczny i następującą nadekspresję wirusową rekombinazy Cre (Cre) połączonej z białkiem zielonej fluorescencji (GFP) przy użyciu wektorów związanych z adenowirusami (AAV). Użyto samo-usuwającego się Cre. AAV-GFP wstrzyknięto zamiast AAV-Cre-GFP w myszach Srffl / fl jako kontrolę. Pokrótce, myszy znieczulono przy użyciu mieszaniny ketaminy (10 mg / kg) i ksylazyny (10 mg / kg), z następującymi współrzędnymi stereotaktycznymi stosowanymi do dostarczania wirusa: + 1.6 (przedni / tylny), + 1.5 (boczny), - 4.4 (grzbietowy / brzuszny) pod kątem 10 ° od linii środkowej (względem bregmy). Całkowitą ilość 0.5 μl oczyszczonego wirusa dostarczono obustronnie w okresie 5 min (0.1 μl / min), a następnie 5 min odpoczynku. Myszy badano 2 tygodnie po operacji, gdy ekspresja wirusa była maksymalna, a miejsca wstrzyknięcia wirusa potwierdzono dla wszystkich zwierząt stosując standardowe metody histologiczne. Skuteczność ekspresji Cre, w której pośredniczy wirus, potwierdzono immunohistochemicznie i metodą PCR z odwrotną transkryptazą na Srf przeprowadzoną na wyciętych z NA mikroskopijnych stemplach od zwierząt, którym podano AAV-Cre-GFP i AAV-GFP do NAc. Wirusy AAV-GFP i AAV-Cre-GFP wytworzono jak opisano wcześniej (Maze i wsp., 2010).

Procedury behawioralne

Stres społeczny.

Myszy C57BL / 6J poddano przewlekłemu stresowi społecznemu przez kolejne dni 10, jak opisano wcześniej (Berton i in., 2006; Krishnan i in., 2007; Vialou i in., 2010). W skrócie, każda mysz była eksponowana na nieznaną i agresywną samicę myszy hodowlanej emerytowanej CD1 dla 5 min na dzień. Po bezpośredniej interakcji z agresorem CD1, zwierzęta umieszczono następnie w sąsiednim przedziale tej samej klatki dla następnego 24 hz kontaktem sensorycznym, ale nie fizycznym. Zwierzęta kontrolne trzymano w równoważnych klatkach, ale z członkami tego samego szczepu. Testy interakcji społecznych przeprowadzono 24 h po ostatnim dniu porażki.

Unikanie społeczne wobec nieznanego samca myszy CD1 oceniano zgodnie z opublikowanymi protokołami (Berton i in., 2006; Krishnan i in., 2007; Vialou i in., 2010). Mysz doświadczalną najpierw wprowadzono na otwarte pole zawierające pustą klatkę z siatki drucianej na 2.5 min. Podczas drugiej sesji nieznany samiec CD1 został wprowadzony do okablowanej klatki. Mierzono czas spędzony w strefie interakcji (korytarz o szerokości 8 cm otaczający klatkę). Segregację pokonanych myszy na podatne i odporne subpopulacje przeprowadzono w sposób opisany wcześniej (Krishnan i in., 2007; Vialou i in., 2010). Ponieważ większość myszy kontrolnych spędzała więcej czasu na interakcji z celem społecznym niż z pustą klatką docelową, jako wartość odcięcia przyjęto współczynnik interakcji równy 100 (równy czas spędzony w strefie interakcji w obecności w porównaniu z nieobecnością celu społecznego). Myszy z punktacją <100 oznaczono jako podatne, a te z punktacją ≥100 oznaczono jako odporne. Obszerne analizy behawioralne, biochemiczne i elektrofizjologiczne potwierdzają ważność tych odrębnych podatnych i odpornych subpopulacji (Krishnan i in., 2007; Wilkinson i in., 2009; Vialou i in., 2010).

Aby zbadać podatność myszy Srffl / fl na stres społeczny, myszy, którym wstrzyknięto obustronnie AAV-GFP lub AAV-Cre-GFP, zostały poddane trzem kolejnym porażkom tego samego dnia, a następnie przetestowane pod kątem interakcji społecznych 24 h później. Ta procedura submaksymalnej porażki została wcześniej potwierdzona, aby ujawnić fenotypy wrażliwości na populację po manipulacjach genetycznych (Krishnan i in., 2007; Vialou i in., 2010).

Wyuczona bezradność.

Myszy Srffl / fl z nadekspresją AAV-GFP lub AAV-Cre-GFP poddano wyuczonej procedurze bezradności, jak opisano wcześniej (Berton i in., 2007). W skrócie, myszy były narażone na okresowe, nieuniknione wstrząsy stóp dla 1 h przez kolejne dni 2 (czas trwania 0.45 mA, czas trwania 5). W dniu testu myszy ponownie wprowadzono do pudełka dla kolejnych prób ucieczki 15. Podczas każdej próby podawano ciągły wstrząs i myszy miały możliwość ucieczki, wchodząc do sąsiedniego, nieelektryfikowanego przedziału. Po udanej ucieczce drzwi zostały automatycznie zamknięte i odnotowano opóźnienie ucieczki. Gdy myszy nie uciekły w 25, próba została zakończona i została zarejestrowana jako niepowodzenie. Wcześniejsze badania wykazały, że ekspresja wirusa w NAc i innych regionach nie ma wpływu na wyjściowe zachowanie ucieczki przy braku stresu (Newton i wsp., 2002; Berton i in., 2007).

Uczulenie narządów ruchu.

Dwa tygodnie po wstrzyknięciu do NAc AAV-GFP lub AAV-Cre-GFP, myszy Srffl / fl poddano uczuleniu lokomotorycznym. Myszy przyzwyczajano do areny lokomotorycznej przez 30 minut dziennie przez 4 dni. Po przyzwyczajeniu zwierzętom wstrzyknięto dootrzewnowo 10 mg / kg kokainy-HCl i umieszczono w komorach lokomotorycznych. Aktywność lokomotoryczną zwierząt rejestrowano przy użyciu systemu fotobramkowego (San Diego Instruments) jako ambulatoryjne zerwanie wiązki przez 30 minut dziennie. Rejestrowano uczulenie lokomotoryczne przez okres 6 dni.

Warunkowa preferencja miejsca.

Procedurę warunkowania miejscowego przeprowadzono zgodnie z wcześniejszym opisem (Maze i in., 2010), z następującymi modyfikacjami. W skrócie, 18 dni po wlewach wewnątrz-NAc AAV-GFP lub AAV-Cre-GFP u myszy Srffl / fl, zwierzęta umieszczono w komorach do kondycjonowania, które składały się z trzech odmiennych kontekstowo środowisk. Myszy wykazujące znaczną preferencję dla którejkolwiek z dwóch komór kondycjonujących wykluczono z badania (<10% wszystkich zwierząt). Grupy kondycjonujące zostały dodatkowo zrównoważone, aby dostosować się do jakichkolwiek obciążeń komory, które mogą nadal istnieć. W następnych dniach zwierzętom wstrzyknięto sól fizjologiczną i zamknięto w jednej komorze po południu na 30 minut, a następnie wstrzyknięto kokainę (7.5 mg / kg, ip) i zamknięto na 30 minut w drugiej komorze następnego dnia, co łącznie odpowiada dwie rundy treningu asocjacyjnego na zabieg (dwie pary soli fizjologicznej i dwie pary kokainy). W dniu testu myszy umieszczono z powrotem w aparacie bez leczenia na 20 minut i testowano w celu oceny preferencji bocznych. Reakcje lokomotoryczne na kokainę oceniano za pomocą przerw wiązki w komorach połączonych z kokainą, aby zapewnić skuteczność leczenia. Dla wszystkich grup oceniano wyjściową lokomocję w odpowiedzi na sól fizjologiczną, aby upewnić się, że leczenie wirusowe nie wpłynęło na lokomocję.

Inne testy behawioralne.

Myszy Srffl / fl testowano w testach otwartego, jasnego / ciemnego i wymuszonego pływania w oparciu o opublikowane protokoły (Vialou i in., 2010). Aktywność myszy w otwartym polu rejestrowano dla 5 min przy użyciu systemu śledzenia wideo (Ethovision) w warunkach czerwonego światła. W przypadku testu jasnego / ciemnego myszy mogły swobodnie badać dwukomorową skrzynkę złożoną z jednej dużej oświetlonej areny połączonej z mniejszą zamkniętą areną. Myszy badano przez okres 5 min, aby ocenić ilość czasu spędzonego w każdej obudowie. W testach otwartego i jasnego / ciemnego czas spędzony odpowiednio na arenie centralnej i świetlnej oceniano jako odwrotny wskaźnik odpowiedzi związanych z lękiem. Przeprowadzono test wymuszonego pływania 1 przez okres 5 min. Zwiększony czas bezruchu podczas testu wymuszonego pływania został zinterpretowany jako zachowanie podobne do prodepresantów. Test wymuszonego pływania 1 d był szeroko stosowany u myszy i został zwalidowany jako miara trafności predykcyjnej, ponieważ terapie przeciwdepresyjne skracają czas bezruchu.

Immunohistochemia

Myszy Srffl / fl znieczulono i perfundowano dosercowo za pomocą 4% paraformaldehydu / PBS. Mózgi usunięto i poddano krioprotekcji w sacharozie 30% / PBS. Skrawki koronalne (30 μm) cięto na mikrotomie zamrażającym i przetwarzano do analiz immunohistochemicznych. Walidację knock-out Srffl / fl przeprowadzono stosując przeciwciało poliklonalne skierowane przeciwko SRF (1 / 2000; Santa Cruz Biotechnology). Ekspresję Cre potwierdzono przez ekspresję GFP (poliklonalny kurczak, 1 / 8000, Aves Labs) w rozciętych mózgach, ponieważ Cre jest połączony z GFP. W celu ilościowego oznaczenia indukcji ΔFosB po stresie społecznym u myszy pozbawionych Srffl / nokaut wykryto ΔFosB przy użyciu króliczego przeciwciała poliklonalnego skierowanego przeciwko N-końcowemu regionowi białka (1 / 1000; Santa Cruz Biotechnology). Obrazy wykonano za pomocą mikroskopu konfokalnego (powiększenie 20 ×; Zeiss). Liczbę immunopozytywnych komórek GFP zliczonych jako ujemne i pozytywne dla immunoreaktywności ΔFosB oznaczono ilościowo w wielu obrazach dla każdego zwierzęcia, przy czym średnie wartości następnie obliczono dla każdego zwierzęcia. Każde zwierzę uznano za indywidualną obserwację do analizy statystycznej.

Ludzka tkanka poporodowa NAc

Ludzką tkankę mózgową pośmiertną uzyskano z Dallas Brain Collection, gdzie tkanki są pobierane z Dallas Medical Examiner's Office i University of Texas (UT) Southwestern's Tissue Transplant Program po uzyskaniu zgody najbliższych krewnych. Tkanki analizowano zarówno od samców, jak i samic dopasowanych pod względem wieku, okresu pośmiertnego, liczby integralności RNA (RIN) i pH. Specyficzne czynniki agonalne, w tym śpiączka, niedotlenienie, gorączka, drgawki, odwodnienie, hipoglikemia, niewydolność wielonarządowa i spożycie substancji neurotoksycznych w momencie śmierci wpływają na integralność RNA w pośmiertnych tkankach mózgu (Tomita i wsp., 2004). Zastosowaliśmy skalę czynnika agonalnego (AFS) do scharakteryzowania próbek tkanek w każdym z tych ośmiu warunków. Brakowi czynnika agonalnego przypisano punktację 0, a jego obecność oceniono jako 1, aby zapewnić całkowitą punktację AFS między 0 a 8. Tkanka z punktacją agonalną 0 lub 1 odzwierciedla próbki dobrej jakości; dane demograficzne przypadku podano w Tabeli 1. Wyjątkowa jakość tkanki została potwierdzona przez wysokie wartości RIN. Przypadki poddano standardowemu rozcięciu przed szybkim zamrożeniem w izopentanie -40 ° C i przechowywaniu w -80 ° C; dalszą sekcję NAc przeprowadzono na zamrożonej tkance. Instytucjonalna komisja rewizyjna UT Southwestern dokonała przeglądu i zatwierdziła zbiór tej tkanki do celów badawczych. Bezpośredni wywiad z informatorem został przeprowadzony dla każdego przypadku depresji w późniejszym terminie, gdzie udokumentowano informacje dotyczące choroby tego przypadku; dwaj psychiatrzy badający postawili konsensusową diagnozę dużego zaburzenia depresyjnego na podstawie kryteriów DSM-IV. Żaden z przypadków objętych tym badaniem nie miał pozytywnych wyników badań toksykologicznych krwi na obecność narkotyków, alkoholu lub leków na receptę innych niż leki przeciwdepresyjne. Pomimo leczenia przeciwdepresyjnego wszyscy pacjenci w chwili śmierci mieli depresję kliniczną. Próbki tkanek wydawano w ślepy sposób do analizy.

Tabela 1.

Dane demograficzne do badań pośmiertnych u ludzi

Western blotting

Ludzkie i mysie próbki NAc przetwarzano jak opisano wcześniej (Maze i in., 2010). Zamrożoną tkankę sonikowano w buforze do lizy 5 mM HEPES zawierającym 1% SDS z proteazą (Roche) i inhibitorami fosfatazy (Sigma). Stężenia białka określono za pomocą oznaczenia białka Dc (Bio-Rad). Równe ilości próbek białek poddano SDS-PAGE i Western blotting. Western blot sondowano przy użyciu przeciwciała do SRF (1 / 2000; Santa Cruz Biotechnology) lub GAPDH (1 / 1500; Abcam), a następnie skanowano i oznaczano ilościowo za pomocą systemu obrazowania Odyssey (Licor).

Izolacja RNA i ilościowa PCR

Izolację RNA, ilościową PCR (qPCR) i analizę danych przeprowadzono jak opisano wcześniej (Maze i wsp., 2010; Vialou i in., 2010). W skrócie, RNA izolowano za pomocą odczynnika TriZol (Invitrogen) i dalej oczyszczano za pomocą mikro zestawów RNAeasy z Qiagen. Wszystkie próbki RNA określono jako mające wartości 260 / 280 i 260 / 230 ≥1.8. Odwrotna transkrypcja została wykonana przy użyciu iScript (Bio-Rad). qPCR przy użyciu SYBR green (Quanta) przeprowadzono za pomocą systemu Applied Biosystems 7900HT RT PCR z następującymi parametrami cyklu: 2 min przy 95 ° C; Cykle 40 95 ° C dla 15 s, 59 ° C dla 30 s, 72 ° C dla 33 s; i stopniowane ogrzewanie do 95 ° C w celu wygenerowania krzywych dysocjacji dla potwierdzenia pojedynczych produktów PCR. Dane analizowano przez porównanie wartości C (t) w warunkach leczenia (myszy kontrolne i wrażliwe lub elastyczne, lub kontrole ludzkie w porównaniu z pacjentami z depresją) z metodą ΔΔC (t) (Tsankova i wsp., 2006). Startery qPCR ΔFosB: dalej, AGGCAGAGCTGGAGTCGGAGAT i odwrotnie, GCCGAGGACTTGAACTTCACTCG.

Żeton

ChIP przeprowadzono zgodnie z wcześniejszym opisem (Maze i wsp., 2010) na pulowanych dwustronnych punk- tach NAc z myszy kontrolnych, wrażliwych i sprężystych (cztery stemple 14 / mysz) 1 h po ostatnim doświadczeniu porażki iz soli fizjologicznej i kokainy- leczone zwierzęta 24 h po końcowej obróbce. Tkankę usieciowano w formaldehydzie 1%. Utrwalenie przerwano następnie przez zastosowanie glicyny, a tkankę przemyto i trzymano w -80 ° C do czasu użycia. Strzyżoną chromatynę inkubowano przez noc z przeciwciałem anty-SRF (Santa Cruz Biotechnology) uprzednio związanym z kulkami magnetycznymi (Dynabeads M-280; Invitrogen). Po odwrotnym sieciowaniu i oczyszczaniu DNA, wiązanie SRF z promotorem fosb określono przez qPCR przy użyciu starterów obejmujących region promotora fosb zawierający dwa miejsca wiązania elementu odpowiedzi surowicy. Udary SRF były znacznie wzbogacone w porównaniu z kontrolą bez przeciwciał. Startery promotora genu mysiego fosb: do przodu, CCCTCTGACGTAATTGCTAGG i do tyłu, ACCTCCCAAACTCTCCCTTC.

Analizy statystyczne

Do porównania średnich między myszami kontrolnymi, podatnymi i odpornymi w analizach biochemicznych i behawioralnych zastosowano jednokierunkowe ANOVA. Zastosowano dwukierunkowe ANOVA do porównania indukcji ΔFosB przez porażkę społeczną u myszy z lokalną nokautą Srf, a także do porównania efektu nokautu Srf w protokołach wyuczonej bezradności i uczulenia narządu ruchu. Testy t Studenta zastosowano do porównania średnich wpływu nokautu Srf na indukcję ΔFosB oraz między grupami w analizie tkanki ludzkiej i mysim ChIP. Różnice między warunkami eksperymentalnymi uznawano za istotne statystycznie, gdy p ≤ 0.05.

wyniki

Ekspresja SRF i ΔFosB w ludzkiej depresji i myszach pokonanych społecznie

Aby zbadać potencjalną rolę SRF w rozwoju zachowań typu depresyjnego, najpierw oceniliśmy ekspresję białka SRF w NAc u ludzi z depresją pośmiertną. Osoby z depresją wykazywały znacząco obniżone poziomy SRF w NAc w porównaniu z ich dobraną wiekowo grupą kontrolną (t (19) = 1.9; p <0.05) (Ryc. 1A). Biorąc pod uwagę rolę SRF w regulacji zależnej od aktywności natychmiastowej wczesnej ekspresji genów (Ramanan i wsp., 2005), postawiliśmy hipotezę, że SRF może być zaangażowany w kontrolowanie ekspresji ΔFosB w tym regionie mózgu. Na poparcie tej hipotezy zaobserwowaliśmy, że poziomy mRNA Δfosb były również znacząco obniżone w NAc ludzi z depresją (t (16) = 1.8; p <0.05) (ryc. 1B). Jest to zgodne z niedawnymi odkryciami dotyczącymi obniżonych poziomów białka ΔFosB również w tych warunkach (Vialou et al., 2010).

Rysunek 1.

Przewlekła wywołana stresem represja SRF koreluje ze zmniejszoną transkrypcją ΔFosB w NAc. Pacjenci z depresją A, B, po śmierci u ludzi wykazują obniżone poziomy ekspresji białka SRF (n = 10 / grupę; A) i Δfosb mRNA w NAc (n = 8 / grupę; B). C, Myszy poddane chronicznemu (10 dni) stresowi wynikającemu z porażki społecznej podzielono na podatne i odporne subpopulacje. D, Przewlekły społeczny stres związany z porażką zmniejsza poziom białka SRF w NAc u podatnych myszy, ale nie u myszy odpornych, w porównaniu z grupą kontrolną 24 godziny po teście interakcji społecznych pokazanym w C. E, poziomy mRNA ΔfosB w NAc są niezmienione u podatnych myszy, ale istotnie zwiększona u odpornych zwierząt (n = 7–15 / grupę). Białko F, ​​SRF wykazuje zwiększone wiązanie z promotorem genu fosb po przewlekłym stresie społecznym tylko u odpornych i niewrażliwych myszy (n = 5 / grupę). Wyświetlane dane są wyrażone jako średnia ± SEM (przedstawione jako słupki błędu). Con., Control; Dep., Przygnębiony; Sus., Podatne; Res., Sprężysty. * p <0.05 względem kontroli; *** p <0.001 względem kontroli; #p <0.05 w porównaniu z podatnymi; ## p <0.01 w porównaniu z podatnymi; ### p <0.001 w porównaniu z podatnym.

Aby rozszerzyć te wyniki, zastosowaliśmy protokół chronicznego stresu społecznego u myszy. Dwie rozróżnialne grupy pokonanych myszy, podatne i odporne, były widoczne (Krishnan et al., 2007) w oparciu o miarę unikania społecznego, w których podatne zwierzęta wykazywały znacznie zmniejszoną interakcję społeczną w porównaniu ze zwierzętami kontrolnymi i odpornymi (F (2,23, 157.2) = 0.001; p <0.001; testy t z poprawką Bonferroniego, wrażliwe vs kontrola, p <0.05; odporne vs kontrolne, p <0.01; sprężyste vs wrażliwe, p <1) (ryc.2,32C). Dwa dni po ostatnim epizodzie porażki, wrażliwe, odporne i niepokonane myszy kontrolne analizowano pod kątem ekspresji SRF w NAc. Podobnie jak w przypadku depresji u ludzi, poziomy białka SRF były znacząco obniżone u myszy podatnych na NAc w porównaniu z kontrolą, podczas gdy poziomy SRF nie uległy zmianie w NAc u myszy odpornych (F (4.7) = 0.05; p <0.05; t testy z Poprawka Bonferroniego, wrażliwi vs kontrola, p <0.05; sprężysty vs wrażliwi, p <1) (ryc. XNUMXD).

Następnie zbadaliśmy ekspresję Δfosb mRNA w NAc tych trzech grup zwierząt i zaobserwowaliśmy znaczący wzrost ekspresji Δfosb tylko u odpornych zwierząt, z tendencją, ale bez istotnego wzrostu obserwowanego u podatnych myszy (t (14) = 2.1; p <0.05 ) (Rys. 1E). Aby dokładniej zbadać możliwe interakcje między poziomami SRF a transkrypcją Δfosb, wykorzystaliśmy ChIP do zbadania, czy wiązanie SRF z promotorem genu fosb zostało zmienione po chronicznym stresie społecznym polegającym na porażce w oddzielnych kohortach podatnych i odpornych myszy. Odporne zwierzęta wykazywały znacznie zwiększone wiązanie SRF z promotorem fosb w NAc w porównaniu z kontrolami (t (8) = 2.1; p <0.05), jak również w porównaniu z wrażliwymi myszami (t (8) = 2.0; p <0.05). Nie zaobserwowano różnicy między myszami kontrolnymi i wrażliwymi, prawdopodobnie odzwierciedlając brak indukcji SRF u podatnych myszy (Fig. 1F).

Aby potwierdzić rolę SRF w regulacji ΔFosB w następstwie przewlekłego społecznego stresu związanego z porażką, do zbadania wpływu selektywnej delecji SRF z NAc na indukowanie stresu ΔFosB użyto myszy Srffl / fl. Myszom Srffl / fl stereotaktycznie wstrzyknięto do NAc wektory AAV wyrażające GFP lub Cre-GFP. Specyficzne dla NAc knock-out z SRF indukowane przez AAV-Cre-GFP potwierdzono immunohistochemicznie (Fig. 2A). Rzeczywiście, nie było nakładania się barwienia SRF i ekspresji Cre, co wskazuje na skuteczność knock-out. W mikropreparowanych stemplach NAc wykryliśmy znaczący 50% spadek poziomów białka SRF (t (11) = 4.3; p <0.001). Wielkość prawdopodobnie odzwierciedla fakt, że ułamek tkanki w takich mikrodekcjach nie jest zakażony wirusem.

Rysunek 2.

SRF pośredniczy w indukcji ΔFosB przez przewlekły społeczny stres związany z porażką. A, Wstrzyknięcie AAV-Cre-GFP do NAc myszy Srffl / fl powoduje knock-out białka SRF w neuronach wykazujących ekspresję Cre. Wstrzyknięcie AAV-GFP było bez zauważalnego efektu. B, Taka selektywna eliminacja SRF z NAc całkowicie blokuje indukcję ΔFosB w NAc w następstwie przewlekłego społecznego stresu związanego z porażką (n = 4 / grupę). Wyświetlane dane są wyrażone jako średnia ± SEM (przedstawione jako słupki błędu). * p <0.05 w porównaniu z kontrolą AAV-GFP; ** p <0.01 w porównaniu z porażką AAV-GFP.

Następnie przeprowadziliśmy ilościową immunohistochemię dla ΔFosB w NAc pokonanych myszy Srffl / fl, którym wstrzyknięto do NAc AAV-Cre-GFP lub AAV-GFP. Po przewlekłym stresie społecznym spowodowanym porażką ekspresja ΔFosB była istotnie indukowana u zwierząt, którym wstrzyknięto AAV-GFP na NAc (interakcja wirus × terapia, F (1,12) = 6.4; testy t z poprawką Bonferroniego, kontrola vs porażka, p <0.05; AAV-Cre w porównaniu z AAV-GFP, p <0.01). Jednak indukcji tej nie obserwowano u myszy Srffl / fl otrzymujących AAV-Cre-GFP (ryc. 2B), co dowodzi, że indukcja ΔFosB w NAc przez przewlekły stres wymaga SRF.

Knock-out SRF w NAc sprzyja fenotypom podobnym do prodepresji i proanksji

Ponieważ wcześniej wykazano, że indukcja ΔFosB przez przewlekły stres związany z porażką społeczną pośredniczy w odporności (Vialou i in., 2010), postawiliśmy hipotezę, że obniżenie poziomu SRF i wynikająca z tego utrata indukcji ΔFosB u podatnych zwierząt może stanowić negatywną adaptację, która ostatecznie powoduje zwierzęta bardziej narażone na szkodliwe skutki stresu. Aby przetestować tę hipotezę, wywołaliśmy lokalną specyficzną dla NAc delecję genu Srf u dorosłych myszy Srffl / fl, jak opisano powyżej, a powstałe myszy i ich kontrole przetestowano w zestawie paradygmatów behawioralnych, aby ocenić wyjściową depresję i lęk. jak zachowanie. Lokalna delecja SRF w NAc sprzyjała efektowi podobnemu do prodepresji, mierzonemu testem wymuszonego pływania (t (30) = 2.5; p <0.05), jak również efektowi lękowemu mierzonemu w otwartym polu (t (38) = 1.9; p <0.05) i testy światło / ciemność (t (8) = 1.9; p <0.05). Zatem myszy Srffl / fl otrzymujące AAV-Cre-GFP do NAc wykazywały zmniejszoną latencję do bezruchu w teście wymuszonego pływania, mniej czasu w środku otwartego pola i mniej czasu w jasnym przedziale jasnego / ciemnego pudełka w porównaniu ze zwierzętami, którym wstrzyknięto AAV-GFP (ryc. 3A – C). Jednak wewnątrz-NAc delecja SRF nie zmieniała wyjściowych poziomów lokomocji, co sugeruje, że obserwowane efekty behawioralne u zwierząt z nokautem SRF nie były spowodowane nieprawidłowościami w ogólnej aktywności lokomotorycznej (ryc. 3D). Dane te są interesujące w świetle wcześniejszych doniesień sugerujących, że chociaż ΔFosB w NAc reguluje zachowania podobne do depresyjnych, nie wydaje się być zaangażowany w reakcje związane z lękiem (Vialou i in., 2010). Nasze obecne odkrycia, że ​​utrata SRF wywołuje anksjogenne odpowiedzi sugerują, że dzieje się to poprzez cele inne niż ΔFosB.

Rysunek 3.

Eliminacja SRF z NAc promuje fenotypy podobne do prodepresji i lęku. A – C, selektywne wyłączenie SRF z NAc, osiągnięte poprzez wstrzyknięcie AAV-Cre-GFP do NAc myszy Srffl / fl, zmniejsza opóźnienie do unieruchomienia w teście wymuszonego pływania (n = 14–18 / grupę; A) i skraca czas spędzony w centrum i czas spędzony w przedziale światła odpowiednio w teście otwartego pola (B) i światła / ciemności (C) (n = 5–15 / grupę). D, Nie zaobserwowano różnicy w podstawowej aktywności lokomotorycznej w otwartym polu myszy, które otrzymały wstrzyknięcia wewnątrz NAc AAV-GFP lub AAV-Cre-GFP. E, F, zwiększona podatność na wyuczoną bezradność (n = 7–8 / grupę; E) i stres związany z porażką społeczną (n = 5–6 / grupę; F), mierzony odpowiednio opóźnieniem ucieczki i czasem interakcji społecznej . Wyświetlane dane są wyrażone jako średnia ± SEM (przedstawione jako słupki błędu). * p <0.05 w porównaniu z GFP lub w porównaniu z brakiem celu; ** p <0.01 względem GFP; *** p <0.001 w porównaniu z GFP.

Następnie zbadaliśmy, czy delecja SRF w NAc zwiększa również podatność zwierzęcia na szkodliwe skutki powtarzającego się stresu. Myszy Srffl / fl, którym wstrzyknięto AAV-Cre-GFP lub AAV-GFP do NAc, badano w dwóch modelach depresji, wyuczonej bezradności i chronicznego stresu związanego z porażką społeczną. W wyuczonej bezradności zwierzęta Srffl / fl otrzymujące AAV-Cre-GFP wykazywały zwiększoną latencję ucieczki przed wstrząsem w stopie po wcześniejszej ekspozycji na nieunikniony wstrząs w stopie (interakcja leczenie × próby, F (14,180) = 10.2; t testy z poprawką Bonferroniego, p <0.001; AAV-Cre vs AAV-GFP, p <0.01), co wskazuje na zwiększoną podatność na deficyty behawioralne wywołane stresem (ryc. 3E). Podobnie, lokalna delecja SRF z NAc również zwiększała awersję społeczną (t (10) = 1.8; p <0.05) w porównaniu ze zwierzętami kontrolnymi, którym wstrzyknięto AAV-GFP po przewlekłym stresie społecznym (Fig. 3F), efekt podobny do progresji.

Brak zaangażowania SRF w indukcję ΔFosB i reakcje behawioralne na kokainę

Biorąc pod uwagę, że ΔFosB jest również indukowany w NAc w odpowiedzi na narkotyki, takie jak kokaina, interesujące było zbadanie potencjalnej roli SRF w działaniu kokainy. W przeciwieństwie do przewlekłego społecznego stresu związanego z porażką, powtarzana ekspozycja na kokainę nie zmieniła ekspresji białka SRF w NAc (t (14) = 0.8; p> 0.05) (ryc. 4A) i nie miała wpływu na wiązanie SRF z promotorem genu fosB w tym regionie mózgu (t (4) = 0.7; p> 0.05) (Rys. 4B). Sugeruje to, że w przeciwieństwie do stresu indukcja ΔFosB po przewlekłej kokainie nie odbywa się za pośrednictwem SRF. Przetestowaliśmy to bezpośrednio, badając, czy akumulacja ΔFosB po przewlekłej kokainie jest zmieniona u zwierząt Srffl / fl otrzymujących AAV-Cre-GFP w porównaniu z AAV-GFP na NAc. Stwierdziliśmy, że delecja SRF nie miała wpływu na indukowaną kokainą akumulację ΔFosB w tym regionie mózgu (ryc. 4C).

Rysunek 4.

Utrata SRF nie miała wpływu na indukcję kokainy ΔFosB lub zachowania regulowane kokainą. A, B, powtarzana ekspozycja na kokainę (7 d, 20 mg / kg kokainy-HCl) nie miała wpływu na ekspresję białka SRF w NAc (A) lub na wiązanie SRF z promotorem genu fosB w tym regionie mózgu (B) 24 h po ekspozycja na lek (n = 5 / grupa). Na akumulację ΔFosB, mierzoną immunocytochemicznie, po przewlekłej ekspozycji na kokainę nie ma wpływu knockout SRF specyficzny dla NAc. D, E, Lokalna delecja SRF z NAc również nie miała wpływu na aktywność lokomotoryczną po wstrzyknięciu soli fizjologicznej (d 1) na indukowaną kokainą aktywność lokomotoryczną i uczulenie (n = 8 / grupa) (d 1-7; D) lub w sprawie preferencji miejsca uzależnionego od kokainy (n = 8 / grupa; E). Wyświetlane dane są wyrażone jako średnia ± SEM (przedstawione jako słupki błędów).

Aby kontynuować to zaskakujące odkrycie, zbadaliśmy, czy selektywne wyłączenie SRF z NAc zmienia reakcje behawioralne na kokainę. Zgodnie z brakiem regulacji SRF indukcji ΔFosB przez kokainę, swoisty dla NAc knock-out SRF nie miał wpływu na aktywność lokomotoryczną wywołaną ostrą kokainą lub uczuleniem lokomotorycznym obserwowaną po wielokrotnej ekspozycji na kokainę (interakcja leczenie x czas, F (4,80) = 0.3; p> 0.05) (ryc.4D). Podobnie, specyficzny dla NAc knock-out z SRF nie miał wpływu na preferencje miejsca uwarunkowane kokainą (t (14) = 0.1; p> 0.05) (ryc. 4E), co stanowi pośrednią miarę nagrody za kokainę.

Dyskusja

Badanie to zidentyfikowało SRF jako nowatorskiego mediatora ΔFosB w NAc po przewlekłym stresie społecznym i pociąga za sobą SRF w rozwoju zachowań depresyjnych i lękowych. Zapewniamy bezpośredni dowód na to, że przewlekły stres społeczny obniża poziom SRF w NAc u podatnych, ale nieodpornych zwierząt, i że ta obniżona regulacja zapobiega indukcji ΔFosB w tym obszarze mózgu, co, jak wykazaliśmy, jest niezbędne do skutecznego radzenia sobie z chronicznym stresem, tj. odporność (Vialou i in., 2010). Podobne zmniejszenie ekspresji SRF stwierdzono w NAc ludzi z depresją, gdzie mRNA i ekspresja białka mRNA ΔFos również uległa zmniejszeniu. W przeciwieństwie do tego, poziomy ΔFosB nie były zmniejszone w NAc podatnych myszy, pomimo obniżenia poziomu SRF, co implikuje inne mechanizmy transkrypcji, jak dotąd nieznane, w kontrolowaniu ekspresji ΔFosB. Przyczynową rolę SRF w pośredniczeniu indukcji ΔFosB w NAc po przewlekłym stresie ustalono przez zastosowanie indukowanej delecji genetycznej SRF z tego regionu mózgu. Analiza behawioralna myszy z tym nokautem SRF specyficznym dla NAc implikuje SRF jako odgrywającą kluczową rolę w rozwoju zachowań depresyjnych i lękowych podobnych do stanu wyjściowego i wywołanego stresem. W uderzającym kontraście, delecja SRF nie miała wpływu na indukcję ΔFosB w odpowiedzi na przewlekłe podawanie kokainy lub na behawioralne działanie kokainy. Odkrycia te potwierdzają nowatorską, specyficzną dla bodźca rolę SRF w regulacji indukcji ΔFosB i reakcji behawioralnych na różne zaburzenia środowiskowe.

Wykazano, że transkrypcja za pośrednictwem SRF odpowiada wcześniej na aktywność synaptyczną, w dużej mierze wywoływaną przez zwiększony napływ wapnia, jak również na zwiększoną aktywność neurotroficzną, zwłaszcza w przypadku czynnika neurotroficznego pochodzenia mózgowego (BDNF) (Bading i in., 1993; Xia i wsp., 1996; Johnson i in., 1997; Chang i wsp., 2004; Kalita i in., 2006; Knöll i Nordheim, 2009). Rodzi to interesujące pytanie, dlaczego SRF jest obniżony w NAc u podatnych, ale nie odpornych myszy po przewlekłym stresie społecznym. Ta różnicowa regulacja prawdopodobnie nie jest mediowana przez sygnalizację dopaminową lub BDNF, ponieważ podatne myszy wykazują zwiększone poziomy białka BDNF i zwiększają sygnalizację w dół BDNF w NAc, jak również zwiększone strzelanie wybuchowe neuronów dopaminowych brzusznej strefy nakrywkowej (VTA), które unerwiają NAc, podczas gdy elastyczne zwierzęta wykazują normalne poziomy sygnalizacji BDNF i szybkości wypalania VTA (Krishnan i in., 2007). Alternatywna możliwość polega na tym, że ekspresja SRF jest tłumiona w NAc w odpowiedzi na zmienione unerwienie glutaminergiczne tego regionu mózgu, co, jak wykazaliśmy, jest regulowane w różny sposób u myszy podatnych na sprężyste (Vialou i in., 2010). Konieczne są dalsze prace, aby bezpośrednio zbadać ten i inne możliwe mechanizmy.

Ostatnie badania z wykorzystaniem metod obejmujących cały genom i innych sugerują, że ∼5 – 10% genów docelowych SRF w neuronach to bezpośrednie wczesne geny (Philippar i in., 2004; Ramanan i in., 2005; Etkin i in., 2006; Knöll i Nordheim, 2009). Jest to zgodne z naszymi danymi wykazującymi krytyczną rolę SRF w indukcji ΔFosB, skróconego produktu wczesnego genu fosb, przez przewlekły stres. Co ciekawe, liczne docelowe geny SRF zidentyfikowane w tych różnych badaniach reprezentują również znane cele ΔFosB w NAc (Kumar i wsp., 2005; Renthal i in., 2008, 2009; Maze i in., 2010). Wśród tych powszechnie regulowanych genów jest kilka, o których wiadomo, że regulują cytoszkielet neuronalny (na przykład Cdk5, Arc i Actb). To z kolei jest zgodne z doniesieniami, że SRF wpływa na dynamikę aktyny i ruchliwość neuronów w kilku typach komórek nerwowych (Alberti i wsp., 2005; Ramanan i in., 2005; Knöll i in., 2006), podczas gdy ΔFosB jest znany wpływają na wzrost dendrytycznych kręgów neuronów NAc (Maze i in., 2010). Takie wspólne funkcjonalne punkty końcowe mogą odzwierciedlać uzgodnione efekty SRF, w połączeniu z jego indukcją ΔFosB, działając na szereg wspólnych genów docelowych, aby wpływać na morfologię neuronów i ostatecznie na złożone zachowanie.

Wykazano również, że SRF odgrywa krytyczną rolę w regulacji plastyczności synaptycznej i ekspresji genów i zachowania zależnego od aktywności neuronalnej. Na przykład utrata zależnej od SRF indukcji wczesnych wczesnych genów w odpowiedzi na dobrowolne badanie nowego środowiska lub aktywację neuronów przez napady drgawkowe była związana z upośledzonym długoterminowym wzmocnieniem synaptycznym w hipokampie mutantów Srf (Ramanan i in. , 2005; Etkin i in., 2006). Ponadto wykazano, że wyczerpanie SRF w hipokampie powoduje deficyty w długotrwałej depresji synaptycznej, natychmiastową wczesną ekspresję genu indukowaną przez nowy kontekst i upośledzoną habituację podczas eksploracji nowego środowiska (Etkin i in., 2006). Dane te określają znaczenie SRF w zdolności zwierzęcia do odpowiedniego przystosowania się do perturbacji środowiskowych, jak we wspomnianym przypadku przyzwyczajenia się do nowego środowiska lub, w przypadku adaptacji do negatywnych bodźców stresujących, w zapobieganiu rozprzestrzenianiu się stresu. indukowane deficyty behawioralne, jak w naszym obecnym badaniu. W związku z tym obserwujemy, że zwierzęta wykazujące deficyty w ekspresji SRF, albo w odpowiedzi na stres związany z porażką społeczną u podatnych osobników, albo poprzez bezpośrednie osłabienie SRF, wykazują zwiększone zachowania depresyjne i lękowe. Biorąc pod uwagę, że ludzie z depresją mają również obniżone poziomy SRF w NAc, można sobie wyobrazić, że SRF odgrywa fundamentalną rolę w regulowaniu zdolności jednostki do pozytywnej adaptacji do negatywnych bodźców środowiskowych, częściowo poprzez regulację ekspresji ΔFosB w NAc.

RÓŻNE MECHANIZMY: WALKA Z ODPORNOŚCIĄ NA STRES

Zaskakującym odkryciem niniejszego badania jest to, że chociaż SRF jest wymagany do akumulacji ΔFosB w NAc w odpowiedzi na przewlekły stres, nie jest wymagany do indukcji ΔFosB w tym samym regionie mózgu w odpowiedzi na przewlekłą kokainę. Podobnie, SRF nie jest wymagany do normalnych reakcji behawioralnych na lek. Dane te pokazują, że pomimo faktu, że ΔFosB jest indukowany w NAc w odpowiedzi na wiele rodzajów bodźców (Nestler i wsp., 1999; Nestler, 2008), wydaje się, że istnieją odrębne szlaki molekularne prowadzące do indukcji ΔFosB. Jednym z możliwych wyjaśnień tych wyników są częściowo różne typy komórek, które wykazują akumulację ΔFosB w odpowiedzi na stres wobec kokainy. Stres przewlekły indukuje ΔFosB w przybliżeniu jednakowo w obrębie dwóch głównych subpopulacji średnich neuronów kolczystych NAc, tych eksprymujących głównie D1 w stosunku do receptorów dopaminowych D2, podczas gdy przewlekła kokaina indukuje ΔFosB głównie w neuronach D1 + (Kelz i wsp., 1999; Perrotti i in., 2004, 2; Perrotti i in., XNUMX) . Zatem możliwe jest, że szlaki zależne od SRF mogą być ważne dla indukcji ΔFosB w neuronach DXNUMX +. Jednak nie wyjaśniałoby to całkowitej utraty indukcji ΔFosB u myszy z nokautem SRF po stresie przewlekłym, ponieważ indukcja zachodzi w obu podtypach neuronów. Alternatywnym wyjaśnieniem jest to, że przewlekły stres i przewlekła kokaina oddziałują na różne wewnątrzkomórkowe kaskady sygnalizacyjne, dzięki różnym trybom działania na neurony NAc, przy czym przewlekły stres może działać poprzez zmienioną transmisję glutaminergiczną, jak wspomniano wcześniej, i przewlekłą kokainę działającą głównie przez D1 sygnalizacja receptora (Nestler, 2008). Jeszcze inna możliwość polega na tym, że indukcja ΔFosB przez przewlekły stres w stosunku do przewlekłej kokainy jest zależna od różnych mechanizmów transkrypcyjnych, które są różnie kontrolowane przez różne wejścia nerwowe unerwiające NAc z różnych regionów projekcji glutaminergicznej, na przykład, kilka obszarów kory przedczołowej, hipokampa i ciała migdałowatego. Konieczne są dalsze prace, aby zbadać te i alternatywne możliwości.

Razem, nasze odkrycia identyfikują nowy mechanizm transkrypcji, poprzez który ΔFosB jest indukowany w NAc, aby pośredniczyć w odpowiedziach proreilancji na stresujące bodźce. Badanie to dostarcza również ważnego nowego wglądu w rolę odgrywaną przez SRF na poziomie NAc w regulacji zachowań depresyjnych i lękowych. Lepsze zrozumienie roli transkrypcyjnej SRF w regulacji takich zachowań pomoże w identyfikacji nowych celów genowych związanych z odpornością na zaburzenia związane ze stresem i może ułatwić przyszłe opracowywanie skuteczniejszych terapii przeciwdepresyjnych.

Praca ta była wspierana przez dotacje z Narodowego Instytutu Zdrowia Psychicznego i Narodowego Instytutu ds. Nadużywania Narkotyków oraz z sojuszu badawczego z AstraZeneca. Dziękujemy Davidowi D. Ginty za dostarczenie myszy Srffl / fl.

Korespondencję należy kierować do Erica J. Nestlera, Departamentu Neurologii w Fishberg, Szkoły Medycznej Mount Sinai, jednego miejsca Gustave L. Levy'ego, Box 1065, Nowego Jorku, NY 10029-6574. [email chroniony]

Prawa autorskie © 2010 autorzy 0270-6474 / 10 / 3014585-08 $ 15.00 / 0

Referencje

1. ↵

1. Alberti S,

2. Krause SM,

3. Kretz O,

4. Philippar U,

5. Lemberger T,

6. Casanova E,

7. Wiebel FF,

8. Schwarz H,

9. Frotscher M,

10. Schütz G,

11. Nordheim A

(2005) Migracja neuronów w mysim rostralnym strumieniu migracyjnym wymaga współczynnika odpowiedzi surowicy. Proc Natl Acad Sci USA 102: 6148 – 6153.

Streszczenie / BEZPŁATNY pełny tekst

2. ↵

1. Bading H,

2. Ginty DD,

3. Greenberg ME

(1993) Regulacja ekspresji genów w neuronach hipokampa przez różne szlaki sygnalizacji wapnia. Science 260: 181 – 186.

Streszczenie / BEZPŁATNY pełny tekst

3. ↵

1. Berton O,

2. McClung CA,

3. Dileone RJ,

4. Krishnan V,

5. Renthal W,

6. Russo SJ,

7. Graham D,

8. Tsankova NM,

9. Bolanos CA,

10. Rios M,

11. Monteggia LM,

12. Self DW,

13. Nestler EJ

(2006b) Istotna rola BDNF w mezolimbicznym szlaku dopaminowym w stresie społecznym. Science 311: 864 – 868.

Streszczenie / BEZPŁATNY pełny tekst

4. ↵

1. Berton O,

2. Covington HE 3rd.,

3. Ebner K,

4. Tsankova NM,

5. Carle TL,

6. Ulery P,

7. Bhonsle A,

8. Barrot M,

9. Krishnan V,

10. Singewald GM,

11. Singewald N,

12. Birnbaum S,

13. Neve RL,

14. Nestler EJ

(2007) Indukcja ΔFosB w szarości okołoprzewodowej przez stres sprzyja aktywnym reakcjom radzenia sobie. Neuron 55: 289 – 300.

CrossRefMedline

5. ↵

1. Chang SH,

2. Poser S,

3. Xia Z

(2004) Nowa rola czynnika odpowiedzi surowicy w przeżyciu neuronów. J Neurosci 24: 2277 – 2285.

Streszczenie / BEZPŁATNY pełny tekst

6. ↵

1. Etkin A,

2. Alarcón JM,

3. Weisberg SP,

4. Touzani K,

5. Huang YY,

6. Nordheim A,

7. Kandel ER

(2006) Rola w uczeniu się dla SRF: usuwanie w zaburzeniach przodomózgowia dorosłych LTD i tworzenie natychmiastowej pamięci nowego kontekstu. Neuron 50: 127 – 143.

CrossRefMedline

7. ↵

1. Heinze HJ,

2. Heldmann M,

3. Voges J,

4. Hinrichs H,

5. Marco-Pallares J,

6. Hopf JM,

7. Müller UJ,

8. Galazky I,

9. Sturm V,

10. Bogerts B,

11. Münte TF

(2009) Przeciwdziałanie uczulaniu motywacyjnemu w ciężkim uzależnieniu od alkoholu za pomocą głębokiej stymulacji mózgu jądra półleżącego: aspektów klinicznych i podstawowych nauk. Przód Hum Neurosci 3: 22.

Medline

8. ↵

1. Johnson CM,

2. Hill CS,

3. Chawla S,

4. Treisman R,

5. Bading H

(1997) Wapń kontroluje ekspresję genów poprzez trzy odrębne szlaki, które mogą funkcjonować niezależnie od kaskady sygnalizacji kinaz białkowych aktywowanych Ras / mitogenami (ERK). J Neurosci 17: 6189 – 6202.

Streszczenie / BEZPŁATNY pełny tekst

9. ↵

1. Kalita K,

2. Kharebava G,

3. Zheng JJ,

4. Hetman M

(2006) Rola ostrej białaczki megakarioblastycznej 1 w zależnej od ERK1 / 2 stymulacji transkrypcji zależnej od czynnika odpowiedzi surowicy przez BDNF lub zwiększonej aktywności synaptycznej. J Neurosci 26: 10020 – 10032.

Streszczenie / BEZPŁATNY pełny tekst

10. ↵

1. Kelz MB,

2. Chen J,

3. Carlezon WA Jr.,

4. Whisler K,

5. Gilden L,

6. Beckmann AM,

7. Steffen C,

8. Zhang YJ,

9. Marotti L,

10. Self DW,

11. Tkatch T,

12. Baranauskas G,

13. Surmeier DJ,

14. Neve RL,

15. Duman RS,

16. Picciotto MR,

17. Nestler EJ

(1999) Ekspresja czynnika transkrypcyjnego ΔFosB w mózgu kontroluje wrażliwość na kokainę. Natura 401: 272-276.

CrossRefMedline

11. ↵

1. Knöll B,

2. Nordheim A

(2009) Funkcjonalna wszechstronność czynników transkrypcyjnych w układzie nerwowym: paradygmat SRF. Trendy Neurosci 32: 432 – 442.

CrossRefMedline

12. ↵

1. Knöll B,

2. Kretz O,

3. Fiedler C,

4. Alberti S,

5. Schütz G,

6. Frotscher M,

7. Nordheim A

(2006) Współczynnik odpowiedzi surowicy kontroluje montaż obwodu neuronalnego w hipokampie. Nat Neurosci 9: 195 – 204.

CrossRefMedline

13. ↵

1. Krishnan V,

2. Han MH,

3. Graham DL,

4. Berton O,

5. Renthal W,

6. Russo SJ,

7. Laplant Q,

8. Graham A,

9. Lutter M,

10. Lagace DC,

11. Ghose S,

12. Reister R,

13. Tannous P,

14. Zielona TA,

15. Neve RL,

16. Chakravarty S,

17. Kumar A,

18. Eisch AJ,

19. Self DW,

20. Lee FS,

21. et al.

(2007) Molekularne adaptacje leżące u podstaw podatności i odporności na porażkę społeczną w regionach nagradzania mózgu. Cell 131: 391 – 404.

CrossRefMedline

14. ↵

1. Kuhn J,

2. Bauer R,

3. Pohl S,

4. Lenartz D,

5. Huff W,

6. Kim EH,

7. Klosterkoetter J,

8. Sturm V

(2009) Obserwacje samoistnego zaprzestania palenia po głębokiej stymulacji mózgu jądra półleżącego. Eur Addict Res 15: 196 – 201.

CrossRefMedline

15. ↵

1. Kumar A,

2. Choi KH,

3. Renthal W,

4. Tsankova NM,

5. Theobald DE,

6. Truong HT,

7. Russo SJ,

8. Laplant Q,

9. Sasaki TS,

10. Whistler KN,

11. Neve RL,

12. Self DW,

13. Nestler EJ

(2005) Przebudowa chromatyny jest kluczowym mechanizmem leżącym u podstaw plastyczności indukowanej kokainą w prążkowiu. Neuron 48: 303 – 314.

CrossRefMedline

16. ↵

1. Labirynt I,

2. Covington HE 3rd.,

3. Dietz DM,

4. LaPlant Q,

5. Renthal W,

6. Russo SJ,

7. Mechanik M,

8. Mouzon E,

9. Neve RL,

10. Haggarty SJ,

11. Ren Y,

12. Sampath SC,

13. Hurd YL,

14. Greengard P,

15. Tarakhovsky A,

16. Schaefer A,

17. Nestler EJ

(2010) Istotna rola metylotransferazy histonowej G9a w plastyczności indukowanej kokainą. Science 327: 213 – 216.

Streszczenie / BEZPŁATNY pełny tekst

17. ↵

1. McClung CA,

2. Ulery PG,

3. Perrotti LI,

4. Zachariou V,

5. Berton O,

6. Nestler EJ

(2004) DeltaFosB: molekularny przełącznik do długoterminowej adaptacji w mózgu. Brain Res Mol Brain Res 132: 146 – 154.

Medline

18. ↵

1. Nestler EJ

(2008) Transkrypcyjne mechanizmy uzależnienia: rola deltaFosB. Philos Trans R Soc Lond B Biol Sci 363: 3245 – 3255.

Streszczenie / BEZPŁATNY pełny tekst

19. ↵

1. Nestler EJ,

2. Carlezon WA Jr.

(2006) Mezolimbiczny obwód nagrody dopaminy w depresji. Psychologia biologiczna 59: 1151 – 1159.

CrossRefMedline

20. ↵

1. Nestler EJ,

2. Kelz MB,

3. Chen J

(1999) ΔFosB: molekularny mediator długoterminowej plastyczności neuronalnej i behawioralnej. Brain Res 835: 10 – 17.

CrossRefMedline

21. ↵

1. Newton SS,

2. Thome J,

3. Wallace TL,

4. Shirayama Y,

5. Schlesinger L,

6. Sakai N,

7. Chen J,

8. Neve R,

9. Nestler EJ,

10. Duman RS

(2002) Hamowanie białka wiążącego element odpowiedzi cAMP lub dynorfiny w jądrze półleżącym wywołuje efekt podobny do antydepresyjnego. J Neurosci 22: 10883 – 10890.

Streszczenie / BEZPŁATNY pełny tekst

22. ↵

1. Nikulina EM,

2. Arrillaga-Romany I,

3. Miczek KA,

4. Hammer RP Jr.

(2008) Długotrwała zmiana w strukturach mezokortykolimbicznych po wielokrotnym stresie społecznym u szczurów: przebieg czasowy mRNA receptora opioidowego mu i immunoreaktywność FosB / DeltaFosB. Eur J Neurosci 27: 2272 – 2284.

CrossRefMedline

23. ↵

1. Perrotti LI,

2. Hadeishi Y,

3. Ulery PG,

4. Barrot M,

5. Monteggia L,

6. Duman RS,

7. Nestler EJ

(2004) Indukcja ΔFosB w strukturach mózgu związanych z nagrodą po przewlekłym stresie. J Neurosci 24: 10594-10602.

Streszczenie / BEZPŁATNY pełny tekst

24. ↵

1. Perrotti LI,

2. Tkacz RR,

3. Robison B,

4. Renthal W,

5. Labirynt I,

6. Yazdani S,

7. Elmore RG,

8. Knapp DJ,

9. Selley DE,

10. Martin BR,

11. Sim-Selley L,

12. Bachtell RK,

13. Self DW,

14. Nestler EJ

(2008) Wyraźne wzory indukcji DeltaFosB w mózgu przez narkotyki. Synapse 62: 358 – 369.

CrossRefMedline

25. ↵

1. Philippar U,

2. Schratt G,

3. Dieterich C,

4. Müller JM,

5. Galgóczy P,

6. Engel FB,

7. Keating MT,

8. Gertler F,

9. Schüle R,

10. Vingron M,

11. Nordheim A

(2004) Gen docelowy SRF Fhl2 antagonizuje zależną od RhoA / MAL aktywację SRF. Mol Cell 16: 867 – 880.

CrossRefMedline

26. ↵

1. Ramanan N,

2. Shen Y,

3. Sarsfield S,

4. Lemberger T,

5. Schütz G,

6. Linden DJ,

7. Ginty DD

(2005) SRF pośredniczy w indukowanej przez aktywność ekspresji genu i plastyczności synaptycznej, ale nie w żywotności neuronów. Nat Neurosci 8: 759 – 767.

CrossRefMedline

27. ↵

1. Renthal W,

2. Carle TL,

3. Labirynt I,

4. Covington HE 3rd.,

5. Truong HT,

6. Alibhai I,

7. Kumar A,

8. Montgomery RL,

9. Olson EN,

10. Nestler EJ

(2008) Delta FosB pośredniczy w odczulaniu epigenetycznym genu c-fos po przewlekłej ekspozycji na amfetaminę. J Neurosci 28: 7344 – 7349.

Streszczenie / BEZPŁATNY pełny tekst

28. ↵

1. Renthal W,

2. Kumar A,

3. Xiao G,

4. Wilkinson M,

5. Covington HE 3rd.,

6. Labirynt I,

7. Sikder D,

8. Robison AJ,

9. LaPlant Q,

10. Dietz DM,

11. Russo SJ,

12. Vialou V,

13. Chakravarty S,

14. Kodadek TJ,

15. Stos A,

16. Kabbaj M,

17. Nestler EJ

(2009) Analiza regulacji chromatyny w całej genomie przez kokainę ujawnia rolę sirtuin. Neuron 62: 335 – 348.

CrossRefMedline

29. ↵

1. Schlaepfer TE,

2. Cohen MX,

3. Frick C,

4. Kosel M,

5. Brodesser D,

6. Axmacher N,

7. Joe AY,

8. Kreft M,

9. Lenartz D,

10. Sturm V

(2008) Głęboka stymulacja mózgu do obwodów nagradzających łagodzi anhedonię w ciężkiej depresji opornej. Neuropsychopharmacology 33: 368 – 377.

CrossRefMedline

30. ↵

1. Sesack SR,

2. Grace AA

(2010) Sieć wynagrodzeń zwojów podstawy Cortico: mikroukład. Neuropsychopharmacology 35: 27 – 47.

CrossRefMedline

31. ↵

1. Tomita H,

2. Vawter MP,

3. Walsh DM,

4. Evans SJ,

5. Choudary PV,

6. Li J,

7. Overman KM,

8. Atz ME,

9. Myers RM,

10. Jones EG,

11. Watson SJ,

12. Akil H,

13. Bunney WE Jr.

(2004) Wpływ czynników agonalnych i pośmiertnych na profil ekspresji genów: kontrola jakości w analizach mikromacierzy lub pośmiertny ludzki mózg. Biol Psychiatry 55: 346 – 352.

CrossRefMedline

32. ↵

1. Tsankova NM,

2. Berton O,

3. Renthal W,

4. Kumar A,

5. Neve RL,

6. Nestler EJ

(2006) Trwała regulacja chromatyny hipokampa w mysim modelu depresji i działania przeciwdepresyjnego. Nat Neurosci 9: 519 – 525.

CrossRefMedline

33. ↵

1. Vassoler FM,

2. Schmidt HD,

3. Gerard ME,

4. Słynny KR,

5. Ciraulo DA,

6. Kornetsky C,

7. Knapp CM,

8. Pierce RC

(2008) Głęboka stymulacja mózgu jądra półleżącego osłabia wywoływane przez kokainę przywrócenie poszukiwania leków u szczurów. J Neurosci 28: 8735 – 8739.

Streszczenie / BEZPŁATNY pełny tekst

34. ↵

1. Vialou V,

2. Robison AJ,

3. Laplant QC,

4. Covington HE 3rd.,

5. Dietz DM,

6. Ohnishi YN,

7. Mouzon E,

8. Rush AJ 3rd.,

9. Watts EL,

10. Wallace DL,

11. Iñiguez SD,

12. Ohnishi YH,

13. Steiner MA,

14. Warren BL,

15. Krishnan V,

16. Bolaños CA,

17. Neve RL,

18. Ghose S,

19. Berton O,

20. Tamminga CA,

21. Nestler EJ

(2010) ΔFosB w obwodach nagrody mózgowej pośredniczy w odporności na stres i odpowiedzi przeciwdepresyjne. Nat Neurosci 13: 745 – 752.

CrossRefMedline

35. ↵

1. Wilkinson MB,

2. Xiao G,

3. Kumar A,

4. LaPlant Q,

5. Renthal W,

6. Sikder D,

7. Kodadek TJ,

8. Nestler EJ

(2009) Leczenie imipraminą i odporność wykazują podobną regulację chromatyny w kluczowym regionie nagrody mózgowej. J Neurosci 29: 7820 – 7832.

Streszczenie / BEZPŁATNY pełny tekst

36. ↵

1. Xia Z,

2. Dudek H,

3. Miranti CK,

4. Greenberg ME

(1996) Napływ wapnia przez receptor NMDA indukuje natychmiastową wczesną transkrypcję genu przez mechanizm zależny od kinazy MAP / ERK. J Neurosci 16: 5425 – 5436.

Streszczenie / BEZPŁATNY pełny tekst