Vaʻaia fualaau faʻapitoa i le epigenetically premiums Fansb gene generator i le rat nucleus accumbens (2012)

FAAMATALAGA: Molimau o le deltafosb lafoaʻi mulimuli mai uiga umi pe a uma ona toe malosi mai le tagofia o mea ua fai ma vaisu. Faʻamatalaga faapitoa o mea ua fai ma vaisu e mafua ai ona suia le epigenetic, e mafua ai le televave vaveina o le deltafosb pe a toe faʻafoʻi. O lenei mea e faʻamatalaina ai le toe faʻafoʻiina, e tusa lava pe a mavae tausaga e vave faʻavave atu i se tulaga ua faʻaleagaina.



J Neurosci. Tusitala Tusitala; avanoa i PMC 2013 Ianuari 25.

 

lē faʻatino

ΔFosB, a Fosb gaʻo, o loʻo faʻaaogaina i le nucleus accumbens (NAc) ma le caudate putamen (CPu) e ala i le faʻaalia soo i fualaau faasaina e pei o le cocaine. O lenei faʻaliliuga e saofaga i mamanu faʻamaoni o faʻamatalaga o le gene ma faʻasologa o amio le faʻaalia i le faʻateleina o fualaau faasaina.

O iinei, matou te iloiloina pe o se talafaasolopito mamao o le faʻamaʻiina o fualaau faʻamaʻi i rato e mafai ona suia le faʻamalosia o le Fosb gaʻo e mafua mai ona o le maua mai o cocaine. Matou te faʻaali atu muamua le puleaina muamua o cocaine, sosoo ai ma le faʻateleina o le faʻamaʻiina o le cocaine, faʻateleina le faʻamalosia o le Fosb i le NAc e pei ona molimauina e le sili atu o le induction o le ΔFosB mRNA ma le faʻaopoopoga vave o le ΔFosB protein pe a maeʻa ona toe faʻaleleia le cocaine. Leai se mea muamua Fosb na maitauina i totonu o le CPu, le induction, o le mea moni, na mulimuli mai ai le induction o le ΔFosB mRNA i le CPu.

O nei mea e le masani ai Fosb o faʻamatalaga e fesoʻotaʻi ma suiga o le chromatin i le Fosb gene promoter. O le muamua o le chronic cocaine administration e faʻaosoina ai le maualalo o le RNA polymerase II (Pol II) i le Fosb tagata faʻaola i NAc, na fautua mai o le Pol II "faʻamalo" muamua Fosb mo le faʻaaogaina i lenei itulagi pe a toe faʻaalia i le koko. O le luitau o le cocaine e mafua ai le tatalaina mai o le Pol II mai le faʻalauiloa o le gene, e mafai ai ona sili atu le vave Fosb tusitusiga. O le luitau o le cocaine e faʻaititia ai foi le toe faʻafouina o le tala o le talafaasolopito i le Fosb tagata faʻasalalau i le NAc, ae faʻateleina faailoga faʻaleagaina ma faʻaitiitia ai faailoga faʻagaoioi i CPu.

O nei taunuʻuga e maua ai se malamalamaaga fou i le faʻaogaina o le chromatin i le Fosb tagata faʻalauiloa ma faʻaalia se faiga faʻapitoa mo primed Fosb induction i le NAc i luga o le toe faʻaaogaina o le koko.

faʻatomuaga

O le tagofiaina o fualaau oona o loʻo faʻamatalaina e ala i le faʻamalosia o fualaau faʻatau ma ave e ui lava i aʻafiaga ogaoga (Kalivas et al., 2005; Hyman et al., 2006). O fualaau faasaina ole taimi e mafua ai ona suia suiga i le faʻaalia o le gene i totonu o le striatum (poʻo le nucleus accumbens; NAc) ma le ogatotonu o le tino (po o le caumate CP,) o fausaga faʻavae o loʻo aʻafia ai i fualaau faasaina ma mea ua fai ma vaisu (Freeman et al., 2001; Robinson ma Kolb, 2004; Shaham ma le Faamoemoe, 2005; Maze ma Nestler, 2011). ΔFosB, o se fulafula faʻasolosolo ma le mausali na faʻapipiʻi e le gutu muamua, Fosb, o se faʻailoga taua tele na faʻailoaina i le NAc ma le CPu e ala i le masani ona faʻaalia i le tele o vailaʻau o le faʻaleagaina, lea e faʻatautaia ai tali a amioga i le faʻaaogaina o fualaau faasaina (Nestler, 2008). Ae ui i lea, tusa lava pe masani ona faʻaalia i se fualaau o le faʻaleagaina mulimuli ane mulimuli ane o le faʻaliliuina o le ΔFosB e le o iloa.

Matou te maitauina talu ai nei o le suiga o le chromatin i le tali atu i le masani ona maua i fualaau faasaina e mafai ona suia ai le faatosinaina o ituaiga patino i totonu o le mafaufau i luga ole mafaufau (Robison ma Nestler, 2011). O le faʻateleina o faʻamaoniga ua faʻaalia ai fualaau o le faʻaleagaina pe a maeʻa le pulega masani o le fesuiaiga o le fausaga ma le faʻasalalau o le chromatin e ala i le tele o ituaiga fesuiaiga, e aofia ai le phosphorylation, acetylation, ma le methylation o fausaga histone. O le tele o galuega i totonu o faiga faʻalauiloa agavaʻa ua taulai atu i le faʻafaigaluegaina o le RNA polymerase II (Pol II) i le faʻaulufaleina o genes muamua aʻo lumanaʻi latou faʻamatalaga, faʻatasi ai ma le Pol II o loʻo faʻaauau pea ona faʻatalatalanoa i le atulaulau faʻasalalau vavalalata ma faʻataʻamilo i le faʻasalalauga (TSS ) i totonu o se setete ua "afaina"Core ma Lis, 2008; Nechaev ma Adelman, 2008). Faʻatoagaina mai o le poli Pol II ua manatu o le a nafa ma lona sola ese mai le tagata e faalauiloaina ma le TSS ma lona tusitusiga o nei "genes"Zeitlinger et al., 2007; Saha et al., 2011; Bataille et al., 2012).

O iinei, tatou te faʻaalia ai muamua muamua le masani ona maua i cocaine, sosoo ai ma se taimi faʻateleina o le tuumuli, e suia ai le faʻamalosia o le Fosb gaʻo i le mulimuli atu i le cocaine administration, faʻatasi ai ma le NAc ua amataina mo le faʻamaina ae leai CPu. Ona matou faailoa mai ai lea o ni igoa tuʻufaʻatasia i le Fosb gene promoter i le NAc ma le CPu e fesoʻotaʻi ma le faʻaleagaina o le faʻamalosia o le Fosb gene, e aofia ai le faʻafaigaluegaina o poli Pol II i le Fosb faʻaauau le faʻaauau ile NAc faʻapitoa faʻapea foi suiga i le faʻafouina ole toe faʻaleleia ole talafaasolopito ile itu uma ole mafaufau. O nei taunuʻuga e maua ai se malamalamaga faʻapitoa i le faʻaogaina o le chromatin i le Fosb gene promoter ma faailoa mai mo le taimi muamua se masini e mafua ai le taamilosaga a Pol II Fosb mo le faʻamalosia atili i le NAc pe a toe faʻaalia i le koko.

Mea ma Metotia

manu

O tama Sprague Dawley rats (250-275 g; Charles River Laboratories), na faʻaaogaina i suʻega uma, na faʻatasi-o loʻo nofo i totonu o se potu e pulea le tau i luga o le 12 hr malamalama / pouliuli (moli i le 7 AM) faʻatasi ai ma meaai ma vai ad libitum. O manu uma na faʻaulu faalua i le aso mo aso e sefulu ma cocaine (15 mg / kg, ip) poʻo le saline (ip) io latou fale. O suʻega a manu na faʻatagaina e le Komiti o le tausiga ma le faʻaaogaina o manu (IACUC) i Mauga Sinai.

Fua o le Locomotor

O manu sa masani ona nofo i totonu ole potu ole potu mo le aso muamua mo le 1 Hr, ona siakiina lea mo le gaoioiga a le locomotor pe a uma se tui tui e faaaoga ai le Photobeam Activity System (San Diego Instruments). A maeʻa le 1 Hr masani i totonu o potu o le potu i aso taitasi, o le cocaine (15 mg / kg, ip) sa faia i aso taitasi mo aso 2 ma toe siakiina ai manu mo le faʻagasologa o le solo mo le 1 hr.

Immunohistochemistry

Na faʻamamaina manu i le 24 Hr ina ua uma le faʻamaʻiina o fualaau. ΔFosB / FosB immunoreactivity na iloa e pei ona faamatalaina (Perrotti et al., 2004). O loʻo faʻamaonia le faʻaaogaina o le ΔFOSB / FosB-like immunoreactivity ile 24 hr pe sili atu foi pe a maeʻa ona faʻaalia mai le inumaga o le ΔFosB, ma le FosB e le mafaamatalaina (e le o faʻaalia).

RNA faʻasesega, fesuiaʻi faʻamatalaga, ma le PCR

O paleni faʻavaomalo 12-maʻa o le NAc ma le telefoni faʻavaomalo CPu na mauaina e pei ona faʻamatalaina (Perrotti et al., 2004), mago i luga o le aisa mago ma faʻapipiʻi e tusa ai ma faʻasalalauga lolomiina (Covington et al., 2011). ΔFosB ma le FNB mRNA na fuaina e faʻaaoga ai le PCR (quantitative PCR) faʻatasi ai ma le faʻataʻitaʻi faapitoa o ΔFosB ma FosB primers (Alibhai et al., 2007). ΔFosB ma FosB mRNA maualuga na faʻamautuina i laʻasaga GAPDH mRNA, e leʻi aʻafia i le maua mai o le cocaine (e le o faʻaalia).

Itu i sisifo

Na faaputuputuina punoci NAc ma CPu e pei ona taua i luga ma faagasolo mo le fesuiaiga o le Western as described (Covington et al., 2011), e faʻaaoga ai faʻamaʻi puipuia e faasaga i le ERK44 / 42 [faʻamaonia faʻapipiʻi extracellular regulated kinase-44 / 42] ma phosphoERK44 / 42 (pERK), AKT [viral viral proto-oncogene] ma p-AKT, SRF (serum response factor), and pSRF, CREB [siama tali tali a le CAMP e fusia le protein], ma le pCREB. O le aofaʻi o le porotini na poloka i luga o laina taʻitasi sa masani ona faʻatulagaina i laʻasaga o le gaioiga poo le tubulin, e leʻi afaina i le maua o le cocaine.

Chromatin immunoprecipitation (ChIP)

Na saunia lelei NAc ma CPu punches mo le ChIP e pei ona faamatalaina (Maze et al., 2010). O suʻega taʻitasi na suʻesuʻeina i le tolu piliona mai vaega tutoʻatasi o manu. Mo faʻataʻitaʻiga taʻitasi ChIP, o le NAc ma le CPu na tuʻufaʻatasia mai i le lima rauka (10 punches). O auupega e faʻaaogaina mo le faʻaleleia atili o talafaasolopito o talafaasolopito e tutusa lava ma i latou na lolomiina (Maze et al., 2010); fomaʻi i Pol II i le Ser5 o lona tuatusi o le carboxyl domain term (CTD) faʻafouina (Pol II-pSer5) na maua mai le abcam 5131. E fa seti o mea muamua na faia i le ChIP Fosb (Lazo et al., 1992; Mandelzys et al., 1997): 1F: GTACAGCGGAGGTCTGAAGG, 1R: GAGTGGGATGAGATGCGAGT; 2F: CATCCCACTCGGCCATAG, 2R: CCACCGAAGACAGGTACTGAG; 3F: GCTGCCTTTAGCCAATCAAC, 3R: CCAGGTCCAAAGAAAGTCCTC; 4F: GGGTGTTTGTGTGTGAGTGG, 4R: AGAGGAGGCTGGACAGAACC. Laʻasaga o faʻalelei teuteu o chromatin e faʻatusatusa i latou mo le DNA ulufale e pei ona faʻamatalaina (Maze et al., 2010).

Suʻega faʻamaumauga

O mea taua uma na lipotia e uiga i le ± sem Faʻamaumauga mo locomotor gaioiga ma sela-faitauga na suʻesuʻeina e ala lua-ANOVAs ma togafitiga ma tui o ni mafuaʻaga. qPCR faʻataʻitaʻiga na suʻesuʻeina ile taimi taimi e le tasi ala ANOVAs ma togafitiga o se mea taua. Ina ua maitauina le tele o aʻafiaga taua (p <0.05), sa faia le faʻataʻitaʻiga o le faʻasologa o Bonferroni mo faʻatusatusaga i fualaʻau na togafitia saline-naïve (^ i fuainumera) ma fualaʻau faʻasaina fualaʻau fualaʻau (* i faʻatusa). E le faʻaluaina-siʻusiʻu Tamaiti Aʻoga-suʻega na faʻaaogaina mo Western blotting ma ChIP faʻamaumauga, ma faʻasaʻoga mo tele faʻatusatusaga.

i'uga

Sili Fansb inducibility i le NAc, ae le o le CPu, o laumei cocaine-poto masani

Iloiloina le aafiaga o se muai masani o cocaine, ona sosoo ai lea ma se vaitaimi faaumiumi o le tuumuli ese, i luga o le fausiaina o le Fosb gene i le tali atu i se luitau mulimuli ane o le cocaine, o kio na muai sasaina i le faalua i aso taitasi ma le saline po o le cocaine (15 mg / kg) mo aso 10 na tuʻuina atu i ai fualaau o fualaau faʻasaʻo i le maeʻa o 28 aso o le faʻamavaeina (Fig 1A). Na matou muai iloiloina tali a le locomotor i se tasi vaega o meaola e faʻamaonia ai le faʻailoaina o le faʻalauteleina o le locomotor e ala i le muamua atu i le cocaine, o se faʻamoemoe tumau o le puleaina o fualaau faasaina. O cocaine-faʻapitoa ma -nati na faʻaalia le tutusa o le locomotor activity, faʻatasi ai ma se luʻu kokeni i vailaʻau faʻasaina e faateleina ai lo latou faʻalagolago (Fig 1B. Auala toe fai auala e lua-auala ANOVA, togafitiga: F1,66 = 30.42, p <0.0001; cocaine luʻi: F2,66= 58.39, p <0.0001; togafitiga x cocaine luitau: F2,66= 8.56, p = 0.0005, Bonferroni post-tests ^p <0.001). O lenei luitau cocaine na faʻaosofia ai le sili atu locomotor gaioiga, ie, faʻalauteleina, i cocaine-poto masani isumu (Bonferroni post-tofotofoga * p <0.001).

Ata 1  

Aafiaga o le faʻalauiloaina o cocaine masani i luga o le mafutaga ma le Fosb induction i le NAc ma le CPu i luga o le toe faʻaaogaina o fualaau faasaina

I le iloiloga o aʻafiaga o lenei cocaine-pretreatment e faʻatatau i le ΔFosB expression i le NAc ma le CPu, na matou fuaina le protein ΔFosB ma auala faʻaoga o le immunohisto Chemical 24 hr ina ua uma ona togafitia i le cocaine-naïve ma le cocaine meaola ma le 0, 1, 3, poʻo le 6 daily cocaine challenge injections (15 mg / kg; vaʻai Fig 1A). E pei ona faʻatuina muamua (Gagana et al., 1995), O le 3 cocaine injections na lava lelei e faatosina ai le protein o le ΔFosB i le NAc ma le CPu o vailaʻau faʻasaina ma o lona faʻaleleia na tumau pea lona taua ina ua mavae le 6 aso o iniseti cocaine (Fig 1C. Auala e toe lua auala auala ANOVA, NAc, togafitiga: F1,28= 23.5, p <0.0001; cocaine luʻi: F3,28= 49.16, p <0.0001; togafitiga x cocaine luitau: F3,28= 6.83, p = 0.0014; NAc shell, togafitiga: F1,28= 18.69, p <0.0001; cocaine luʻi: F3,28= 31.52, p <0.0001; togafitiga x cocaine luitau: F3,28= 3.21, p <0.05; CPu, togafitiga: F.1,28= 9.47, p <0.001; cocaine luʻi: F3,28= 19.74, p <0.0001; togafitiga x cocaine luitau: F3,28= 0.94, p> 0.05. I le NAc autu, atigi, ma le CPu, Bonferroni post-tofotofoga ^p <0.05). I meaola o le cocaine, e leai se faʻamaoniga o le faʻaauau pea istFosB faʻasolosolo i le NAc poʻo le CPu ina ua tuanaʻi le 28 aso o le toʻesea, e o gatasi ma lipoti muamua, o le faʻailoga ΔFosB ua faʻamamaina atoa i lenei taimi taimi (Gagana et al., 1995), o le mafuaʻaga na faʻaaoga ai lenei taimi i lenei suʻesuʻega. Ae ui i lea, o le mea e foliga mai ai, o ni kenei na maua i le cocaine na maua 3 poʻo 6 cocaine luitau faʻalavelave na faʻaalia ai le sili atu le amatalia o le ΔFosB protein i le NAc, o se faʻaaliga manino i totonu o le ogatotonu ma atigipusa atigipusa (Fig 1C. Bonferroni post-tofotofoga * p <0.05). I se faʻatusatusaga, e leai se sili atu faʻatosinaina o ΔFosB porotini na matauina i le CPu; nai lo lea, tutusa ΔFosB faʻatonuga na vaʻaia i lenei itulagi ina ua mavae le 3 pe 6 aso o cocaine luʻi tui i cocaine-naïve ma -e masani poto masani (Fig 1C).

Ina ia maua se malamalamaʻaga i suiga o suiga o loʻo tutupu i le NAc ma le CPu i le tali atu i se luitau o le cocaine, na matou suʻesuʻeina le taimi (45, 90, ma le 180 min) o le faʻamalosia o le ΔFosB ma le MRNA FosB na tusi i luga o le cocaine e tasi poʻo le inumaga saline i le cocaine-naiʻese ma-leai ni faʻamanuiaga i le maeʻa o 28 aso o le faʻaliliuina (tagai Fig 1A). E fesootaʻi atu i se luitau o le saline, o le aʻafiaina o le koko e mafua ai le faʻavavevave o le maualuga o le ΔFosB ma le FNB mRNA i tulaga uma e tolu i le NAc ma le CPu o meaʻai cocaine-naïve (Fig 1D. Auala toe faia i se tasi ala ANOVA i taimi uma; Bonferroni post-suʻega ^p <0.05). I le NAc, na maitauina ai le tele atu o le ΔFosB ma le FosB mRNA i totonu o manu e masani ona faʻatatau i le cocaine pe a faʻatusatusa i meaola o le cocaine-naïve ina ua maeʻa le luʻi o le cocaine, o le aafiaga e taua tele i le 90 minute, ae i se faʻatusatusaga, o le le mafai gaioi o le ΔFosB ma le FosB mRNA i le CPu na matua tele lava. faaititia i cocaine-poto masani manu (Fig 1D. Bonferroni post-suʻega %p = 0.08, * p <0.05).

Faʻailogaina o auala faʻataʻitaʻi i luga o le NAc ma le CPu o manunuʻa-faʻavaʻa iloa

Tasi faʻamatalaga talafeagai mo le suiga faʻafefe o le Fosb gaʻo i le NAc ma le CPu i le maeʻa ai o se kosi masani o cocaine, o se talafaasolopito mamao o le faʻalauiloaina o le koko e mafai ona aʻafia ai suiga tumau i ala e iloagofie ai luga ole auala Fosb gaosia o le geniu e pei o le malosi o le cocaine o le a osoosoina ai le gutu i se tikeri o le va. Ina ia suʻesuʻeina lenei manatu, matou te suʻesuʻeina ia faʻailoga e lua, SRF ma le CREB, lea na faʻaalia talu ai nei e manaʻomia mo le faʻaaogaina o le cocaine o le ΔFosB i nei itu o faiʻai (Vialou et al., 2012) faʻatasi ai ma le kinetini protein kinases, ERK ma le AKT, e aʻafia foi i le gaioiga (Valjent et al., 2000; Lu et al., 2006; Boudreau et al., 2009). Ua matou le mafai ona iloa soʻo se suiga i le aofaʻi atoa poʻo le phosphorylated o nei pusa eseese lea e mafai ona faʻamatalaina le faʻafouina o le faʻamalosia o le Fosb matauina, e aofia ai le leai o suiga i le SRF, CREB, poʻo le AKT (Fig 2B, C). Le leai o se suiga i le pSRF ma le pCREB i le NAc i le tali atu i se luitau o le cocaine e ogatusa ma se lipoti talu ai nei, lea na maua uma e le gata i le cocaine masani (Vialou et al., 2012).

Ata 2  

Aafiaga o le faʻalauiloaina o cocaine masani i luga o vaʻalele sikola i luga o le eleele i NAc ma CPu

I le NAc ma le CPu o vailaʻau faʻasaina, 20 min i le maeʻa ai o le faʻamaʻi muamua o fualaau (Fig 2A), o se toʻatasi na luʻuina cocaine na faʻaititia le maualuga o le pERK42 / 44 (Fig 2B, C. Lua faʻataʻitaʻiga Tamaiti Aʻoga suʻega: * p <0.05). E i ai lipoti muamua o le faʻateleina tulaga PERK i nei itulagi ina ua maeʻa faʻamalosia cocaine pulega (Valjent et al., 2000). E faigata tele ona faʻatusatusa i isi pepa o loʻo suʻesuʻeina le ERK phosphorylation i le NAc i le taimi e teʻa ese ai mai le faʻaaogaina o le koko (cocaine injections)Boudreau et al., 2007; Shen et al., 2009), e pei ona faia i la tatou suʻesuʻega pERK ina ua maeʻa le 28 aso o le tosoina ma mulimuli i se cocaine poʻo se faʻafitauli mole. O le vaʻaia i manufeʻai fualaau oona e maua ai le cocaine mo le taimi muamua, toe faʻafeiloaʻi i le cocaine i 'anuʻau o cocaine-faʻapitoa, i le maeʻa o 28 aso o le faʻamutaina, na mafua ai ona maualuga le maualuga o PERK42 / 44 i CPu (Fig 2B, C. Lua suʻega tamaiti aʻoga-suʻega: * p <0.05).

Faʻafanua Chromatin i le Fosb gene promoter i le NAc ma le CPu o kenei-faʻavaʻa iloa

Na matou suʻesuʻeina mulimuli ane pe suia i Fosb gaioiga o le gaʻo e fesoʻotaʻi ma suiga i lona faʻatulagaina o chromatin. O le ChIP na faia i luga o le NAc ma le CPu e faʻaaoga ai auupega e faasaga i le tolu ituaiga o mea faʻalelei o le suiga o le histone: limasela o le Lys4 o le histone H3 (H3K4me3) e fesoʻotaʻi ma le gaioiga o le gene, ma le H3K27me3 ma le H3K9me2 e fesoʻotaʻi ma le gene repression. Na matou suʻesuʻeina ni manoa o le cocaine ma-e leai ni faʻamaonia pe a maeʻa le 28 aso o le toso i tua pe leai foʻi se luʻi i le tuiina o le koko, faatasi ai ma manu na suesueina 1 i le taimi mulimuli ane (Fig 3A). I le NAc, matou te leʻi maua ni suiga taua i le fusia o soʻo se tasi o nei suiga e tolu o talafaasolopito i le Fosb gene promoter i le le i ai o se mea e maua ai le cocaine, e ui lava sa i ai se tulaga mo le faʻaitiitia o maualuga o le H3K9me2 (Fig 3B-D. E lua suʻega T-tamaititi T-test. #p = 0.2 pe a faatusatusa i le pulea o fualaau oona. O lenei aafiaga na taua tele ina ua maeʻa le luitau o le cocaine ma sa patino mo le vaega faalauiloa faalauaitele o le gene (Fig 3C. * p <0.05). E ui ina maualalo le maualuga ole H3K9me2 i nisi genes, ole Fosb gene promoter o loʻo faʻaalia le maualuga o le talisapaia o lenei faailoga i le NAc i lalo o le puleaina o tulaga (Maze et al., 2010, faʻamatalaga e leʻi faʻaalia). I le eseesega, i le CPu, na matou maua se faʻaitiitiga itiiti ae taua i H3K4me3, ma faʻateleina le H3K27me3 binding, i le Fosb tagata faʻasalalau i le leai o se pene cocaine, aʻafiaga ua leiloloa pe a uma le luʻitau (Fig 3D. * p <0.05).

Ata 3  

Aafiaga o le muaʻi faʻalaʻauina o le koko i luga o le epigenetic priming o le Fosb gene i NAc ma CPu

Na matou toe suʻesuʻeina le Pol II i le Fosb gaʻo, e faavae i luga o suʻesuʻega lata mai i le aganuʻu i totonu o le cell lea na tuʻu ai Pol II i le TSSs, lea e faʻaalia i lona faʻamalosia i le Ser 5 i lona CTD, e fesoʻotaʻi ma le amataga o kene (tagai i le Folasaga). O lea na matou iloiloina ai Pol II-pSer5 i le Fosb i totonu o vaega e fa o le gutu (Fig 3B). O lenei suʻesuʻega na faʻaalia ai se faʻaolaina tele o Pol II-pSer5 i le Fosb gaʻo i lona itu lata ane o le aufaʻasalalauga ma faʻataʻatia lona TSS i le NAC o manuʻa-faʻapitoa i meaola, pe a maeʻa le tolopoina o taimi, i le leai o se pene cocaine pe a faatusatusa i le pulea (Fig 3E. * p <0.05). O lenei faʻatamaoaigaina e leʻi manino mai i itutino e lua tino itulagi o Fosb, faʻatasi ma le Pol II i le faʻataʻitaʻiga o loʻo faʻamatalaina i faiga faʻapitoa faʻataʻitaʻiga. O le mea e maofa ai, a maeʻa le luʻi o le cocaine, o le Pol II-pSer5 o loʻo fusifusia pea faailoga o le faʻatamaoaigaina, e ui e le o se mea sili, i le Fosb tuaoi faʻapitonuʻu faʻalapotopotoga (Fig 3E. %p = 0.1), ae na toe foi mai e pulea tulaga i le TSS. O faʻamatalaga i le CPu na sili atu ona fesuisuiai, ma e leai se mamanu manino o le Pol II-pSer5 ua faamauina.

Talanoaga

O le suʻesuʻega o loʻo i ai nei e maua ai se faʻamatalaga fou i tulafono faatonutonu ua puipuia Fosb vaiaso pe a maeʻa le faʻaauau ona faʻaalia i le cocaine. Matou te faʻaali atu o le muaʻi faʻamaualuga o le cocaine administration e tuʻuina atu Fosb gaʻo sili atu ona faʻaauau i le NAc, ma mafua ai le faʻaopoopoga vave o le Ava Ava i luga o le toe faʻaaogaina o fualaau faasaina. Talu ai le faʻatuatuaina o faʻamaoniga o le induction o le ΔFosB i le NAc e faʻapipiʻiina ai tali i amioga i le koko (Nestler, 2008), o a matou sailiga e faʻaalia ai se faiga faʻavae mo le vave faʻafouina o na tali taua pe a maeʻa le faaumiumi.

Matou te faʻaalia o le faʻaleleia atili o le ΔFosB i le NAc e fesoʻotaʻi ma suiga i le chromatin i le Fosb gaʻo lea o le a faʻamoemoeina mo le sili atu o le faʻatagaina. O le mea lea, matou te faʻaalia le faʻateleina o le Pol II i le tagata vaʻavaʻalata lata ane ma le TSS o loʻo i ai ina ua maeʻa le 4 vaiaso o le tosoina mai le pulega muamua o cocaine muamua. O le faʻamalosia o Pol II i le TSS ua vave ona leiloa i le tau o le koko Fosb faʻatasi, faʻatasi ma se faʻataʻitaʻiga i le aganuʻu faʻalauiloa lea na faʻasaʻoloto ai le Pol II mai le TSSs i luga o le gaioiga o le fatu (silasila i le Folasaga). O le luitau o le cocaine e mafua ai foi le faaitiitia vave o le fusifusia o H3K9me2-o se faailoga o le tui o le gene-i le Fosb tagata faʻaola. I le eseesega, matou te iloa e leai se faʻamalosia tumau o le tele o faʻamatalaga tusitusia, poʻo o latou tuuga i luga, lea e lauiloa e vavalalata Fosb atinaʻe e le cocaine. O nei taunuuga e lagolagoina ai lo tatou talitonuga o le faʻaleleia atili o le faʻaaogaina o le ΔFosB i le NAc e faʻatalanoaina e ala i le epigenetic priming o le Fosb gene ae le o le toe faatonutonuina o mea i luga.

E tele naua taunuʻuga na maua mo CPu. E leai se faʻamaoniga mo Pol II o loʻo tu i le Fosb i laʻau o le cocaine-e masani ona i ai muamua aʻo leʻi oʻo ile luca, e ui lava e iai ni suiga faʻale-aganuʻu ma taua tele e tusa ai ma le faʻaosoosoga o le gene: faʻateleina le H3K27me3 ma faʻaititia H3K4me3. E leʻi i ai foi se suiga i luga o mea e fesoʻotaʻi ai faʻamaumauga poʻo le kinases e tutusa ma le faʻaititia Fosb induction. O nei suʻesuʻega e taʻu mai ai, pe a maeʻa le puleaina o cocaine, o le a faʻaitiitia le faʻaleleia o epigenetic Fosb eletise i le CPu, e ese mai i le amataga vaaia i le NAc. Ae ui i lea, e ui o nei aʻafiaga e paʻu ai le ΔFosB mRNA i le toe faʻafeiloaʻi i le koko, e leai se gau i le faaputuputu o le protein ΔFosB. O le faiga o loʻo faʻavaeina ai lenei faʻafitauli e manaʻomia ai se suʻesuʻega atili.

I le tele o tulaga, oa tatou taunuuga e lagolagoina ai se faʻataʻitaʻiga pe a fai o suiga i le chromatin i totonu o genes patino e tali atu i le puleaina o cocaine masani e faʻapitoa pe faʻafanoina na ituaiga o gaʻo mulimuli ane i le toe faʻaaogaina o fualaau faasaina. O suiga faapena o le chromatin, lea e mafai ona vaʻaia o le "epigenetic scars," o le a misia i auiliiliga o laʻasaga o le mRNA o le tino. I lenei auala, o le faʻamatalaina o le epigenome o le tagofia o mea ua fai ma vaisu o loʻo folafola mai e faʻaalia ai faʻamatalaga fou e uiga i le pathogenesis molécula o le maʻi, lea e mafai ona faʻatauina mo le atinaʻeina o togafitiga fou.

Faʻafetai

O lenei galuega na lagolagoina e fesoasoani mai le National Institute on Drug Abuse.

mau faasino

  • Alibhai IN, Green TA, Potashkin JA, Nestler EJ. Faatonutonuina o le fosB ma le deltafosB mRNA: i vitio ma in vitro suesuega. Brain Res. 2007;1143: 22-33. [PMC free article] [PubMed]
  • O le Faʻataʻitaʻiga o le RNA Polymerase II Taamilosaga CTD Ua Faʻatoʻaina e le Faʻatagata Faʻamatalaina i le va o le Kinase, Phosphatase, ma le Aseraserase Enzymes i le va o Genes. Mol Cell. 2012;45: 158-170. [PubMed]
  • Boudreau AC, Reimers JM, Milovanovic M, Wolf ME. O loʻo maua i totonu o le kulupu o loʻo maua ai le AMPA i le rat rat accumbens i le taimi o le faʻamaʻiina o cocaine ae faʻatautaia pe a uma le faʻaaogaina o le kokeni e fesoʻotai ma le faʻagasologa o le faʻaaogaina o kinitetini mitogen-activated kinases. J Neurosci. 2007;27: 10621-10635. [PMC free article] [PubMed]
  • Boudreau AC, Ferrario CR, Glucksman MJ, Wolf ME. Faʻailogaina o auala faʻalelei ma palatini protein kinase O mea e fesoʻotaʻi ma le faʻaleleia o amioga i le koko. J Neurochem. 2009;110: 363-377. [PMC free article] [PubMed]
  • Core LJ, Lis JT. Faʻasalalauga faʻasalalauga e ala i le faʻasalalauga faʻalavelave-latalata ile RNA polymerase II. Saienisi. 2008;319: 1791-1792. [PMC free article] [PubMed]
  • Covington HE, 3rd, Maze I, Sun H, Bomze HM, DeMaio KD, Wu EY, Dietz DM, Lobo MK, Ghose S, Mouzon E, Neve RL, Tamminga CA, Nestler EJ. O se matafaioi mo le faʻamalolo o le methylation histone i le cocaine-faʻaosofia ai le faʻafitauli faigata e faʻamalosi ai. Neuron. 2011;71: 656-670. [PMC free article] [PubMed]
  • Freeman WM, Nader MA, Nader SH, Robertson DJ, Gioia L, Mitchell SM, Daunais JB, Porrino LJ, Friedman DP, Vrana KE. Faʻaaogaina o cocaine ole taimi e sui ai i le tagata e le o se tagata e faʻaalia ai le faʻamatalaga o le geneumbus accumbens gene. J Neurochem. 2001;77: 542-549. [PubMed]
  • Hyman SE, Malenka RC, Nestler EJ. Faʻaaogaina o mea e fai ma vaisu: o le matafaioi o aʻoaʻoga ma le manatua. Annu Rev Neurosci. 2006;29: 565-598. [PubMed]
  • Kalivas PW, Volkow N, Seamans J. Faʻatonuina le faʻamalosi i le tagofia o mea ua fai ma vaisu: o se togafitiga i le muai-accumbens glutamate transmission. Neuron. 2005;45: 647-650. [PubMed]
  • Lazo PS, Dorfman K, Noguchi T, Mattei MG, Bravo R. Faʻatulagaga ma le faʻatulagaina o le fosB gene. O le FosB faʻaitiitia le galuega a le fosB promoter. Nucleic Acids Res. 1992;20: 343-350. [PMC free article] [PubMed]
  • Lu L, Koya E, Zhai H, Faamoemoe BT, Shaham Y. Matafaioi a ERK i mea ua fai ma vaisu o kokeni. Trends Neurosci. 2006;29: 695-703. [PubMed]
  • Mandelzys A, Gruda MA, Bravo R, Morgan JI. O le leai o se faʻaauau o le 37 kDa flog-related antigen ma le AP-1-pei o le DNA-binding binding in the brains of kainic acids treated fosB null souris. J Neurosci. 1997;17: 5407-5415. [PubMed]
  • Maze I, Nestler EJ. O le epigenetic landscape of addiction. Ann NY Acad Sci. 2011;1216: 99-113. [PMC free article] [PubMed]
  • Maze I, Covington HE, 3rd, Dietz DM, LaPlant Q, Renthal W, Russo SJ, Mechanic M, Moulon E, Neve RL, Haggarty SJ, Ren Y, Sampath SC, Hurd YL, Greengard P, Tarakhovsky A, Schaefer A, Nestler EJ. Matafaioi taua o le histone methyltransferase G9a i le siakiina o siama. Saienisi. 2010;327: 213-216. [PMC free article] [PubMed]
  • Nechaev S, Adelman K. Promoter-latalata Pol II: pe a fetogi vave mea. Cell Cycle. 2008;7: 1539-1544. [PubMed]
  • Nestler EJ. Iloiloga. Faiga faʻamatalaga o mea ua fai ma vaisu: matafaioi a DeltaFosB. Philos Trans R Soc Lond B Biol Sci. 2008;363: 3245-3255. [PMC free article] [PubMed]
  • Tuuina atu HE, Hope BT, Kelz MB, Iadarola M, Nestler EJ. O suʻesuʻega faʻamaloilo e uiga i le faʻatonutonuina o le faʻateleina o le antigen i le FOS e masani ona maua e le cocaine i le tumutumu ma le tumutumu. J Pharmacol Exp Ther. 1995;275: 1671-1680. [PubMed]
  • Perrotti LI, Hadeishi Y, Ulery PG, Barrot M, Monteggia L, Duman RS, Nestler EJ. Faʻailoga o le deltaFosB i faʻaleleia o le faiʻai i le taui pe a mavae le faʻalavelave masani. J Neurosci. 2004;24: 10594-10602. [PubMed]
  • Robinson TE, Kolb B. Pisikisi faʻasaina e fesoʻotai ma le faʻaaogaina o fualaau faasaina. Neuropharmacology 47 Suppl. 2004;1: 33-46. [PubMed]
  • Robison AJ, Nestler EJ. Transcriptional ma epigenetic mechanisms o vaisu. Nat Rev Neurosci. 2011;12: 623-637. [PMC free article] [PubMed]
  • Saha RN, Wissink EM, Bailey ER, Zhao M, Fargo DC, Hwang JY, Daigle KR, Fenn JD, Adelman K, Dudek SM. O faʻamaumauga faʻataʻitaʻiga o le Arc ma isi IEG e faʻalagolago i le RNA polymerase II. Nat Neurosci. 2011;14: 848-856. [PMC free article] [PubMed]
  • Shaham Y, Faamoemoe BT. Le matafaioi o le neuroadaptations i le toe faʻafoʻi i le faʻatau fualaau. Nat Neurosci. 2005;8: 1437-1439. [PubMed]
  • Shen HW, Toda S, Moussawi K, Bouknight A, Zahm DS, Kalivas PW. Suʻu venditiki fesuisuiaʻi suiga i siaki cocaine-toso ese mai. J Neurosci. 2009;29: 2876-2884. [PMC free article] [PubMed]
  • Valjent E, Corvol JC, Itulau C, Besson MJ, Maldonado R, Caboche J. Faʻatinoina o le faʻamaonia o le kinase mo le faʻaaogaina o le koko. J Neurosci. 2000;20: 8701-8709. [PubMed]
  • Zeitlinger J, Stark A, Kellis M, Hong JW, Nechaev S, Adelman K, Levine M, Young RA. RNA polymerase o loʻo sosolo i gutu o le atinaʻeina o atinaʻe i totonu o le embryo o le Drosophila melanogaster. Nat Genet. 2007;39: 1512-1516. [PMC free article] [PubMed]
  • Vialou VF, Feng J, Robison AJ, Ferguson D, Scobie KN, Mazei-Robison M, Mouzon E, Nestler EJ. O le numera o le tali o le kulumu ma le siama o le tali a le CAMP o loʻo fusia faʻamalosi e manaʻomia uma mo le faʻamaina o le cocaine o le ΔFosB. J Neurosci. 2012 taliaina. [PMC free article] [PubMed]