Reglarea stabilității DeltaFosB prin fosforilare (2006)

J Neurosci. 2006 May 10;26(19):5131-42.

Ulery PG, Rudenko G, Nestler EJ.

Sursă

Departamentul de Psihiatrie, Centrul pentru Neuroștiințe de Bază, Universitatea din Texas Southwestern Medical Center, Dallas, Texas 75390-9070, SUA.

Abstract

Factorul de transcriere DeltaFosB (denumit și FosB2 sau FosB [formă scurtă]) este un mediator important al plasticității pe termen lung indus în creier prin expunerea cronică la mai multe tipuri de stimuli psihoactivi, inclusiv medicamente de abuz, stres și convulsii electroconvulsive. . O caracteristică distinctă a DeltaFosB este că, odată indusă, persistă în creier pentru perioade relativ lungi de timp, în absența stimulării ulterioare. Mecanismele care stau la baza acestei aparente stabilități au rămas însă necunoscute. Aici, demonstrăm că DeltaFosB este un factor de transcripție relativ stabil, cu un timp de înjumătățire de aproximativ 10 h în cultura celulară. Mai mult, arătăm că DeltaFosB este o fosfoproteină în creier și că fosforilarea unui reziduu serin extrem de conservat (Ser27) în DeltaFosB îl protejează de degradarea proteasomală. Oferim mai multe linii de dovezi care sugerează că această fosforilare este mediată de cazeina kinaza 2. Aceste descoperiri constituie primele dovezi conform cărora DeltaFosB este fosforilată și demonstrează că fosforilarea contribuie la stabilitatea sa, ceea ce este esențialul capacității sale de a media adaptări de lungă durată în creier.

Introducere

Factorul de transcripție ΔFosB, de asemenea, desemnat FosB2 sau FosB [formă scurtă], este o variantă de divizare trunchiată C terminală a genei imediate timpurii fosb (Dobrazanski și colab., 1991; Nakabeppu și Nathans, 1991; Yen și colab., 1991). Ca și FosB de lungime completă, ΔFosB are un domeniu de bază de legare la ADN și un fermoar de leucină prin care se dimerizează cu proteinele Jun pentru a forma complexe de factor de transcripție proteină-1 (AP-1), care reglează expresia multor gene (Morgan și Curran, 1995; Rylski și Kaczmarek, 2004). În ciuda lipsei unei părți din domeniul de transactivare care se găsește în capătul C al FosB, ΔFosB funcționează atât ca un activator transcripțional puternic, cât și ca un represor în celulele cultivate și în creier (Dobrazanski și colab., 1991; Nakabeppu și Nathans, 1991; Chen și colab., 1997; McClung și Nestler, 2003; Kumar și colab., 2005).

ΔFosB este indus la niveluri ridicate, într-o manieră specifică regiunii, în creier, după expunerea cronică, dar nu acută, la o varietate de stimuli psihoactivi, incluzând stresul, anumite leziuni, medicamente antipsihotice și antidepresive, droguri de abuz și recompense naturale. (Hope și colab., 1994b; Hiroi și Graybiel, 1996; Moratalla și colab., 1996; Bing și colab., 1997; Mandelzys și colab., 1997; Kelz și colab., 1999; Werme și colab., 2002; Andersson și colab., 2003; Colby și colab., 2003; Peakman și colab., 2003; Perrotti și colab., 2004; Zachariou și colab., 2006). Inducerea ΔFosB a fost legată direct de efectele funcționale ale mai multor dintre acești stimuli asupra creierului. Persistența ΔFosB chiar și în absența stimulării suplimentare o distinge de toți ceilalți factori de transcripție din familia Fos, care sunt induși rapid ca răspuns la stimuli acuti, se degradează până la niveluri bazale în câteva ore și, în general, prezintă desensibilizare după stimularea cronică (Hope și colab., 1992; Daunais și colab., 1993; Persico și colab., 1993; Hiroi și Graybiel, 1996; Perrotti și colab., 2004). Acest lucru face ca ΔFosB să fie un candidat atractiv pentru a medie unele dintre schimbările de lungă durată ale expresiei genice care stau la baza adaptărilor neuronale stabile cauzate de anumiți stimuli cronici.

Deoarece prezența prelungită a ΔFosB apare în absența unei alte inducții a mARN-ului său (Chen și colab., 1995), am speculat că, spre deosebire de FosB de lungime întreagă și de toate celelalte proteine ​​din familia Fos, care sunt intrinsec instabile, ΔFosB poate fi un factor de transcripție neobișnuit de stabil (Hope și colab., 1994b; Chen și colab., 1997; Nestler și colab., 2001; McClung și colab., 2004). Mai mult, analiza imunoblotării țesutului cerebral stimulat acut sau cronic stimulat sugerează că „FosB se schimbă în aparent Mr (masă moleculară) de la ∼33 kDa în stare acută la ∼35-37 kDa în timpul tratamentului cronic (Hope și colab., 1994a; Chen și colab., 1995). Deoarece nu există dovezi pentru existența unor mRNAs suplimentare care ar putea codifica pentru aceste diferite izoforme, am mai speculat că ΔFosB este modificat post-translațional și că, probabil, acest lucru contribuie la stabilitatea sa neobișnuită. Până în prezent, însă, nu au fost raportate analize biochimice ale cifrei de afaceri sau modificări post-translaționale ale ΔFosB. Scopul acestui studiu a fost să stabilească dacă ΔFosB este o fosfoproteină și dacă fosforilarea joacă un rol în stabilitatea sa.

Secțiunea precedentăSecțiunea următoare

Materiale și metode

Liniile de celule mamifere și construcțiile ADN.

Celulele PC12 (Clontech, Mountainview, CA) au fost cultivate în DMEM cu conținut ridicat de glucoză conținând l-glutamină (L-Gln) și completate cu 5% ser bovin fetal (FBS), 10% ser cal (ambele din Invitrogen, Carlsbad, CA) , 100 U / ml penicilină și 100 μg / ml streptomicină (ambele din Sigma-Aldrich, St. Louis, MO). Celulele HeLa (American Type Culture Collection, Manassas, VA) au fost cultivate în DMEM cu conținut ridicat de glucoză conținând L-Gln și completate cu 10% FBS, penicilină și streptomicină. Ambele linii celulare au fost menținute la 37 ° C într-un 5% CO umed2 atmosfera.

Pentru tranzacțiile tranzitorii cu ADN, celulele PC12 sau HeLa au fost însămânțate pe plăci cu șase godeuri (acoperite cu colagen I pentru celulele PC12), astfel încât să ajungă la confluența 90-100% a doua zi și apoi au fost transfectate folosind Lipofectamina 2000 (Invitrogen). În unele experimente (vezi Fig. 1-7), ΔFosB a fost exprimat tranzitoriu în celulele PC12 prin infecție cu virusul herpes simplex recombinant (HSV).

ADNc-urile FB și FosB au fost obținute din propriile noastre constructe pTetop (Chen și colab., 1997), și subclonat într-un vector pcDNA3.1 (Invitrogen). Aceste constructe pcDNA3.1-ΔFosB / FosB au fost utilizate pentru exprimarea în celulele de mamifer și ca un șablon pentru mutageneza direcționată pe site. HSV-ΔFosB recombinant a fost preparat așa cum s-a descris anterior (Neve și colab., 1997), iar preparatul a avut un titru de ∼1 × 108 pfu / ml.

Experimente cu urmărirea impulsurilor.

Aproximativ 24 h după infecție / transfecție, celulele (PC12 sau HeLa) în plăci cu șase godeuri au fost spălate de două până la trei ori cu 2 ml de PBS și incubate la 37 ° C pentru ∼1 h în 2 ml de Cys / DMEM fără met. (Invitrogen) completat cu FBS dializat 5% (Hyclone, Logan, UT) pentru a epuiza grupurile intracelulare de Met și Cys. La sfârșitul acestei perioade de „înfometare”, s-au adăugat medicamente (dacă s-ar trata celulele), iar celulele au fost etichetate (puls) cu 12-25 μCi de 35S Amestec de etichetare a proteinelor (PerkinElmer, Wellesley, MA) pentru ∼1 h la 37 ° C pentru a eticheta toate proteinele nou sintetizate. Radiocabelul a fost apoi îndepărtat prin spălarea celulelor de două până la trei ori cu 2 ml de PBS și 35Proteinele marcate cu S au fost urmate (alungare) prin înlocuirea mediului cu mediu „rece” (neradioactiv) suplimentat cu 5% FBS și recoltarea celulelor în diferite momente de timp. Tratamentele celulare au fost menținute pe tot parcursul urmării. Toate cifrele acestor experimente arată cantități inițiale similare ale diferitelor proteine ​​pentru a optimiza comparațiile dintre ratele lor de afaceri.

Animalele și tratamentul crizelor electroconvulsive cronice.

Șobolani masculi Sprague Dawley adulți (200 – 300 g; Charles River Laboratories, Kingston, RI) au fost tratați o dată pe zi cu crize electroconvulsive (ECS) pentru 7 – 9 d. ECS a fost efectuat așa cum s-a descris anterior (Hope și colab., 1994a) folosind un Ugo Basile (Comerio VA, Italia) Unitate ECS cu următoarele setări: frecvență, impulsuri / s 100; puls cu, 0.5 ms; durata de șoc, 1.0 s; și curent, 75 mA. Animalele de control fărâme au fost tratate în paralel prin aplicarea electrozilor cu agrafă pentru ureche fără niciun curent electric.

32 P etichetare metabolică.

Pentru etichetarea feliilor de creier, șobolanii au fost decapitați, creierul s-a disecat rapid și s-au preparat 300 μm corticale felii cu un microslicer DSK (Ted Pella, Redding, CA). Feliile au fost incubate în tuburile de plastic în 2 ml de CSF artificial cu deficiență de fosfat (ACSF) și menținute la 30 ° C în condiții de bombă blândă constantă cu O2/ CO2 amestec (Hemmings și colab., 1989). Feliile (două felii pe tub) au fost etichetate cu 1.3 mCi pentru 8 – 10 h în prezența sau absența acidului okadaic (100 ng / ml). La sfârșitul acestei incubații, feliile au fost clătite de cel puțin trei ori cu ACSF rece și apoi omogenizate prin sonicare în 250 μl de testare radioimunoprecipitare rece (RIPA) [PBS, pH 7.4, 150 mm NaCl, 1% (v / v ) Igepal, 0.5% (în greutate) deoxiclolat de sodiu, 0.1% (în greutate) SDS, 1 mm EDTA] completat înainte de utilizare cu SDS până la 0.6%, cocktail inhibitor de protează pentru celulele mamifere (utilizat la 5 μl / ml; Sigma-Aldrich), inhibitor de fosfatază cocktail I și II (utilizat la 1: 100; Sigma-Aldrich), 1 mm PMSF și 2% glicerol. Omogenatele au fost apoi fierte timp de 15 min și curățate prin centrifugare la 15,000 × g pentru 15 min. Concentrația de proteine ​​în supernatanții rezultați a fost evaluată folosind testul proteic BCA (Pierce, Holmdel, NJ).

Pentru 32Etichetarea P a celulelor cultivate, ∼24 h după infecție / transfecție, celulele au fost spălate de două până la trei ori cu mediu fără fosfat și incubate în acest mediu pentru ∼1 h. După această perioadă de înfometare, 0.2-0.3 mCi de 32PH3PO4 (PerkinElmer) au fost adăugate la fiecare godeu și celulele au fost etichetate pentru 4 – 12 h în funcție de tipul de experiment (a se vedea Fig. 1 – 7 pentru specificații). Celulele au fost apoi spălate de trei ori cu PBS și lisate pe gheață pentru 15 min cu 50 µl de tampon RIPA suplimentat. Lizatele au fost colectate prin răzuire și au fost trecute de 10 ori printr-un ac 25 ga pentru a forța ADN-ul, a fiert timp de 10 min și s-au centrifugat la 15,000 rpm pentru 15-30 min la 4 ° C. Lizatele șterse (supernatanții) au fost transferate într-un nou tub și s-a efectuat un test de proteine ​​BCA (Pierce). Toate cifrele acestor experimente arată cantități similare de proteine ​​de tip sălbatic total (WT) și proteine ​​S27A ΔFosB pentru a optimiza comparațiile dintre nivelul lor relativ de fosforilare.

Produse chimice și tratamente de cultură celulară.

Acidul okadaic (OA, Sigma-Aldrich) a fost dizolvat în etanol și utilizat la o concentrație finală de 100 ng / ml. 5,6-Dicloro-1-β-d-ribofuranozil-benzimidazol (DRB; Biomol, Plymouth Meeting, PA) a fost dizolvat în dimetilsulfoxid (DMSO; Sigma-Aldrich). Spermina (Sigma-Aldrich) a fost dizolvată în apă și utilizată la o concentrație finală de 50 pm. Calphostin-C (Biomol) s-a dizolvat în DMSO și s-a utilizat la 200 μm, în timp ce Xhorum xNUMX-myristat 0.2-acetat (PMA; Promega, Madison, WI) a fost dizolvat în DMSO și utilizat la 12 μm. a fost dizolvat în apă și utilizat la o concentrație finală de 13 și 0.1 pm. Inhibitorii de proteină kinază cu spectru larg H-2 și H-1 (Biomol) au fost dizolvați în apă și utilizați la o concentrație finală de 10 și respectiv 7 μm. MG8 (Calbiochem, San Diego, CA) și epoxomicină (Peptides International, Louisville, KY) au fost dizolvate ambele în DMSO și utilizate la o concentrație finală de 150 și, respectiv, 200 μm. În toate experimentele, DMSO (vehicul) a fost adăugat la celule după cum este necesar pentru a menține o cantitate constantă de DMSO în timpul tratamentelor. Pentru 32P, medicamentele au fost adăugate imediat înainte de etichetare și au fost păstrate pentru restul perioadei de etichetare. Pentru experimentele cu impulsuri, medicamentele au fost adăugate la momentul foametei Cys / Met, "păstrate în perioada de etichetare și apoi adăugate înapoi în mediul de urmărire. Inhibitorii proteazomilor au fost împrăștiați fiecare 3-4 h pe parcursul urmăririi, pentru a compensa viteza de rulare rapidă a acestor peptide.

Imunoprecipitarea ΔFosB, imunoblotting și autoradiografie.

Pentru imunoprecipitări, lizatele au fost diluate 1: 5 cu RIPA simplu pentru a aduce concentrația de SDS până la valoarea 0.1% înainte de a începe imunoprecipitarea (IP). Pentru a limita legarea nespecifică, lizatele s-au eliminat mai întâi prin imunoprecipitare cu IgG non-imun și proteina G-Sepharose (Sigma-Aldrich) timp de cel puțin 4 h. A fost apoi imunoprecipitată din lizatele curățate utilizând un anticorp policlonal de capră care recunoaște un epitop intern prezent în ambele FosB și ΔFosB (SC-48G, Santa Cruz Biotechnology, Santa Cruz, CA) la 0.5-1 pg IgG per 10 pg de proteină de lizat (50-300 μg din proteina totală) într-un volum total de 0.5 ml. IP-urile au fost amestecate ușor la 4 ° C pe un rotor pentru cel puțin 8 h și apoi s-au adăugat 15 μl de proteină G-Sepharose și IP-urile au fost amestecate pentru cel puțin un alt 4 h. IP-urile au fost peletizate prin rotire la 3000 × g pentru 3-5 min la 4 ° C, se spală de trei ori cu 0.5 ml de RIPA netedă rece și de două ori cu PBS rece conținând 0.1% Tween 20. IP-urile au fost apoi resuspendate în 0.5 ml de PBS rece, transferate, peletizate într-un tub nou și proteinele imunoprecipitate au fost apoi eluate prin adăugarea de 15-25 ul de 2 x de reducere a tamponului de probă de proteină Laemmli. Acest protocol IP a dus la precipitarea specifică și eficientă a practic tuturor ΔFosB în lizat. Proteinele imunoprecipitate au fost supuse SDS-PAGE prin încărcarea întregii IP pe un gel 12.5% Tris-HCI Criterion (Bio-Rad, Hercules, CA) și apoi transferat pe PVDF sau nitroceluloză. După transfer, membrana a fost uscată la aer și 32P- și 35Bandele de proteine ​​radio-marcate cu S au fost observate prin autoradiografie utilizând pelicula autoradiografică Kodak (Rochester, NY), precum și prin simularea fosforului utilizând un Storm (Amersham Biosciences, Piscataway, NJ) PhosphorImager. DFosB total (nefosforilat și fosforilat) în lizatele celulare sau în omogenatele de creier a fost detectat prin imunoblotarea fie a proteinei imunoprecipitate (utilizând aceeași membrană utilizată pentru a detecta 32Proteina marcată cu P) sau a unor cantități egale de proteină de lizat / omogenat supusă SDS-PAGE și transferată pe PVDF sau nitroceluloză. Membrana a fost blocată mai întâi prin incubarea acesteia cu lapte uscat 1% (greutate / volum) uscat (Bio-Rad) în PBS suplimentat cu 0.1% (v / v) Tween 20 (Sigma) pentru 1 h la 25 ° C. Membrana a fost apoi imunoblotată peste noapte la 4 ° C cu propriul anticorp policlonal de iepure anti-FosB generat împotriva aminoacizilor 1-16 de FosB / ΔFosB (utilizat la 1: 10,000). După incubarea primară, membranele au fost spălate de patru ori timp de 5 min cu tampon de blocare și apoi incubate la 25 ° C pentru ~1 h cu un IgG de capră anti-iepure conjugat cu peroxidază de hrean (folosit la 1: 5000 în tampon de blocare, de la Vector Laboratories, Burlingame, CA). Membranele au fost apoi spălate de trei ori pentru 10 min cu tampon de blocare și o dată pentru 5 min cu PBS. Bandele totale de proteine ​​ΔFosB au fost vizualizate pe pelicula Kodak MR prin chemiluminiscență îmbunătățită (Pierce) și / sau prin detectarea fluorescenței utilizând reactivii ECL-Plus (Amersham Biosciences) și Storm PhosphorImager.

Supraexpresia și purificarea ΔFosB recombinantă din celulele insectelor.

ΔFosB a fost supraexprimat în celule de insectă Sf9 ca o proteină cu tag-ul hexa-His (N-His (6) ΔFosB) terminală N folosind sistemul de expresie Bac-la-Bac baculovirus (Invitrogen) și urmând instrucțiunile producătorului. Pe scurt, cADN-ul ΔFosB (resturile 2-237) precedat de eticheta de afinitate N-terminală MGHHHHHHAG a fost subclonată în vectorul pFASTBacTM1, care a fost utilizat pentru a genera baculovirus recombinant. Celulele Sf9 au fost infectate cu virus recombinant și AFsB N-His (6) a fost purificat din lizatele celulare prin câteva etape cromatografice incluzând cromatografie de afinitate utilizând o coloană de nichel (Qiagen, Valencia, CA), schimb de anioni utilizând o coloană mono-Q Biosciences) și excluderea mărimii utilizând o coloană de gel-filtrare (Amersham Biosciences).

In vitro studii de fosforilare.

In vitro reacțiile de fosforilare pentru analiza timpului și stoichiometrie au fost efectuate într-un volum de 30 μl conținând substrat 10 μm (N-His (6) ΔFosB sau un substrat de control pozitiv), 250 μm ATP și 1 μCi /32P] ATP, tamponul furnizat de producătorul kinazei și una dintre următoarele kinaze: CK2 (20 ng / ul; Upstate, Charlottesville, VA), CaMKII (10 ng / pl; Upstate), PKC (1.6 ng / Calbiochem) sau p70S6K (2.5 mU / ul; Upstate). Reacțiile timpului au fost realizate prin îndepărtarea alicoturilor 5 μl din soluția de reacție la punctele de timp indicate și adăugarea unui volum egal de tampon 4 x de reducere a eșantionului proteic Laemmli. Parametrii cinetici Michaelis-Menten pentru reacția CK2 au fost determinați în condiții de stare liniară stabilă empiric. Aceste reacții au fost efectuate pentru 15 min într-un volum de 10 μl conținând enzima 2 ng / μl, 250 μm ATP, 1 μCi / μl [y-32P] ATP și concentrațiile de N-His (6) ΔFosB variind de la 2.5-30 μm. Toate reacțiile au fost efectuate la 30 ° C într-o baie de apă. După SDS-PAGE și colorarea gelului cu Bio-Safe Coomassie (Bio-Rad), gelul a fost uscat și 32Incorporarea P-fosfatului a fost evaluată prin analiză cu fosfor (vezi mai jos, cuantificarea datelor, calcule și statistici).

Harta fosfopeptidelor bidimensionale și analiza fosfoaminoacidelor.

Ambele analize au fost efectuate conform descrierii de la Ploegh și Dunn (2000). Pe scurt, fragmente de gel uscat conținând 32DFosB marcat cu P (fie din in vitro reacții sau de la imunoprecipitate ale celulelor marcate metabolic), au fost excizate, rehidratate, spălate și supuse digestiei tryptice. Supernatantul conținând produsele de digestie tryptică a fost liofilizat și liofilatul spălat de mai multe ori și resuspendat în 10 pl de tampon de electroforeză, pH 1.9. Proba (3 μl) a fost păstrată pe o placă de cromatografie pe strat subțire celulozic (TLC) (Analtech, Newark, DE) și separată într-o singură dimensiune prin electroforeză și cealaltă dimensiune prin TLC ascendentă. Hărțile fosfopeptidelor rezultate au fost vizualizate prin autoradiografie și imagistica cu fosfor. Pentru analiza fosfoaminoacidă, 2l din digestările triptice care au fost resuspendate în tampon de electroforeză au fost scindate suplimentar prin hidroliza HCI la 105 ° C timp de 25 min în 3 m HCI sub un N2 atmosfera. Reacția a fost oprită printr-o diluție de șase ori în apă și amestecul a fost liofilizat. Liofilatul a fost resuspendat în 5 pl de tampon de electroforeză, pH 1.9 și plasat pe o placă TLC de celuloză împreună cu standardele fosfo-Ser, -Thr și -Tyr. Electroforeza a fost efectuată pe o jumătate din lungimea plăcii TLC utilizând tampon de electroforeză, pH 1.9 și apoi placa a fost transferată în tamponul pH 3.5 și s-a efectuat electroforeza până la finalizare. Standardele de fosfoaminoacid au fost vizualizate prin pulverizarea plăcii TLC cu o soluție de ninhidrină 1% (v / v) în acetonă și 32Probele de aminoacizi marcate cu P au fost vizualizate atât prin autoradiografie, cât și prin simularea fosforului.

si-a indus CK2a indus de siRNA.

Am folosit o metodă de interferență ARN pentru a elimina selectiv nivelele de CK2 (Di Maira și colab., 2005). Celulele PC12 au fost însămânțate pe plăci cu șase godeuri acoperite cu colagen I pentru a ajunge la confluența cu ~ 70-80% a doua zi, când au fost transfectate tranzitoriu cu 20 nm (concentrația finală) fie de siARN ne-orientat, fie de siARN direcționat către mARN al catalizatorului α subunitate de șobolan CK2, utilizând 5 μl de agent de transfecție SilentFectin (Bio-Rad) și urmând instrucțiunile producătorului. Aproximativ 24 h mai târziu, celulele au fost transfectate tranzitoriu cu plasmida ΔFosB, așa cum s-a menționat mai sus. Aproximativ 24 h mai târziu (~ 48 h după transfecția cu siARN), celulele au fost supuse fie 32P etichetare metabolică sau analiză puls-chase așa cum s-a descris mai sus. Următoarele patru sIRNAs CK2α au fost utilizate cu rezultate similare: 5'P-CAAACUAUAAUCGUACAUCUU3 ', 5'P-UCAAUCAU-GACAUUAUGCGUU3', 5'P-UAGUCAUAUAAAUCUUCCGUU3 ', 5'P-AAAUCCCUG ACAUCAUAUUUU3' (Dharmacon, Lafayette, CO). Ca un control negativ, am folosit surdină control negativ #3 siRNA de la Ambion (Austin, TX). Mărimea scăderii CK2 a fost monitorizată prin imunoblotting folosind un anticorp policlonal anti-CK2 (catalogul # 06-873 de la Upstate) peste noapte la o diluție 1: 1000. B-Tubulina a fost utilizată ca un control de încărcare și detectată cu un anticorp monoclonal (catalogul # 05-661 de la Upstate) peste noapte la o diluție 1: 20,000.

Mutageneză direcționată pe sit.

Mutația Ser27 la Ala sau la Asp s-a realizat utilizând un kit de mutagenizare orientat pe site-ul de schimbare rapidă (Stratagene, La Jolla, CA) și urmând instrucțiunile fabricantului. Pentru a introduce mutațiile Ser27 în proteina ΔFosB de șoarece, au fost utilizați primeri de mutageneză. Ser27 la Ala: (primer inițial) 5'GCCGAAGGAGTCCACCGAAGCCAGGTACTGAGACTCGGCGGAGGG3 ". Ser27 la Asp (primer primar) 5'CCCTCCGCCGAGTCTCAGTACCTGGATTCGGTGGACTCCTTCGGC3 ". Bazele mutante sunt îngroșate, iar codonul Ser27 este italicizat.

Bioinformatica.

Posibilitățile de fosforilare și kinazele pentru ΔFosB au fost căutate prin depunerea secvenței proteinelor de șoarece la baze de date specializate, incluzând ProSite (http://www.expasy.org/prosite/), PredictProtein (Rost și colab., 2004) și NetPhosK (Blom și colab., 2004).

Cuantificarea datelor, calcule și statistici.

Cantitatea de proteină prezentă în membrana PVDF sau nitroceluloză a fost cuantificată utilizând un Storm PhosphorImager și software-ul ImageQuant însoțitor (Amersham Biosciences / Molecular Dynamics). În studiile de fosforilare a culturii celulare și a creierului, valorile obținute pentru 32Proteina marcată cu P a fost apoi împărțită la valorile obținute pentru ΔFosB total și exprimată ca raport. În in vitro studii de fosforilare, cantitatea de 32DFosB marcat cu P pe mol de ΔFosB (stoichiometrie) a fost calculat așa cum s-a descris anterior (Sahin și colab., 2004). Toate măsurătorile au fost efectuate în limitele de liniaritate ale instrumentului utilizat. Parametrii cinetici au fost calculați folosind modelul Michaelis-Menten, prin care V = Vmax[S] / ([S]+KM) Şi Vmax = k2[ETotal]. Timpul de înjumătățire (t1 / 2) din ΔFosB și FosB au fost estimate din parcelele de urmărire a impulsurilor (folosind regresia neliniară care a fixat cel mai bine punctele de date) și corespund momentului în care cantitatea de proteină rămasă este de 50% din original. În toate figurile, rezultatele prezentate sunt reprezentative pentru cel puțin două până la trei experimente independente. În toate graficele, datele prezentate sunt medii ± SEM (3 ≤ n ≤16). Semnificația statistică a diferențelor a fost evaluată utilizând o metodă neprotejată t test, corectat pentru comparații multiple, și indică asteriscurile p ≤ 0.05.

Secțiunea precedentăSecțiunea următoare

REZULTATE

ΔFosB este un factor de transcripție neobișnuit de stabil

Deși am speculat anterior că ΔFosB este un factor de transcripție relativ stabil (Nestler și colab., 2001), o analiză directă a profilului cifrei de afaceri a proteinei nu a fost efectuată până în prezent. Pentru a aborda această întrebare, am efectuat experimente cu puls-chase folosind celule PC12, care au fost utilizate pe scară largă ca o linie celulară neuronică, în care ΔFosB a fost exprimat tranzitoriu prin infecția cu un virus recombinant de herpes simplex (HSV-ΔFosB). Proteinele noi sintetizate au fost marcate metabolic 35S-Met / Cys și modelul de degradare al lui 35S-marcat cu ΔFosB (35S-ΔFosB) a fost monitorizată prin imunoprecipitare din lizatele de celule obținute la momente diferite de timp după îndepărtarea aminoacizilor radiomarcați. Analiza imunoprecipitatelor prin SDS-PAGE și autoradiografia a arătat că timpul de înjumătățire al ΔFosB în celulele PC12 este ~ 10 h (Fig. 1). Aceste constatări arată că timpul de înjumătățire al ΔFosB este mai mare decât cel al majorității factorilor de transcripție inducibili (vezi Discuție), inclusiv FosB cu lungime întreagă, a cărui timp de înjumătățire în cultura celulară a fost raportat a fi ~ 90 minDobrazanski și colab., 1991; Carle și colab. 2004). În plus, este de remarcat faptul că degradarea lui ΔFosB nu se potrivește cu o curbă exponențială de decădere de gradul întâi, ci mai degrabă este bifazică, pornind de la o viteză de degradare mai lentă. Aceasta sugerează existența a mai mult de o specie ΔFosB și / sau mai mult de o cale de degradare.

Figura 1.

Vedeți versiunea mai mare:

Figura 1.

ΔFosB este un factor de transcripție neobișnuit de stabil. Timpul de înjumătățire al ΔFosB este de ~ xNUMX h în cultura celulară. ΔFosB a fost exprimată în celule PC10 fie prin infecție cu HSV-ΔFosB, fie prin transfecție tranzitorie cu plasmidă conținând ΔFosB, și celulele au fost supuse experimentelor de urmărire pulsată așa cum s-a descris în Materiale și metode. Rezultatele echivalente au fost obținute indiferent de metoda utilizată pentru supraexprimarea ΔFosB. Figura prezintă timpul (și autoradiograma reprezentativă) a degradării ΔFosB. Datele reprezentate reprezintă media ± SEM a punctelor de date individuale de cel puțin 12 obținute din cel puțin cinci experimente independente. Pentru comparație, semnalul de înjumătățire raportat FosB cu lungime întreagă este indicat.

ΔFosB este o fosfoproteină în creier

Am emis ipoteza că modificarea posttranslațională a ΔFosB poate contribui la stabilitatea sa aparentă. Deoarece sa demonstrat că fosforilarea modulează activitatea factorilor de transcripție în mai multe moduri, inclusiv stabilitatea lor (pentru revizuire, a se vedea Desterro și colab., 2000; Whitmarsh și Davis, 2000), am investigat dacă ΔFosB este o fosfoproteină. În acest scop, expresia ΔFosB a fost indusă în creierul de șobolan folosind ECS cronică, un tratament cunoscut care induce niveluri ridicate de ΔFosB, în special în cortexul frontal (Hope și colab., 1994a). La o zi după ultimul tratament ECS, când nivelurile ΔFosB rămân ridicate, s-au preparat felii corticale frontale subțiri și s-au marcat metabolic cu 32P-ortofosfat. Un set paralel de felii nu a fost radiomarcat, iar acestea au fost folosite pentru a detecta nivelurile totale ΔFosB. După imunoprecipitarea cu un anticorp specific anti-FosB / ΔFosB și separarea proteinelor imunoprecipitate prin SDS-PAGE, fosforilate 32P-marcat cu P a fost detectat prin autoradiografie, în timp ce ΔFosB total a fost detectat prin imunoblotting. Această analiză a arătat că ΔFosB este fosforilat în creier, așa cum este evidențiat de un anumit factor 32Panglică marcată cu P-xNUMX kDa prezentă în probele de creier tratate cronic, dar este practic nedetectabilă la controalele tratate în mod fals (Fig. 2A). Acest lucru este în concordanță cu faptul că, în absența stimulării cronice, nivelurile bazale ale ΔFosB sunt foarte scăzute. Specificitatea reacției de imunoprecipitare este ilustrată de lipsa semnalului în precipitatul IgG non-imun.

Figura 2.

Vedeți versiunea mai mare:

Figura 2.

ΔFosB este o fosfoproteină în creier. A, ΔFosB este fosforilat în creier. IDFosB endogen a fost indus în creierul șobolan prin tratamentul ECS cronic, așa cum este descris în Materiale și metode. Frunzele corticale frontale au fost etichetate metabolic cu 32PH3PO4 pentru câteva ore. După omogenizarea feliilor, ΔFosB a fost imunoprecipitat și a fost fosforilat ΔFosB (32P-ΔFosB) a fost detectat prin autoradiografie (panoul superior). Total ΔFosB în imunoprecipitati nonradioactive a fost detectat prin imunoblotting (panoul inferior). Ca martori negativi, sunt arătate imunoprecipitarea unui animal tratat cu ficuie și IgG neimună. B, Situsurile de fosforilare candidate și kinazele cu scorurile de predicție corespunzătoare pentru secvența proteinei ΔFosB de șoarece au fost obținute prin analiză bioinformatică. Locațiile candidate cu scorurile de predicție mai mari sunt evidențiate în secvența de proteine ​​și sunt enumerate în tabel. Domeniul de legare a ADN-ului (bazic) și fermoarul de leucină sunt îngroșate în secvența de proteine. C, D, Fosforilarea ΔFosB este mărită de inhibitorul fosfatazei Ser / Thr OA. C, 32Nivelurile P-ΔFosB în imunoprecipitates din fracțiuni corticale frontale marcate în absența (Ctr) sau prezența 100 ng / ml OA (grafic și top panel) au fost detectate prin autoradiografie. Panoul din partea de jos prezintă totalul ΔFosB detectat în imunoprecipitări din felii neetichetate prin imunoblotting. D, Celulele PC12 au fost infectate cu HSV-ΔFosB sau HSV-LacZ (vector) și au fost marcate metabolic cu 32PH3PO4 în absența (Ctr) sau prezența de 100 ng / ml OA. 32Nivelurile P-ΔFosB în imunoprecipitates au fost detectate prin autoradiografie (grafic, top panel). Panoul din partea de jos prezintă ΔFosB total detectat în celulele lizate prin imunoblotting.

Ca prim pas spre elucidarea carei kinaze și site-uri sunt implicate în fosforilarea ΔFosB, am supus secvența de aminoacizi la mai multe analize bioinformatice. Acest lucru a arătat că, deși ΔFosB nu conține situsuri candidate pentru fosforilarea Tyr, acesta conține câteva situsuri consensus Ser / Thr kinază, incluzând trei situri CaMKII, trei situsuri CK2 și două situsuri PKC cu scoruri foarte bune de predicție a fosforilăriiFig. 2B). Dacă, așa cum este prezis prin bioinformatică, ΔFosB este fosforilat numai pe resturile Ser sau Thr, atunci fosforilarea sa trebuie modulate în mod semnificativ de activitatea fosfatazelor Ser / Thr. Pentru a testa această ipoteză, am etichetat felii frontale corticale cu 32P-ortofosfat în prezența sau absența OA, un inhibitor Ser / Thr proteină fosfatază. Așa cum se arată în Figura 2C, OA a cauzat o creștere mare (~ 2.5-fold) 32P-ΔFosB. De asemenea, a determinat o creștere mică a nivelurilor ΔFosB totale, care este în concordanță cu rapoartele anterioare care leagă efectele cancerigene ale OA de capacitatea sa de a induce mai multe gene imediate imediate, inclusiv proteinele Fos (Miller și colab., 1998; Choe și colab., 2004). Rezultatul net este o creștere globală semnificativă (~ 60%) în nivelul fosforilat ΔFosB.

Apoi am investigat dacă, în celulele PC12, care sunt mai receptive la manipularea experimentală, ΔFosB a prezentat un model de fosforilare similar cu cel observat în creier. Am exprimat ΔFosB în celulele PC12 prin intermediul infecției cu HSV-ΔFosB și am marcat metabolic celulele cu 32P-ortofosfat în prezența sau absența OA. Expresia cu succes și imunoprecipitarea proteinei din celulele infectate cu HSV-ΔFosB este demonstrată de prezența atât în ​​imunoblot (Fig. 2D, panoul de fund) și autoradiograful (panoul superior) al unei banda kDa ~ 35, absentă în celulele infectate cu vectori. După cum sa observat în creier, OA a determinat o creștere mică a nivelului total de ΔFosB, dar o creștere mult mai mare (aproximativ dublu) 32P-ΔFosB, rezultând o creștere netă (~ 50%) a fosforilării ΔFosB. În plus, în conformitate cu previziunile bioinformatice, tratamentul celulelor PC12 cu un inhibitor Tyr fosfatazei nu a dus la modificări semnificative în 32Nivelurile P-ΔFosB (datele nu sunt prezentate). Împreună, aceste constatări au arătat că ΔFosB este fosforilat pe resturile serice și / sau Thr din creier și în celulele PC12 și a confirmat că acesta din urmă este un sistem bun de cultură celulară în care să studieze în continuare profilurile de fosforilare și degradare a ΔFosB.

CK2 dar nu PKC sau CaMKII fosforilează ΔFosB in vitro

Așa cum s-a descris mai sus, analiza secvenței de aminoacizi ΔFosB a relevat scoruri mari de predicție pentru situsurile de fosforilare CK2, PKC și CaMKII. Pentru a determina care dintre aceste kinaze pot fosforila DFosB, am efectuat o serie de in vitro reacții de fosforilare folosind kinaze purificate și ΔFosB recombinat purificat. Așa cum se arată în Figura 3A, din cele trei kinaze candidate, numai CK2 a fosforilat ΔFosB într-o manieră semnificativă. În plus, au fost testate mai multe alte kinaze (de exemplu, GSK3 și p70S6K), dar nu a reușit să fosforileze în mod semnificativ ΔFosB (datele nu sunt prezentate). Caracterizarea suplimentară a reacției CK2 prin analiza timpului a arătat că această kinază poate cataliza încorporarea de fosfat de ~ xNUMX pe mol de ΔFosB (Fig. 3B). Faptul că CK2 poate fosforila ΔFosB in vitro la o stoichiometrie considerabilă (~ 50%) sugerează o reacție relevantă din punct de vedere fiziologic. Apoi am studiat cinetica acestei reacții prin incubarea CK2 în prezența unor cantități crescătoare de ΔFosB purificat și am stabilit că CK2 fosforilează ΔFosB cu o Vmax din 5.8 pmol · min-1 · Μg-1 de enzimă, a KM din 18.4 μm și a kpisică din 0.2 / s (Fig. 3C). Valorile obținute pentru acești parametri cinetici susțin în continuare relevanța fiziologică a acestei reacții. De exemplu, KM din CK2 pentru DARPP32, unul dintre cele mai cunoscute substraturi, este 3.4 μm, iar kpisică este ~ 0.3 / s (Girault și colab., 1989); KM pentru ATP variază de la ~ 10-40 μm (Cochet și colab., 1983; Silva-Neto și colab., 2002), iar pentru cazeina variază de la ~ 10-50 μm (Meggio și colab., 1977; Pyerin și colab., 1987). Împreună, aceste date indică faptul că ΔFosB este un substrat de bună credință pentru CK2 in vitro.

Figura 3.

Vedeți versiunea mai mare:

Figura 3.

CK2 dar nu PKC sau CaMKII fosforilează ΔFosB in vitro. Autoradiograful (panoul superior) prezintă produsul fosforilat, iar gelul colorat cu Coomassie (panoul de jos) prezintă ΔFosB total prezent în reacție. A, A fost supus DFosB recombinant purificat in vitro fosforilarea prin diferite kinaze candidate (dintre care trei sunt prezentate). B, Analizele de timp și analizele stoichiometrice indică faptul că CK2 poate fosforila ΔFosB in vitro cu o stoichiometrie de ~ 50%. C, Analiza cinetică a reacției CK2 a arătat că ΔFosB este un bona fide in vitro substrat. Linializarea reacției este prezentată într-un grafic dublu-reciproc (partea de jos), dar parametrii cinetici au fost derivați din curba Michaelis-Menten (partea de sus).

CK2 modulează fosforilarea și stabilitatea ΔFosB în celule intacte

Pentru a evalua relevanța fiziologică a fosforilării mediate de CK2 a ΔFosB, am realizat o mapare comparativă a fosfopeptidelor utilizând in vitro fosforilați și ΔFosB fosforilați de celule PC12. După SDS-PAGE și eluția cu gel pe 32P-ΔFosB (de la in vitro reacții sau de la imunoprecipitarea lui 32Celulele marcate cu P), proteina a fost digerată cu tripsină și fosfopeptidele rezultate au fost supuse unei separări bidimensionale. Această analiză a arătat că principala fosfopeptidă din reacția CK2 a comigrat cu una dintre cele două fosfopeptide majore din ΔFosB fosforilate în celule PC12 (Fig. 4A), în timp ce fosfopeptidele care rezultă din reacția PKC sau CaMKII (datele nu sunt prezentate) nu au avut loc. A existat oa doua fosfopeptidă ΔFosB prezentă pe hartă din celule PC12, dar din cauza incapacității oricărei dintre kinazele testate pentru a genera o fosfopeptidă similară in vitro, nu știm în prezent dacă această a doua fosfopeptidă conține un situs de fosforilare diferit de celălalt fosfopeptid sau dacă reprezintă o peptidă triptică distinctă care conține același situs de fosforilare.

Figura 4.

Vedeți versiunea mai mare:

Figura 4.

CK2 modulează fosforilarea și stabilitatea ΔFosB în celule intacte. A, CK2 dar nu PKC pare să fosforileze ΔFosB în celule. Două dimensiuni de hărți fosfopeptidice ale ΔFosB fosforilate de CK2 sau PKC in vitro sau de celule PC12 intacte. Săgețile arată comigrarea peptidei fosforilate CK2, dar nu a fosforilatului PKC cu una dintre fosfopeptidele ΔFosB obținute din celulele PC12. B, Fosforilarea ΔFosB în celulele PC12 este crescută prin tratarea celulelor cu potențios activator de spermă CK2 (SP) și scăzută prin tratamentul cu inhibitorul CK2 DRB. Dimpotrivă, fosforilarea ΔFosB în celulele PC12 nu a fost afectată de tratamentul cu un activator PKC (PMA) sau cu inhibitorul specific PKC calphostin-C (Calph). Sunt prezentate o autoradiogramă reprezentativă (panoul de sus) și imunoblot (panoul de jos). C-F, Efectul activității CK2 asupra stabilității ΔFosB. Cifrele arată timpul (și autoradiograma reprezentativă) a degradării ΔFosB. Celulele PC12 care exprima tranzitoriu ΔFosB au fost supuse experimentelor cu impulsuri efectuate în absența sau prezența inhibitorului CK2 DRB (C), activatorul CK2 spermina (D) sau inhibitorul de kinază cu spectru larg H-8 (E), care a fost folosit pentru a controla efectele nespecifice ale DRB. F, Efectul distrugerii subunității catalitice a CK2 asupra stabilității ΔFosB. Celulele PC12 au fost transfectate fie cu șoareci CK2a și 24 h, care nu au fost orientați cu siARN (Ctr), fie cu siRNA și apoi au fost transfectați cu o plasmidă ΔFosB. Panoul de sus prezintă imunobloturi de lizați de celule întregi care prezintă efectul siRNA CK2 asupra nivelurilor de proteine ​​CK2 și ΔFosB. Imunoblotul corespunzător pentru β-tubulină este prezentat ca un control al încărcării.

Pentru a aborda în continuare relevanța fiziologică a CK2 ca o kinază ΔFosB, am tratat celulele PC12 care exprimă ΔFosB cu două medicamente care modulează activitatea CK2. Așa cum se arată în Figura 4B, Fosforilarea ΔFosB a fost scăzută prin tratamentul celulelor PC12 cu inhibitorul CK2 DRB permeabil la celule (Meggio și colab., 1990; Szyszka și colab., 1995) și a crescut prin tratamentul cu speramina poliamină, cunoscută a fi un potențial activator CK2 (Cochet și Chambaz, 1983; Meggio și colab., 1983). În contrast, tratamentul celulelor PC12 cu inhibitor PKC calphostin-C (Kobayashi și colab., 1989; Tamaoki și colab., 1990) sau activatorul PKC PMA (Schmidt și Hecker, 1975; Beh și colab., 1989) nu au dus la schimbări semnificative în fosforilarea ΔFosB. În cazul PMA, ușoară (și nu semnificativă) creștere în 32P-ΔFosB ar putea fi explicat prin creșterea numărului total de ΔFosB cauzate de acest medicament; în fapt, s-a raportat că esterii forbolului induc expresia mai multor proteine ​​de familie Fos, incluzând FosB (Yoza și colab., 1992; Suh și colab., 2004). În plus, tratamentul celulelor cu inhibitorul specific m-AIP permeabil la celulă permeabilă de celule (Ishida și Fujisawa, 1995; Stevens și colab., 1999), de asemenea, nu au dus la o scădere a fosforilării ΔFosB (datele nu sunt prezentate). Împreună, aceste rezultate sunt în concordanță cu cele ale noastre in vitro și indică faptul că în celulele intacte ΔFosB este probabil fosforilat de CK2 dar nu și PKC sau CaMKII. Faptul că inhibarea CK2 nu împiedică complet fosforilarea ΔFosB indică existența unor situsuri suplimentare de fosforilare în proteină.

Apoi am examinat dacă CK2 joacă un rol în cifra de afaceri a ΔFosB și, prin urmare, în stabilitatea sa. În acest scop, am realizat experimente cu puls-chase folosind celule PC12 care exprimă ΔFosB tratate fie cu inhibitorul CK2, fie cu activatorul CK2 utilizat în studiul de fosforilare. Așa cum se arată în Figura 4C, tratamentul celulelor cu inhibitorul CK2 DRB a avut un efect semnificativ asupra ratei de fluctuație a ΔFosB, evidențiat prin modificarea formei curbei sale de degradare, de la bifazic la o curbă mai apropiată de cea a unei degradări exponențiale. În schimb, prezența activatorului spermă CK2 a determinat o scădere semnificativă a ratei de degradare a ΔFosB, ceea ce a condus la acumularea proteinei în primele ore de urmărire (Fig. 4D).

Ca și în cazul multor activatori și inhibitori ai kinazei, spermina și DRB pot avea efecte metabolice în afara modulației activității CK2. De fapt, sa demonstrat că DRB inhibă kinaza asociată cu factorul de transcripție IIH (TFIIH) (Yankulov și colab., 1995), care are ca rezultat inhibarea transcrierii ARN polimerazei II mediată. Deoarece acest efect ar putea afecta stabilitatea ΔFosB, am analizat efectul inhibitorului de kinază cu spectru larg H-8 (Hidaka și Kobayashi, 1992) pe fluctuația ΔFosB la o concentrație (200 μm) cunoscută că inhibă kinaza asociată cu TFIIH, dar nu CK2 (Yankulov și colab., 1995). Așa cum se arată în Figura 4E, tratamentul cu H-8 nu a afectat rata de circulație a ΔFosB. Rezultate similare s-au obținut cu H-7, un alt inhibitor de kinază cu spectru larg, utilizat la o concentrație care inhibă kinaza asociată cu TFIIH, dar nu CK2 (datele nu sunt prezentate). Aceste date susțin în continuare interpretarea că reducerea stabilității ΔFosB cauzată de DRB este cel mai probabil atribuită inhibării CK2.

Pentru a stabili în continuare rolul CK2 în cifra de afaceri ΔFosB, am investigat consecințele doborârii CK2 prin intermediul siRNA. Am efectuat aceste experimente utilizând celule PC12 care au fost transfectate mai întâi cu siARN de control (nontargeting) sau cu un siARN care vizează ARNm al subunității catalitice a CK2 (CK2α) și 24 h de șobolan, transfectate ulterior cu ΔFosB. Așa cum se arată în Figura 4F, transfecția cu siRNA CK2α a eliminat în mod eficient și specific nivelurile de proteine ​​CK2α fără a afecta nivelele ΔFosB (panoul superior). Analiza impulsurilor a arătat că distrugerea CK2 a dus la o creștere semnificativă a ratei de circulație a ΔFosB, după cum reiese din degradarea mai rapidă a proteinei. Faptul că inhibarea activității CK2 (fie prin tratamentul DRB sau siRNA) crește cifra de afaceri a ΔFosB și are ca rezultat dispariția componentei cu viteză lentă a curbei bifazice, în timp ce activarea CK2 îmbunătățește faza lentă a curbei, ideea că CK2 joacă un rol în reglarea stabilității ΔFosB.

CK2 fosforilează ΔFosB pe Ser27

Pentru a începe identificarea site-urilor pe ΔFosB fosforilate de CK2, am efectuat analiza fosfoaminoacid a ΔFosB recombinant fosforilat de CK2 in vitro și a ΔFosB fosforilat în celule PC12. Aceste experimente au arătat că, în ambele cazuri, singurul fosfo-aminoacid detectat a fost fosfo-Ser (Fig. 5A). Această constatare, împreună cu stoichiometria obținută pentru CK2 in vitro reacție de fosforilare (~ 50%) (Fig. 3B) și prezența unui singur loc semnificativ pe harta fosfopelpelor CK2 (Fig. 4A), sugerează că fosforilarea CK2 a ΔFosB este probabil limitată la un singur rest de serină. Această concluzie este compatibilă cu analiza site-ului privind consensul de fosforilare (Fig. 2B), care a prezis doar o seringă candidată, adică Ser27, pentru CK2. Analiza taxonomică a evidențiat faptul că Ser27 este foarte conservat prin evoluție în rândul membrilor familiei Fos (Fig. 5B), sugerând că poate avea o importantă funcție fiziologică.

Figura 5.

Vedeți versiunea mai mare:

Figura 5.

CK2 fosforylates ΔFosB pe Ser27. A, Analiza fosfoaminoacidă a fosforylei CK2 (in vitro) și ΔFosB cu fosforilarea celulară PC12 care arată că, în ambele cazuri, reziduul major fosforilat este serina. B, Analiza inter-specie a secvenței de aminoacizi FosB / ΔFosB a evidențiat o conservare ridicată a Ser27 în rândul membrilor familiei Fos, de la om la zebră. Cu toate acestea, reziduul acid în poziția + 3, care este necesar pentru site-ul consensului CK2, nu este conservat (evidențiere ușoară). C, Celulele HeLa au fost transfectate tranzitoriu fie cu ΔFosB de tip sălbatic (WT), fie cu ΔFosB conținând o mutație punctuală pentru a substitui Ser27 cu Ala (S27A). Celulele au fost marcate metabolic cu 32PH3PO4 și tratate cu vehicul sau cu spermină (SP) pentru a activa CK2. Se prezintă o autoradiogramă reprezentativă (panoul de sus) și imunoblot (panoul inferior) al imunoprecipitatelor ΔFosB obținute. Se prezintă imunoprecipitarea celulelor transfectate machete (vector).

Pentru a determina dacă Ser27 este fosforilat în ΔFosB, am mutat acest reziduu la Ala și am analizat consecințele asupra stării de fosforilare a proteinei. În acest scop, am folosit celule HeLa (care pot fi transfectate cu o eficiență mai mare) pentru a exprima tranzitoriu fie WF, fie ΔFosB mutant S27A. Aproximativ 24 h după transfecție, celulele au fost marcate metabolic cu 32S-au preparat p-ortofosfat și lizate de celule întregi. După imunoprecipitare și SDS-PAGE, 32P-ΔFosB a fost detectat prin autoradiografie și ΔFosB total prin imunoblotting. Așa cum se arată în Figura 5C (panou inferior), ΔFosB nu a fost detectat în celulele transfectate vector, în timp ce celulele transfectate fie cu WF, fie cu SFNUMXA mutant ΔFosB au exprimat cu succes proteina. Am constatat că mutația S27A a provocat o reducere semnificativă (~ 27%) 32Nivelele P-ΔFosB (Fig. 5C, panoul de sus și graficul), indicând faptul că în celulele vii, ΔFosB este fosforilat pe Ser27. Într-un efort de a stabili dacă în celule Ser27 este într-adevăr fosforilat de CK2, am comparat capacitatea activatorului CK2 spermină de a modula fosforilarea WT și S27A ΔFosB. După cum am observat anterior în celulele PC12 (Fig. 4B), tratamentul celulelor HeLa cu spermina a crescut semnificativ fosforilarea proteinei WT. Faptul că acest efect a fost semnificativ diminuat de mutația S27A (Fig. 5C) susține interpretarea că Ser27 în ΔFosB este un substrat fiziologic pentru CK2.

Fosforilarea Ser27 reglează stabilitatea ΔFosB

După stabilirea faptului că stabilitatea ΔFosB este scăzută atunci când CK2 este inhibat și îmbunătățit când CK2 este activat (Fig. 4) și că CK2 fosforilează ΔFosB pe Ser27 (Fig. 5), am prezis că prevenirea fosforilării acestui sit trebuie să destabilizeze proteina. Experimentele cu experimente în impulsuri desfășurate cu celule HeLa care exprimă tranzitoriu fie WT, fie mutantul ΔFosB mutant S27A au arătat că, așa cum sa prevăzut, mutația S27A a determinat o creștere semnificativă a ratei de degradare a ΔFosB și o scădere concomitentă a timpului de înjumătățire al proteinei (Fig. 6A). Apoi am investigat dacă acest mecanism de reglementare apare și în linia de celule PC12 mai neuronală. Aceste experimente au arătat că, așa cum am observat în celulele HeLa, mutația punctuală S27A determină o scădere dramatică a timpului de înjumătățire al ΔFosB în celulele PC12 (de la ~ 11 la ~ 4 h) (Fig. 6B). Faptul că această destabilizare este similară cu cea cauzată de inhibarea sau reducerea CK2 (Fig. 4) oferă sprijin suplimentar pentru ideea că fosforilarea mediată de CK2 a Ser27 reglează stabilitatea ΔFosB. Dovezi suplimentare privind rolul de reglementare a fosforilării Ser27 asupra turnover-ului proteinei ΔFosB au fost obținute utilizând o mutație Ser27 fosfomimetică la Asp (S27D). Mutația S27D este considerată ca fiind fosfomimetică, deoarece plasează o grupă mare (carboxil) încărcată negativ la aminoacidul 27 și, prin urmare, mimează parțial fosforilarea Ser27. Așa cum se arată în Figura 6C, mutația S27D a determinat efectul opus al mutației S27A și a determinat o proteină semnificativ mai stabilă decât proteina WT. Similar cu efectul obținut după activarea CK2 (Fig. 4D), mutația S27D a dus la acumularea și, astfel, la creșterea nivelului ΔFosB în primele ore de urmărire.

Figura 6.

Vedeți versiunea mai mare:

Figura 6.

Fosforilarea Ser27 reglează stabilitatea ΔFosB. A, C, Analiza puls-chase care arată efectul fosforilării Ser27 asupra ratei de rotație a ΔFosB. Se prezintă profilul de degradare și durata de înjumătățire estimată a ΔFosB de tip sălbatic (WT), a mutantului Ser27 la Ala (S27A) și a Ser27 fosfomimetic la mutantul Asp (S27D). Aceleași descoperiri s-au obținut în celulele HeLa (A) și celulele PC12 (B, C).

SeroxNUMX fosforilarea stabilizează ΔFosB prin prevenirea degradării sale proteasomale

Pentru a începe elucidarea mecanismului prin care fosforilarea Ser27 stabilizează ΔFosB, am examinat capacitatea inhibitorilor de proteazom MG132 (Palombella și colab., 1994; Tsubuki și colab., 1996) și epoxomicină (Hanada și colab., 1992; Kim și colab., 1999) pentru a modula rata de degradare a WT și a ΔFosB mutant S27A. Au fost efectuate experimente de chase pulsate utilizând celule PC12 infectate cu un HSV recombinant care exprimă fie WT, fie S27A ΔFosB și tratate fie cu DMSO, fie cu unul dintre cei doi inhibitori de proteazom. Aceste experimente au arătat că, deși rata de degradare a proteinei WT este relativ insensibilă față de prezența oricărui dintre cei doi inhibitori ai proteazomilor (Fig. 7A), cea a mutantului S27A este sensibilă la aceste medicamente (Fig. 7B). Acest lucru indică faptul că, spre deosebire de proteina WT, mutantul S27A este o țintă a degradării proteasomale. Într-adevăr, tratamentul celulelor fie cu MG132 fie cu epoxomicină a inversat complet efectul mutației S27A asupra vitezei de degradare a ΔFosB, evidențiată de o creștere a timpului de înjumătățire al mutantului S27A de la ~ 4 la -9 h pentru MG132 și la ~ 12 h pentru epoxomicină (Fig. 7B). Împreună, aceste constatări indică faptul că fosforilarea ΔFosB pe Ser27 protejează proteina de degradarea proteasomală și, prin urmare, este esențială pentru stabilitatea sa neobișnuită.

Figura 7.

Vedeți versiunea mai mare:

Figura 7.

Fosforilarea Ser27 stabilizează ΔFosB prin prevenirea degradării sale proteasomale. A, B, Analiza puls-chase cu celule PC12 infectate cu HSV, care prezintă profilul de degradare și timpul de înjumătățire estimat al ΔFosB de tip sălbatic (A) sau S27A ΔFosB (B) în absența sau prezența oricăror doi inhibitori de proteazom [MG132 și epoxomicină (Epoxo)]. Rețineți faptul că nici un medicament nu are un efect semnificativ asupra cifrei de afaceri a ΔFosB de tip sălbatic, în timp ce tratamentul celulelor fie cu inhibitor de proteazom, a determinat stabilizarea S27A ΔFosB. C, Un model pentru rolul fosforilării Ser27 în capacitatea ΔFosB de a mediaze plasticitatea creierului pe termen lung. Odată indusă, o parte din ΔFosB este stabilizată în creier prin fosforilarea mediată de CK2 a S27. Aceasta are ca rezultat acumularea sa, ceea ce, la rândul său, are ca rezultat schimbări de lungă durată în expresia genelor. Aceste schimbări stabile în expresia genelor contribuie la adaptarea comportamentală stabilă. Dimpotrivă, defosforilarea S27 de fosfatazele Ser / Thr PP1 și / sau PP2A are ca rezultat destabilizarea proteinei și prelucrarea acesteia de către mașinile proteasomale.

Secțiunea precedentăSecțiunea următoare

Discuție

În studiul de față, am arătat că ΔFosB are o durată de înjumătățire de ~ 10 h în cultura celulară, ceea ce îl face stabil în comparație cu FosB cu lungime întreagă și cei mai mulți factori de transcripție inducibili, a căror timp de înjumătățire în cultura celulară poate fi la fel de scurt ca câteva minute și rareori depășesc 3 h (Hann și Eisenman, 1984; Dobrazanski și colab., 1991; Roberts și Whitelaw, 1999; Ferrara și colab., 2003; Hirata și colab., 2004). În plus, descoperim că ΔFosB este fosforilat în creier și că fosforilarea lui este sensibilă la acidul okadaic inhibitor PP1 / PP2A. Studiile noastre privind cultura celulară demonstrează că stabilitatea ΔFosB este modulată de CK2, cu activitate CK2 mai mare stabilizând proteina. În cele din urmă, concluziile noastre sugerează că CK2 fosforilează ΔFosB pe o serină terminală extrem de conservată N (S27) și demonstrează că fosforilarea S27 protejează ΔFosB de degradarea proteasomală. Prin urmare, propunem un model prin care fosforilarea ΔFosB pe S27 de către CK2 este un mecanism de reglementare critic al cifrei de afaceri a ΔFosB (Fig. 7C). O astfel de stabilizare mediată de fosforilare a ΔFosB este importantă din punct de vedere funcțional, deoarece nivelele crescute ale ΔFosB în regiuni ale creierului, în special, au dovedit că reglează direct numeroase gene neuronale in vivo și să exercite efecte comportamentale puternice în modelele animale ale mai multor tulburări neuropsihiatrice (vezi Introducere).

Deși fosforilarea este un mod rapid și reversibil de reglare a activității transcripționale a anumitor factori de transcripție, cum ar fi CREB (proteina de legare a elementului de răspuns de cAMP) (Bohmann, 1990), modularea degradării factorilor de transcripție oferă o formă de reglementare chiar mai puternică (mai puțin ușor de reversibilă) (Desterro și colab., 2000). Factorii de transcripție a căror activitate funcțională este reglementată la nivelul degradării lor includ NFκB (Desterro și colab., 2000), c-Myc (Sears și colab., 1999) și c-Fos (Ferrara și colab., 2003), printre alții. În multe cazuri, fosforilarea este un regulator cheie al stabilității unui factor de transcripție, așa cum s-a arătat pentru c-Fos (Okazaki și Sagata, 1995; Tsurumi și colab., 1995), Antigen-1 legat de Fos (Fra-1) (Vial și Marshall, 2003), Fra-2 (Manabe și colab., 2001), c-iunie (Fuchs și colab., 1996), Iunie (Fuchs și colab., 1997), ATF2 (Fuchs și colab., 2000) și p53 (Buschmann și colab., 2001). Studiile noastre adaugă astfel ΔFosB la această listă de factori de transcripție a căror activitate funcțională este reglată prin stabilitatea sa dependentă de fosforilarea.

CK2 este o kinază Ser / Thr omniprezentă și constitutivă activă care are> 300 pretinse substraturi identificate până acum și este implicată în multiple procese biologice, inclusiv moartea celulelor și supraviețuirea (Litchfield, 2003; Unger și colab., 2004), răspunsurile de stres celular (Yanagawa și colab., 1997; Kato și colab., 2003) și repararea ADN-ului și remodelarea cromatinei (Barz și colab., 2003; Krohn și colab., 2003). Mai mult de o treime din substraturile putative ale CK2 sunt proteine ​​implicate în reglarea expresiei genice (Meggio și Pinna, 2003). De fapt, CK2 s-a dovedit a fi o kinază nucleară proeminentă (Krek și colab., 1992) (pentru revizuire, vezi Yu și colab., 2001) și să interacționeze cu domeniile bZIP pentru mai mulți factori de transcripție (Yamaguchi și colab., 1998). S-a demonstrat, de asemenea, că fosforilarea mediată de CK2 modulează degradarea (fie îmbunătățind-o sau diminuând-o) multe proteine, inclusiv IkB (Schwarz și colab., 1996), PTEN (Torres și Pulido, 2001), connexina lentilelor (Yin și colab., 2000), proteina asociată cromatinei HMG1 (Wisniewski și colab., 1999) și mai mulți factori de transcripție, cum ar fi HMGB (Stemmer și colab., 2002), Myf-5 (Winter și colab., 1997) și c-Myc (Channavajhala și Seldin, 2002). CK2 este cel mai abundent în creier (Alcazar și colab., 1988; Girault și colab., 1990), iar activitatea sa a fost implicată în multe aspecte ale funcției creierului, inclusiv supraviețuirea neuronală (Boehning și colab., 2003), diferențiere (Nuthall și colab., 2004), funcția canalului ionic (Jones și Yakel, 2003; Bildl și colab., 2004) și potențarea pe termen lung și plasticitatea neuronală (Diaz-Nido și colab., 1992; Lieberman și Mody, 1999; Reikhardt și colab., 2003).

În ciuda acestor dovezi crescânde pentru rolul CK2 în reglarea funcției neuronale, nu se știe prea multe despre ceea ce controlează activitatea sa. Se consideră că CK2 este activ în mod constitutiv, cu reglarea capacității sale de a fosforila substraturile specifice bazându-se mai ales pe modificările localizării sale intracelulare (de exemplu, citosol vs nucleu) (Ahmed și Tawfic, 1994; Yu și colab., 1999). Această informație ridică o întrebare importantă cu privire la ce semnale sunt necesare pentru a induce acumularea ΔFosB în creier după stimulare cronică (Fig. 7C). O cerință este activarea repetată a fosB gena și inducerea mARN-ului ΔFosB (Chen și colab., 1995). Datele noastre indică faptul că fosforilarea CF2 a ΔFosB este critică pentru stabilitatea sa, sugerând că un al doilea semnal poate fi necesar pentru efectele pe termen lung ale ΔFosB asupra expresiei genei, și anume, un semnal care stimulează fosforilarea proteinei de către CK2. Aceasta ar putea implica activarea CK2 de către un mecanism necunoscut sau translocarea lui în nucleu. Alternativ, fosforilarea CK2 a ΔFosB poate fi constitutivă, astfel încât proteina ΔFosB este tradusă ca răspuns la fiecare stimul, o porțiune din acesta devine fosforilată și astfel stabilizată, astfel încât, cu stimularea repetată, se acumulează la nivele ridicate în neuronii afectați.

Constatările noastre arată că CK2 și S27 nu sunt probabil singura kinază și situs responsabilă de fosforilarea ΔFosB, deoarece nici inhibarea CK2, nici mutația S27A nu au reușit să împiedice complet fosforilarea ΔFosB. În același punct, faptul că mutația S27A are ca rezultat o reducere de 30% a fosfo-ΔFosB susține că S27 este un situs de fosforilare major al proteinei. Cu toate acestea, investigăm alte kinaze putative și situsuri de fosforilare pe ΔFosB. În cele din urmă, va fi, de asemenea, important să se analizeze fosforilarea S27 și orice alte site-uri de fosforilare în ΔFosB în creier in vivo după diferite tipuri de stimulare cronică, de exemplu, prin utilizarea spectrometriei de masă sau a anticorpilor fosfospecifici.

După cum sa menționat mai sus, S27 în ΔFosB este foarte conservat pe tot parcursul evoluției și printre alte proteine ​​de familie Fos. Cu toate acestea, site-ul de consens pentru CK2 nu este: așa cum se arată în Figura 5B, doar FosB / ΔFosB (și xenologul Zebrafish), dar nu și c-Fos sau Fra-2, dețin un reziduu acid la + 3, un determinant cheie al fosforilării CK2 (Marin și colab., 1986; Meggio și colab., 1994). Astfel, lipsa fosforilării CK2 pe S27 poate explica de ce alte proteine ​​din familia Fos nu sunt la fel de stabile ca ΔFosB. Totuși, acest lucru nu explică de ce FosB de lungă durată, care are același site de consens CK2 ca ΔFosB, nu este stabilizat în mod similar. Nu știm dacă FosB cu lungime întreagă este fosforilată de CK2 pe acest reziduu conservat. Singurele rapoarte ale FosB (Skinner și colab., 1997) și c-Fos (Okazaki și Sagata, 1995; Chen și colab., 1996) fosforilarea descrie siturile din regiunea C-terminal a acestor proteine, care este absentă în ΔFosB. Fosforilarea potențială a FosB de lungime întreagă și a altor proteine ​​din familia Fos de către CK2 necesită investigare directă. Cu toate acestea, chiar dacă sunt fosforilate, se știe că celelalte proteine ​​din familia Fos conțin motive la terminalele lor C care vizează proteinele pentru degradare rapidă (Papavassiliou și colab., 1992; Jariel-Encontre și colab., 1997; Acquaviva și colab., 2002). De exemplu, s-a arătat că o întindere a resturilor ~ 21 prezente în capătul C al tuturor proteinelor familiei Fos, dar absentă în ΔFosB, acționează ca un domeniu destabilizator pentru c-Fos (Acquaviva și colab., 2001). Am constatat că, deși această secvență destabilizează în mod similar FosB cu lungime întreagă (Carle și colab., 2004), absența acestui domeniu în ΔFosB nu reflectă pe deplin stabilizarea sa. Mai degrabă, combinația absenței acestui domeniu terminal C și a fosforilării Ser27 pare să reprezinte pe deplin diferența de aproximativ 5 ori a stabilității între ΔFosB și FosB.

Deși degradarea proteinelor familiei Fos este complexă și nu este pe deplin înțeleasă, degradarea proteasomală pare să fie calea principală implicată (Salvat și colab., 1999; Acquaviva și colab., 2002; Ferrara și colab., 2003). Datele prezentate aici, în care inhibitorii proteazomali nu modifică în mod semnificativ rata degradării ΔFosB, susțin că, spre deosebire de alte proteine ​​din familia Fos, ΔFosB evită proteasomul 26S și acesta joacă un rol central în stabilizarea sa. Prin urmare, propunem o schemă prin care stabilitatea sporită a ΔFosB se poate atribui combinației a doi factori principali: (1) absența unui domeniu destabilizator C-terminal și (2) fosforilarea S27 de către CK2.

În rezumat, prezentul studiu oferă o perspectivă mecanică asupra motivului pentru ΔFosB, produs al genei imediate fosB, este, spre deosebire de toți ceilalți membri ai familiei Fos, o proteină relativ îndelungată. Deși se crede că alte proteine ​​de familie Fos mediază cuplarea rapidă, dar tranzitorie, a stimulării-transcripției (Morgan și Curran, 1995), stabilitatea relativă a ΔFosB îi conferă capacitatea de a media schimbări transcripționale de lungă durată induse de stimularea cronică. Aceasta susține ideea că ΔFosB funcționează ca un schimbător susținut de molecule în creier, transformând treptat răspunsurile acute în adaptări cronice. Identificarea fosforilării Ser27 ca mecanism central pentru stabilitatea ΔFosB deschide noi căi de dezvoltare a mijloacelor pentru a regla funcția ΔFosB și, astfel, să moduleze efectele sale pe termen lung asupra plasticității neuronale și comportamentale.

Secțiunea precedentăSecțiunea următoare

Note de subsol

  • A primit Noiembrie 21, 2005.
  • Revizia a fost primită în februarie 21, 2006.
  • Acceptat aprilie 2, 2006.
  • Acest lucru a fost sustinuta de catre o Alianta Nationala pentru Cercetare in Schizofrenie si depresie Young Investigator Award la PGU, un Institutul National pentru Abuzul de droguri (NIDA) National de Servicii de Cercetare Award la PGU, si subventii de la Institutul National de Sanatate Mintala si NIDA la EJN Noi mulțumesc dr. James Bibb pentru ajutorul acordat in vitro analize de fosforilare, Dr. Ming-Hu Han pentru ajutorul său pentru prepararea de felii de creveți utilizate pentru etichetarea metabolică și Dr. Rachael Neve pentru ajutorul său pentru ambalarea HSV-urilor recombinate.
  • Adresa actuală a lui G. Rudenko: Institutul de Științe ale Vieții și Departamentul de Farmacologie, Universitatea din Michigan, 210 Washtenaw Avenue # 3163A, Ann Arbor, MI 48109-2216.
  • Corespondența trebuie adresată lui Eric J. Nestler, bulevardul 5323 Harry Hines, Dallas, TX 75390-9070. E-mail: [e-mail protejat]

Secțiunea precedentă

 

Referinte

Acquaviva C, Brockly F, Ferrara P, Bossis G, Salvat C, Jariel-Encontre I, Piechaczyk M (2001) Identificarea unui motiv tripeptidic C-terminal implicat în controlul degradării proteasomale rapide a proto-oncoproteinei c-Fos în timpul tranziției de fază G (0) -to-S. Oncogene 20:7563-7572.

CrossRefMedline

Acquaviva C, Bossis G, Ferrara P, Brockly F, Jariel-Encontre I, Piechaczyk M (2002) Căi multiple de degradare pentru proteinele familiei Fos. Ann NY Acad Sci 973:426-434.

Medline

Ahmed K, Tawfic S (1994) Mecanismul de reglare intracelulară a protein kinazei CK2: rolul asociației subnucleare mediate de stimulare. Mol Molol Biol Res 40:539-545.

Medline

Alcazar A, Martin E, Lopez-Fando J, Salinas M (1988) O procedură îmbunătățită de purificare și proprietățile caseinei kinazei II din creier. Neurochem Res 13:829-836.

CrossRefMedline

Andersson M, Westin JE, Cenci MA (2003) Timpul cursului imunoreactivității striate de tip DeltaFosB și a nivelului mRNA de prodynorfin după întreruperea tratamentului cu dopaminomimetic cronic. Eur J Neurosci 17:661-666.

CrossRefMedline

Barz T, Ackermann K, Dubois G, Eils R, Pyerin W. (2003) Ecrane de expresie la nivelul genomului indică rolul global al proteinkinazei CK2 în remodelarea cromatinei. J Cell Sci 116:1563-1577.

Rezumat / Text complet gratuit

Beh I, Schmidt R, Hecker E (1989) Două izoenzime de PKC găsite în celulele HL-60 prezintă o diferență de activare de către esterul de forbol ester TPA. FEBS Lett 249:264-266.

Medline

Bildl W, Strassmaier T, Thurm H, Andersen J, Eble S, Oliver D, Knipper M, Mann M, Schulte U, Adelman JP, Fakler B (2004) Proteina kinaza CK2 este asamblată cu canale K + (2 +) activată cu canale mici și reglează blocarea canalului. Neuron 43:847-858.

CrossRefMedline

Bing G, Wang W, Qi Q, Feng Z, Hudson P, Jin L, Zhang W, Bing R, Hong JS (1997) Exprimarea pe termen lung a antigenului legat de Fos și expresia tranzitorie a FosB delta asociată cu convulsii în hipocampul și striatul de șobolan. J Neurochem 68:272-279.

Medline

Blom N, Sicheritz-Ponten T, Gupta R, Gammeltoft S, Brunak S (2004) Predicția glicozilării post-translaționale și a fosforilării proteinelor din secvența de aminoacizi. proteomica 4:1633-1649.

CrossRefMedline

Boehning D, Moon C, Sharma S, Hurt KJ, Hester LD, Ronnett GV, Shugar D, Snyder SH (2003) Neurotransmisia de monoxid de carbon activată prin fosforylarea CK2 a hem oxigenazei-2. Neuron 40:129-137.

CrossRefMedline

Bohmann D (1990) Fosforilarea factorului de transcripție: o legătură între transducția semnalului și reglarea exprimării genelor. Celule canceroase 2:337-344.

Medline

Buschmann T, Potapova O, Bar-Shira A, Ivanov VN, Fuchs SY, Henderson S, Fried VA, Minamoto T, Alarcon-Vargas D, Pincus MR, Gaarde WA, Holbrook NJ, Shiloh Y, Ronai Z (2001) Jun fosforația kinazei NH2-terminal a p53 pe Thr-81 este importantă pentru stabilizarea p53 și pentru activitățile transcripționale ca răspuns la stres. Mol Cell Biol 21:2743-2754.

Rezumat / Text complet gratuit

Carle TL, Ulery PG, Nestler EJ (2004) Absența unui domeniu C-terminal al familiei Fos conservat contribuie la stabilitatea unică a deltaFosB. Soc Neurosci Abstr 30: 692.2.

Channavajhala P, Seldin DC (2002) Interacțiunea funcțională a protein kinazei CK2 și c-Myc în limfogeneza. Oncogene 21:5280-5288.

CrossRefMedline

Chen J, Nye HE, Kelz MB, Hiroi N, Nakabeppu Y, Hope BT, Nestler EJ (1995) Reglarea proteinelor delta FosB și FosB prin tratamente de convulsii electroconvulsive și tratamente cu cocaină. Mol Pharmacol 48:880-889.

Abstract

Chen J, Kelz MB, Hope BT, Nakabeppu Y, Nestler EJ (1997) Antigenii anti-Fos cronici: variante stabile de ΔFosB induse în creier prin tratamente cronice. J Neurosci 17:4933-4941.

Rezumat / Text complet gratuit

Chen RH, Juo PC, Curran T, Blenis J (1996) Fosforilarea c-Fos la capătul C-terminal amplifică activitatea sa de transformare. Oncogene 12:1493-1502.

Medline

Choe ES, Parelkar NK, Kim JY, Cho HW, Kang HS, Mao L, Wang JQ (2004) Inhibitorul proteic fosfatazei 1 / 2A acidul okadaic crește fosforilarea CREB și Elk-1 și expresia c-fos în striatum de șobolan in vivo. J Neurochem 89:383-390.

CrossRefMedline

Cochet C, Chambaz EM (1983) Fosforilații proteice mediate de poliamine: o posibilă țintă pentru acțiunea poliaminei intracelulare. Mol Cell Endocrinol 30:247-266.

CrossRefMedline

Cochet C, Feige JJ, Chambaz EM (1983) Proprietăți catalitice și moleculare ale unei casein kinaze de tip G de la țesutul pulmonar bovin. Biochim Biophys Acta 743:1-12.

Medline

Colby CR, Whisler K, Steffen C, Nestler EJ, Self DW (2003) Supraexpresia specifică de tip celular de tip Striatal a DeltaFosB sporește stimularea cocainei. J Neurosci 23:2488-2493.

Rezumat / Text complet gratuit

Daunais JB, Roberts DC, McGinty JF (1993) Administrarea de cocaină autoadministrează preprodynorphin, dar nu c-fos, mRNA în striatum de șobolan. NeuroReport 4:543-546.

Medline

Desterro JM, Rodriguez MS, Hay RT (2000) Reglarea factorilor de transcripție prin degradarea proteinelor. Cell Mol Life Sci 57:1207-1219.

CrossRefMedline

Diaz-Nido J, Armas-Portela R, Avila J (1992) Creșterea activității citoplasmatice de tip casein-kinază II însoțește creșterea neuritară după inhibarea sintezei ADN în celulele neuroblastomului NIA-103. J Neurochem 58:1820-1828.

Medline

Di Maira G, Salvi M, Arrigoni G, Marin O, Sarno S, Brustolon F, Pinna LA, Ruzzene M (2005) Proteina kinaza CK2 fosforilează și upregulates Akt / PKB. Moartea celulelor diferă 12:668-677.

CrossRefMedline

Dobrazanski P, Noguchi T, Kovary K, Rizzo CA, PS Lazo, Bravo R (1991) Ambele produse ale genei fosB, FosB și forma sa scurtă, FosB / SF, sunt activatori transcripționali în fibroblaste. Mol Cell Biol 11:5470-5478.

Rezumat / Text complet gratuit

Ferrara P, Andermarcher E, Bossis G, Acquaviva C, Brockly F, Jariel-Encontre I, Piechaczyk M (2003) Factorii determinanți structurali responsabili de degradarea proteazomală a proteinei c-Fos diferă în funcție de condițiile de exprimare. Oncogene 22:1461-1474.

CrossRefMedline

Fuchs SY, Dolan L, Davis RJ, Ronai Z (1996) Focalizarea dependentă de fosforilare a ubicitării c-Jun de Jun N-kinază. Oncogene 13:1531-1535.

Medline

Fuchs SY, Xie B, Adler V, Fried VA, Davis RJ, Ronai Z (1997) c-Jun kinazele NH2-terminale țintesc ubiquitinizarea factorilor lor de transcripție asociați. J Biol Chem 272:32163-32168.

Rezumat / Text complet gratuit

Fuchs SY, Tappin I, Ronai Z (2000) Stabilitatea factorului de transcripție ATF2 este reglată prin fosforilare și defosforilare. J Biol Chem 275:12560-12564.

Rezumat / Text complet gratuit

Girault JA, Hemmings HC Jr, Williams KR, Nairn AC, Greengard P (1989) Fosforilarea DAPP-32, o fosfoproteină reglementată de dopamină și cAMP, de către cazein kinaza II. J Biol Chem 264:21748-21759.

Rezumat / Text complet gratuit

Girault JA, Hemmings HC Jr, Zorn SH, Gustafson EL, Greengard P (1990) Caracterizarea în creierul mamifer a unei serine kinaze DARPP-32 identică cu cea a caseinei kinazei II. J Neurochem 55:1772-1783.

Medline

Hanada M, Sugawara K, Kaneta K, Toda S, Nishiyama Y, Tomita K, Yamamoto H, Konishi M, Oki T (1992) Epoxomicina, un nou agent antitumoral de origine microbiană. J Antibiot (Tokyo) 45:1746-1752.

Medline

Hann SR, Eisenman RN (1984) Proteine ​​codificate de oncogena umană c-myc: expresie diferențială în celulele neoplazice. Mol Cell Biol 4:2486-2497.

Rezumat / Text complet gratuit

Hemmings HC Jr, Girault JA, Williams KR, LoPresti MB, Greengard P (1989) ARPP-21, o fosfoproteină reglementată cu AMP ciclic (Mr = 21,000) îmbogățită în regiunile cerebrale inervate de dopamină. Secvența de aminoacizi a situsului fosforilate prin AMP ciclic în celule intacte și studiile cinetice ale fosforilării sale in vitro. J Biol Chem 264:7726-7733.

Hidaka H, ​​Kobayashi R (1992) Farmacologia inhibitorilor protein kinazei. Annu Rev Pharmacol Toxicol 32:377-397.

CrossRefMedline

Hirata H, Bessho Y, Kokubu H, Masamizu Y, Yamada S, Lewis J, Kageyama R (2004) Instabilitatea proteinei Hes7 este esențială pentru ceasul de segmentare somită. Nat Genet 36:750-754.

CrossRefMedline

Hiroi N, Graybiel AM (1996) Tratamente neuroleptice atipice și tipice induc programe distincte de exprimare a factorului de transcripție în striatum. J. Comp. Neurol 374:70-83.

CrossRefMedline

Hope B, Kosofsky B, Hyman SE, Nestler EJ (1992) Reglarea exprimării genetice imediate și legarea AP-1 în nucleul accumbens de șobolan prin cocaină cronică. Proc Natl Acad Sci SUA 89:5764-5768.

Rezumat / Text complet gratuit

Hope BT, Kelz MB, Duman RS, Nestler EJ (1994a) Tratamentul cu convulsii electroconvulsive cronice (ECS) are ca rezultat exprimarea unui complex AP-1 de lungă durată în creier, cu compoziție și caracteristici modificate. J Neurosci 14:4318-4328.

Abstract

Hope BT, Nye HE, Kelz MB, Self DW, Iadarola MJ, Nakabeppu Y, Duman RS, Nestler EJ (1994b) Inducerea unui complex AP-1 de lungă durată compus din proteine ​​modificate Fos în creier prin cocaină cronică și alte tratamente cronice. Neuron 13:1235-1244.

CrossRefMedline

Ishida A, Fujisawa H (1995) Stabilizarea protein kinazei II de către calmodulină, prin domeniul autoinhibitor. J Biol Chem 270:2163-2170.

Rezumat / Text complet gratuit

Jariel-Encontre I, Salvat C, Steff AM, Pariat M, Acquaviva C, Furstoss O, Piechaczyk M (1997) Mecanisme complexe pentru degradarea c-fos și c-jun. Mol Biol Rep 24:51-56.

CrossRefMedline

Jones S, Yakel JL (2003) Casein kinaza ii (proteina kinaza ck2) reglează funcția canalului serotonin 5-ht (3) în celule ng108-15. Neuroştiinţe 119:629-634.

CrossRefMedline

Kato T Jr, Delhase M, Hoffmann A, Karin M (2003) CK2 este o kinază IkappaB C-terminală responsabilă de activarea NF-kappaB în timpul răspunsului UV. Mol celulă 12:829-839.

CrossRefMedline

Kelz MB, Chen J, Carlezon WA Jr, Whisler K, Gilden L, Beckmann AM, Steffen C, Zhang YJ, Marotti L, Self DW, Tkatch T, Baranauskas G, Surmeier DJ, Neve RL, Duman RS, Picciotto MR, Nestler E J (1999) Exprimarea factorului de transcripție deltaFosB în creier controlează sensibilitatea la cocaină. Natură 401:272-276.

CrossRefMedline

Kim KB, Myung J, Sin N, echipaje CM (1999) Proteozomul inhibă produsele epoxomicinei și dihidroeponemicinei naturale: înțelege specificitatea și potența. Bioorg Med Chem Lett 9:3335-3340.

CrossRefMedline

Kobayashi E, Nakano H, Morimoto M, Tamaoki T (1989) Calphostin C (UCN-1028C), un nou compus microbian, este un inhibitor foarte puternic și specific al protein kinazei C. Biochem Biophys Res Comun 159:548-553.

CrossRefMedline

Krek W, Maridor G, Nigg EA (1992) Casein kinaza II este o enzimă predominant nucleară. J Cell Biol 116:43-55.

Rezumat / Text complet gratuit

Krohn NM, Stemmer C, Fojan P, Grimm R, Grasser KD (2003) Proteina kinaza CK2 fosforilează proteina de domeniu cu mobilitate înaltă SSRP1, inducând recunoașterea ADN-ului deteriorat UV. J Biol Chem 278:12710-12715.

Rezumat / Text complet gratuit

Kumar A, Choi KH, Renthal W, Tsankova NM, Theobald DEH, Truong HT, Russo SJ, LaPlant Q, Whistler K, Neve RL, Self DW, Nestler EJ (2005) Remodelarea cromatinei este un mecanism cheie care stă la baza plasticității induse de cocaină în striatum. Neuron 48:303-314.

CrossRefMedline

Lieberman DN, Mody I (1999) Casein kinaza-II reglează funcția canalului NMDA în neuronii hipocampali. Nat Neurosci 2:125-132.

CrossRefMedline

Litchfield DW (2003) Protein kinaza CK2: structura, reglementarea și rolul în deciziile celulare ale vieții și ale morții. Biochem J 369:1-15.

CrossRefMedline

Manabe T, Kuramoto N, Nakamichi N, Aramachi K, Baba K, Hirai T, Yoneyama M, Yoneda Y (2001) Degradarea proteinei c-Fos exprimată prin N-metil-dacidul aspartic în fracțiile nucleare ale hipocampului murin. Brain Res 905:34-43.

Medline

Mandelzys A, Gruda MA, Bravo R, Morgan JI (1997) Absența unui antigen cu 37 kDa asociat fos fosforic crescut și a activității de legare a ADN-ului ca AP-1 în creierul șoarecilor fosB null tratați cu acid kainic. J Neurosci 17:5407-5415.

Rezumat / Text complet gratuit

Marin O, Meggio F, Marchiori F, Borin G, Pinna LA (1986) Specificitatea situsului cazein kinazei-2 (TS) din citozol ficat de șobolan. Un studiu cu substraturi peptidice model. Eur J Biochem 160:239-244.

McClung CA, Nestler EJ (2003) Reglementarea expresiei genelor și a recompensei cocainei de către CREB și DeltaFosB. Nat Neurosci 6:1208-1215.

CrossRefMedline

McClung CA, Ulery PG, Perrotti LI, Zachariou V, Berton O, Nestler EJ (2004) DeltaFosB: un comutator molecular pentru adaptarea pe termen lung în creier. Brain Res Mol Brain Res 132:146-154.

Medline

Meggio F, Pinna LA (2003) O mie și una substraturi de protein kinază CK2? FASEB J 17:349-368.

Rezumat / Text complet gratuit

Meggio F, Donella-Deana A, Pinna LA, Moret V (1977) Fosforilarea fracțiunilor de cazeină prin ficatul de șobolan „fosvitin kinază”. FEBS Lett 75:192-196.

Medline

Meggio F, Brunati AM, Pinna LA (1983) Autofosforilarea tipului 2 casein kinazei TS la ambele subunități alfa și beta. Influența diferiților efectori. FEBS Lett 160:203-208.

CrossRefMedline

Meggio F, Shugar D, Pinna LA (1990) Derivații de ribofuranozil-benzimidazol ca inhibitori ai caseinei kinazei-2 și a caseinei kinazei-1. Eur J Biochem 187:89-94.

Medline

Meggio F, Marin O, Pinna LA (1994) Substratul specific al protein kinazei CK2. Mol Molol Biol Res 40:401-409.

Medline

Miller C, Zhang M, He Y, Zhao J, Pelletier JP, Martel-Pelletier J, Di Battista JA (1998) Inducerea transcripțională a genei ciclooxigenază-2 prin inhibarea activității acidului okadaic a activității fosfatazei în condrocitele umane: co-stimularea proteinelor de legare nucleară AP-1 și CRE. J Cell Biochem 69:392-413.

CrossRefMedline

Moratalla R, Elibol B, Vallejo M, Graybiel AM (1996) Modificări la nivelul rețelei în exprimarea proteinelor Fos-Jun invazive în striatum în timpul tratamentului și retragerii cocainei cronice. Neuron 17:147-156.

CrossRefMedline

Morgan JI, Curran T (1995) Genele imediate-devreme: zece ani mai târziu. Tendințe Neurosci 18:66-67.

CrossRefMedline

Nakabeppu Y, Nathans D (1991) O formă trunchiată în mod natural a FosB care inhibă activitatea transcripțională Fos / Jun. Celulă 64:751-759.

CrossRefMedline

Nestler EJ, Barrot M, Self DW (2001) Delta FosB: un comutator molecular susținut pentru dependență. Proc Natl Acad Sci SUA 98:11042-11046.

Rezumat / Text complet gratuit

Neve RL, Howe JR, Hong S, Kalb RG (1997) Introducerea subunității receptorului de glutamat 1 în neuronii motori in vitro și in vivo folosind un virus recombinant de herpes simplex. Neuroştiinţe 79:435-447.

CrossRefMedline

Nuthall HN, Joachim K, Stifani S. (2004) Fosforilarea serinei 239 de Groucho / TLE1 de către proteina kinaza CK2 este importantă pentru inhibarea diferențierii neuronale. Mol Cell Biol 24:8395-8407.

Rezumat / Text complet gratuit

Okazaki K, Sagata N. (1995) Calea kinazei Mos / MAP stabilizează c-Fos prin fosforilare și mărește activitatea de transformare în celulele NIH 3T3. EMBO J 14:5048-5059.

Medline

Palombella VJ, Rando JO, Goldberg AL, Maniatis T (1994) Calea ubiquitin-proteazom este necesară pentru procesarea proteinei precursoare NF-kappa B1 și pentru activarea NF-kappa B. Celulă 78:773-785.

CrossRefMedline

Papavassiliou AG, Treier M, Chavrier C, Bohmann D (1992) Degradarea targetată a c-Fos, dar nu a v-Fos, printr-un semnal dependent de fosforilare pe c-Jun. Ştiinţă 258:1941-1944.

Rezumat / Text complet gratuit

Peakman MC, Colby C, Perrotti LI, Tekumalla P, Carle T, Ulery P, Chao J, Duman C, Steffen C, Monteggia L, Allen MR, Stock JL, Duman RS, McNeish JD, Barrot M, Self DW, Nestler EJ , Schaeffer E (2003) Inductibilă, exprimarea specifică a regiunii creierului a unui mutant negativ dominant al c-Jun la șoarecii transgenici scade sensibilitatea la cocaină. Brain Res 970:73-86.

CrossRefMedline

Perrotti LI, Hadeishi Y, Ulery PG, Barrot M, Monteggia L, Duman RS, Nestler EJ (2004) Inducerea DeltaFosB în structurile cerebrale legate de recompense după stresul cronic. J Neurosci 24:10594-10602.

Rezumat / Text complet gratuit

Persico AM, Schindler CW, O'Hara BF, Brannock MT, Uhl GR (1993) Expresia factorului de transcriere a creierului: efectele amfetaminei acute și cronice și stresul la injectare. Brain Res Mol Brain Res 20:91-100.

Medline

Ploegh HL, Dunn BM (2000) Modificări post-translaționale: fosforilarea și fosfatazele. In: Protocoalele curente în știința proteinei (Dunn BM, ed.) Pag. 13.01-13.02. New York: Wiley și fiii.

Pyerin W, Burow E, Michaely K, Kubler D, Kinzel V (1987) Proprietăți catalitice și moleculare ale fosfitinei / cazein kinazei de înaltă purificare de tip II din celule epiteliale umane în cultură (HeLa) și relația cu proteina kinaza ecto. Biol Chem Hoppe Seyler 368:215-227.

Medline

Reikhardt BA, Kulikova OG, Borisova GY, Aleksandrova IY, Sapronov NS (2003) Starea sistemului de "protein kinază CK2-HMG14" în amnezia legată de vârstă la șobolani. Neurosci Behav Physiol 33:799-804.

Medline

Roberts BJ, Whitelaw ML (1999) Degradarea receptorului de dioxină din domenii de homologie helix-loop-helix / per-ARNT-Sim prin intermediul căii ubiquitin / proteazom. J Biol Chem 274:36351-36356.

Rezumat / Text complet gratuit

Rost B, Yachad G, Liu J (2004) Serverul PredictProtein. Nucleic Acids Res 32:W321-W326.

Rezumat / Text complet gratuit

Rylski M, Kaczmarek L (2004) Ap-1 ținte în creier. Front Biosci 9:8-23.

CrossRefMedline

Sahin B, Kansy JW, Nairn AC, Spychala J, Ealick SE, Fienberg AA, Greene RW, Bibb JA (2004) Caracterizarea moleculară a adenozin kinazei mouse-ului recombinant și evaluarea ca țintă pentru fosforilarea proteinelor. Eur J Biochem 271:3547-3555.

Medline

Salvat C, Aquaviva C, Jariel-Encontre I, Ferrara P, Pariat M, Steff AM, Carillo S, Piechaczyk M (1999) Există căi proteolitice multiple care contribuie la degradarea proteinei c-Fos, c-Jun și p53 in vivo? Mol Biol Rep 26:45-51.

CrossRefMedline

Schmidt R, Hecker E (1975) Autoxidarea esterilor forbolului în condiții normale de păstrare. Cancer Res 35:1375-1377.

Text complet gratuit

Schwarz EM, Van Antwerp D, Verma IM (1996) Fosforilarea constitutivă a IkappaBalpha de către cazeină kinaza II are loc preferențial la serina 293: cerința de degradare a IkappaBalpha liberă. Mol Cell Biol 16:3554-3559.

Rezumat / Text complet gratuit

Sears R, Leone G, DeGregori J, Nevins JR (1999) Ras îmbunătățește stabilitatea proteinei Myc. Mol celulă 3:169-179.

CrossRefMedline

Silva-Neto MA, Fialho E, Paes MC, Oliveira PL, Masuda H (2002) Cyclociclic independent de fosforilare a vitelinei de către cazein kinaza II purificată din ovocitele Rhodnius prolixus. Insecte Biochem Mol Biol 32:847-857.

CrossRefMedline

Skinner M, Qu S, Moore C, Înțelepciunea R (1997) Activarea și transformarea transcripțională prin proteina FosB necesită fosforilarea domeniului de activare carboxil-terminal. Mol Cell Biol 17:2372-2380.

Rezumat / Text complet gratuit

Stemmer C, Schwander A, Bauw G, Fojan P, Grasser KD (2002) Proteina kinaza CK2 protejează diferențiat proteine ​​cromozomiale de înaltă mobilitate a culturii de porumb B (HMGB), care modulează stabilitatea și interacțiunile ADN. J Biol Chem 277:1092-1098.

Rezumat / Text complet gratuit

Stevens I, Derua R, Rondelez E, Waelkens E, Merlevede W, Goris J (1999) Identificarea cic, o ciclină B2 kinază, ca o nouă protein kinază II dependentă de calciu / calmodulină și rolul acesteia în timpul maturării ovocitelor Xenopus laevis. Rez. Celule exp 252:303-318.

CrossRefMedline

Suh HW, Choi SS, Lee JK, Lee HK, Han EJ, Lee J (2004) Reglarea exprimării genelor c-fos și c-jun prin lipopolizaharidă și citokine în astrocite de cultură primară: efect al căilor PKA și PKC. Arh. Pharm Res 27:396-401.

Medline

Szyszka R, Boguszewska A, Grankowski N, Ballesta JP (1995) Fosforilarea diferențială a proteinelor acizilor ribozomali din celulele de drojdie de către două proteine ​​kinaze endogene: kasein kinaza-2 și kinaza 60S. Acta Biochim Pol 42:357-362.

Medline

Tamaoki T, Takahashi I, Kobayashi E, Nakano H, Akinaga S, Suzuki K (1990) Calphostinul (UCN1028) și compușii înrudiți cu calfostina, o nouă clasă de inhibitori specifici și potenți ai protein kinazei C. Adv al doilea Mesager Phosphoprotein Res 24:497-501.

Medline

Torres J, Pulido R (2001) Supresorul tumoral PTEN este fosforilat de proteina kinaza CK2 la capătul său C. Implicații pentru stabilitatea PTEN la degradarea mediată de proteazom. J Biol Chem 276:993-998.

Rezumat / Text complet gratuit

Tsubuki S, Saito Y, Tomioka M, Ito H, Kawashima S (1996) Inhibarea diferențială a calpainelor și a activităților proteazomului prin peptidil aldehide ale di-leucinei și trileucinei. J Biochem (Tokyo) 119:572-576.

Rezumat / Text complet gratuit

Tsurumi C, Ishida N, Tamura T, Kakizuka A, Nishida E, Okumura E, Kishimoto T, Inagaki M, Okazaki K, Sagata N (1995) Degradarea c-Fos de către proteomul 26S este accelerată de c-Jun și de mai multe proteine ​​kinaze. Mol Cell Biol 15:5682-5687.

Rezumat / Text complet gratuit

Unger GM, Davis AT, Slaton JW, Ahmed K (2004) Proteina kinaza CK2 ca regulator al supraviețuirii celulare: implicații pentru terapia cancerului. Curr Cancer Targets 4:77-84.

CrossRefMedline

Vial E, Marshall CJ (2003) Activitatea crescuta a ERK-MAP kinazei protejeaza membrul FOS al familiei FRA-1 impotriva degradarii proteazomale in celulele carcinomului de colon. J Cell Sci 116:4957-4963.

Rezumat / Text complet gratuit

Werme M, Messer C, Olson L, Gilden L, Thoren P, Nestler EJ, Brene S (2002) ΔFosB reglează funcționarea roții. J Neurosci 22:8133-8138.

Rezumat / Text complet gratuit

Whitmarsh AJ, Davis RJ (2000) Reglarea funcției factorului de transcripție prin fosforilare. Cell Mol Life Sci 57:1172-1183.

CrossRefMedline

Iarbă B, Kautzner I, Issinger OG, Arnold HH (1997) Două situsuri de fosforilare a protein kinazei CK2 sunt importante pentru activitatea Myf-5. Biol Chem 378:1445-1456.

Medline

Wisniewski JR, Szewczuk Z, Petry I, Schwanbeck R, Renner U (1999) Fosforilarea constitutivă a cozilor acide ale proteinelor 1 cu mobilitate ridicată de către cazeina kinaza II modifică conformitatea, stabilitatea și specificitatea de legare a ADN-ului. J Biol Chem 274:20116-20122.

Rezumat / Text complet gratuit

Yamaguchi Y, Wada T, Suzuki F, Takagi T, Hasegawa J, Handa H (1998) Casein kinaza II interacționează cu domeniile bZIP ale câtorva factori de transcripție. Nucleic Acids Res 26:3854-3861.

Rezumat / Text complet gratuit

Yanagawa T, Yuki K, Yoshida H, Bannai S, Ishii T (1997) Fosforilarea proteinei de stres A170 de către activitatea de tip casein kinază II în macrofage. Biochem Biophys Res Comun 241:157-163.

CrossRefMedline

Yankulov K, Yamashita K, Roy R, Egly JM, Bentley DL (1995) Inhibitorul de alungire transcripțională 5,6-dicloro-1-beta-d-ribofuranozilbenzimidazol inhibă proteina kinaza asociată cu factorul de transcripție IIH. J Biol Chem 270:23922-23925.

Rezumat / Text complet gratuit

Yen J, înțelepciunea RM, Tratner I, Verma IM (1991) O formă alternativă splicată a FosB este un regulator negativ al activării și transformării transcripționale prin proteinele Fos. Proc Natl Acad Sci SUA 88:5077-5081.

Rezumat / Text complet gratuit

Yin X, Jedrzejewski PT, Jiang JX (2000) Casein kinaza II fosforilează lentilele conjunxin 45.6 și este implicată în degradarea acesteia. J Biol Chem 275:6850-6856.

Rezumat / Text complet gratuit

Yoza BK, Brooks JW, Mizel SB (1992) Inducerea componentelor factorului de transcripție AP-1 în timpul activării celulelor T de interleukină 1 și esteri de forbol. Creșterea celulelor diferă 3:677-684.

Abstract

Yu S, Wang H, Davis A, Ahmed K (2001) Consecințele semnalizării CK2 la matricea nucleară. Mol Cell Biochem 227:67-71.

CrossRefMedline

Yu S, Davis AT, Guo C, Green JE, Ahmed K (1999) Direcționarea diferențială a protein kinazei CK2 la matricea nucleară după supraexpresia tranzitorie a subunităților sale. J Cell Biochem 74:127-134.

CrossRefMedline

Zachariou V, Bolanos CA, Selley DE, Theobald D, Cassidy MP, Kelz MB, Shaw-Lutchmann T, Berton O, Sim-Selley LJ, DiLeone RJ, Kumar A, Nestler EJ (2006) ΔFosB: un rol esențial pentru ΔFosB în nucleul accumbens în acțiunea morfinei. Nat Neurosci 9:205-211.

CrossRefMedline

articole care citeaza acest articol

  • Răspunsurile comportamentale și structurale la cocaină cronică necesită o buclă de alimentare care implică {delta} FosB și proteina kinază II dependentă de calciu / calmodulin în Nucleus Accumbens Shell Journal of Neuroscience, 6 martie 2013, 33(10):4295-4307
  • Supraexpresia stresantă a {Delta} FosB reproduce mișcările involuntare induse de levodopa cronică Journal of Neuroscience, 26 Mai 2010, 30(21):7335-7343
  • Abstract
  • Full text
  • Text integral (PDF)
  • Abstract
  • Full text
  • Text integral (PDF)
  • Abstract
  • Full text
  • Text integral (PDF)
  • Abstract
  • Full text
  • Text integral (PDF)
  • Mecanisme transcripționale ale dependenței: rolul lui {Delta} FosB Tranzacțiile filozofice ale societății regale B: Științe biologice, 12 Octombrie 2008, 363(1507):3245-3255
  • Rezistența la vulnerabilitate la reintegrarea comportamentului care caută metamfetamina în șoarecii mutanți ai factorului neurotrofic derivat din linia celulară glială Jurnalul FASEB, 1 iulie 2007, 21(9):1994-2004
  • Activator Protein-1 Factor de transcriere în carcinogeneza epiteliului respirator Cercetarea cancerului molecular, 1 Februarie 2007, 5(2):109-120