Përvoja e drogës epigenetikisht primes induktivitetin e gjenit Fosb në nucleus accumbens rat (2012)

KOMENTE: Dëshmi që deltafosb lë gjurmë pas shërimit nga varësia. Në mënyrë të veçantë varësia shkakton ndryshime epigjenike, që rezultojnë në induksion shumë më të shpejtë të deltafosb kur ndodh rikthimi. Kjo shpjegon se si relapsing, edhe pas viteve mund të përshkallëzohet me shpejtësi në një shtet të varur plotësisht.



J Neurosci. Dorëshkrim i autorit; në dispozicion në PMC 2013 Janar 25.

 

Abstrakt

ΔFosB, a Fosb produkti gjen, nxitet në nucleus accumbens (NAc) dhe caudate putamen (CPu) nga ekspozimi i përsëritur ndaj drogave të abuzimit si kokaina. Ky induksion kontribuon në modelet e gabuara të shprehjes së gjeneve dhe anomalive të sjelljes të shikuara me ekspozim të përsëritur të drogës.

Këtu, ne vlerësuam nëse një histori e largët e ekspozimit të drogës në minjtë mund të ndryshojë induktivitetin e Fosb gjen e nxitur nga ekspozimi pasues i kokainës. Ne tregojmë se administrimi i mëparshëm kronik i kokainës, i ndjekur nga tërheqja e zgjatur, rrit indukueshmërinë e Fosb në NAc siç dëshmohet nga induksioni akut më i madh i ARN mRNA dhe akumulimi më i shpejtë i proteinës ΔFosB pas riekspozimit të përsëritur të kokainës. Asnjë primed i tillë Fosb induksioni u vëzhgua në CPu, në fakt, indukcioni i mëvonshëm akut i ΔFosB mRNA u shtyp në CPu.

Këto modele anormale të Fosb shprehjet janë të lidhura me modifikimet e kromatit në Fosb promotor gjen. Administrimi i mëparshëm kronik i kokainës shkakton një rritje të qëndrueshme në RNA polimeraza II (Pol II) që lidhet në Fosb promotor vetëm në NAc, duke sugjeruar që Pol II "ngadalëson" primet Fosb për induksion në këtë rajon pas riekspozimit ndaj kokainës. Një sfidë e kokainës më pas nxit lirimin e Pol II nga promotori i gjenit, duke lejuar më të shpejtë Fosb transkriptimi. Një sfidë e kokainës ul gjithashtu modifikimet e histonit represiv në Fosb promovues në NAc, por rrit shenjat e tilla represive dhe ul shenjat e aktivizimit në CPu.

Këto rezultate ofrojnë njohuri të reja në dinamikën e kromatinës në Fosb promotor dhe zbulojnë një mekanizëm roman për primed Fosb induksion në NAc pas riekspozimit ndaj kokainës.

Prezantimi

Varësia nga droga karakterizohet nga kërkimi dhe marrja e drogës, pavarësisht nga pasoja të rënda negative (Kalivas et al., 2005; Hyman et al., 2006). Ekspozimi kronik i drogës shkakton ndryshime të vazhdueshme në shprehjen e gjeneve në striatumin e barkut (ose nucleus accumbens; NAc) dhe striatum dorsal (ose caudate putamen; CPu), strukturat striatake të përfshira në shpërblimin e drogës dhe varësisë (Freeman dhe të tjerët, 2001; Robinson dhe Kolb, 2004; Shaham dhe Hope, 2005; Maze dhe Nestler, 2011). ΔFosB, një proteinë e shkrirë dhe e qëndrueshme e koduar nga gjenin e menjëhershëm të hershëm, Fosb, është një faktor i transkriptimit i karakterizuar mirë në NAc dhe CPu nga ekspozimi kronik në pothuajse të gjitha barnat e abuzimit, ku ndërmjetëson reagimet sensibilizuese të sjelljes ndaj administrimit të përsëritur të drogës (Nestler, 2008). Sidoqoftë, nëse ekspozimi i mëparshëm kronik ndaj një droge abuzimi ndryshon induksionin pasues të ΔFosB mbetet i panjohur.

Hipotezuam kohët e fundit që modifikimet e kromatinit në përgjigje të ekspozimit kronik të drogës mund të ndryshojnë induktivitetin e gjeneve të veçanta në rajonet e trurit të synuar (Robison dhe Nestler, 2011). Rritja e dëshmive ka treguar se drogat e abuzimit pas administrimit kronik ndryshojnë strukturën dhe aksesin transkripcional të kromatit përmes llojeve të shumta të modifikimeve, përfshirë fosforilimin, acetilimin dhe metilizimin e bishtit të histonit. Puna më e fundit në sistemet e kulturës së qelizave është fokusuar në rekrutimin e ARN polimerazës II (Pol II) tek promotori i "gjeneve të induktueshme" para shfaqjes së tyre, me Pol II të lidhur vazhdimisht me rajonet proksimale të promotorëve dhe rreth faqes së fillimit të transkriptimit (TSS ) në një shtet "të zvarritur" (Core dhe Lis, 2008; Nechaev dhe Adelman, 2008). Aktivizimi i Pol II i zvarritur mendohet të jetë përgjegjës për arratisjen e saj nga rajonet e promotorit dhe TSS dhe transkriptimin e këtyre gjeneve "primed" (Zeitlinger et al., 2007; Saha et al., 2011; Bataille et al., 2012).

Këtu tregojmë se ekspozimi i mëparshëm kronik ndaj kokainës, i ndjekur nga një periudhë e zgjatur e tërheqjes, ndryshon induktivitetin e Fosb gjen në administrimin e mëvonshëm të kokainës, me NAc të primuar për induksion ndërsa CPu nuk është. Ne pastaj identifikojmë nënshkrime të veçanta të kromatinës në Fosb promotori i gjeneve në NAc dhe CPu që janë të lidhur me induktivitetin e tillë aberrant të Fosb gjen, duke përfshirë edhe rekrutimin e Pol II të zvarritur në Fosb promotor proksimal vetëm në NAc, si dhe ndryshime në disa modifikime aktive ose repressive histone në të dy rajonet e trurit. Këto rezultate japin njohuri të reja në dinamikën e kromatinës në Fosb promotor gjen dhe tregojnë për herë të parë një mekanizëm me të cilin bllokimi i Pol II primes Fosb për aktivizimin më të madh në NAc pas riekspozimit ndaj kokainës.

Materialet dhe Metodat

kafshët

Rats Mashkull Sprague Dawley (250-275 g; Charles River Laboratories), të përdorura në të gjitha eksperimentet, u vendosën në çifte në një dhomë të kontrolluar nga klima në një cikël 12 hr / dritë të errët (dritat në 7 AM) me qasje në ushqim dhe ujë ad libitum. Të gjitha kafshët u injektuan dy herë në ditë për dhjetë ditë me kokainë (15 mg / kg, ip) ose kripur (ip) në kafazet e tyre të shtëpisë. Eksperimentet e kafshëve u miratuan nga Komiteti Institucional i Kujdesit dhe Përdorimit të Kafshëve (IACUC) në Malin Sinai.

Matjet e lokomotoreve

Kafshët u përdorën në dhomën lokomotore në ditën e parë për orë 1, dhe pastaj u monitoruan për aktivitetin lokomotor pas një injeksioni kripur duke përdorur Sistemin e Aktivitetit të Photobeam (San Diego Instruments). Pas përdorimit të dhomës lokomotore të 1 në ditë, kokaina (15 mg / kg, ip) u administrua në ditë për ditët 2 dhe kafshët u monitoruan përsëri për aktivitetin lokomotor për orë 1.

Immunohistochemistry

Kafshët u perfunduan pas 24 pas ekspozimit të fundit të tyre të drogës. Imunoreaktiviteti ΔFosB / FosB është zbuluar siç përshkruhet (Perrotti et al., 2004). Western blotting konfirmoi se të gjitha imunotaktikat e ngjashme me ΔFosB / FosB vëzhguan 24 orë ose më shumë pas injeksioneve të kokainës pasqyruan ΔFosB, ndërsa FosB ishte i padeklarueshëm (nuk u shfaq).

Izolimin e ARN, transkriptimin e kundërt dhe PCR

Pëllëmbët bilaterale 12-gauge të NAc dhe dorsolateral / dorsomedial CPu janë marrë siç përshkruhet (Perrotti et al., 2004), të ngrira në akull të thatë dhe të përpunuara sipas protokolleve të botuara (Covington et al., 2011). ΔFosB dhe FosB mRNA është matur duke përdorur PCR sasior (qPCR) me abstrakte ΔFosB dhe FosB specifike isoforme (Alibhai et al., 2007). Niveli i ARNi dhe FosB mRNA u normalizua në nivelet e ARNi GAPDH, të cilat nuk u prekën nga ekspozimi i kokainës (nuk është treguar).

Western blotting

Grushta NAc dhe CPu u mblodhën si më sipër dhe u përpunuan për blotting Western si përshkruhet (Covington et al., 2011), duke përdorur antitrupa kundër ERK44 / 42 [kinazës-44 / 42] të rregulluar sinjalin e jashtëm dhe phosphoERK44 / 42 (pERK), AKT [proto-onkogjenë virale të thymomës] dhe p-AKT, SRF (faktor i përgjigjes serum) dhe pSRF, CREB [proteina lidhëse e elementit të reagimit cAMP], dhe pCREB. Sasia e proteinave të bluar në secilën korsi u normalizua në nivele të aktinës ose tubulinës, të cilat nuk ishin të ndikuara nga ekspozimi i kokainës.

Impiantet e kromatit (ChIP)

Grumbulluar flakët NAc dhe grushta CPu u përgatitën për ChIP siç përshkruhet (Maze et al., 2010). Çdo kusht eksperimental u analizua në tri kopje nga grupet e pavarura të kafshëve. Për secilën mostër të CHIP, grushtat dypalësh NAc dhe CPu u grumbulluan nga pesë rats (grushta 10). Antitrupat e përdorur për modifikime specifike histone janë njësoj si ato të publikuara (Maze et al., 2010); antitrupat e Pol II të fosforiluara në Ser5 të rajonit të përsëritjes së saj të terminalit karboni (CTD) (Pol II-pSer5) është marrë nga abcam 5131. Katër grupe të primeve të ÇIP janë projektuar për të Fosb (Lazo et al., 1992; Mandelzys et al., 1997): 1F: GTACAGCGGAGGTCTGAAGG, 1R: GAGTGGGATGAGATGCGAGT; 2F: CATCCCACTCGGCCATAG, 2R: CCACCGAAGACAGGTACTGAG; 3F: GCTGCCTTTAGCCAATCAAC, 3R: CCAGGTCCAAAGAAAGTCCTC; 4F: GGGTGTTTGTGTGTGAGTGG, 4R: AGAGGAGGCTGGACAGAACC. Nivelet e modifikimeve të kromatit krahasohen me ato për ADN-në e hyrjes siç përshkruhet (Maze et al., 2010).

Analiza statistikore

Të gjitha vlerat e raportuara janë gjysma mesatare e të dhënave për aktivitetin lëvizës dhe numërimin e qelizave u analizuan nga ANOVA dykahëshe me trajtim dhe injeksion si faktorë. Eksperimentet e qPCR u analizuan për çdo kohë nga ANOVA me një drejtim me trajtimin si një faktor. Kur u vunë re efekte kryesore të rëndësishme (p <0.05), testet post-hoc të Bonferroni u kryen për krahasime me kafshë të kripura të trajtuara me kripë naive të drogës (^ në figura) dhe kafshë të trajtuara me kokainë naive të drogës (* në figura). Testet t-studentore të palidhura me dy bishta u përdorën për njollën Western dhe të dhënat e ChIP, me korrigjime për krahasime të shumëfishta.

Rezultatet

Madhe Nxitjen e Fosb në NAc, por jo CPu, të minjve me kokainë

Për të shqyrtuar ndikimin e një kursi të mëparshëm kronik të kokainës, e ndjekur nga një periudhë e zgjatur e tërheqjes, në induktivitetin e Fosb gjen në përgjigje të një sfide të mëvonshme të kokainës, minjtë që ishin injektuar më parë ip dy herë në ditë me kripë ose kokainë (15 mg / kg) për ditët 10 u dhanë doza sfiduese të drogës pas ditëve 28 të tërheqjes (Fig 1A). Ne fillim matur përgjigjet locomotor në një grup kafshësh për të konfirmuar induksionin e sensibilizimit lokomotor nga ekspozimi paraprak i kokainës, një pasojë e pritshme e qëndrueshme e administrimit të drogës. Rats me përvojë dhe jo-kokë të kokainës treguan aktivitetin e lokomotoreve të barabartë me bazën, me një sfidë kokainë ndaj kafshëve naivë të drogës duke rritur lokomotivitetin e tyre (Fig 1B. Masat e përsëritura ANOVA me dy drejtime, trajtimi: F1,66 = 30.42, p <0.0001; sfida e kokainës: F2,66= 58.39, p <0.0001; trajtimi x sfida e kokainës: F2,66= 8.56, p = 0.0005, Bonferroni pas testeve ^p <0.001). Kjo sfidë e kokainës shkaktoi aktivitet lëvizës dukshëm më të madh, dmth, sensibilizim, në minjtë me përvojë të kokainës (post-testet Bonferroni * p <0.001).

Figura 1  

Efekti i ekspozimit të mëparshëm kronik të kokainës në aktivitetin lokomotor dhe Fosb induksion në NAc dhe CPu pas riekspozimit të drogës

Për të vlerësuar efektet e këtij regjimi të para-trajtimit të kokainës në shprehjen ΔFosB në NAc dhe CPu, kemi matur proteina ΔFosB me metoda imunohistokemike 24 orë pasi kafshët me kokainë naive dhe me kokainë u trajtuan me sfidën e përditshme të kokainës 0, 1, 3 ose 6 injeksione (15 mg / kg, shih Fig 1A). Siç është vendosur më parë (Nye et al., 1995), Injeksionet e kokainës 3 ishin të mjaftueshme për të nxitur në mënyrë të konsiderueshme proteina ΔFosB në NAc dhe CPu të kafshëve naivë të drogës dhe akumulimi i saj mbeti i rëndësishëm pas ditëve 6 të injekcionit të kokainës (Fig 1C. Masat e përsëritura dyanshëm ANOVA, core NAc, trajtim: F1,28= 23.5, p <0.0001; sfida e kokainës: F3,28= 49.16, p <0.0001; trajtimi x sfida e kokainës: F3,28= 6.83, p = 0.0014; Shell NAc, trajtim: F1,28= 18.69, p <0.0001; sfida e kokainës: F3,28= 31.52, p <0.0001; trajtimi x sfida e kokainës: F3,28= 3.21, p <0.05; CPU, trajtimi: F1,28= 9.47, p <0.001; sfida e kokainës: F3,28= 19.74, p <0.0001; trajtimi x sfida e kokainës: F3,28= 0.94, p> 0.05. Në thelbin NAc, shell dhe CPu, post-testet Bonferroni ^p <0.05). Në kafshët me përvojë kokainë, nuk kishte asnjë provë të induksionit të vazhdueshëm ΔFosB në NAc ose CPU pas 28 ditësh tërheqjeje, në përputhje me raportet paraprake që sinjali ΔFosB shpërndahet plotësisht në këtë pikë kohore (Nye et al., 1995), arsyeja pse kjo pikë kohe është përdorur në këtë studim. Sidoqoftë, minjtë me përvojë kokainë që morën injeksione me sfida të kokainës 3 ose 6 treguan dukshëm më shumë indukacionin e proteinave ΔFosB në NAc, një efekt i dukshëm në të dy nënratat thelbësore dhe shell (Fig 1C. Pas-testet e Bonferroni * p <0.05). Në të kundërt, asnjë induksion kaq i madh i proteinës ΔFosB nuk u vu re në CPU; në vend të kësaj, induksioni ekuivalent ΔFosB u pa në këtë rajon pas 3 ose 6 ditësh injeksionesh të sfidës së kokainës në minjtë kokainë-naivë dhe të papërvojë (Fig 1C).

Për të fituar njohuri në ndryshimet transkriptuese që ndodhin në NAc dhe CPu në përgjigje të një sfide të kokainës, kemi studiuar kursin e kohës (45, 90 dhe 180 min) të induktivitetit të transkripteve ΔFosB dhe FosB mRNA mbi një kokainë të vetme ose injeksion të kripës tek minjtë e kokainës-naive dhe të eksperiencave pas ditëve 28 të tërheqjes (shih Fig 1A). Në lidhje me një sfidë të kripur, një sfidë e kokainës nxiti një rritje të shpejtë të niveleve të ARN-së FosB dhe FOSB në të tri pikat kohore në të dy NAc dhe CPu të kafshëve kokainë-naive (Fig 1D. Masat e përsëritura në një mënyrë ANOVA në pikën kohore; Bonferroni pas testeve ^p <0.05). Në NAc, kemi vërejtur induksion më të madh të ΔFosB dhe FosB mRNA në kafshët me përvojë të kokainës krahasuar me kafshët e kokainës naive pas sfidës së kokainës, efekti ishte i rëndësishëm në 90 min ndërsa, në të kundërt, induktiviteti i mRNA të ΔFosB dhe FosB në CPU ishte në mënyrë të konsiderueshme ulet në kafshët me përvojë të kokainës (Fig 1D. Bonferroni pas testeve %p = 0.08, * p <0.05).

Karakterizimi i rrugëve sinjalizuese në rrjedhën e sipërme në NAc dhe CPu të minjve me përvojë të kokainës

Një shpjegim i mundshëm për induktivitetin e ndryshuar të Fosb gjen në NAc dhe CPu pas një kursi të mëparshëm kronik të kokainës është se një histori e largët e ekspozimit të kokainës mund të nxisë ndryshime të qëndrueshme në rrugët sinjalizuese që janë në rrjedhën e sipërme të Fosb induksionit të gjeneve të tilla që një sfidë e kokainës atëherë e shkakton gjenin në një shkallë të gabuar. Për të studiuar këtë hipotezë, kemi analizuar dy faktorët e transkriptimit, SRF dhe CREB, të cilat kohët e fundit janë treguar të kërkuara për induksionin e kokainës të ΔFosB në këto rajone të trurit (Vialou et al., 2012) së bashku me kinaza proteinash në rrjedhën e sipërme, ERK dhe AKT, gjithashtu të implikuar në veprim të kokainës (Valjent et al., 2000; Lu et al., 2006; Boudreau et al., 2009). Ne nuk arritëm të zbulonim ndonjë ndryshim në nivelet totale ose nivelet e fosforiluara të këtyre proteinave të ndryshme që mund të shpjegonin ndryshimin e mundshëm të Fosb pa ndryshime në SRF, CREB, ose AKT (Fig 2B, C). Mungesa e ndryshimeve në pSRF dhe pCREB në NAc si përgjigje ndaj një sfide të kokainës është në përputhje me një raport të kohëve të fundit, i cili gjeti të dyja të nxitura në mënyrë të konsiderueshme vetëm nga kokaina kronike (Vialou et al., 2012).

Figura 2  

Efekti i ekspozimit të mëparshëm kronik të kokainës në kaskadat molekulare të sinjalizimit në rrjedhën e sipërme në NAc dhe CPu

Në NAc dhe CPu të kafshëve naivë të drogës, 20 min pas një ekspozimi fillestar të drogës (Fig 2A), një sfidë e vetme e kokainës uli nivelet e pERK42 / 44 (Fig 2B, C. T-testi studentor me dy bishta: * p <0.05). Ka raporte të mëparshme të niveleve të rritura të PERK në këto rajone pas administrimit akut të kokainës (Valjent et al., 2000). Kjo është e vështirë për t'u krahasuar me letrat e tjera që ekzaminojnë ERK fosforilimin në NAc gjatë tërheqjes nga injeksione të përsëritura të kokainës (Boudreau et al., 2007; Shen et al., 2009), pasi në studimin tonë pERK u quantifikua pas ditëve 28 të tërheqjes dhe pas një sfide të kokainës ose të kripës. Në lidhje me kafshët naivë të drogës që përjetojnë kokainë për herë të parë, riekspozimi ndaj kokainës në minjtë me kokainë me përvojë, pas ditëve 28 të tërheqjes, shkaktoi një rritje të konsiderueshme në nivelet pERK42 / 44 në CPu (Fig 2B, C. Testa e studentit me dy bishta: * p <0.05).

Peizazhi i Kromatinit në Fosb promotor i gjeneve në NAc dhe CPu të minjve me përvojë të kokainës

Ne më pas hetojmë nëse ndryshimet në Fosb induktiviteti i gjeneve shoqërohet me ndryshime në strukturën e saj të kromatinës. ChIP është kryer në NAc dhe CPu duke përdorur antitrupa të drejtuara kundër tre formave të karakterizuara mirë të modifikimeve histone: trimethylation of Lys4 e histone H3 (H3K4me3) lidhur me aktivizimin e gjenit, dhe H3K27me3 dhe H3K9me2 lidhur me represionin e gjeneve. Ne analizuam rats kokainë-naivë dhe -experienced pas 28 ditëve të tërheqjes ose pa ose me injektim sfidash të kokainës, me kafshët ekzaminuar më vonë 1 (Fig 3A). Në NAc, ne nuk gjetëm ndryshime të rëndësishme në lidhjen e ndonjë prej këtyre tre modifikimeve histone në Fosb promotor gjen në mungesë të sfidës së kokainës, megjithëse ka pasur një trend për uljen e niveleve të H3K9me2 (Fig 3B-D. Dy t-test tailed. #p = 0.2 krahasuar me kontrollet përkatëse Naïve të drogës). Ky efekt u bë i rëndësishëm pas një sfide të kokainës dhe ishte specifike për rajonin e promotorit proksimal të gjenit (Fig 3C. * p <0.05). Ndërsa nivelet e H3K9me2 janë shumë të ulta në disa gjene, Fosb promotori i gjeneve tregon nivele të dukshme të kësaj shenje në NAc nën kushtet e kontrollit (Maze et al., 2010, të dhënat nuk tregohen). Në të kundërt, në CPu, kemi gjetur ulje të vogla por të rëndësishme në lidhjen H3K4me3 dhe rritet në lidhjen H3K27me3, në Fosb promovues në mungesë të një sfide të kokainës, efektet e humbura pas sfidës (Fig 3D. * p <0.05).

Figura 3  

Efekti i ekspozimit të mëparshëm kronik të kokainës në mbushjen epigjenetike të Fosb gjen në NAc dhe CPu

Ne vazhdim studion Pol II detyrueshme për të Fosb gjen, i bazuar në zbulimet e fundit në kulturën qelizore që zvarritja e Pol II në TSSs, e cila karakterizohet nga fosforilimi i saj në Ser 5 në rajonin e përsëritjes CTD, është i lidhur me mbushjen e gjeneve (shih Hyrje). Ne kështu analizuam Pol II-pSer5 që lidhet me Fosb në katër rajone të dallueshme të gjenit (Fig 3B). Kjo analizë zbuloi një pasurim të konsiderueshëm të Pol II-pSer5 në Fosb gjen në rajonin e tij proximal promotor dhe rreth TSS e saj në NAc e kafshëve me përvojë kokainë, pas tërheqjes së zgjatur, në mungesë të një sfidë kokainë në krahasim me kontrollet (Fig 3E. * p <0.05). Ky pasurim nuk ishte i dukshëm në dy rajone të trupit gjen Fosb, në përputhje me stallingun e Pol II të përshkruar në sistemet më të thjeshta eksperimentale. Interesante, pas një sfide të kokainës, lidhja Pol II-pSer5 ende tregoi shenja të pasurimit, edhe pse jo më shumë, në Fosb rajonin e nxitësit proksimal (Fig 3E. %p = 0.1), por u kthye në nivelet e kontrollit në TSS. Të gjeturat në CPu ishin më të ndryshueshme, pa ndonjë model të qartë të vërejtur të Pol II-pSer5.

Diskutim

Ky studim ofron një pasqyrë të re për rregullimin e qëndrueshëm të Fosb javë pas ndërprerjes së ekspozimit të përsëritur ndaj kokainës. Ne tregojmë se administrimi i mëparshëm kronik i kokainës bën Fosb gjen më shumë i induktueshëm në NAc, duke rezultuar në akumulimin më të shpejtë të ΔFosB pas riekspozimit të drogës. Duke pasur parasysh preponderancën e provave që induksioni i ΔFosB në NAc ndërmjetëson reagimet sensibilizuese të sjelljes ndaj kokainës (Nestler, 2008), gjetjet tona zbulojnë një mekanizëm të ri për rikthimin më të shpejtë të përgjigjeve të tilla sensibilizuese pas tërheqjes së zgjatur.

Ne demonstrojme se induksioni i zgjeruar i ΔFosB në NAc është i lidhur me ndryshimet e kromatinës në Fosb gjen që do të pritej ta kryente atë për induksion më të madh. Kështu, ne tregojmë rritje Pol II të detyrueshme për promotorët proksimal dhe rajonet TSS të gjenit që janë të pranishëm pas 4 javëve të tërheqjes nga administrimi i mëparshëm kronik i kokainës. Pasurimi i tillë i Pol II në TSS humbet shpejt me sfidën e kokainës dhe Fosb induksion, në përputhje me një model në kulturën qelizore që zvarrit Pol II është lëshuar nga TSSs pas aktivizimit të gjenit (shih Hyrje). Një sfidë e kokainës gjithashtu nxit një rënie të shpejtë të lidhjes së H3K9me2-një shenjë e represionit të gjeneve - tek Fosb promotori. Në të kundërt, ne nuk zbuluam induksion të qëndrueshëm të disa faktorëve të transkriptimit, ose të kinazave të tyre në rrjedhën e sipërme, të cilat njihen për të ndërmjetësuar Fosb induksion nga kokaina. Këto rezultate mbështesin hipotezën tonë se induksioni i rritur i ΔFosB në NAc është i ndërmjetësuar nëpërmjet mbushjes epigenetike të Fosb gjen dhe jo nëpërmjet rritjes së ngjarjeve në rrjedhën e sipërme.

Rezultate shumë të ndryshme janë marrë për CPu. Nuk kishte asnjë dëshmi për të hedhur poshtë Pol II Fosb në rats me përvojë kokainë para një sfide të kokainës, megjithëse kishte modifikime të vogla por të rëndësishme të histonit në përputhje me shtypjen e gjeneve: rritja e lidhjes H3K27me3 dhe uljes së H3K4me3. Nuk pati gjithashtu asnjë ndryshim në faktorët e transkriptimit në rrjedhën e sipërme ose kinazet në përputhje me reduktimin Fosb induksion. Këto të dhëna sugjerojnë se pas administrimit kronik të kokainës, modifikimet epigjenike shërbejnë për t'u zbehur Fosb induktiviteti i gjeneve në CPu, në kontrast me mbushjen e parezit të parë në NAc. Megjithatë, ndërkohë që këto efekte shtypin induksionin e ARMB mRNA pas riekspozimit ndaj kokainës, nuk ka humbje në akumulimin e proteinës ΔFosB. Mekanizmi që qëndron në këtë paradoks tani kërkon hetime të mëtejshme.

Më në përgjithësi, rezultatet tona mbështesin një model ku ndryshimet në peizazhin e kromatinës në gjenet specifike në përgjigje të administrimit kronik të kokainës shërbejnë për të kryqëzuar ose hapur ato gjene për induksion të mëvonshëm pas riekspozimit ndaj drogës. Ndryshime të tilla të kromatit, të cilat mund të konsiderohen si "plagë epigjenetike", do të humbeshin në analizat e niveleve të qëndrueshme të ARNi të gjeneve. Në këtë mënyrë, karakterizimi i epigenomës së varësisë premton të zbulojë informacion të freskët rreth patogjenezës molekulare të çrregullimit, e cila mund të minohet për zhvillimin e trajtimeve të reja.

Mirënjohje

Kjo punë u mbështet nga grantet e Institutit Kombëtar për abuzimin e drogës.

Referencat

  • Alibhai IN, Green TA, Potashkin JA, Nestler EJ. Rregullimi i ekspresionit të fosB dhe DeltafosB mRNA: studime in vivo dhe in vitro. Brain Res. 2007;1143: 22-33. [Artikulli i lirë i PMC] [PubMed]
  • Bataille AR, Jeronimo C, Jacques PE, Laramee L, Fortin ME, Forest A, Bergeron M, Hanes SD, Robert F. Një Cycle Universale ARN Polymerase II CTD është orkestruar nga ndërthurje komplekse midis enzimeve të Kinazës, Fosfatazës dhe Isomerazës përgjatë Genes. Mol Cell. 2012;45: 158-170. [PubMed]
  • Boudreau AC, Reimers JM, Milovanovic M, Wolf ME. Receptorët e AMPA në sipërfaqen e qelizës së bërthamës së miut rriten gjatë tërheqjes së kokainës, por internalizohen pas sfidës së kokainës në lidhje me aktivizimin e ndryshuar të kinazave proteinike të aktivizuara me mitogjen. J Neurosci. 2007;27: 10621-10635. [Artikulli i lirë i PMC] [PubMed]
  • Boudreau AC, Ferrario CR, Glucksman MJ, Wolf ME. Përshtatjet e rrugës sinjalizuese dhe novelën e proteinave kinazës A substrate të lidhura me sensibilizimin e sjelljes ndaj kokainës. J Neurochem. 2009;110: 363-377. [Artikulli i lirë i PMC] [PubMed]
  • Core LJ, Lis JT. Rregullimi i transkriptimit nëpërmjet pushimit promotor-proximal të ARN polimerazës II. Shkenca. 2008;319: 1791-1792. [Artikulli i lirë i PMC] [PubMed]
  • Covington HE, 3rd, Maze I, Sun H, Bomze HM, DeMaio KD, Wu EC, Dietz DM, Lobo MK, Ghose S, Mouzon E, Neve RL, Tamminga CA, Nestler EJ. Një rol për methylation shtypjen histone në kokainë-induktuar dobësi të stresit. Neuron. 2011;71: 656-670. [Artikulli i lirë i PMC] [PubMed]
  • Freeman WM, Nader MA, Nader SH, DJ Robertson, Gioia L, Mitchell SM, Daunais JB, Porrino LJ, Friedman DP, Vrana KE. Ndryshimet kronike të kokainës ndërmjetësuara në shprehjen gjenetike të jo-njeriut të primatit nucleus accumbens. J Neurochem. 2001;77: 542-549. [PubMed]
  • Hyman SE, Malenka RC, Nestler EJ. Mekanizmat nervore të varësisë: roli i mësimit dhe kujtesës lidhur me shpërblimin. Annu Rev Neurosci. 2006;29: 565-598. [PubMed]
  • Kalivas PW, Volkow N, Seamans J. Motivimi i pakontrollueshëm në varësi: një patologji në transmetimin e glutamatit prefrontal-accumbens. Neuron. 2005;45: 647-650. [PubMed]
  • Lazo PS, Dorfman K, Noguchi T, Mattei MG, Bravo R. Struktura dhe hartografia e fosB gjen. FosB ul rregullimin e aktivitetit të promotorit fosB. Acidet nukleike Res. 1992;20: 343-350. [Artikulli i lirë i PMC] [PubMed]
  • Lu L, Koya E, Zhai H, Hope BT, Shaham Y. Roli i ERK në varësinë e kokainës. Trendet Neurosci. 2006;29: 695-703. [PubMed]
  • Mandelzys A, Gruda MA, Bravo R, Morgan JI. Mungesa e një antigjeni të lidhur ngushtë me 37 kDa fos dhe veprimtaria e detyrueshme e AD-1-së që lidhet me ADN-në në trurin e minjve të fosb null të trajtuara me acid kainik. J Neurosci. 1997;17: 5407-5415. [PubMed]
  • Maze I, Nestler EJ. Peizazhi epigjenik i varësisë. Ann NY Acad Sci. 2011;1216: 99-113. [Artikulli i lirë i PMC] [PubMed]
  • Mehmeti E, Neve RL, Haggarty SJ, Ren Y, Sampath SC, Hurd YL, Greengard P, Tarakhovsky A, Schaefer A, Nestler EJ. Roli thelbësor i histone methyltransferase G3a në plasticitetin e nxitur nga kokaina. Shkenca. 2010;327: 213-216. [Artikulli i lirë i PMC] [PubMed]
  • Nechaev S, Adelman K. Promoter-proximal Pol II: kur stalling shpejton gjërat. Cikli i celularit. 2008;7: 1539-1544. [PubMed]
  • Nestler EJ. Shqyrtim. Mekanizmat transkripcionalë të varësisë: roli i DeltaFosB. Philos Trans R Soc Lond Biol Sci. 2008;363: 3245-3255. [Artikulli i lirë i PMC] [PubMed]
  • Nye HE, Hope BT, MB Kelz, Iadarola M, Nestler EJ. Studime farmakologjike për rregullimin e induksionit antigjen kronik të FOS nga kokaina në striatum dhe nucleus accumbens. J ther Pharmacol Exp. 1995;275: 1671-1680. [PubMed]
  • Perrotti LI, Hadeishi Y, Uleri PG, Barrot M, Monteggia L, Duman RS, Nestler EJ. Induksioni i deltaFosB në strukturat e trurit të lidhura me shpërblimin pas stresit kronik. J Neurosci. 2004;24: 10594-10602. [PubMed]
  • Robinson TE, Kolb B. Plastika strukturore e lidhur me ekspozimin ndaj drogave të abuzimit. Neurofarmakologjia 47 Suppl. 2004;1: 33-46. [PubMed]
  • Robison AJ, Nestler EJ. Mekanizmat transkripcionalë dhe epigjenetikë të varësisë. Nat Rev Neurosci. 2011;12: 623-637. [Artikulli i lirë i PMC] [PubMed]
  • Saha RN, Wissink EM, Bailey ER, Zhao M, Fargo DC, Hwang JY, Daigle KR, Fenn JD, Adelman K, Dudek SM. Transkriptimi i shpejtë i aktivitetit të Arc-it dhe i IEG-ve të tjera mbështetet në ARN polimerazën II të gatshme. Nat Neurosci. 2011;14: 848-856. [Artikulli i lirë i PMC] [PubMed]
  • Shaham Y, Hope BT. Roli i neuroadaptations në rikthim në kërkim të drogës. Nat Neurosci. 2005;8: 1437-1439. [PubMed]
  • Shen HW, Toda S, Moussawi K, Bouknight A, DS Zahm, Kalivas PW. Ndryshueshmëria e plasticitetit dendritik të shtyllës kurrizore në minjtë e tërhequr nga kokaina. J Neurosci. 2009;29: 2876-2884. [Artikulli i lirë i PMC] [PubMed]
  • Valjent E, Corvol JC, Faqet C, Besson MJ, Maldonado R, Caboche J. Përfshirja e kaskadës së kinazës të rregulluar nga sinjalet extracellulare për pronat që përfitojnë kokainë. J Neurosci. 2000;20: 8701-8709. [PubMed]
  • Zeitlinger J, Stark A, Kellis M, Hong JW, Nechaev S, Adelman K, Levine M, Young RA. RNA polymerase ngadalësuar në gjenet e kontrollit të zhvillimit në embrion Drosophila melanogaster. Nat Genet. 2007;39: 1512-1516. [Artikulli i lirë i PMC] [PubMed]
  • Vialou VF, Feng J, Robison AJ, Ferguson D, Scobie KN, Mazei-Robison M, Mouzon E, Nestler EJ. Faktori i reagimit të serumit dhe proteina lidhëse e elementit të reagimit të cAMP janë të dyja të kërkuara për induksionin e kokainës të ΔFosB. J Neurosci. 2012 pranua. [Artikulli i lirë i PMC] [PubMed]