Faktor sérovej odpovede podporuje odolnosť voči chronickému spoločenskému stresu prostredníctvom indukcie DeltaFosB (2010)

PRIPOMIENKY: Napriek tomu, že stres, zneužívanie drog a určité prírodné odmeny vyvolávajú akumuláciu DeltaFosB, stres aktivuje rôzne bunky po prúde a neskôr rôzne receptory a gény. Inými slovami, závislosť a odolnosť voči stresu sa opierajú o zásadne odlišné mechanizmy

FULL STUDY

J Neurosci. 2010 Okt 27, 30 (43): 14585-92.

Vialou V, Maze I, Renthal W, LaPlant QC, Watts EL, Mouzon E, Ghose S, Tamminga CA, Nestler EJ.

zdroj

Fishberg oddelenie neurovedy, Mount Sinai lekárska škola, New York, New York 10029, USA.

abstraktné

Molekulárne mechanizmy, ktoré sú základom neurónových adaptácií vyvolaných stresom a liekmi, sú neúplne pochopené. Jednou molekulou, ktorá sa podieľa na takýchto adaptáciách, je ΔFosB, transkripčný faktor, ktorý sa hromadí v hlodavcovi nucleus accumbens (NAc), kľúčovej oblasti odmeňovania mozgu ako odpoveď buď na chronický stres, alebo na opakované vystavenie zneužívaniu drog. Tprechodové transkripčné mechanizmy, ktoré kontrolujú indukciu ΔFosB týmito environmentálnymi stimulmi, zostávajú nedostupné. Tu identifikujeme činiteľovo závislé transkripčné faktory, faktor sérovej odozvy (SRF), ako nového mediátora stresového, ale nie kokaín-, indukovaný ΔFosB. SRF je znížená v NAc u depresívnych ľudských pacientov aj u myší chronicky vystavených sociálnemu stresovému stresu. Táto znížená regulácia SRF chýba v pružných zvieratách. Použitím indukovateľnej mutagenézy ukazuje, že stresom sprostredkovaná indukcia AFosB, ktorá sa vyskytuje prevažne v pružných myšiach, závisí od expresie SRF v tejto oblasti mozgu, Navyše, NAc-špecifická genetická delécia SRF podporuje množstvo fenotypov podobajúcich sa pretrvávajúcemu a proankoticky, a činí zvieratá citlivejšie na škodlivé účinky chronického stresu. Na rozdiel od toho preukazujeme, že SRF nezohráva úlohu pri akumulácii ΔFosB v NAc ako odpoveď na chronickú expozíciu kokaínu. Navyše špecifické vyradenie SRC zo strany NAc nemá žiadny vplyv na správanie vyvolané kokaínom, čo naznačuje, že chronický spoločenský stres a opakovaná expozícia kokaínu regulujú akumuláciu ΔFosB a citlivosť správania prostredníctvom nezávislých mechanizmov.

úvod

Nucleus accumbens (NAc), kľúčová oblasť odmeňovania mozgu, je dôležitá pre integráciu senzorických a kognitívnych vstupov, ktoré riadia motivatívne relevantné správanie v reakcii na environmentálne podnety (Nestler a Carlezon, 2006, Sesack a Grace, 2010). NAc sa tiež podieľa na behaviorálnych abnormalitách spojených s drogovou závislosťou a depresiou. V súlade s tým sa ukázalo, že zacielenie na NAc s hlbokou stimuláciou mozgu zmierňuje depresívne a návykové správanie ako u ľudí, tak u hlodavcov (Schlaepfer a kol., 2008, Vassoler a kol., 2008, Heinze a kol., 2009, Kuhn et. al., 2009).

Opakovaná expozícia liekom zneužívania alebo stresu indukuje zmenené vzory génovej expresie v NAc, potenciálne podliehajúce chronickosti závislosti a depresie (Berton et al., 2006, Krishnan a kol., 2007, Maze a kol., 2010, Vialou et al. ., 2010). Zaujímavé je, že transkripčný faktor ΔFosB, zostrihový produkt génu fosB sa akumuluje v NAc ako odpoveď na opakované vystavenie pôsobeniu liečiva alebo stresu (Nestler, 2008, Perrotti a spol., 2008, Vialou a kol., 2010). DFosB bol navrhnutý ako potenciálny molekulárny spínač, ktorý riadi prechod od rekreačného užívania drog k chronicky závislému stavu (Nestler et al., 1999, McClung a ďalší, 2004, Renthal a kol., 2009), pretože jeho akumulácia v NAc zvyšuje odmeňovanie odpovedí na niekoľko návykových látok. Nedávno bola objasnená úloha indukcie ΔFosB v NAc po chronickom spoločenskom porážkovom strese (Nikulina et al., 2008, Vialou a kol., 2010): ΔFosB podporuje aktívnu korekciu odpovedí na stresové stimuly a zvyšuje odolnosť, Hoci sa indukcia ΔFosB vyskytuje spôsobom, ktorý závisí od stimulu, mechanizmy zodpovedné za akumuláciu ΔFosB indukovanú liekmi a stresom v NAc zostávajú neznáme.

Faktor sérovej odozvy (SRF) je transkripčný faktor potrebný na aktivačne závislú transkripčnú aktiváciu niekoľkých okamžitých skorých génov, vrátane c-fos, fosb, Egr1 a Arc (Knöll a Nordheim, 2009). Posledné štúdie preukázali účinky SRF na morfologické a cytoarchitektonické vlastnosti neurónov vrátane regulácie synaptickej aktivity a tvorby obvodov v mozgu dospelých (Knöll a Nordheim, 2009). Tieto objavy nás viedli k tomu, aby sme preskúmali, či je SRF funkčne regulovaný chronickým vystavením návykovým látkam alebo stresu, ako aj možnému vplyvu takejto regulácie na indukciu ΔFosB za týchto podmienok.

Tu popisujeme nový mechanizmus, prostredníctvom ktorého downregulácia SRF v NAc podporuje prodepresívne a anxiogénne fenotypy, čo v konečnom dôsledku zvyšuje zraniteľnosť zvieraťa voči škodlivým účinkom chronického stresu.. Tieto účinky sú sprostredkované čiastočne stratou indukcie ΔFosB v NAc stresovaných zvierat. Pozorované poklesy expresie SRF a ΔFosB v posmrtnom NAc tkanive získané od pacientov s depresiou podporujú dôležitosť našich nálezov pre ľudskú depresiu. Je zaujímavé, že tento mechanizmus regulujúci akumuláciu ΔFosB sa javí ako stresovo špecifický: chronická expozícia kokaínu nemá žiadny vplyv na expresiu SRF, delécia SRF z NAc nemá žiadny vplyv na akumuláciu ΔFosB po chronickej expozícii kokaínu a takáto delécia SRF nemá žiadny vplyv na kokaín. vyvolané správanie. Táto nová súhra medzi SRF a ΔFosB v kontexte stresu môže predstavovať dôležitý homeostatický mechanizmus regulujúci citlivosť jednotlivca na chronický stres.

Materiály a metódy

zver

Osem týždňov staré samce myší C57BL / 6J (Jackson Laboratory) sa použili vo všetkých behaviorálnych a biochemických experimentoch. Všetky zvieratá boli zvyknuté na živočíšne zariadenie najmenej počas 1 týždňa pred experimentálnymi manipuláciami a udržiavali sa pri 23-25 ° C v cykle 12 h svetlo / tma (svetlá od 7: 00 AM do 7: 00 PM) s ad libitum prístup k jedlu a vode. Pokusy boli vykonávané v súlade s usmerneniami Spoločnosti pre neurovedu a inštitucionálneho výboru pre starostlivosť o zvieratá a používania na Mount Sinai School of Medicine.

V experimentoch s kokaínom [Western blotting a kvantitatívna chromatinová imunoprecipitácia (ChIP)] sa použili 8- až 10 týždeň staré samce C57BL / 6J myší. Zvieratám boli podávané sedem denných intraperitoneálnych injekcií soľného roztoku alebo kokaínu (20 mg / kg kokaínu-HCl, Sigma). Myšiam sa po konečnej liečbe použil 24 h. Pri behaviorálnych pokusoch boli myši jednotlivo umiestnené v post-chirurgickom režime a boli liečené 10 mg / kg (pohybová senzibilizácia) alebo 7.5 mg / kg (upravené miesto preferencie) kokaín-HCl intraperitoneálne, ako je opísané nižšie.

Srffl / flice boli vytvorené ako bolo opísané (Ramanan a kol., 2005). NAc-špecifické vyradenie Srf sa dosiahlo stereotaxickou injekciou a následnou vírusovou nadmernou expresiou Cre rekombinázy (Cre) fúzovanej so zeleným fluorescenčným proteínom (GFP) s použitím adeno-asociovaného vírusu (AAV) vektorov. Bol použitý nonself-mazanie Cre. AAV-GFP sa injikoval namiesto AAV-Cre-GFP v Srffl / flice ako kontrola. Stručne povedané, myši sa anestetizovali použitím zmesi ketamínu (10 mg / kg) a xylazínu (10 mg / kg) s nasledujúcimi stereotaxickými súradnicami použitými na vírusovú aplikáciu: + 1.6 (predná / zadná) + 1.5 4.4 (chrbtový / ventrálny) v uhle 10 ° od stredovej čiary (vzhľadom na bregmu). Celkový počet 0.5 μl purifikovaného vírusu sa dodával bilaterálne počas min. Periódy 5 (0.1 μl / min), po čom nasledovala 5 minúta odpočinku. Myši boli testované 2 týždne po chirurgickom zákroku, keď bola vírusová expresia maximálna, a miesta vpichu injekcie boli potvrdené pre všetky zvieratá použitím štandardných histologických metód. Účinnosť expresie Cre sprostredkovanej vírusom bola validovaná imunohistochemickou metódou a PCR s reverznou transkriptázou pre Srf uskutočňovanú na mikrodiskujúcich NAc dierach zo zvierat, ktorým boli podané AAV-Cre-GFP a AAV-GFP do NAc. Vírusy AAV-GFP a AAV-Cre-GFP sa vytvorili tak, ako sa už opísalo (Maze et al., 2010).

Behaviorálne postupy

Sociálny porážkový stres.

C57BL / 6J myši boli podrobené chronickému spoločenskému poraneniu pri 10 po sebe idúcich dňoch, ako bolo opísané skôr (Berton et al., 2006, Krishnan a spol., 2007, Vialou a kol., 2010). Stručne povedané, každá myš bola vystavená neznámej a agresívnej malej plemennej myši CD1 na 5 min za deň. Po priamej interakcii s CD1 agresorom sa zvieratá umiestnili do priľahlého oddelenia tej istej klietky pre nasledujúci 24 h so senzorickým, ale nie fyzickým kontaktom. Kontrolné zvieratá boli umiestnené v ekvivalentných klietkach, ale s členmi toho istého kmeňa. Testy sociálnej interakcie boli vykonané 24 h po poslednom dni porážky.

Sociálne vyhýbanie sa neznámej samčej myši CD1 sa hodnotilo podľa publikovaných protokolov (Berton a kol., 2006; Krishnan a kol., 2007; Vialou a kol., 2010). Experimentálna myš sa najskôr 2.5 minúty umiestnila do otvoreného poľa obsahujúceho prázdnu klietku z drôteného pletiva. Počas druhého sedenia bola do káblovej klietky zavedená neznáma myšia myš CD1. Meral sa čas strávený v interakčnej zóne (8 cm široká chodba obklopujúca klietku). Segregácia porazených myší na citlivé a odolné subpopulácie sa uskutočňovala tak, ako už bolo opísané (Krishnan et al., 2007; Vialou et al., 2010). Pretože väčšina kontrolných myší trávila viac času interakciou so sociálnym cieľom ako s prázdnym uzavretím terča, bol ako medzný limit stanovený interakčný pomer 100 (rovnaký čas strávený v interakčnej zóne v prítomnosti proti neprítomnosti sociálneho cieľa). Myši so skóre <100 boli označené ako citlivé a myši so skóre ≥ 100 boli označené ako odolné. Rozsiahle behaviorálne, biochemické a elektrofyziologické analýzy podporujú platnosť týchto odlišných náchylných a odolných subpopulácií (Krishnan et al., 2007; Wilkinson et al., 2009; Vialou et al., 2010).

Na preskúmanie zraniteľnosti Srffl / flice na spoločenský stresový stres sa myši, injikované bilaterálne AAV-GFP alebo AAV-Cre-GFP, podstúpili tri rovnaké porážky v ten istý deň a potom sa testovali na sociálnu interakciu 24 h neskôr. Tento submaximálny porážkový postup bol predtým potvrdený na odhalenie fenotypov preceptovateľnosti po genetických manipuláciách (Krishnan et al., 2007, Vialou a kol., 2010).

Naučená bezmocnosť.

Srfl / fl uxy exprimujúce buď AAV-GFP alebo AAV-Cre-GFP sa podrobili procedúre naučenej bezmocnosti, ako bolo opísané vyššie (Berton et al., 2007). Stručne povedané, myši boli vystavené prerušovaným, nevyvrátiteľným šokom nohy pre 1 h počas 2 po sebe idúcich dní (0.45 mA, trvanie 5). V deň testu boli myši opätovne vložené do krabice pre 15 po sebe idúce únikové štúdie. Počas každej skúšky sa poskytol nepretržitý šok a myši dostali príležitosť uniknúť tým, že vstúpili do susedného, ​​neelektrifikovaného oddelenia. Po úspešnom úniku sa dvere automaticky zatvorili a zaznamenala sa latencia úniku. Keď sa myši v 25e neuskutočnili, štúdia bola ukončená a bola zaznamenaná ako zlyhanie. Predchádzajúce štúdie ukázali, že vírusová expresia v NAc a iných oblastiach nemá vplyv na východiskový únikový stav v neprítomnosti stresu (Newton et al., 2002, Berton et al., 2007).

Lokomotorická senzibilizácia.

Dva týždne po intra-NAc injekciách buď AAV-GFP alebo AAV-Cre-GFP boli myši Srffl / fl podrobené pohybovej senzibilizácii. Myši boli zvyknuté na pohybové pole 30 minút denne počas 4 dní. Po navyknutí si zvieratá intraperitoneálne injikovali 10 mg / kg kokaínu-HCl a umiestnili sa do lokomotorických boxov. Lokomotorické aktivity zvierat sa zaznamenávali pomocou systému lúčov lúčov (San Diego Instruments) ako ambulantné lámanie lúčov po dobu 30 minút denne. Lokomotorická senzibilizácia sa zaznamenávala po dobu 6 dní.

Uprednostňované miesto preferencie.

Procedúra úpravy miesta sa uskutočňovala tak, ako už bolo opísané (Maze et al., 2010), s nasledujúcimi modifikáciami. Stručne, 18 dní po intra-NAc infúziách AAV-GFP alebo AAV-Cre-GFP u myší Srffl / fl boli zvieratá umiestnené do kondicionovacích komôr, ktoré pozostávali z troch kontextovo odlišných prostredí. Myši, ktoré vykazovali významnú preferenciu pre ktorúkoľvek z dvoch kondicionovacích komôr, boli zo štúdie vylúčené (<10% všetkých zvierat). Skupiny s kondicionovaním sa ďalej vyvážili tak, aby sa prispôsobili akejkoľvek odchýlke komory, ktorá ešte môže existovať. Nasledujúce dni sa zvieratám injekčne podal soľný roztok a popoludní sa 30 minút nechali v jednej komore a potom sa nasledujúci deň injekčne podal kokaín (7.5 mg / kg, ip) a vpustili sa do ďalšej komory 30 minút, čo sa rovnalo celkovo dve kolá tréningu asociácie na jednu liečbu (dva páry fyziologického roztoku a dve kokaínu). V deň testu sa myši umiestnili späť do prístroja bez ošetrenia na 20 minút a testovali sa na vyhodnotenie preferencie strany. Lokomotorické reakcie na kokaín sa hodnotili pomocou lúčových zlomov v komorách spárovaných s kokaínom, aby sa zaistila účinnosť liečby drogami. Pre všetky skupiny sa hodnotila východisková lokomócia ako odpoveď na soľný roztok, aby sa zabezpečilo, že lokomócia nebola ovplyvnená vírusovou liečbou.

Ďalšie behaviorálne testy.

Skúšky boli testované na základe publikovaných protokolov (Vialou et al., 2010) v testoch otvoreného poľa, svetla / tmy a núteného plávania. Aktivita myší v otvorenom poli bola zaznamenaná pre 5 min pomocou systému sledovania videa (Ethovision) za červených svetelných podmienok. Pri skúške svetlo / tma sa myšiam umožnilo voľne preskúmať dvojkomorovú krabicu zloženú z jednej veľkej osvetlenej arény spojenej s menšou uzavretou arénou. Myši sa testovali na čas 5 min na vyhodnotenie času stráveného v oboch priestoroch. Pri testoch na otvorenom poli a svetle / tme bol čas strávený v strede a svetlá aréna hodnotený ako inverzný index reakcií súvisiacich s úzkosťou. Test 1 d bol vykonaný núteným plavaním počas obdobia 5 min. Zvýšená doba nehybnosti počas testu núteného plávania bola interpretovaná ako správanie podobné preprave. Test 1 d nútený plavat bol široko používaný u myší a bol validovaný ako miera prediktívnej platnosti, pretože antidepresívne lieky znižujú nehybnosť.

imunohistochémia

Srffl / flice boli anestetizované a infúziou intrakardiálne perfundované pomocou 4% paraformaldehydu / PBS. Mozgy boli odstránené a kryoprotektované v 30% sacharóze / PBS. Koronálne rezy (30 μm) boli rezané na mraziacom mikrotome a spracované na imunohistochemické analýzy. Validácia Srffl / fl knock-out sa uskutočnila s použitím polyklonálnej protilátky namierenej proti SRF (1 / 2000, Santa Cruz Biotechnology). Cre expresia bola potvrdená pomocou expresie GFP (kuracie polyklonálne, 1 / 8000, Aves Labs) v disekovaných mozgoch, pretože Cre je fúzovaný s GFP. Na kvantifikáciu indukcie ΔFosB po spoločnom porážkovom strese u myší Srffl / fl knock-out bola detegovaná ΔFosB s použitím králičej polyklonálnej protilátky proti N-terminálnej oblasti proteínu (1 / 1000, Santa Cruz Biotechnology). Obrázky boli odobraté konfokálnym mikroskopom (zväčšenie 20 × Zeiss). Počet GFP imunopozitívnych buniek počítaných ako negatívny a pozitívny na imunoreaktivitu proti IFF sa kvantifikoval vo viacerých obrázkoch pre každé zviera so strednými hodnotami následne vypočítanými pre každé zviera. Každé zviera sa považovalo za individuálne pozorovanie pre štatistickú analýzu.

Ľudské posmrtné tkanivo NAc

Ľudské posmrtné mozgové tkanivo sa získalo z Dallas Brain Collection, kde sa tkanivo zhromažďuje od Dallas Medical Examiner's Office a University of Texas (UT) Southwestern's Tissue Transplant Program na základe súhlasu najbližšieho príbuzného. Tkanivo sa analyzovalo u mužov aj u žien podľa veku, postmortálneho intervalu, čísla integrity RNA (RIN) a pH. Špecifické agonálne faktory vrátane kómy, hypoxie, pyrexie, záchvatov, dehydratácie, hypoglykémie, zlyhania viacerých orgánov a požitia neurotoxických látok v čase smrti ovplyvňujú integritu RNA v posmrtných mozgových tkanivách (Tomita et al., 2004). Na charakterizáciu vzoriek tkaniva pri každej z týchto ôsmich podmienok sme použili stupnicu agonálneho faktora (AFS). Absencii agonálneho faktora bolo pridelené skóre 0 a jeho prítomnosť bola hodnotená ako 1, čím sa získalo celkové skóre AFS medzi 0 a 8. Tkanivo s agonálnym skóre 0 alebo 1 odráža vzorky dobrej kvality; demografické údaje o prípadoch sú uvedené v tabuľke 1. Vynikajúca kvalita tkaniva bola potvrdená vysokými hodnotami RIN. Prípady sa podrobili štandardnej disekcii pred rýchlym zmrazením v -40 ° C izopentáne a uskladnením pri -80 ° C; ďalšia disekcia NAc sa uskutočnila na zmrazenom tkanive. Inštitucionálna kontrolná komisia UT Southwestern preskúmala a schválila odber tohto tkaniva na výskumné účely. Pre každý prípad depresie sa neskôr uskutočnil priamy informačný rozhovor, kde boli zdokumentované informácie týkajúce sa choroby; konsenzuálnu diagnózu veľkej depresívnej poruchy stanovili pomocou kritérií DSM-IV dvaja výskumní psychiatri. V žiadnom z prípadov zahrnutých v tejto štúdii neboli krvné toxikologické vyšetrenia pozitívne na zneužívanie drog, alkohol alebo lieky na predpis iné ako antidepresíva. Napriek liečbe antidepresívami boli všetci jedinci v čase smrti klinicky depresívni. Vzorky tkaniva sa na analýzu dávali zaslepeným spôsobom.

Tabuľka 1.

Demografické údaje pre štúdie ľudských post mortem

Western blotting

Ľudské a myšacie vzorky NAc sa spracovali tak, ako sa už opísalo (Maze a kol., 2010). Zmrazené tkanivo sa podrobilo pôsobeniu ultrazvuku v lýznom pufri 5 mM HEPES obsahujúcom 1% SDS s proteázou (Roche) a inhibítormi fosfatázy (Sigma). Koncentrácie proteínov boli stanovené pomocou testu Dc proteínu (Bio-Rad). Rovnaké množstvá proteínových vzoriek boli podrobené SDS-PAGE a Western blotting. Western blot sa sondoval použitím protilátky na SRF (1 / 2000, Santa Cruz Biotechnology) alebo GAPDH (1 / 1500, Abcam) a boli potom skenované a kvantifikované pomocou Odyssey imaging system (Licor).

Izolácia RNA a kvantitatívna PCR

Izolácia RNA, kvantitatívna PCR (qPCR) a analýza údajov sa uskutočnili tak, ako už bolo opísané (Maze et al., 2010, Vialou a kol., 2010). Stručne, RNA bola izolovaná s TriZolovým činidlom (Invitrogen) a ďalej bola purifikovaná pomocou RNAeasy mikro kitov od firmy Qiagen. U všetkých vzoriek RNA sa stanovilo, že majú hodnoty 260 / 280 a 260 / 230 ≥ 1.8. Reverzná transkripcia sa vykonala použitím iScriptu (Bio-Rad). qPCR s použitím SYBR zelenej (Quanta) sa uskutočnila systémom Applied Biosystems 7900HT RT PCR s nasledujúcimi parametrami cyklu: 2 min pri 95 ° C; 40 cykly 95 ° C pre 15 s, 59 ° C pre 30 s, 72 ° C pre 33 s; a odstupňované zahrievanie na teplotu 95 ° C na vytvorenie disociačných kriviek na potvrdenie jednotlivých produktov PCR. Údaje boli analyzované porovnaním hodnôt C (t) liečených stavov (kontrola voči vnímavým alebo pružným myšiam alebo ľudským kontrolám oproti pacientom s depresiou) metódou ΔCC (t) (Tsankova et al., 2006). Priméry ΔFosB qPCR: foward, AGGCAGAGCTGGAGTCGGAGAT a reverzné, GCCGAGGACTTGAACTTCACTCG.

Čip

Chip sa uskutočnil tak, ako sa už opísalo (Maze et al., 2010) na združených dvojstranných nárazoch NAc od kontrolných, náchylných a pružných myší (14 razník / myš) 1 h po poslednej skúsenosti s porážkou a zo slaného a kokaínového liečených zvierat 24 h po konečnej liečbe. Tkanivo sa zosieťovalo v 1% formaldehyde. Fixácia sa následne prerušila aplikáciou glycínu a tkanivo sa premylo a udržovalo sa na -80 ° C až do použitia. Nakrájaný chromatín bol inkubovaný cez noc s anti-SRF protilátkou (Santa Cruz Biotechnology) predtým viazanou na magnetické guľôčky (Dynabeads M-280, Invitrogen). Po reverznom zosieťovaní a purifikácii DNA sa viazanie SRF na fosb promótor stanovilo pomocou qPCR za použitia primerov pokrývajúcich oblasť fosb promótora obsahujúceho dve väzbové miesta sérového odozvového elementu. SRF pulldowns boli významne obohatené v porovnaní s kontrolami bez protilátok. Myši fosf gén promótorové priméry: dopredu, CCCTCTGACGTAATTGCTAGG a reverzné, ACCTCCCAAACTCTCCCTTC.

Štatistické analýzy

Na porovnanie priemerov medzi kontrolnými, vnímavými a odolnými myšami v biochemických a behaviorálnych analýzach sa použili jednosmerné ANOVA. Na porovnanie indukcie ΔFosB sociálnou porážkou u miestnych knock-out myší Srf sa použili obojsmerné ANOVA, ako aj na porovnanie účinku knof-outu Srf v protokoloch naučenej bezmocnosti a lokomotorickej senzibilizácie. Študentove t testy sa použili na porovnanie priemerov v účinku knof-outu Srf na indukciu AFosB a medzi skupinami v ľudskej posmrtnej tkanivovej a myšej ChIP analýze. Rozdiely medzi experimentálnymi podmienkami sa považovali za štatisticky významné, keď p ≤ 0.05.

výsledky

Expresie SRF a ΔFosB v ľudskej depresii a sociálne porazených myšiach

Aby sme preskúmali potenciálnu úlohu SRF pri vývoji depresívneho správania, najskôr sme vyhodnotili expresiu proteínu SRF v NAc postmortálne depresívnych ľudských pacientov. Depresívni jedinci vykazovali signifikantne znížené hladiny SRF v NAc v porovnaní s ich vekovo porovnateľnými kontrolami (t (19) = 1.9; p <0.05) (obr. 1A). Vzhľadom na úlohu SRF v regulácii okamžitej včasnej expresie génu závislej od aktivity (Ramanan et al., 2005) sme predpokladali, že SRF môže byť zapojený do riadenia expresie ΔFosB v tejto oblasti mozgu. Na podporu tejto hypotézy sme pozorovali, že hladiny mRNA Δfosb boli tiež významne znížené v NAc depresívnych ľudí (t (16) = 1.8; p <0.05) (obr. 1B). To je v súlade s nedávnymi zisteniami o znížených hladinách ΔFosB proteínu aj za týchto podmienok (Vialou et al., 2010).

Obrázok 1.

Chronická stresom indukovaná represia SRF koreluje so zníženou transkripciou ΔFosB v NAc. A, B, postmortálni ľudia s depresiou vykazujú znížené hladiny proteínu SRF (n = 10 / skupina; A) a expresie mRNA Δfosb v NAc (n = 8 / skupina; B). C, myši vystavené chronickému (10 d) sociálnemu porážkovému stresu boli zoskupené do náchylných a odolných subpopulácií. D, Chronický stres sociálnej porážky znižuje hladiny proteínov SRF v NAc vnímavých myší, ale nie odolných, v porovnaní s kontrolami 24 hodín po teste sociálnej interakcie uvedenom v C. E, hladiny mRNA ΔfosB v NAc sa u vnímavých myší nezmenili, ale významne upregulovaná u odolných zvierat (n = 7–15 / skupina). F, SRF proteín vykazuje zvýšenú väzbu na promótor fosbového génu po chronickom strate sociálnej porážky iba u odolných a nie u citlivých myší (n = 5 / skupina). Zobrazené údaje sú vyjadrené ako priemer ± SEM (vyjadrené ako chybové stĺpce). Con., Control; Dep., Depresívny; Sus., Vnímavý; Res., Odolný. * p <0.05 verzus kontrola; *** p <0.001 verzus kontrola; #p <0.05 verzus citlivé; ## p <0.01 verzus vnímavý; ### p <0.001 verzus citlivé.

Na rozšírenie týchto zistení sme použili protokol chronického stresu zo sociálnej porážky u myší. Boli zjavné dve rozlíšiteľné skupiny porazených myší, vnímavé a odolné (Krishnan et al., 2007), založené na miere sociálneho vyhýbania sa, u ktorých vnímavé zvieratá vykazovali významne zníženú sociálnu interakciu v porovnaní s kontrolnými aj odolnými zvieratami (F (2,23, 157.2) = 0.001; p <0.001; t testy s Bonferroniho korekciou, náchylné proti kontrole, p <0.05; odolné proti kontrole, p <0.01; odolné proti citlivému, p <1) (obr. 2,32C). Dva dni po poslednej porážkovej epizóde sa citlivé, odolné a neporazené kontrolné myši analyzovali na expresiu SRF v NAc. Podobné nálezom v ľudskej depresii boli hladiny proteínov SRF významne znížené v NAc vnímavých myší v porovnaní s kontrolami, zatiaľ čo hladiny SRF neboli ovplyvnené v NAc odolných myší (F (4.7) = 0.05; p <0.05; t testy s Bonferroniho korekcia, vnímavý vs kontrola, p <0.05; pružný vs citlivý, p <1) (obr. XNUMXD).

Ďalej sme skúmali expresiu mRNA Δfosb v NAc týchto troch skupín zvierat a pozorovali sme signifikantné zvýšenie expresie ffosb iba u odolných zvierat, s trendom, ale signifikantné zvýšenie sa nepozorovalo u vnímavých myší (t (14) = 2.1; p <0.05 ) (Obr. 1E). Na ďalšie preskúmanie možných interakcií medzi hladinami SRF a transkripciou Δfosb sme pomocou ChIP preskúmali, či sa väzba SRF na promótor génu fosb zmenila po chronickom strate sociálnej porážky v samostatných kohortách vnímavých a odolných myší. Pružné zvieratá vykazovali významne zvýšenú väzbu SRF na fosbový promótor v NAc v porovnaní s kontrolami (t (8) = 2.1; p <0.05), ako aj v porovnaní s vnímavými myšami (t (8) = 2.0; p <0.05). Nebol pozorovaný žiadny rozdiel medzi kontrolami a vnímavými myšami, čo pravdepodobne odráža nedostatok indukcie SRF u vnímavých myší (obr. 1F).

Na potvrdenie úlohy SRF v regulácii ΔFosB po chronickom strese zo sociálnej porážky boli myši Srffl / fl použité na preskúmanie účinku selektívnej delécie SRF z NAc na indukciu stresu ΔFosB. Myškám Srffl / fl boli stereotaxicky injikované intra-NAc AAV vektory exprimujúce GFP alebo Cre-GFP. Imunohistochemicky bolo potvrdené NAc-špecifické vyradenie SRF indukované AAV-Cre-GFP (obr. 2A). Skutočne nedošlo k žiadnemu prekrytiu medzi farbením SRF a expresiou Cre, čo dokazuje účinnosť knock-outu. V mikrodisekovaných NAc razniciach sme zistili významné 50% zníženie hladín proteínov SRF (t (11) = 4.3; p <0.001). Rozsah pravdepodobne odráža skutočnosť, že časť tkaniva v takýchto mikrodisekciách nie je vírusovo infikovaná.

Obrázok 2.

SRF sprostredkuje indukciu ΔFosB chronickým stresom zo sociálnej porážky. A, injekcia AAV-Cre-GFP do NAc myší Srffl / fl vedie k vyradeniu proteínu SRF v neurónoch exprimujúcich Cre. Injekcia AAV-GFP bola bez zjavného účinku. B, Takéto selektívne vyradenie SRF z NAc úplne blokuje indukciu ΔFosB v NAc po chronickom strate sociálnej porážky (n = 4 / skupina). Zobrazené údaje sú vyjadrené ako priemer ± SEM (vyjadrené ako chybové stĺpce). * p <0.05 verzus kontrola AAV-GFP; ** p <0.01 verzus porážka AAV-GFP.

Ďalej sme uskutočnili kvantitatívnu imunohistochémiu pre ΔFosB v NAc porazených Srffl / fl myší injikovaných intra-NAc buď AAV-Cre-GFP alebo AAV-GFP. Po chronickom strese zo sociálnej porážky bola expresia ΔFosB významne indukovaná u NAc zvierat injikovaných AAV-GFP (interakcia vírus x liečba, F (1,12) = 6.4; t testy s Bonferroniho korekciou, kontrola vs porážka, p <0.05; AAV-Cre vs AAV-GFP, p <0.01). Táto indukcia však nebola pozorovaná u myší Srffl / fl, ktoré dostávali AAV-Cre-GFP (obr. 2B), čo ukazuje, že indukcia AFosB v NAc chronickým stresom vyžaduje SRF.

SRF knock-out v NAc podporuje fenotypy podobné predajnej a proankoticky podobné

Pretože sa predtým preukázalo, že indukcia ΔFosB chronickým stresom sociálnej porážky sprostredkováva odolnosť (Vialou et al., 2010), predpokladali sme, že znížená regulácia SRF a výsledná strata indukcie ΔFosB u vnímavých zvierat môžu predstavovať negatívnu adaptáciu, ktorá nakoniec spôsobí zvieratá zraniteľnejšie voči škodlivým účinkom stresu. Na testovanie tejto hypotézy sme indukovali lokálnu NAc-špecifickú deléciu génu Srf u dospelých myší Srffl / fl, ako je opísané vyššie, a výsledné myši a ich kontroly boli testované v sérii paradigiem správania na vyhodnotenie východiskovej depresie a úzkosti. ako správanie. Lokálna delécia NAc zo SRF podporovala účinok podobný prodepresii meraný pomocou testu núteného plávania (t (30) = 2.5; p <0.05), ako aj anxiogénny účinok meraný v otvorenom poli (t (38) = 1.9; p <0.05) a testy svetlo / tma (t (8) = 1.9; p <0.05). Takže myši Srffl / fl dostávajúce AAV-Cre-GFP do NAc vykazovali zníženú latenciu k nehybnosti v teste núteného plávania, menej času v strede otvoreného poľa a menej času vo svetlej komore svetlej / tmavej skrinky v porovnaní so zvieratami injikovanými AAV-GFP (obr. 3A – C). Avšak intra-NAc delécia SRF nezmenila základné hladiny lokomócie, čo naznačuje, že pozorované behaviorálne účinky u SRF knock-out zvierat neboli spôsobené abnormalitami vo všeobecnej pohybovej aktivite (obr. 3D). Tieto údaje sú zaujímavé z hľadiska predchádzajúcich správ, ktoré naznačujú, že hoci ΔFosB v NAc reguluje depresívne správanie, zdá sa, že nie je zapojený do reakcií súvisiacich s úzkosťou (Vialou et al., 2010). Naše súčasné zistenia, že strata SRF indukuje anxiogénne reakcie, naznačujú, že sa tak deje prostredníctvom iných cieľov ako ΔFosB.

Obrázok 3.

Vyradenie SRF z NAc podporuje fenotypy podobné prodepresii a proanxiite. A – C, selektívne vyradenie SRF z NAc, dosiahnuté injekciou AAV-Cre-GFP do NAc myší Srffl / fl, znižuje latenciu k nehybnosti v teste núteného plávania (n = 14–18 / skupina; A) a redukuje čas strávený v strede a čas strávený vo svetelnom oddelení v testoch na otvorenom poli (B) a svetlo / tma (C) (n = 5–15 / skupina). D, Nebol pozorovaný žiadny rozdiel v bazálnej pohybovej aktivite v otvorenom poli myší, ktoré dostávali intra-NAc injekcie AAV-GFP alebo AAV-Cre-GFP. E, F, Zvýšená náchylnosť k naučenej bezmocnosti (n = 7–8 / skupina; E) a stres zo sociálnej porážky (n = 5–6 / skupina; F), merané v uvedenom poradí, latenciou úniku a časom sociálnej interakcie. . Zobrazené údaje sú vyjadrené ako priemer ± SEM (vyjadrené ako chybové stĺpce). * p <0.05 verzus GFP alebo verzus cieľ chýba; ** p <0.01 verzus GFP; *** p <0.001 oproti GFP.

Ďalej sme študovali, či delécia SRF v NAc tiež zvyšuje zraniteľnosť zvieraťa voči škodlivým účinkom opakovaného stresu. Myši Srffl / fl, ktorým bol injekčne podaný AAV-Cre-GFP alebo AAV-GFP do NAc, boli vyšetrené na dvoch modeloch depresie, naučenej bezmocnosti a stresu chronickej sociálnej porážky. V prípade naučenej bezmocnosti vykazovali zvieratá Srffl / fl, ktoré dostávali AAV-Cre-GFP, zvýšenú latenciu pri úniku zo šoku z chodidla po predchádzajúcom vystavení stresu zo šoku nevyhnutného pre šliapanie (liečba × pokusy, F (14,180 10.2) = 0.001; t testy s Bonferroniho korekciou, p <0.01; AAV-Cre oproti AAV-GFP, p <3), čo naznačuje zvýšenú náchylnosť na deficity správania vyvolané stresom (obr. 10E). Podobne lokálna delécia SRF z NAc tiež zvýšila sociálnu averziu (t (1.8) = 0.05; p <3) v porovnaní s kontrolnými zvieratami injikovanými AAV-GFP po chronickom strate sociálnej porážky (obr. XNUMXF), účinku podobnom prodepresii.

Nedostatok zapojenia SRF do indukcie ΔFosB a reakcií na správanie sa kokaínu

Vzhľadom na to, že ΔFosB je indukovaný aj v NAc v reakcii na zneužívanie drog, ako je kokaín, bolo zaujímavé preskúmať potenciálnu úlohu SRF pri pôsobení kokaínu. Na rozdiel od stresu chronickej sociálnej porážky, opakovaná expozícia kokaínu nezmenila expresiu proteínu SRF v NAc (t (14) = 0.8; p> 0.05) (obr. 4A) a nemala žiadny vplyv na väzbu SRF na promótor génu fosB v tejto oblasti mozgu. (t (4) = 0.7; p> 0.05) (obr. 4B). To naznačuje, že na rozdiel od stresu indukcia ΔFosB po chronickom kokaíne nie je sprostredkovaná prostredníctvom SRF. Testovali sme to priamo skúmaním, či sa akumulácia ΔFosB po chronickom kokaíne mení u zvierat Srffl / fl dostávajúcich AAV-Cre-GFP oproti AAV-GFP na NAc. Zistili sme, že delécia SRF nemala žiadny vplyv na akumuláciu ΔFosB indukovanú kokaínom v tejto oblasti mozgu (obr. 4C).

Obrázok 4.

Strata SRF nemala žiadny vplyv na indukciu kokaínu pri správaní podľa ΔFosB alebo kokaínu. A, B, opakovaná expozícia kokaínu (7 d, 20 mg / kg kokaínu-HCl) nemala žiadny vplyv na expresiu proteínu SRF v NAc (A) alebo na väzbu SRF na promótor génu fosB v tejto oblasti mozgu (B) expozícia lieku (n = 24 / skupina). C, akumulácia ΔFosB, meraná imunocytochemicky, po chronickej expozícii kokaínu nie je ovplyvnená špecifickým vyradením SRF zo strany NAc. D, E Lokálna delécia SRF z NAc tiež nemala žiadny vplyv na lokomotorickú aktivitu po injekcii soľného roztoku (d 5) na lokomotorickú aktivitu a senzibilizáciu vyvolanú kokaínom (n = 1 / skupina) (d 8-1; D) alebo na kokaínom upravené miesto preferencie (n = 7 / skupina, E). Zobrazené údaje sú vyjadrené ako priemer ± SEM (reprezentované ako chybové pruhy).

V nadväznosti na toto prekvapivé zistenie sme skúmali, či selektívne vyradenie SRF z NAc mení behaviorálne reakcie na kokaín. V súlade s nedostatočnou reguláciou indukcie ΔFosB kokaínom zo strany SRF nemalo vylučovanie SRF špecifické pre NAc žiadny vplyv na pohybovú aktivitu indukovanú akútnym kokaínom alebo lokomotorickú senzibilizáciu po opakovaných expozíciách kokaínu (liečba × časová interakcia, F (4,80) = 0.3; p> 0.05) (obr. 4D). Rovnako NAc-špecifické vyradenie SRF nemalo žiadny vplyv na preferenciu kokaínom podmieneného miesta (t (14) = 0.1; p> 0.05) (obr. 4E), čo poskytuje nepriame meradlo odmeny za kokaín.

Diskusia

Táto štúdia identifikovala SRF ako nového sprostredkovateľa protizápalového faktora AFFosB v NAc po chronickom spoločenskom porážkovom strese a zapája SRF do vývoja depresívneho a úzkostného správania. Poskytujeme priamy dôkaz, že chronický spoločenský porážkový stres znižuje hladiny SRF v NAc vnímavých, ale nie odolných zvierat a že toto zníženie regulácie bráni indukcii ΔFosB v tejto oblasti mozgu, čo sme ukázali, že je nevyhnutné na účinné zvládnutie chronického stresu, tj. odolnosť (Vialou et al., 2010). Podobná redukcia expresie SRF bola zistená v NAc u depresívnych ľudí, kde sa tiež znížila expresia mFNA a proteínov DFosB, Naproti tomu hladiny ΔFosB neboli redukované v NAc vnímavých myší napriek zníženej regulácii SRF, čo ovplyvňuje ďalšie neznáme transkripčné mechanizmy pri riadení expresie ΔFosB. Príčinná úloha SRF pri sprostredkovaní indukcie ΔFosB v NAc po chronickom strese bola stanovená použitím indukovanej genetickej delécie SRF z tejto oblasti mozgu. Behaviorálna analýza myší s týmto nac-špecifickým SRF knock-out ďalej znamená, že SRF hrajú kľúčovú úlohu vo vývoji tak základného, ​​ako aj stresom indukovaného depresívneho a úzkostného správania. Pri nápadnom kontraste nemá delécia SRF žiadny vplyv na indukciu ΔFosB v reakcii na chronické podávanie kokaínu alebo na správanie kokaínu. Tieto zistenia podporujú novú špecifickú úlohu pre SRF pri regulácii indukcie ΔFosB a reakcií správania na odlišné environmentálne perturbácie.

SRF-sprostredkovaná transkripcia predtým preukázala, že reaguje na synaptickú aktivitu, zväčša vyvolanú zvýšeným prítokom vápnika, ako aj zvýšenou neurotrofickou aktivitou, najmä v prípade neurotrofného faktora odvodeného z mozgu (BDNF) (Bading et al., 1993; Xia a kol., 1996, Johnson a kol., 1997, Chang et al., 2004, Kalita a kol., 2006, Knöll a Nordheim, 2009). To vyvoláva zaujímavú otázku, prečo je SRF v chronickej spoločenskej porážkovej strese znížená v NAc citlivých, ale nie odolných myší. Táto diferenciálna regulácia pravdepodobne nie je sprostredkovaná signalizáciou dopamínu alebo BDNF, pretože vnímavé myši vykazujú zvýšenú hladinu BDNF proteínu a zvýšenú BDNF signalizáciu v NAc, ako aj zvýšené vypálenie ventrálnych tegmentových oblastí (VTA) dopamínových neurónov, ktoré inervujú NAc, odolné zvieratá vykazujú normálne úrovne signalizácie BDNF a rýchlosti spúšťania VTA (Krishnan a kol., 2007). Alternatívnou možnosťou je, že expresia SRF je potlačená v NAc ako odpoveď na zmenenú glutamatergickú inerváciu tejto oblasti mozgu, ktorú sme ukázali diferenciálne regulovanú v citlivých a pružných myšiach (Vialou et al., 2010). Ďalšia práca je potrebná na priame štúdium tohto a ďalších možných mechanizmov.

Nedávne štúdie s použitím metód širokého genómu a ďalších metód naznačujú, že cieľové gény SRN v neurónoch sú bezprostredné skoré gény (Philippar et al., 5, Ramanan a spol., 10, Etkin et al., 2004, Knöll a kol. Nordheim, 2005). To je v súlade s našimi údajmi, ktoré preukázali kritickú úlohu SRF pri indukcii ΔFosB, skrátenom produkte génu bezprostredne skorého fosfínu, chronickým stresom. Zaujímavé je, že mnohé cieľové gény SRF identifikované v týchto rôznych štúdiách tiež predstavujú známe ciele ΔFosB v NAc (Kumar a kol., 2006, Renthal a kol., 2009, 2005, Maze a kol., 2008). Medzi týmito bežne regulovanými génmi sú niektoré, o ktorých je známe, že regulujú neuronový cytoskeleton (napríklad Cdk2009, Arc a Actb). Toto je zase v súlade so správami, že SRF ovplyvňuje dynamiku aktinov a motilitu neurónov v niekoľkých typoch neurónových buniek (Alberti et al., 2010, Ramanan a kol., 5, Knöll a kol., 2005) ovplyvňujú rast dendritického chrbtice neurónov NAc (Maze a kol., 2005). Takéto spoločné funkčné koncové body môžu odrážať zosúladené účinky SRF v kombinácii s indukciou ΔFosB pôsobením na rad bežných cieľových génov na ovplyvnenie morfológie neurónov a nakoniec komplexného správania.

Ukázalo sa tiež, že SRF hrá kritické úlohy pri regulácii synaptickej plasticity a génovej expresie a správania závislej od neuronálnej aktivity. Napríklad strata SRF-dependentnej indukcie okamžitých skorých génov v reakcii buď na dobrovoľné skúmanie nového prostredia alebo neurónovej aktivácie pomocou elektrokonvulzívnych záchvatov bola spojená so zhoršenou dlhodobou synaptickou potentiáciou v hipokampe mutantov Srf (Ramanan et al. , 2005, Etkin a kol., 2006). Okrem toho bolo preukázané, že deplécia SRF v hipokampe spôsobuje nedostatky v dlhodobej synaptickej depresii, okamžitá včasná expresia génu indukovaná novým kontextom a zhoršená habituácia pri skúmaní nového prostredia (Etkin et al., 2006). Tieto údaje potvrdzujú význam SRF v schopnosti zvieraťa primerane sa prispôsobiť poruchám prostredia, ako v uvedenom prípade učenia sa návyku v novom prostredí, alebo v prípade prispôsobenia sa negatívnym stresovým stimulom, aby sa zabránilo vyhláseniu stresu -indukované deficity správania, ako v našej súčasnej štúdii. Takže pozorujeme, že zvieratá vykazujúce deficity v expresii SRF, buď v reakcii na stres sociálnej porážky u vnímavých jedincov, alebo priamym odbúravaním SRF, vykazujú zvýšené depresívne a úzkostné správanie. Vzhľadom na to, že ľudia v depresii majú tiež zníženú hladinu SRF v NAc, je možné, že SRF hrá zásadnú úlohu v regulácii schopnosti jednotlivca pozitívne sa prispôsobiť negatívnym environmentálnym stimulom, čiastočne reguláciou expresie ΔFosB v NAc.

RÔZNE MECHANIZMY: ODOLNOSŤ VS STRES ODOLNOSŤ

Prekvapujúcim zistením tejto štúdie je, že hoci SRF je potrebná na akumuláciu ΔFosB v NAc ako odpoveď na chronický stres, nie je potrebná indukcia ΔFosB v rámci rovnakej oblasti mozgu v reakcii na chronický kokaín. Podobne SRF nie je potrebná pre normálne behaviorálne reakcie na liek. Tieto údaje ukazujú, že napriek skutočnosti, že ΔFosB je indukovaný v NAc ako odpoveď na mnohé typy stimulov (Nestler a kol., 1999, Nestler, 2008), sa zdá, že existujú odlišné molekulárne cesty vedúce k indukcii ΔFosB. Jedným z možných vysvetlení týchto zistení sú čiastočne odlišné typy buniek, ktoré vykazujú akumuláciu ΔFosB v reakcii na stres versus kokaín. Chronické napätie indukuje ΔFosB približne rovnako v rámci dvoch hlavných subpopulácií NAc stredných spinových neurónov, ktoré exprimujú prevažne D1 verzus D2 dopamínové receptory, zatiaľ čo chronický kokaín indukuje ΔFosB prevažne v neurónoch D1 + (Kelz et al., 1999, Perrotti a kol., 2004) , Je teda možné, že cesty závislé od SRF môžu byť dôležité pre indukciu ΔFosB v neurónoch D2 +, To by však nevysvetľovalo úplnú stratu indukcie ΔFosB u knock-out myší SRF po chronickom strese, pretože indukcia sa vyskytuje v oboch neuronových subtypoch. Alternatívnym vysvetlením je, že chronický stres a chronický kokaín zasahujú do odlišných intracelulárnych signalizačných kaskád na základe ich odlišných spôsobov pôsobenia na neuróny NAc s chronickým stresom, ktorý možno pracuje prostredníctvom zmeneného glutamatergického prenosu, ako už bolo uvedené, a chronického kokaínu pracujúceho predovšetkým prostredníctvom D1 (Nestler, 2008). Ešte ďalšou možnosťou je, že indukcia DFosB chronickým stresom oproti chronickému kokaínu závisí od odlišných transkripčných mechanizmov, ktoré sú diferenčne riadené odlišnými neurónovými vstupmi, ktoré inervujú NAc z rôznych glutamatergických oblastí projekcie, napríklad z niekoľkých oblastí prefrontálnej kôry, hipokampu a amygdaly. Na preskúmanie týchto a alternatívnych možností je potrebná veľa ďalšej práce.

Naše zistenia spoločne identifikujú nový transkripčný mechanizmus, prostredníctvom ktorého sa indukuje pôsobenie ΔFosB v NAc na sprostredkovanie proresienciálnych odpovedí na stresové podnety. Táto štúdia tiež poskytuje dôležitý nový pohľad na úlohu SRF na úrovni NAc pri regulácii depresívnych a úzkostných správaní. Získanie lepšieho pochopenia transkripčnej úlohy SRF pri regulácii tohto správania pomôže pri identifikácii nových génových cieľov zapojených do odolnosti voči stresovým poruchám a môže uľahčiť budúci vývoj účinnejších antidepresívnych terapií.

Táto práca bola podporená grantmi od Národného inštitútu duševného zdravia a Národného ústavu pre zneužívanie drog a výskumnou alianciou s AstraZeneca. Ďakujeme Davidovi D. Gintymu za poskytnutie služby Srffl / flmice.

Korešpondencia by sa mala adresovať Ericovi Nestlerovi, oddelenie pre neurovědy Fishbergu, lekárskej škole Mount Sinai, jednému Gustavemu L. Levymu, boxu 1065, New York, NY 10029-6574. [chránené e-mailom]

Copyright © 2010 autori 0270-6474 / 10 / 3014585-08 $ 15.00 / 0

Referencie

1. ↵

1. Alberti S,

2. Krause SM,

3. Kretz O,

4. Philippar U,

5. Lemberger T,

6. Casanova E,

7. Wiebel FF,

8. Schwarz H,

9. Frotscher M,

10. Schütz G,

11. Nordheim A

(2005) Migrácia neurónov v migračnom toku myšieho rastra vyžaduje faktor sérovej odpovede. Proc Natl Acad Sci USA 102: 6148-6153.

Abstrakt / ZADARMO plný text

2. ↵

1. Bading H,

2. Ginty DD,

3. Greenberg ME

(1993) Regulácia expresie génov v hipokampálnych neurónoch pomocou rôznych signálnych ciest vápnika. Veda 260: 181-186.

Abstrakt / ZADARMO plný text

3. ↵

1. Berton O,

2. McClung CA,

3. Dileone RJ,

4. Krishnan V,

5. Renthal W,

6. Russo SJ,

7. Graham D,

8. Tsankova NM,

9. Bolanos CA,

10. Rios M,

11. Monteggia LM,

12. Vlastné DW,

13. Nestler EJ

(2006b) Základná úloha BDNF v mezolimbickej dopamínovej dráhe v spoločenskom porážkovom strese. Veda 311: 864-868.

Abstrakt / ZADARMO plný text

4. ↵

1. Berton O,

2. Covington HE 3rd.,

3. Ebner K,

4. Tsankova NM,

5. Carle TL,

6. Ulery P,

7. Bhonsle A,

8. Barrot M,

9. Krishnan V,

10. Singewald GM,

11. Singewald N,

12. Birnbaum S,

13. Neve RL,

14. Nestler EJ

(2007) Indukcia ΔFosB v periaqueduktálnej šedej stresom podporuje aktívne odpovede na zvládnutie. Neurón 55: 289-300.

CrossRefMedline

5. ↵

1. Chang SH,

2. Poser S,

3. Xia Z

(2004) Nová úloha faktora sérovej odpovede pri prežívaní neurónov. J Neurosci 24: 2277-2285.

Abstrakt / ZADARMO plný text

6. ↵

1. Etkin A,

2. Alarcón JM,

3. Weisberg SP,

4. Touzani K,

5. Huang YY,

6. Nordheim A,

7. Kandel ER

(2006) Úloha vo vzdelávaní pre SRF: vymazanie v prednom mozgu dospelého narúša LTD a vznik okamžitej pamäti nového kontextu. Neurón 50: 127-143.

CrossRefMedline

7. ↵

1. Heinze HJ,

2. Heldmann M,

3. Voges J,

4. Hinrichs H,

5. Marco-Pallares J,

6. Hopf JM,

7. Müller UJ,

8. Galazky I,

9. Sturm V,

10. Bogerts B,

11. Münte TF

(2009) Pôsobenie proti stimulačnej motivácii pri ťažkej závislosti od alkoholu pomocou hlbokej mozgovej stimulácie nucleus accumbens: klinické a základné vedecké aspekty. Predná Hum Neurosci 3: 22.

Medline

8. ↵

1. Johnson CM,

2. Hill CS,

3. Chawla S,

4. Treisman R,

5. Znak H

(1997) Vápnik kontroluje génovú expresiu prostredníctvom troch odlišných ciest, ktoré môžu fungovať nezávisle od signalizačnej kaskády aktivovaných proteínkinázami Ras / mitogénu (ERK). J Neurosci 17: 6189-6202.

Abstrakt / ZADARMO plný text

9. ↵

1. Kalita K,

2. Kharebava G,

3. Zheng JJ,

4. Hetman M

(2006) Úloha megakaryoblastickej akútnej leukémie-1 pri stimulácii transkripcie riadenej sérovou odozvou na BDNF alebo zvýšenej synaptickej aktivite závislého od ERK1 / 2. J Neurosci 26: 10020-10032.

Abstrakt / ZADARMO plný text

10. ↵

1. Kelz MB,

2. Chen J,

3. Carlezon WA Jr.,

4. Whisler K,

5. Gilden L,

6. Beckmann AM,

7. Steffen C,

8. Zhang YJ,

9. Marotti L,

10. Vlastné DW,

11. Tkatch T,

12. Baranauskas G,

13. Surmeier DJ,

14. Neve RL,

15. Duman RS,

16. Picciotto MR,

17. Nestler EJ

(1999) Expresia transkripčného faktora ΔFosB v mozgu riadi citlivosť na kokaín. Príroda 401: 272-276.

CrossRefMedline

11. ↵

1. Knöll B,

2. Nordheim A

(2009) Funkčná všestrannosť transkripčných faktorov v nervovom systéme: paradigma SRF. Trendy Neurosci 32: 432-442.

CrossRefMedline

12. ↵

1. Knöll B,

2. Kretz O,

3. Fiedler C,

4. Alberti S,

5. Schütz G,

6. Frotscher M,

7. Nordheim A

(2006) Faktor sérovej odozvy riadi zostavu neuronálnych obvodov v hipokampe. Nat Neurosci 9: 195-204.

CrossRefMedline

13. ↵

1. Krishnan V,

2. Han MH,

3. Graham DL,

4. Berton O,

5. Renthal W,

6. Russo SJ,

7. Laplant Q,

8. Graham A,

9. Lutter M,

10. Lagace DC,

11. Ghose S,

12. Reister R,

13. Tannous P,

14. Zelená TA,

15. Neve RL,

16. Chakravarty S,

17. Kumar A,

18. Eisch AJ,

19. Vlastné DW,

20. Lee FS,

21. et al.

(2007) Molekulárne adaptácie, ktoré sú základom náchylnosti a odolnosti voči sociálnej porážke v regiónoch odmeňovania mozgu. Bunka 131: 391-404.

CrossRefMedline

14. ↵

1. Kuhn J,

2. Bauer R,

3. Pohl S,

4. Lenartz D,

5. Huff W,

6. Kim EH,

7. Klosterkoetter J,

8. Sturm V

(2009) Pozorovania o odvykaní od fajčenia po hlbokej mozgovej stimulácii nucleus accumbens. Eur Addict Res 15: 196-201.

CrossRefMedline

15. ↵

1. Kumar A,

2. Choi KH,

3. Renthal W,

4. Tsankova NM,

5. Theobald DE,

6. Truong HT,

7. Russo SJ,

8. Laplant Q,

9. Sasaki TS,

10. Whistler KN,

11. Neve RL,

12. Vlastné DW,

13. Nestler EJ

(2005) Chromatínová remodelácia je kľúčovým mechanizmom, ktorý je základom plasticity indukovanej kokaínom v striate. Neurón 48: 303-314.

CrossRefMedline

16. ↵

1. Bludisko I,

2. Covington HE 3rd.,

3. Dietz DM,

4. LaPlant Q,

5. Renthal W,

6. Russo SJ,

7. Mechanic M,

8. Mouzon E,

9. Neve RL,

10. Haggarty SJ,

11. Ren Y,

12. Sampath SC,

13. Hurd YL,

14. Greengard P,

15. Tarakhovsky A,

16. Schaefer A,

17. Nestler EJ

(2010) Základná úloha histónmetyltransferázy G9a v kokaínom indukovanej plasticite. Veda 327: 213-216.

Abstrakt / ZADARMO plný text

17. ↵

1. McClung CA,

2. Ulery PG,

3. Perrotti LI,

4. Zachariou V,

5. Berton O,

6. Nestler EJ

(2004) DeltaFosB: molekulárny prepínač pre dlhodobú adaptáciu v mozgu. Brain Res Mole Brain Res 132: 146-154.

Medline

18. ↵

1. Nestler EJ

(2008) Transkripčné mechanizmy závislosti: úloha deltaFosB. Philos Trans R Soc Londo B Biol Sci 363: 3245-3255.

Abstrakt / ZADARMO plný text

19. ↵

1. Nestler EJ,

2. Carlezon WA Jr.

(2006) Mesolimbický okruh odmeňovania dopamínu v depresii. Biologická psychiatria 59: 1151-1159.

CrossRefMedline

20. ↵

1. Nestler EJ,

2. Kelz MB,

3. Chen J

(1999) ΔFosB: molekulárny mediátor dlhodobej nervovej a behaviorálnej plasticity. Brain Res 835: 10-17.

CrossRefMedline

21. ↵

1. Newton SS,

2. Thome J,

3. Wallace TL,

4. Shirayama Y,

5. Schlesinger L,

6. Sakai N,

7. Chen J,

8. Neve R,

9. Nestler EJ,

10. Duman RS

(2002) Inhibícia proteínu viažuceho element cAMP alebo dynorfínu v nucleus accumbens vyvoláva antidepresívny účinok. J Neurosci 22: 10883-10890.

Abstrakt / ZADARMO plný text

22. ↵

1. Nikulina EM,

2. Arrillaga-Rómovia I,

3. Miczek KA,

4. Hammer RP Jr.

(2008) Dlhodobá zmena v mezokorticolimbických štruktúrach po opakovanom spoločenskom porážkovom strese u potkanov: časový priebeh mRNA mu-opioidného receptora a imunoreaktivita FosB / DeltaFosB. Eur J Neurosci 27: 2272-2284.

CrossRefMedline

23. ↵

1. Perrotti LI,

2. Hadeishi Y,

3. Ulery PG,

4. Barrot M,

5. Monteggia L,

6. Duman RS,

7. Nestler EJ

(2004) Indukcia ΔFosB v mozgových štruktúrach súvisiacich s odmenou po chronickom strese. J Neurosci 24: 10594-10602.

Abstrakt / ZADARMO plný text

24. ↵

1. Perrotti LI,

2. Weaver RR,

3. Robison B,

4. Renthal W,

5. Bludisko I,

6. Yazdani S,

7. Elmore RG,

8. Knapp DJ,

9. Selley DE,

10. Martin BR,

11. Sim-Selley L,

12. Bachtell RK,

13. Vlastné DW,

14. Nestler EJ

(2008) Rozlišujúce vzory indukcie DeltaFosB v mozgu spôsobené užívaním drog. Synapse 62: 358-369.

CrossRefMedline

25. ↵

1. Philippar U,

2. Schratt G,

3. Dieterich C,

4. Müller JM,

5. Galgóczy P,

6. Engel FB,

7. Keating MT,

8. Gertler F,

9. Schüle R,

10. Vingron M,

11. Nordheim A

(2004) Cieľový gén SRF Fhl2 antagonizuje aktiváciu SRF závislej od RhoA / MAL. Molová bunka 16: 867-880.

CrossRefMedline

26. ↵

1. Ramanan N,

2. Shen Y,

3. Sarsfield S,

4. Lemberger T,

5. Schütz G,

6. Linden DJ,

7. Ginty DD

(2005) SRF sprostredkováva expresiu génu indukovanú aktivitou a synaptickú plasticitu, ale nie neuronálnu životaschopnosť. Nat Neurosci 8: 759-767.

CrossRefMedline

27. ↵

1. Renthal W,

2. Carle TL,

3. Bludisko I,

4. Covington HE 3rd.,

5. Truong HT,

6. Alibhai I,

7. Kumar A,

8. Montgomery RL,

9. Olson EN,

10. Nestler EJ

(2008) Delta FosB sprostredkováva epigenetickú desenzibilizáciu génu c-fos po chronickej expozícii amfetamínu. J Neurosci 28: 7344-7349.

Abstrakt / ZADARMO plný text

28. ↵

1. Renthal W,

2. Kumar A,

3. Xiao G,

4. Wilkinson M,

5. Covington HE 3rd.,

6. Bludisko I,

7. Sikder D,

8. Robison AJ,

9. LaPlant Q,

10. Dietz DM,

11. Russo SJ,

12. Vialou V,

13. Chakravarty S,

14. Kodadek TJ,

15. Stack A,

16. Kabbaj M,

17. Nestler EJ

(2009) Genómová analýza regulácie chromatínu pomocou kokaínu ukazuje úlohu sirtuínov. Neurón 62: 335-348.

CrossRefMedline

29. ↵

1. Schlaepfer TE,

2. Cohen MX,

3. Frick C,

4. Kosel M,

5. Brodesser D,

6. Axmacher N,

7. Joe AY,

8. Kreft M,

9. Lenartz D,

10. Sturm V

(2008) Hlboká mozgová stimulácia na odmeňovanie obvodov zmierňuje anhedóniu pri refraktérnej depresii. Neuropsychofarmakológia 33: 368 – 377.

CrossRefMedline

30. ↵

1. Sesack SR,

2. Grace AA

(2010) Kortiko-bazálna ganglia sieť odmien: microcircuitry. Neuropsychofarmakológia 35: 27 – 47.

CrossRefMedline

31. ↵

1. Tomita H,

2. Vawter MP,

3. Walsh DM,

4. Evans SJ,

5. Choudary PV,

6. Li J,

7. Overman KM,

8. Atz ME,

9. Myers RM,

10. Jones EG,

11. Watson SJ,

12. Akil H,

13. Bunney WE Jr.

(2004) Vplyv agonistických a postmortemálnych faktorov na profil génovej expresie: kontrola kvality v microarray analýzach alebo postmortem ľudského mozgu. Biol Psychiatria 55: 346 – 352.

CrossRefMedline

32. ↵

1. Tsankova NM,

2. Berton O,

3. Renthal W,

4. Kumar A,

5. Neve RL,

6. Nestler EJ

(2006) Trvalá regulácia hipokampálneho chromatínu v myšom modeli depresie a antidepresívneho účinku. Nat Neurosci 9: 519 – 525.

CrossRefMedline

33. ↵

1. Vassoler FM,

2. Schmidt HD,

3. Gerard ME,

4. Slávny KR,

5. Ciraulo DA,

6. Kornetsky C,

7. Knapp CM,

8. Pierce RC

(2008) Hlboká mozgová stimulácia jadra nucleus accumbens zmierňuje opätovné navodenie navodenia liečiva u potkanov vyvolané kokaínom. J Neurosci 28: 8735 – 8739.

Abstrakt / ZADARMO plný text

34. ↵

1. Vialou V,

2. Robison AJ,

3. Laplant QC,

4. Covington HE 3rd.,

5. Dietz DM,

6. Ohnishi YN,

7. Mouzon E,

8. Rush AJ 3rd.,

9. Watts EL,

10. Wallace DL,

11. Iñiguez SD,

12. Ohnishi YH,

13. Steiner MA,

14. Warren BL,

15. Krishnan V,

16. Bolaños CA,

17. Neve RL,

18. Ghose S,

19. Berton O,

20. Tamminga CA,

21. Nestler EJ

(2010) AFosB v okruhoch odmeňovania mozgu sprostredkováva odolnosť voči stresu a antidepresívnym reakciám. Nat Neurosci 13: 745 – 752.

CrossRefMedline

35. ↵

1. Wilkinson MB,

2. Xiao G,

3. Kumar A,

4. LaPlant Q,

5. Renthal W,

6. Sikder D,

7. Kodadek TJ,

8. Nestler EJ

(2009) Liečba a odolnosť voči imámamínu vykazujú podobnú reguláciu chromatínu v kľúčovom regióne odmeňovania mozgov. J Neurosci 29: 7820 – 7832.

Abstrakt / ZADARMO plný text

36. ↵

1. Xia Z,

2. Dudek H,

3. Miranti CK,

4. Greenberg ME

(1996) Influx vápnika cez receptor NMDA indukuje okamžitú skorú transkripciu génu mechanizmom závislým od MAP kinázy / ERK. J Neurosci 16: 5425 – 5436.

Abstrakt / ZADARMO plný text