Długotrwała dieta wysokotłuszczowa Redukuje wychwyt zwrotny dopaminy bez zmieniania ekspresji genu DAT (2013)

  • Jackson J. Cone,
  • Elena H. Chartoff,
  • David N. Potter,
  • Stephanie R. Ebner,
  • Mitchell F. Roitman

Abstrakcyjny

Rozwój otyłości indukowanej dietą (DIO) może silnie zmienić wiele aspektów sygnalizacji dopaminy, w tym ekspresję transportera dopaminy (DAT) i wychwyt zwrotny dopaminy. Jednakże czas zmian wywołanych dietą w ekspresji i funkcji DAT oraz to, czy zmiany te zależą od rozwoju DIO, pozostaje nierozwiązany. Tutaj karmiliśmy szczury dietą wysokotłuszczową (HFD) lub niską (LFD) dla tygodni 2 lub 6. Po ekspozycji na dietę, szczury znieczulono uretanem, a funkcję prążkowia DAT oceniano przez elektryczną stymulację ciałek dopaminowych w brzusznym obszarze nakrywkowym (VTA) i rejestrowanie wynikających z tego zmian stężenia dopaminy w prążkowiu brzusznym za pomocą szybkiej woltamperometrii cyklicznej. Oceniliśmy również wpływ HFD na DAT związaną z błoną we frakcjach komórek prążkowia z oddzielnej grupy szczurów po ekspozycji na ten sam protokół diety. Warto zauważyć, że żadna z naszych grup terapeutycznych nie różniła się masą ciała. Stwierdziliśmy niedobór szybkości ponownego wychwytu dopaminy u szczurów HFD względem szczurów LFD po 6, ale nie tygodniach ekspozycji na dietę 2. Dodatkowo, wzrost wywołanej dopaminy po farmakologicznej prowokacji kokainą był znacząco osłabiony w HFD względem szczurów LFD. Analiza Western blot wykazała, że ​​dieta nie miała wpływu na całkowite białko DAT. Jednakże tygodnie 6 ekspozycji na HFD znacząco zmniejszyły izoformę 50 kDa DAT we frakcji związanej z błoną synaptosomalną, ale nie we frakcji związanej z recyklingiem endosomów. Nasze dane dostarczają dalszych dowodów na wywołane dietą zmiany w wychwycie dopaminy niezależnie od zmian w produkcji DAT i pokazują, że takie zmiany mogą manifestować się bez rozwoju DIO. 

Cytat: Stożek JJ, Chartoff EH, Potter DN, Ebner SR, Roitman MF (2013) Długotrwała dieta wysokotłuszczowa Redukuje wychwyt dopaminy bez zmiany ekspresji genu DAT. PLoS ONE 8 (3): e58251. doi: 10.1371 / journal.pone.0058251

Redaktor: Sidney Arthur Simon, Duke University Medical Center, Stany Zjednoczone Ameryki

Odebrane: Październik 26, 2012; Przyjęty: Luty 5, 2013; Opublikowano: 13 marca 2013 r.

Prawa autorskie: © 2013 Cone et al. Jest to artykuł o otwartym dostępie dystrybuowany zgodnie z warunkami licencji Creative Commons Attribution License, która zezwala na nieograniczone korzystanie, dystrybucję i reprodukcję na dowolnym nośniku, pod warunkiem uznania oryginalnego autora i źródła.

Finansowanie: Opisany projekt był wspierany przez National Institutes of Health (NIH), przyznawany przez DA025634 (MFR) i T32-MH067631 z Biomedical Neuroscience Training Program (JJC). Dodatkowe wsparcie zapewniło Narodowe Centrum Zasobów Badawczych i Narodowe Centrum Zaawansowanych Nauk Translacyjnych, NIH, poprzez grant UL1RR029877 (JJC) oraz Chicago Biomedical Consortium przy wsparciu Searle Funds w The Chicago Community Trust (JJC). Za treść odpowiadają wyłącznie autorzy i niekoniecznie odzwierciedlają oficjalne poglądy NIH lub Chicago Biomedical Consortium. Darczyńcy nie mieli żadnej roli w projektowaniu badań, zbieraniu i analizowaniu danych, podejmowaniu decyzji o publikacji lub przygotowaniu manuskryptu.

Konkurencyjne zainteresowania: Autorzy zadeklarowali, że nie istnieją konkurencyjne interesy.

Wprowadzenie

Nadwaga i otyłość stanowią coraz większy odsetek populacji Stanów Zjednoczonych i całego świata [1], [2]. Chociaż istnieje wiele dróg prowadzących do otyłości, być może jednym z największych zagrożeń dla zdrowej masy ciała jest powszechność i spożycie bardzo smacznych, gęsto kalorycznych pokarmów [3]. Rzeczywiście, gęstość energii (kcal / g) żywności silnie przyczynia się do nadwagi i otyłości u dorosłych [4], [5]. Smakowita żywność wywołuje uwalnianie dopaminy w prążkowiu zarówno ludzi, jak i zwierząt innych niż ludzie [6], [7], [8], [9] a subiektywne oceny umięśnienia w pożywieniu są dodatnio skorelowane z siłą odpowiedzi nerwowych w prążkowiu brzusznym [10]. Zatem dopamina i prążkowie wydają się przyczyniać do preferencji dla pokarmów gęstych energetycznie. Ostatnio wykazano, że różnice w diecie mogą powodować jednoczesne zmiany w obwodzie prążkowia i zachowania ukierunkowane na żywność [11]. Jednakże, być może mniej doceniany jest rosnący dowód, że różnice w spożywanych pokarmach, zwłaszcza w odniesieniu do tłuszczu, mogą powodować sprzężenie zwrotne i zmieniać sygnalizację dopaminową prążkowia.

Sygnalizacja dopaminowa prążkowia jest regulowana przez kilka czynników, w tym wytwarzanie dopaminy przez enzym hydroksylazę tyrozynową, pre- i postsynaptyczne receptory dopaminy oraz presynaptyczne transportery dopaminy (DAT), z których wszystkie są zaangażowane w otyłość [12], [13]. Zmiany liczby lub funkcji DAT mogą zmienić sferę wpływu uwolnionej dopaminy iw konsekwencji funkcji prążkowia [14], [15]. Wykazano, że insulina uwalniana w odpowiedzi na połknięty pokarm wpływa na funkcję DAT [16], [17]. Tak więc DAT jest jednym z prawdopodobnych kandydatów na skutki diety.

Ostatnio zbadano korelacje między otyłością a dostępnością DAT, a także zmiany funkcji DAT wywołane dietą. Wskaźnik masy ciała (BMI) jest ujemnie skorelowany z dostępnością DAT w prążkowiu człowieka [18]. Wiązanie DAT, a zatem dostępność, jest zmniejszone u myszy karmionych dietą wysokotłuszczową (HFD) [19]. Otyłość indukowana HFD (DIO) wiąże się ze zmniejszoną szybkością wychwytu zwrotnego dopaminy przez DAT u szczurów [20]. Podsumowując, badania te sugerują, że otyłość ustalona przez konsumpcję HFD może silnie wpływać na krytyczne presynaptyczne regulatory sygnałów dopaminy - zwłaszcza DAT. Jednak czas zmian wywołanych przez dietę w sygnalizacji dopaminy i to, czy rozwój DIO jest niezbędny dla zmian manifestacyjnych, pozostaje nieznany. Ocenialiśmy funkcję DAT, wywołując uwalnianie dopaminy w prążkowiu brzusznym i określając jej szybkość ponownego wychwytu u szczurów, stosując cykliczną woltamperometrię z szybkim skanowaniem. Aby ustalić, czy obniżony wychwyt zwrotny dopaminy był spowodowany zmniejszoną ekspresją genu DAT, zmierzyliśmy mRNA DAT w brzusznym obszarze nakrywkowym i istocie czarnej przy użyciu qRT-PCR w czasie rzeczywistym. Dodatkowo zastosowaliśmy procedurę frakcjonowania biochemicznego i analizę Western blot w celu oznaczenia poziomów DAT prążkowia w surowych błonach synaptosomalnych i endosomalnych. Szczury miały tygodnie 2 lub 6 diety wysokotłuszczowej lub niskotłuszczowej, ale wszystkie pomiary wykonywano przy braku DIO. Nasze wyniki sugerują, że przedłużone spożycie HFD, niezależne od DIO, zmniejsza szybkość wychwytu dopaminy w prążkowiu brzusznym bez zmniejszania ekspresji DAT.

Materiały i Metody

Oświadczenie o etykiecie

Badanie to zostało przeprowadzone w ścisłej zgodności z zaleceniami zawartymi w Przewodniku dotyczącym opieki nad zwierzętami laboratoryjnymi w National Institutes of Health. Protokół został zatwierdzony przez Komitet ds. Opieki nad Zwierzętami na University of Illinois, Chicago. Wszystkie zabiegi chirurgiczne wykonano pod znieczuleniem uretanowym i podjęto wszelkie wysiłki, aby zminimalizować cierpienie.

Tematy

Stosowano standardowe samce szczurów Sprague-Dawley (n = 67), w wieku około 2 i ważące 225-275 g po przybyciu. Zwierzęta trzymano pojedynczo w plastikowych klatkach (26.5 × 50 × 20 cm) w środowisku kontrolowanym temperaturowo (22 ° C) i wilgotności (30%) w cyklu 12∶12 h światło: ciemność (światła włączone przy 07∶00 h). Szczury zaaklimatyzowały się w ośrodku przez tydzień ad libitum dostęp do standardowej karmy laboratoryjnej i wody.

Przyjmowanie pokarmu i pomiary masy ciała

Po aklimatyzacji szczury ważono i losowo przypisywano do 1 grup 4, które były równoważone dla początkowej masy ciała. Dwie grupy utrzymywano na diecie niskotłuszczowej (LFD; Diety badawcze, New Brunswick, NJ; D12450B; 10% kilokalorii z tłuszczu (3.85 kcal / g)). Pozostałe grupy 2 utrzymywano na HFD (Diety badawcze; D12492; 60% kilokalorii z tłuszczu (5.24 kcal / g)). Dla każdej diety szczury utrzymywano przez tygodnie 2 lub 6 (wks). Tak więc, grupy 4 obejmowały: wklej LFD-2 (n = 18), wklej HFD-2 (n = 16), wklej LFD-6 (n = 16) i wklej HFD-6 (n = 17). Wszystkie grupy miały ad libitum dostęp do wody. Pomiary spożycia pokarmu i masy ciała przeprowadzono trzy razy w tygodniu, a dane podano osobno dla szczurów przechodzących zapisy woltamperometryczne lub analizę białka / wiadomości DAT.

Procedury chirurgiczne i pomiary dopaminy

Po ekspozycji na dietę podgrupę szczurów, które nie różniły się masą ciała, przygotowano do rejestracji woltamperometrycznej (LFD-2 tyg. (N = 8), HFD-2 tyg. (N = 6), LFD-6 tyg. (N = 6)) i HFD-6 tygodni (n = 7)) w znieczuleniu uretanem (1.5 g / kg) [jak w 9,21]. Kaniulę prowadzącą (Bioanalytical Systems, West Lafayette, IL) umieszczono powyżej prążkowia brzusznego (1.3 mm do przodu, 1.5 mm bocznie od bregmy), elektrodę referencyjną z chlorowanego drutu srebrnego (Ag / AgCl) wszczepiono w korze przeciwległej i obie zostały mocowany do czaszki śrubami ze stali nierdzewnej i cementem dentystycznym. Do kaniuli prowadzącej wprowadzono mikromanipulator zawierający elektrodę z włókna węglowego (CFE) i elektrodę obniżono do prążkowia brzusznego. CFE i elektrodę odniesienia podłączono do sceny i skanowano potencjał CFE w zakresie od -0.4 do +1.3 V (w porównaniu z Ag / AgCl) iz powrotem (400 V / s; 10 Hz). Dwubiegunową elektrodę stymulującą (Plastics One, Roanoke, VA) stopniowo obniżano do brzusznego obszaru nakrywki / istoty czarnej pars compacta (VTA / SNpc; 5.2 mm do tyłu, 1.0 mm w bok i początkowo 7.0 mm w kierunku brzusznym od bregmy) w odstępach co 0.2 mm . Z każdym przyrostem dostarczano ciąg impulsów prądu (60 impulsów, 4 ms na impuls, 60 Hz, 400 µA). Gdy elektroda stymulująca jest umieszczona w VTA / SNpc, a CFE znajduje się w prążkowiu, stymulacja niezawodnie wywołuje uwalnianie dopaminy - uzyskiwane z danych woltamperometrycznych przy użyciu analizy głównych składników [9], [22]; i przekształcane w stężenie po kalibracji każdego CFE w systemie wstrzykiwania przepływu po każdym eksperymencie [23]. Położenie elektrody stymulującej zostało zoptymalizowane pod kątem maksymalnego uwalniania. CFE pozostawiono następnie do osiągnięcia równowagi przez 10 min przed rozpoczęciem eksperymentu. Uwalnianie dopaminy wywołano przez stymulację elektryczną VTA / SNpc (takie same parametry jak powyżej), a wynikające z tego zmiany stężenia dopaminy obliczono od −5 s do 10 s względem stymulacji. Natychmiast po stymulacji szczurom wstrzyknięto chlorowodorek kokainy rozpuszczony w 0.9% soli fizjologicznej (10 mg / kg ip) i 10 min później, stymulację powtórzono. Zastosowane napięcia, akwizycję danych i analizę przeprowadzono przy użyciu oprogramowania napisanego w LabVIEW (National Instruments, Austin, TX, USA) [22].

Reaktywacja dopaminy

Ponowny wychwyt dopaminy modelowano za pomocą Demon Voltammetry Analysis Software (24; Wake Forest University, Winston-Salem NC). Tutaj podajemy stałą tau rozpadu jako naszą miarę szybkości wychwytu zwrotnego dopaminy. Tau jest pochodną dopasowania krzywej wykładniczej, która obejmuje większość krzywej klirensu dopaminy i jest silnie skorelowana (r = .9899) z Km, pozorne powinowactwo dopaminy do DAT [24]. Aby określić wpływ kokainy na szczytowe stężenie dopaminy, porównano wartości otrzymane przed i po podaniu (zmiana%).

Histologia

Po każdym nagraniu elektroda ze stali nierdzewnej (AM Systems # 571500, Sequim, WA) została obniżona do tej samej głębokości, co CFE, a uszkodzenie (10 µA, 4 s) zostało wykonane w celu oznaczenia miejsca zapisu. Mózgi usunięto i przechowywano w formalinie 10%. Mikroskopię świetlną zastosowano do identyfikacji miejsca uszkodzenia na przekrojach czołowych (50 µm) przez prążkowie. Wszystkie nagrania tutaj zgłoszone zostały wykonane w prążkowiu brzusznym [25].

Frakcjonowanie subkomórkowe tkanki prążkowia

Szczury (wklej LFD-2, wklej HFD-2, wklej LFD-6 i wklej HFD-6; n = 10 / grupa; brak różnicy masy ciała) zabito przez dekapitację. Frakcjonowanie biochemiczne przeprowadzono stosując protokół opisany w [26], z niewielkimi modyfikacjami. Mózgi szybko usuwano, zamrażano w izopentanie i krojono na kriostacie (HM505E, Microm, Walldorf, Niemcy, -20 ° C) aż do osiągnięcia prążkowia. Dwustronne 1-mm3 stemple przez prążkowia brzuszne (średnia masa tkanki: 15.2 mg) homogenizowano dla 20 s w 0.8 ml lodowato zimnej TEVP (10 mM Tris zasada, 5 mM NaF, 1 mM Na3VO4, 1 mM EDTA, 1 mM EGTA, pH 7.4) + bufor 320 mM sacharoza. Zachowano porcję 100 µl całkowitego homogenatu (H). Pozostałą część H odwirowano przy 800 x g dla 10 min w 4 ° C. Osad (P1, jądra i duże szczątki) ponownie zawieszono w buforze TEVP 0.2 ml i zachowano. Supernatant (S1) usunięto i umieszczono w czystej probówce na lodzie. S1 wirowano przy 9200 x g przez 15 min w 4 ° C w celu wytworzenia osadu (P2, surowe błony synaptosomalne) i supernatantu (S2). P2 przepłukano jednokrotnie buforem sacharozowym TEVP + 35.6 mM, a następnie ponownie zawieszono w 0.25 ml buforu sacharozowego TEVP + 35.6 mM, zworteksowano delikatnie dla 3 i poddano lizie osmotycznej, utrzymując próbkę na lodzie przez 30 min. Supernatant (S2) zebrano i wirowano przy 165,000 × g dla 2 h, aby wytworzyć osad (P3, błony lekkie, recykling endosomów), który ponownie zawieszono w TEVP (0.1 ml) i zapisano. Wszystkie próbki trzymano w -80 ° C do czasu elektroforezy w żelu poliakrylamidowym.

Elektroforeza żelowa i Western Blotting

Zawartość białka oznaczono przy użyciu zestawu Bio-Rad DC Protein Assay (Hercules, CA), a stężenie każdej próbki doprowadzono do 0.3 mg / ml białka. Do każdej próbki dodano bufor do próbek NuPAGE LDS (dodecylosiarczan litu) (Invitrogen, Carlsbad, CA) i 50 mM ditiotreitol przed ogrzewaniem w 70 ° C przez 10 min. Aby załadować równoważne ilości białka dla każdej frakcji, 3 µg każdej próbki załadowano do żeli NuPAGE Novex 4–12% Bis-Tris (Invitrogen) w celu rozdzielenia za pomocą elektroforezy żelowej. Białka następnie przeniesiono na membranę z polifluorku winylidenu (PVDF) (PerkinElmer Life Sciences, Boston, MA). Nieswoiste miejsca wiązania blokowano przez 2 godziny w temperaturze pokojowej w buforze blokującym (5% odtłuszczone mleko w proszku w PBS i 0.02% Tween 20 [PBS-T]). Bloty następnie inkubowano z przeciwciałem pierwszorzędowym (1–3000 mysich monoklonalnych przeciwciał anty-NR2B [nr 05–920, Millipore], 1–5000 króliczych przeciwciał anty-DAT [nr AB2231, Millipore] i 1–1000 mysich monoklonalnych receptorów anty-transferyny ( TfR) [# 13–6800, Invitrogen]. Bloty pocięto na 3 części: wysoką (> 97 kDa), średnią (46–97 kDa) i niską (<46 kDa) masę, a każdą część sondowano przeciwciałem rozpoznającym białko w tym zakresie wagowym. Pozorne masy cząsteczkowe zastosowanych przeciwciał to: NR2B, 180 kDa; DAT, 75, 64 i 50 kDa; TrfR, 95 kDa. Po sondowaniu blotów o średniej masie dla DAT, przeciwciała usunięto przez inkubację z buforem do odpędzania (62.5 mM Tris, 2% SDS, 100 mM β-merkaptoetanolu, pH 6.8) przez 15 min w 50 ° C. Bloty następnie ponownie zablokowano i sondowano anty-TfR. SeeBlue Plus 2 (Invitrogen) wstępnie wybarwione standardy analizowano w celu oszacowania masy cząsteczkowej.

Immunobloty białek analizowano przy użyciu oprogramowania Carestream Molecular Imaging Software 5.0. Intensywność netto (suma pikseli w paśmie zainteresowania minus suma pikseli tła) została określona dla każdego pasma. Aby umożliwić porównania między plamami, dane znormalizowano do kontroli LFD w 2 i 6 wks. Dane wyrażono jako średnią krotność indukcji w porównaniu z LFD ± SEM.

Ilościowa reakcja łańcuchowa polimerazy w odwrotnej transkryptazie w czasie rzeczywistym (qRT-PCR)

Po zebraniu stempli prążkowia do analizy Western blot, zamrożone mózgi podzielono koronalnie na mikrotomie aż do osiągnięcia VTA / SN. Dwustronne 1-mm3 wykonano stemple tkanki VTA i SN (średnia masa tkanki = 15.0 mg) i ekstrahowano RNA przy użyciu zestawu PureLink RNA Mini Kit (Invitrogen). Jakość i ilość RNA oceniano stosując chip Nano RNA 6000 (Agilent, Santa Clara, CA) na Agilent Bioanalyzer 2100. Liczba integralności RNA (RIN) przekroczyła 7 dla wszystkich próbek, wskazując wysoką jakość. Jeden mikrogram całkowitego RNA wykorzystano do syntezy cDNA za pomocą zestawu syntezy cDNA iScript (BioRad) w ThermoHybaid iCycler (Thermo Scientific). Startery specyficzne dla DAT (Slc6a3; starter do przodu: GGAAGCTGGTCAGCCCCTGCTT, starter Reverse: GAATTGGCGCACCTCCCCTCTG), β-aktyna (Nba; starter do przodu: AGGGAAATCGTGCGTGACAT; starter odwrotny: AAGGAAGGCTGGAAGAGAGC) i białko wiążące do skrzynki TATA (Tbp; starter do przodu: ACCTAAAGACCATTGCACTTCGTGC; : GCTCCTGTGCACACCATTTTCCC) geny (numery dostępu Genbank NM_012694, NM_031144 i NM_001004198) zostały zaprojektowane przy użyciu NCBI Primer-BLAST (http://www.ncbi.nlm.nih.gov/tools/primer-blast/) i zakupione od Integrated DNA Technologies (Coralville, Iowa). Analiza krzywej topnienia i elektroforeza w żelu poliakrylamidowym potwierdziły specyficzność starterów. Amplikony DAT, β-aktyny i Tbp to odpowiednio pary zasad 266, 182 i 136.

Zastosowano zestaw Q-PCR (iQ SybrGreen Supermix, BioRad). Reakcję przeprowadzono na systemie detekcji PCR w jednym kolorze MyiQ Real-Time PCR (BioRad) w objętości 20 µl, z 2 µL starterów 3 µM ​​do przodu i do tyłu i próbką cDNA 4 µL rozcieńczoną 1∶10. Warunki cykli PCR były 95 ° C dla 5 min; Cykle 40 przy 94 ° C dla 15 s, 60 ° dla 15 s, 72 ° C dla 15 s. Dane zbierano w temperaturze odczytu 84 ° C dla 15 s w oparciu o temperatury stopu amplikonu. Wygenerowano standardowe krzywe rozcieńczenia dla każdego zestawu starterów przez seryjne rozcieńczanie (1.00, 0.2, 0.04 i 0.008-fold) podstawowy zapas cDNA zawierający równą mieszaninę cDNA ze wszystkich grup poddanych działaniu. Dziennik10 wartości rozcieńczenia wykreślono względem wartości progowych cyklu dla krzywych standardowych. Do analizy danych wykorzystano oprogramowanie MyiQ Optical System Software (BioRad). Próbki nie zawierające matrycy cDNA i próbek z reakcji cDNA nie zawierających odwrotnej transkryptazy były prowadzone jako kontrole odpowiednio dla zanieczyszczenia i amplifikacji genomowego DNA. Podane wartości znormalizowano do średnich wartości wzorców wewnętrznych ß-aktyny i Tbp dla każdej próbki. Dane wyrażono jako średnie względne poziomy DAT / standardów wewnętrznych mRNA ± SEM.

Analizy statystyczne

Wyrażenie DAT dynamicznie zmienia się podczas cyklu życia u obu ludzi [27] i szczury [28], [29]. Ponadto dopamina i reakcja behawioralna na kokainę również się zmienia, gdy młode szczury dojrzewają [30]. Zatem pomiary DAT mogą zmieniać się wraz z wiekiem i zabraniać znaczących porównań między grupami 2 wk i 6 wk. W związku z tym grupy środków na przyjmowanie pokarmu, masę ciała, szczytowe stężenie dopaminy, zmianę tau,% i względną ekspresję genów porównywano oddzielnie dla grup 2 i 6 wk za pomocą niesparowanego testu t Studenta. Dla analiz Western blot, różnice grupowe w znormalizowanej intensywności pasma DAT porównywano oddzielnie dla grup 2 i 6 wk stosując dwukierunkową ANOVA z powtarzanymi pomiarami (dietXfraction). Wszystkie analizy statystyczne przeprowadzono w Graph Pad 5 (Prism Inc.).

wyniki

HFD promuje zwiększone spożycie tłuszczu

Przed wystąpieniem ekspozycji na dietę nie było różnic w początkowej masie ciała w 2 wk (LFD: 275.22 +/− 4.1 g; HFD: 280.87 +/− 4.8 g; p = 0.37) lub 6 tygodni (LFD: 287.31 +/− 4.9 g; HFD: 289.44 +/− 5.1 g; 6 tygodni p = 0.97) grupy. Pomimo stosowania diet o drastycznie różnym składzie, nie stwierdziliśmy różnic w masie ciała między grupami diet po 2 lub 6 tygodniach (Rys. 1a – b; oba ns). Nie było również różnicy w całkowitym zużyciu kcals pomiędzy grupami po 2 i 6 wks narażenia na dietę (Rys. 1c – d; ns). Jednak szczury HFD spożywały znacznie więcej kcal z tłuszczu (Rys. 1e – f; 2 wks: t (32) = 25.59; 6 wks: t (31) = 27.54; p<0.0001 dla obu okresów diety).

miniatur

Download:

Slajd z PowerPointa

powiększenie

oryginalny obraz

Rysunek 1. Przyjmowanie pokarmu i pomiary masy ciała.

Nie stwierdzono różnic między HFD a LFD w końcowej masie ciała (a – b) lub całkowite zużyte kilokalorie (Płyta CD) po tygodniach ekspozycji 2 lub 6 na dietę. (e – f) Szczury HFD spożywały znacznie więcej kilokalorii z tłuszczu niż szczury z LFD w obu tygodniach 2 i 6 (***p<0.001).

http://dx.doi.org/10.1371/journal.pone.0058251.g001

Przedłużony HFD Zmniejsza szybkość ponownego wychwytu DA

Nagrania woltamperometryczne wykonano w prążkowiu brzusznym (Rysunek 2). Rysunek 3 pokazuje reprezentatywne elektrycznie wywołane zmiany stężenia dopaminy uzyskane od szczurów po 6 wks diety. Na początku wielkość wywołanej dopaminy nie różniła się między grupami dietetycznymi i czasem trwania diety (Rys. 4a – b, oba ns). Jednak kontrola poszczególnych przykładów sugerowała, że ​​tempo rozpadu po szczytowym stężeniu dopaminy różniło się między grupami diet po 6 wks narażenia na dietę (Rysunek 3 a – b na przykład). Szybkość rozkładu wynika głównie z klirensu dopaminy przez DAT [31], które modelowaliśmy jako jednofazową wykładniczą w celu określenia tau. Nie było różnic między grupami diet po 2 wks narażenia na dietę (Rys. 4c). Jednakże, po 6 wks narażenia na dietę, tau był znacząco większy u szczurów HFD-6 wk w porównaniu z wklejem LFD-6 (Rys. 4d; t (11) = 2.668; p<0.05). Tak więc 6 tygodni HFD zmniejsza szybkość usuwania dopaminy w prążkowiu brzusznym w porównaniu ze zwierzętami, które spożywały LFD.

miniatur

Download:

Slajd z PowerPointa

powiększenie

oryginalny obraz

Rysunek 2. Weryfikacja histologiczna miejsc zapisu do analizy wychwytu zwrotnego.

Miejsca nagrań dla szczurów karmionych LFD są kodowane przez szare trójkąty, a dla szczurów HFD przez czarne kółka. Liczby wskazują odległość w mm przed Bregmą. Rysunek zaadaptowany z Paxinos i Watson 2006.

http://dx.doi.org/10.1371/journal.pone.0058251.g002

miniatur

Download:

Slajd z PowerPointa

powiększenie

oryginalny obraz

Rysunek 3. Elektryczna stymulacja VTA / SNc wywołuje skok fazowy w stężeniu dopaminy.

Reprezentatywne przykłady danych uzyskanych po tygodniach ekspozycji na dietę 6. a) Wykres koloru odejmowanego w tle pokazuje zmiany prądu przy różnych potencjałach elektrody przed (-5 do 0 s względem początku) i po (0.1 do 10 s względem początku) stymulacji elektrycznej (STIM) VTA / SNc. Czas to odcięta, potencjał elektrody to rzędna, a zmiany prądu są zakodowane w fałszywym kolorze. Dopamina [zidentyfikowana przez jej utlenianie (+ 0.6 V; zielony) i redukcja (−0.2 V; niebieski) cechy] przejściowo wzrosła w odpowiedzi na stymulację w tym szczurze LFD-6 wk. b) Tak samo jak w punkcie a), z wyjątkiem szczura HFD-6 wk. c) Stężenie dopaminy w funkcji czasu jest pobierane z wykresu barwnego w a), a tau jest identyfikowane przez dopasowanie krzywej. Dwie czerwone kropki oznaczają pik i stężenie dopaminy w punkcie czasowym, w którym osiąga się tau. Tau jest wskazany po prawej stronie. d) Tak samo jak w c), ale dane są pobierane z b).

http://dx.doi.org/10.1371/journal.pone.0058251.g003

miniatur

Download:

Slajd z PowerPointa

powiększenie

oryginalny obraz

Rysunek 4. Sześć tygodni diety wysokotłuszczowej zmniejsza szybkość wychwytu zwrotnego dopaminy i osłabia odpowiedź dopaminową na kokainę.

Średnie szczytowe stężenie dopaminy wywołane przez stymulację VTA / SNpc po 2 (a) lub 6 tygodni (b) ekspozycji na dietę przed wstrzyknięciem kokainy. Płyta CD) Średnia Tau po 2 (c) wks lub 6 wks (d) ekspozycji na dietę. Tau był istotnie większy dla szczurów HFD-6 wk w porównaniu ze szczurami LFD-6 wk (*p<0.05). e – f) Procentowa zmiana piku wywołała stężenie dopaminy po wstrzyknięciu kokainy dla 2 (e) i 6 (f) tygodnie ekspozycji na dietę. Procentowa zmiana była istotnie mniejsza w wklej HFD-6 w porównaniu ze szczurami LFD-6 wk (**p<0.01).

http://dx.doi.org/10.1371/journal.pone.0058251.g004

Przedłużona HFD Zmniejsza odpowiedź DA na kokainę

Aby dalej badać zmiany wywołane dietą w DAT, wstrzyknęliśmy szczury kokainą blokującą DAT. Szczytowe stężenie dopaminy po stymulacji elektrycznej jest spowodowane uwalnianiem dopaminy, ale jest również ograniczone przez jednoczesne usuwanie dopaminy przez DAT [21]. Scharakteryzowaliśmy wpływ kokainy na transmisję dopaminy, obliczając zmianę wielkości wywołanej dopaminy w stosunku do wartości sprzed leku (zmiana%). Dwa tygodnie HFD nie wpłynęły na zmianę% w stosunku do LFD (Rys. 4e; ns). Jednak po 6 wks narażenia na dietę,% zmiany był znacznie stępiony w HFD w stosunku do LFD (Rys. 4f; t (10) = 4.014; p<0.01). Nasze wyniki sugerują, że 6, ale nie 2 tygodnie ekspozycji na HFD zmniejsza odpowiedź dopaminy na kokainę.

Przedłużona ekspozycja HFD zmniejsza ekspresję białka DAT w błonach synaptosomalnych

Aby określić, czy efekty przedłużonego HFD były spowodowane zmianami liczby DAT, poziomy białka DAT oznaczono ilościowo w całkowitych homogenatach tkankowych (frakcja H), błonach synaptosomalnych (frakcja P2) i wewnątrzkomórkowych endosomach recyklingu (frakcja P3). DAT to Npołączona glikoproteina o pozornej masie cząsteczkowej między 50 i 80 kDa ze względu na rosnące poziomy glikozylacji w miarę dojrzewania białka [32]. Frakcjonowanie potwierdzono przez wzbogaconą ekspresję podjednostki NR2B receptora NMDA we frakcji błony synaptosomalnej i receptora transferyny we frakcji endosomalnej (na przykład blot see Rys. 5b). Nie stwierdzono różnic w całkowitym białku DAT po 2 i 6 wks narażenia na dietę (dane nie pokazane). Aby przetestować różnice specyficzne dla frakcji w białku DAT, wykorzystaliśmy dwukierunkową ANOVA z powtarzanymi pomiarami (dietXfraction). Zgodnie z eksperymentami woltamperometrycznymi, 2 wks narażenia na dietę był niewystarczający, aby zmienić poziom którejkolwiek z izoform DAT we frakcjach P2 lub P3 (Rys. 5. c, e, g; wszystkie ns). Jednak po 6 wks narażenia na dietę, nastąpiła znacząca interakcja dietetyczna frakcja (F(1,18) = 8.361, p<0.01); Rys. 5d) dla izoformy 50 kD DAT. Tak więc, przedłużony HFD istotnie zmniejszał izoformę 50 kD DAT we frakcji P2 i powodował tendencję do wzrostu frakcji P3. Nie stwierdziliśmy wpływu diety ani frakcji na 64 kD (Rys. 5f; ns) lub 70 kD (Rys. 5h; ns) izoformy DAT.

miniatur

Download:

Slajd z PowerPointa

powiększenie

oryginalny obraz

Rysunek 5. Spożywanie wysokotłuszczowej diety zmniejsza białko DAT związane z błoną w prążkowiu brzusznym.

a) Reprezentatywny obraz przedstawiający przebicia tkanki (2) 1 × 1 mm pobrane z prążkowia brzusznego, które zostały połączone w celu analizy białka DAT. VStr = Ventral Striatum; DStr = prążkowane grzbietowe; cc = ciało modzelowate; ac = spoidło przednie. b) Reprezentatywne Western blots danych prezentowanych w c – h. L = LFD; H = HFD; TfR = receptor transferyny; NR2B = podjednostka NR2B receptora NMDA. c) Nie było różnic w białku 50 kD DAT dla frakcji P2 lub P3 po tygodniach ekspozycji na dietę 2. d) Białko DAT o 50 kDa jest znacznie obniżone w P2 (* = p<05), ale nie frakcja P3 tkanki prążkowia brzusznego u szczurów HFD-6 tyg. W stosunku do szczurów LFD-6 tyg. Nie było różnic w białku DAT 64 kD po 2 (e) lub 6 tygodni (f) ekspozycji na dietę. Nie było różnic w białku 70 kD DAT po 2 (g) lub 6 tygodni (h) ekspozycji na dietę.

http://dx.doi.org/10.1371/journal.pone.0058251.g005

Aby określić, czy obniżone poziomy białka DAT we frakcji P2 spowodowane były, po części, zmniejszeniem transkrypcji DAT, poziomy mRNA VTA / SNc DAT zmierzono u tych samych szczurów, co powyżej (Rys. 6a na przykład). Nie zaobserwowaliśmy różnic między grupami diet w śródmózgowia mRNA DAT po 2 lub 6 wks narażenia na dietę (Rys. 6b – c; oba ns). Zatem różnice w poziomie białka DAT w prążkowiu brzusznym prawdopodobnie nie są spowodowane deficytami w produkcji DAT.

miniatur

Download:

Slajd z PowerPointa

powiększenie

oryginalny obraz

Rysunek 6. Spożywanie wysokotłuszczowej diety nie zmienia poziomu mRNA DAT. za)

Reprezentatywny obraz pokazujący stemple 1 × 1 mm pobrane z VTA / SN i połączony do analizy mRNA DAT. cp = wahadło mózgowe; pc = spoidło tylne; MM = przyśrodkowe jądro sutkowe. Nie było różnic we względnych poziomach mRNA DAT po tygodniach 2 (b) lub 6 tygodni ekspozycji na dietę (c).

http://dx.doi.org/10.1371/journal.pone.0058251.g006

Dyskusja

Długotrwałe zużycie HFD może prowadzić do DIO i plastyczności w centralnym układzie nerwowym. Neurony dopaminowe i prążkowate receptory dopaminy wydają się być jednym zestawem celów OUN, na które wpływa HFD i u osób otyłych [11], [13], [33]. Poniżej podajemy, że HFD zmniejszył tempo wychwytu zwrotnego dopaminy w prążkowiu brzusznym i efekt ten zależał od czasu trwania ekspozycji. Co ważne, wpływ HFD na funkcję DAT wystąpił przy braku DIO. Podczas gdy w tym badaniu nie mierzyliśmy bezpośrednio markerów otyłości ciała, zwierzęta tradycyjnie klasyfikowano jako DIO lub oporne na dietę wyłącznie na podstawie przyrostu masy ciała po ekspozycji na HFD [34]. Przedłużone HFD znacząco osłabiało zdolność kokainy, która zakłóca DAT, do zwiększania wielkości uwalniania dopaminy. Oceniliśmy ilościowo poziomy białka DAT w prążkowiu brzusznym za pomocą analizy Western blot - rozróżnienie między DAT zlokalizowanym we frakcjach subkomórkowych wzbogaconych w błonę plazmatyczną lub endosomy recyklingowe. Stwierdziliśmy znaczne zmniejszenie niedojrzałej izoformy DAT związanej z błoną plazmatyczną. Wydaje się zatem, że przedłużony HFD zmniejsza szybkość ponownego wychwytu dopaminy przez DAT, prawdopodobnie poprzez zakłócanie przemieszczania DAT lub może dojrzewania, ale nie przez zmniejszanie ekspresji genu DAT lub stabilności mRNA DAT. Co więcej, okres od dwóch do sześciu tygodni ekspozycji na HFD wydaje się być najwcześniejszym punktem zwrotnym dla plastyczności wywołanej dietą w odniesieniu do DAT.

Otyłość jest skorelowana z wieloma aspektami sygnalizacji dopaminy w prążkowiu, w tym z dostępnością DAT u obu ludzi [18] i myszy [19]. Jednak dopiero niedawno wykazano, że rozwój DIO zmienia szybkość wychwytu zwrotnego dopaminy u szczurów [20]. Podczas gdy badanie to wykazało upośledzony wychwyt zwrotny dopaminy po egzogennie zastosowanej dopaminie po zaledwie 4 tygodniach HFD, zwierzęta, które były utrzymywane na HFD, wybrano na podstawie początkowego przyrostu masy ciała, a zatem mogły reprezentować unikalną populację. Zgodnie z tym poglądem, zwierzęta HFD nadal jedzą więcej kalorii i zyskują większą masę w porównaniu z kontrolami LFD. W innym niedawnym badaniu odnotowano upośledzony wychwyt zwrotny dopaminy po tygodniach HND po 12 u szczurów hodowlanych [35]. Istniały jednak znaczne różnice w masie ciała między zwierzętami karmionymi HFD a standardową dietą laboratoryjną, gdy wykonywano pomiary wychwytu zwrotnego. W związku z tym nie było jasne, czy zaburzenia wychwytu zwrotnego dopaminy pojawiają się jako bezpośredni skutek, czy poprzedzają rozwój DIO. W przeciwieństwie do tych ostatnich doniesień, nie stwierdziliśmy różnic w masie ciała ani całkowitej konsumpcji kcal pomiędzy naszymi grupami dietetycznymi, gdy wykonywano pomiary wychwytu zwrotnego. To, że stwierdziliśmy różnice w wychwycie dopaminy po 6, ale nie w 2, w tygodniach HFD sugeruje, że wywołane dietą zmiany w wychwycie dopaminy są odpowiedzią na przewlekłe, ale nie ostre zmiany składu diety. Ponadto nasze wyniki sugerują, że zamiast być wynikiem otyłości, zmiany DAT wywołane dietą mogą przyczynić się do rozwoju choroby. Przyszłe badania będą musiały dotyczyć tego, czy populacje zwierząt są podatne na DIO w różny sposób [34] mają wcześniej istniejące różnice w ekspresji / funkcji DAT lub są różnie podatne na zmiany wywołane dietą w DAT.

Według naszej wiedzy jest to pierwsze badanie wykazujące, że HFD zmniejsza odpowiedź na dopaminę na kokainę. Biorąc pod uwagę rolę dopaminy w nagradzaniu narkotyków, nasze wyniki są zgodne z wcześniejszymi pracami, które pokazują, że szczury karmione HFD przez około 6 tygodni są wolniejsze w zdobywaniu kokainy przez samoleczenie niż zwierzęta karmione dietą kontrolną [36]. Co ważne, efekt ten był również niezależny od rozwoju DIO. Ponadto szczury selektywnie hodowane w celu uzyskania wrażliwości na DIO wykazują obniżoną preferencję miejsca kokainy, co sugeruje, że satysfakcjonujące właściwości kokainy są stępione u tych zwierząt [37]. Zmniejszona odpowiedź na kokainę obserwowana u szczurów HFD-6 może być spowodowana zmniejszoną dostępnością DAT w prążkowiu. Jednak kokaina zwiększa również sygnalizację dopaminy poprzez mechanizmy niezależne od DAT. W szczególności HFD może mieć zaburzoną indukowaną kokainą mobilizację rezerw pęcherzyków dopaminy [38]. Kokaina osłabia również transmisję GABA na neurony dopaminowe w obrębie VTA [39] i indukuje oscylacje szybkości zapłonu ciał komórek dopaminowych [40]. Dowolny lub wszystkie z tych procesów również mogły zostać dotknięte przez HFD. Przyszłe badania będą musiały zająć się mechanizmami leżącymi u podstaw tego, w jaki sposób HFD modyfikuje satysfakcjonujące aspekty kokainy i / lub potencjał adaptacji nerwowej wywołanej lekami [18]. Zużycie HFD osłabia zarówno zachowanie [41] i odpowiedź na dopaminę [20], [42] do amfetaminy, która również koliduje z DAT. Co ważne, szczury, których spożycie HFD było kalorycznie dopasowane do szczurów karmionych dietą kontrolną, nie rozwijają DIO, ale nadal nie rozwijają preferencji miejsca uzależnionego od amfetaminy [41]. Wraz z prezentowanymi tutaj danymi wydaje się, że konsumpcja HFD osłabia reakcję na psychostymulanty. Wszystkie narkotyki wpływają na układ dopaminowy, a indukowane przez narkotyki wzmocnienie sygnalizacji dopaminy uważa się za kluczowe dla rozwoju uzależnienia [43]. Tak więc zmniejszona odpowiedź na kokainę u szczurów z HFD jest zgodna z doniesieniami, że otyli ludzie mają znacznie niższe ryzyko dożywotniego rozwoju zaburzenia uzależnienia od substancji [44]. Przyszłe prace będą musiały zająć się tym, czy subiektywna ocena nagrody za kokainę różni się u osób otyłych w porównaniu z normalną kontrolą wagi.

Nasza analiza western blot sugeruje, że przedłużone spożycie HFD nie wpływa na całkowite białko DAT prążkowia, ale zamiast tego zmniejsza integrację nieglikozylowanej izoformy 50 kDa DAT do błon synaptosomalnych. Podczas gdy glikozylacja DAT poprawia szybkość transportu dopaminy i zwiększa stabilność powierzchni błony [45], [46], [47], nieglikozylowany DAT od ludzi [45], [46] jak również szczury [47] łatwo transportuje dopaminę. Ponadto eksperymenty związane z znakowaniem immunologicznym ujawniają, że poziomy nieglikozylowanego DAT są wyższe w brzusznym porównaniu z prążkowiem grzbietowym u małp i ludzi [47]. Podsumowując, badania te sugerują, że obniżony poziom błon XTUMX kDa DAT może przyczynić się do deficytu wychwytu zwrotnego obserwowanego u szczurów HFD 50 wk. Nasze dane są zgodne z wcześniejszym badaniem pokazującym, że spożycie HFD zmniejsza dostępność DAT w prążkowiu brzusznym myszy [19]. Jednak to badanie nie mierzyło lokalizacji DAT w różnych przedziałach wewnątrzkomórkowych. Dodatkowo, nasze odkrycia są zgodne z badaniem pokazującym redukcję DAT na powierzchni komórek w prążkowiu szczurów DIO [20]. Badanie to wykazało również, że dieta w modelu DIO nie miała wpływu na całkowite poziomy białka DAT. Rozszerzamy to odkrycie, aby pokazać, że całkowite białko DAT jest również odporne na HFD u szczurów hodowlanych. Dlatego przedłużone spożywanie HFD nie zmienia ekspresji DAT, ale może zakłócać ruch DAT lub dojrzewanie.

Brak różnic w poziomach mRNA VTA / SNpc DAT po 2 lub 6 wks ekspozycji HFD dodatkowo potwierdza pogląd, że nasze manipulacje dietą nie wpłynęły na ogólne poziomy DAT. Wynik ten kontrastuje z poprzednim raportem pokazującym zmniejszone mRNA DAT w VTA myszy po tygodniach spożycia HFD przez 17 [12]. Jednak w tym badaniu poziomy mRNA DAT mierzono po tym, jak grupy diet różniły się masą ciała dla 12 tygodni. Tak więc ich wyniki prawdopodobnie reprezentują adaptacje późnego etapu do DIO. Podsumowując, nasze dane dostarczają mocnych dowodów na to, że ekspozycja na HFD prowadzi do funkcjonalnych zmian w wychwycie dopaminy w prążkowiu poprzez zmniejszenie DAT związanych z błoną bez zmiany całkowitej ekspresji DAT. Co ważne, stwierdzamy, że zaburzenia DAT wywołane dietą mogą wystąpić przed wystąpieniem DIO, co sugeruje, że zmiany te mogą przyczynić się do rozwoju otyłości.

Nasze dane stanowią uzupełnienie rosnącej literatury dotyczącej diety w regulacji funkcji dopaminy i dostarczają dalszych dowodów na to, że wywołane dietą zmiany w ekspresji DAT prowadzą do istotnych funkcjonalnie zmian w sygnalizacji dopaminy. Wywołane przez dietę zmiany dynamiki sygnalizacji dopaminowej prążkowia przez DAT mogą mieć konsekwencje dla zachowania żywieniowego. Bodźce związane z pokarmem wywołują fazowe wzrosty dopaminy w prążkowiu [9], [48], [49], które prawdopodobnie wzmacniają i wzmacniają działania ukierunkowane na żywność [50]. Tutaj pokazujemy, że tygodnie 6 spożycia HFD wydłużają czas trwania fazowego uwalniania dopaminy poprzez zmniejszenie DAT związanych z błoną w obszarze prążkowia, gdzie funkcja dopaminy jest niezbędna do przyjmowania pokarmu [51]. Zależne od diety zmiany w DAT mogą promować mechanizm wyprzedzający, w którym przedłużone sygnały dopaminowe wywołane przez bodźce pokarmowe zwiększają aktywację receptorów dopaminy D1 prążkowia o niskim powinowactwie, które są krytyczne dla zachowania podejścia [52], [53], [54]. Z biegiem czasu przedłużone podwyższenie dopaminy w prążkowiu może sprzyjać adaptacjom, takim jak obniżenie poziomu receptorów dopaminy D2 (D2R), co zostało wykazane zarówno w modelach otyłości u ludzi, jak i w gryzoniach [11], [33]. Nasze badanie sugeruje, że rozwój otyłości nie jest niezbędny do zmiany wychwytu zwrotnego dopaminy. Tak więc związane z dietą obniżenie DAT w błonie może poprzedzać i przyczyniać się do zmniejszenia poziomu D2R, otyłości i kompulsywnych zachowań związanych z jedzeniem, które rozwijają się w trakcie konsumpcji HFD [11].

Podziękowanie

Chcemy podziękować dr. Jamie D. Roitman i James E. McCutcheon za pomocne komentarze na temat wcześniejszych wersji rękopisu. Za treść tego dokumentu odpowiadają wyłącznie autorzy i niekoniecznie odzwierciedlają oficjalne poglądy NIH lub Chicago Biomedical Consortium.

Autorskie Wkłady

Opracowano i zaprojektowano eksperymenty: JJC EHC MFR. Wykonał eksperymenty: JJC DNP SRE. Przeanalizowano dane: JJC EHC SRE MFR. Napisał artykuł: JJC EHC MFR.

Referencje

  1. 1. Flegal KM, Carroll MD, Kit BK, Ogden CL (2012) Rozpowszechnienie otyłości i trendy w dystrybucji wskaźnika masy ciała wśród dorosłych w USA, 1999 – 2010. JAMA 307: 491 – 497.
  2. 2. Ogden CL, Carroll MD, Curtin LR, McDowell MA, Tabak CJ i in. (2006) Częstość występowania nadwagi i otyłości w Stanach Zjednoczonych, 1999 – 2004. JAMA 295: 1549 – 1555.
  3. Zobacz artykuł
  4. PubMed / NCBI
  5. Google Scholar
  6. 3. Drewnowski A, Almiron-Roig E (2010) Ludzkie postrzeganie i preferencje dla pokarmów bogatych w tłuszcz. W: Montmayeur JP, le Coutre J, redaktorzy. Wykrywanie tłuszczu: smak, tekstura i efekty po spożyciu, Rozdział 11. Boca Raton, Floryda: CRC Press.
  7. Zobacz artykuł
  8. PubMed / NCBI
  9. Google Scholar
  10. Zobacz artykuł
  11. PubMed / NCBI
  12. Google Scholar
  13. Zobacz artykuł
  14. PubMed / NCBI
  15. Google Scholar
  16. Zobacz artykuł
  17. PubMed / NCBI
  18. Google Scholar
  19. Zobacz artykuł
  20. PubMed / NCBI
  21. Google Scholar
  22. Zobacz artykuł
  23. PubMed / NCBI
  24. Google Scholar
  25. Zobacz artykuł
  26. PubMed / NCBI
  27. Google Scholar
  28. Zobacz artykuł
  29. PubMed / NCBI
  30. Google Scholar
  31. Zobacz artykuł
  32. PubMed / NCBI
  33. Google Scholar
  34. Zobacz artykuł
  35. PubMed / NCBI
  36. Google Scholar
  37. Zobacz artykuł
  38. PubMed / NCBI
  39. Google Scholar
  40. Zobacz artykuł
  41. PubMed / NCBI
  42. Google Scholar
  43. Zobacz artykuł
  44. PubMed / NCBI
  45. Google Scholar
  46. Zobacz artykuł
  47. PubMed / NCBI
  48. Google Scholar
  49. Zobacz artykuł
  50. PubMed / NCBI
  51. Google Scholar
  52. Zobacz artykuł
  53. PubMed / NCBI
  54. Google Scholar
  55. Zobacz artykuł
  56. PubMed / NCBI
  57. Google Scholar
  58. Zobacz artykuł
  59. PubMed / NCBI
  60. Google Scholar
  61. Zobacz artykuł
  62. PubMed / NCBI
  63. Google Scholar
  64. Zobacz artykuł
  65. PubMed / NCBI
  66. Google Scholar
  67. Zobacz artykuł
  68. PubMed / NCBI
  69. Google Scholar
  70. 4. Rolls BJ (2009) Związek między gęstością energii w diecie a spożyciem energii. Physiology & Behavior 97: 609–15.
  71. 5. Ledikwe JH, Blanck HM, Kettel Khan L, Serdula MK, Seymour JD, et al. (2006) Gęstość energii w diecie jest związana z poborem energii i statusem wagi u dorosłych w USA. American Journal of Clinical Nutrition 83: 1362 – 8.
  72. Zobacz artykuł
  73. PubMed / NCBI
  74. Google Scholar
  75. Zobacz artykuł
  76. PubMed / NCBI
  77. Google Scholar
  78. Zobacz artykuł
  79. PubMed / NCBI
  80. Google Scholar
  81. Zobacz artykuł
  82. PubMed / NCBI
  83. Google Scholar
  84. Zobacz artykuł
  85. PubMed / NCBI
  86. Google Scholar
  87. Zobacz artykuł
  88. PubMed / NCBI
  89. Google Scholar
  90. Zobacz artykuł
  91. PubMed / NCBI
  92. Google Scholar
  93. Zobacz artykuł
  94. PubMed / NCBI
  95. Google Scholar
  96. Zobacz artykuł
  97. PubMed / NCBI
  98. Google Scholar
  99. Zobacz artykuł
  100. PubMed / NCBI
  101. Google Scholar
  102. Zobacz artykuł
  103. PubMed / NCBI
  104. Google Scholar
  105. Zobacz artykuł
  106. PubMed / NCBI
  107. Google Scholar
  108. Zobacz artykuł
  109. PubMed / NCBI
  110. Google Scholar
  111. Zobacz artykuł
  112. PubMed / NCBI
  113. Google Scholar
  114. Zobacz artykuł
  115. PubMed / NCBI
  116. Google Scholar
  117. Zobacz artykuł
  118. PubMed / NCBI
  119. Google Scholar
  120. Zobacz artykuł
  121. PubMed / NCBI
  122. Google Scholar
  123. Zobacz artykuł
  124. PubMed / NCBI
  125. Google Scholar
  126. Zobacz artykuł
  127. PubMed / NCBI
  128. Google Scholar
  129. Zobacz artykuł
  130. PubMed / NCBI
  131. Google Scholar
  132. Zobacz artykuł
  133. PubMed / NCBI
  134. Google Scholar
  135. Zobacz artykuł
  136. PubMed / NCBI
  137. Google Scholar
  138. Zobacz artykuł
  139. PubMed / NCBI
  140. Google Scholar
  141. Zobacz artykuł
  142. PubMed / NCBI
  143. Google Scholar
  144. Zobacz artykuł
  145. PubMed / NCBI
  146. Google Scholar
  147. Zobacz artykuł
  148. PubMed / NCBI
  149. Google Scholar
  150. Zobacz artykuł
  151. PubMed / NCBI
  152. Google Scholar
  153. Zobacz artykuł
  154. PubMed / NCBI
  155. Google Scholar
  156. 6. Mały DM, Jones-Gotman M, Dagher A (2003) Wywołane karmieniem uwalnianie dopaminy w prążkowiu grzbietowym koreluje z ocenami przyjemności posiłku u zdrowych ochotników. NeuroImage 19: 1709 – 1715.
  157. 7. Bassero V, Di Chiara G (1999) Różnicowa reaktywność przenoszenia dopaminy na bodźce pokarmowe w jądrze półleżącym półleżącym. Neuroscience 89: 637 – 41.
  158. 8. Roitman MF, Wheeler RA, Wightman RM, Carelli RM (2008) Reakcje chemiczne w czasie rzeczywistym w jądrze półleżącym różnicują bodźce nagradzające i awersyjne. Nature Neuroscience 11: 1376 – 7.
  159. 9. Brown HD, McCutcheon JE, Cone JJ, Ragozzino ME, Roitman MF (2011) Podstawowe bodźce nagradzające żywność i przewidujące nagrody wywołują różne wzorce fazowej sygnalizacji dopaminy w prążkowiu. The European Journal of Neuroscience 34: 1997 – 2006.
  160. 10. Grabenhorst F, Rolls ET, Parris BA, d 'Souza AA (2010) Jak mózg przedstawia wartość nagrody tłuszczu w ustach. Cerebral Cortex 20: 1082 – 91.
  161. 11. Johnson PM, Kenny PJ (2010) Receptory dopaminy D2 w dysfunkcji nagradzania podobnego do uzależnienia i kompulsywnym jedzeniu u otyłych szczurów. Nature Neuroscience 13: 635 – 41.
  162. 12. Vucetic Z, Carlin JL, Totoki K, Reyes TM (2012) Epigenetyczne rozregulowanie układu dopaminowego w otyłości indukowanej dietą. Journal of neurochemistry 120: 891 – 84.
  163. 13. Stice E, Spoor S, Bohon C, Mały DM (2008) Relacja między otyłością a osłabioną odpowiedzią prążkowia na pokarm jest moderowana przez allel TaqIA A1. Science 322: 449 – 452.
  164. 14. Cragg SJ, Rice ME (2004) Tańcząc obok DAT w synapsie DA. Trendy w neurologii 27: 270 – 7.
  165. 15. Dreyer JK, Herrik KF, Berg RW, Hounsgaard JD (2010) Wpływ fazowego i tonicznego uwalniania dopaminy na aktywację receptora. The Journal of Neuroscience 30: 14273 – 83.
  166. 16. Figlewicz DP, Szot P, Chavez M, Woods SC, Veith RC (1994) Insulina wewnątrzkomorowa zwiększa mRNA transportera dopaminy w szczurzym VTA / istocie czarnej. Brain Research 644: 331 – 4.
  167. 17. Mebel DM, Wong JC, Dong YJ, Borgland SL (2012) Insulina w brzusznym obszarze nakrywkowym zmniejsza żywienie hedoniczne i hamuje stężenie dopaminy poprzez zwiększenie wychwytu zwrotnego. The European Journal of Neuroscience 36: 2336 – 46.
  168. 18. Chen PS, Yang YK, Yeh TL, Lee IH, Yao WJ i in. (2008) Korelacja między wskaźnikiem masy ciała a dostępnością transportera dopaminy w prążkowiu u zdrowych ochotników - badanie SPECT. NeuroImage 40: 275 – 9.
  169. 19. South T, Huang XF (2008) Ekspozycja na wysokotłuszczową dietę zwiększa receptor dopaminy D2 i zmniejsza gęstość wiązania receptora transportera dopaminy w jądrze półleżącym i skorupie ogona myszy. Badania neurochemiczne 33: 598 – 605.
  170. 20. Speed ​​N, Saunders C, Davis AR, Owens WA, Matthies HJG, et al. (2011) Upośledzona sygnalizacja Akt prążkowia zakłóca homeostazę dopaminy i zwiększa karmienie. PloS jeden 6: e25169.
  171. 21. Roitman MF, Wescott S, Cone JJ, McLane MP, Wolfe HR (2010) MSI-1436 zmniejsza ostre przyjmowanie pokarmu bez wpływu na aktywność transportera dopaminy. Farmakologia Biochemia i zachowanie 97: 138 – 43.
  172. 22. Heien MLAV, Johnson MA, Wightman RM (2004) Rozpoznawanie neuroprzekaźników wykrytych przez woltamperometrię cykliczną z szybkim skanowaniem. Chemia analityczna 76: 5697 – 704.
  173. 23. Sinkala E, McCutcheon JE, Schuck MJ, Schmidt E, Roitman MF, et al. (2012) Kalibracja elektrody za pomocą mikroprzepływowej komory przepływowej do szybkiej cyklicznej woltamperometrii. Laboratorium na chipie 12: 2403 – 08.
  174. 24. Yorgason JT, España RA, Jones SR (2011) Woltamperometria i oprogramowanie do analizy demonów: analiza indukowanych kokainą zmian w sygnalizacji dopaminy za pomocą wielu miar kinetycznych. Journal of neuroscience methods 202: 158 – 64.
  175. 25. Paxinos G i Franklin KBJ (2004) Mózg szczura o współrzędnych stereotaktycznych. San Diego, CA: Academic Press.
  176. 26. Hallett PJ, Collins TL, Standaert DG, Dunah AW (2008) Biochemiczne frakcjonowanie tkanki mózgowej do badań dystrybucji receptorów i handlu nimi. Aktualne protokoły w radzie naukowej / redakcyjnej, Jacqueline N. Crawley… [i in.] Rozdział 1: Jednostka 1.16.
  177. 27. Meng SZ, Ozawa Y, Itoh M, Takashima S (1999) Zmiany rozwojowe i związane z wiekiem w transporcie dopaminy oraz receptory dopaminy D1 i D2 w ludzkich zwojach podstawy mózgu. Brain Research 843: 136 – 144.
  178. 28. Moll GH, Mehnert C, Wicker M, Bock N, Rothenberger A, i in. (2000) Związane z wiekiem zmiany gęstości gęstości presynaptycznych transporterów monoamin w różnych regionach mózgu szczura od wczesnego życia młodzieńczego do późnej dorosłości. Rozwój Brain Research 119: 251 – 257.
  179. 29. Cruz-Muros I, Afonso-Oramas D, Abreu P, Perez-Delgado MM, Rodriguez M, i in. (2009) Wpływ starzenia na ekspresję transportera dopaminy i mechanizmy kompensacyjne. Neurobiologia starzenia się 30: 973 – 986.
  180. 30. Badanich KA, Adler KJ, Kirstein CL (2006) Młodzież różni się od dorosłych w warunkowanej kokainą preferencji miejsca i indukowanej kokainą dopaminy w jądrze półleżącym. European Journal of Pharmacology 550: 95 – 106.
  181. 31. Jones SR, Garris PA, Kilts CD, Wightman RM (1995) Porównanie wychwytu dopaminy w jądrze podstawno-bocznym ciała migdałowatego, skorupie ogoniastej i jądrze półleżącym szczura. Journal of neurochemistry 64: 2581 – 9.
  182. 32. Rao A, Simmons D, Sorkin A (2011) Różnicowa subkomórkowa dystrybucja przedziałów endosomalnych i transporter dopaminy w neuronach dopaminergicznych. Molekularna i komórkowa neurologia 46: 148 – 58.
  183. 33. Wang GJ, Volkow ND, Thanos PK, Fowler JS (2009) Obrazowanie mózgowych szlaków dopaminowych: implikacje dla zrozumienia otyłości. Journal of Addiction Medicine 3: 8 – 18.
  184. 34. Levin BE, Dunn-Meynell AA, Balkan B, Keesey RE (1997) Hodowla selektywna dla otyłości spowodowanej dietą i odporności u szczurów Sprague-Dawley. American Journal of Physiology 273: R725 – 730.
  185. 35. Morris JK, Bomhoff GL, Gorres BK, Davis VA, Kim J i in. (2011) Oporność na insulinę upośledza nigrostriatalną funkcję dopaminy. Eksperymentalna neurologia 231: 171 – 80.
  186. 36. Wellman PJ, Nation JR, Davis KW (2007) Upośledzenie nabywania samopodawania kokainy u szczurów utrzymujących dietę wysokotłuszczową. Farmakologia, biochemia i zachowanie 88: 89 – 93.
  187. 37. Thanos PK, Kim R, Cho J, Michaelides M, Anderson BJ i wsp. (2010) Szczury S5B odporne na otyłość wykazywały większą preferencję miejsca uwarunkowanego kokainą niż szczury OM podatne na otyłość. Fizjologia i zachowanie 101: 713–8.
  188. 38. Venton BJ, Seipel AT, Phillips PEM, Wetsel WC, Gitler D, i in. (2006) Kokaina zwiększa uwalnianie dopaminy przez mobilizację rezerwy zależnej od synapsyny. The Journal of Neuroscience 26: 4901 – 04.
  189. 39. Steffenson SC, Taylor SR, Horton ML, Barber EN, Lyte LT (2008) Kokaina hamuje neurony dopaminowe w brzusznym obszarze tegmenal poprzez zależną od użycia blokadę neuronów sodowych wrażliwych na neurony GABA. European Journal of Neuroscience 28: 2028 – 2040.
  190. 40. Shi WX, Pun CL, Zhou Y (2004) Psychostymulanty indukują oscylacje o niskiej częstotliwości w aktywności strzelania neuronów dopaminowych. Neuropsychopharmacology 29: 2160 – 2167.
  191. 41. Davis JF, Tracy AL, Schurdak JD, Tschop MH, Lipton JW, i in. (2008) Narażenie na podwyższone poziomy tłuszczu w diecie osłabia psychostymulującą nagrodę i mezolimbiczny obrót dopaminy u szczura. Behawioralna Neuroscience 122: 1257 – 63.
  192. 42. Geiger BM, Haburcak M, Avena NM, Moyer MC, Hoebel BG i in. (2009) Deficyty mezolimbicznej neurotransmisji dopaminy w otyłości dietetycznej u szczurów. Neuroscience 159: 1193 – 9.
  193. 43. Hyman SE, Malenka RC, Nestler EJ (2006) Neuralne mechanizmy uzależnienia: rola nauki i pamięci związanej z nagrodami. Uzależnienie 29: 565 – 598.
  194. 44. Simon GE, Von Korff M, Saunders K, Miglioretti DL, Crane PK, et al. (2006) Związek między otyłością a zaburzeniami psychicznymi w dorosłej populacji USA. Archives of General Psychiatry 63: 824 – 30.
  195. 45. Torres GE, Carneiro A, Seamans K, Fiorentini C, Sweeney A, et al. (2003) Oligomeryzacja i transport ludzkiego transportera dopaminy. The Journal of Biological Chemistry 278: 2731 – 2739.
  196. 46. Li LB, Chen N, Ramamoorthy S, Chi L, Cui XN i in. (2004) Rola N-glikozylacji w funkcji i ruchu powierzchni ludzkiego transportera dopaminy. The Journal of Biological Chemistry 279: 21012 – 21020.
  197. 47. Afonso-Oramas D, Cruz-Muros I, de la Rosa DA, Abreu P, Giraldez T, i in. (2009) Glikozylacja transportera dopaminy koreluje z wrażliwością komórek dopaminergicznych śródmózgowia w chorobie Parkinsona. Neurobiologia choroby 36: 494 – 508.
  198. 48. Roitman MF, Stuber GD, Phillips PEM, Wightman RM, Carelli RM (2004) Dopamina działa jako drugi modulator poszukiwania pożywienia. The Journal of Neuroscience 24: 1265 – 71.
  199. 49. McCutcheon JE, Beeler JA, Roitman MF (2012) Sygnały predykcyjne dla sacharozy wywołują większe fazowe uwalnianie dopaminy niż sygnały przewidujące sacharynę. Synapse 66: 346 – 51.
  200. 50. Flagel SB, Clark JJ, Robinson TE, Mayo L, Czuj A, i in. (2011) Selektywna rola dopaminy w nauce o nagradzaniu bodźców. Nature 469: p53 – 7d.
  201. 51. Szczypka MS, Mandel RJ, Donahue BA, Snyder RO, Leff SE, et al. (1999) Dostarczanie genu wirusowego selektywnie przywraca karmienie i zapobiega śmiertelności myszy z niedoborem dopaminy. Neuron 22: 167 – 78.
  202. 52. Di Ciano P, Cardinal RN, Cowell RA, Little SJ, Everitt BJ (2001) Zaangażowanie NMDA, AMPA / kainianu i receptorów dopaminowych w jądro półleżące w nabyciu i działaniu zachowania podejścia pavlovian. Journal of Neuroscience 21: 9471 – 9477.
  203. 53. Kravitz AV, Freeze BS, Parker PRL, Kay K, Thwin MT, et al. (2010) Regulacja zachowań motorycznych parkinsonizmu poprzez kontrolę optogenetyczną obwodów jąder podstawnych. Nature 466: 622 – 6.
  204. 54. Kravitz AV, Tye LD, Kreitzer AC (2012) Różne role neuronów prążkowia w zbrojeniu bezpośrednim i pośrednim. Nature Neuroscience 15: 816 – 818.