Maikutlo: Ho hlaha ho bontša hore Cdk5 e baka taolo ea tlase ea li-receptor tsa dopamine D2. Ho makatsang ke hore, phetolelo ea deltafosb e etsa hore tlhahiso ea Cdk5.
inahaneloang
Dopamine D2 receptor (DRD2) ke senotlolo sa bohlokoa se arolelanang mesebetsi ea boko e amanang le dopamine e joalo ka moea oa moputso, moputso le maikutlo. Cyclin-based kinase 5 (Cdk5) ke serine / threonine kinase e tataisoang ke proline eo ts'ebetso ea eona e kentsoeng potolohong ea moputso oa boko. Thutong ena, re senotse hore serine 321 e setseng (S321) ka hara karolo ea boraro ea liphatlalatso tsa DRD2 (D2i3) ke sebaka sa taolo sa buka sa Cdk5. Phosphorylation e itšetlehileng ka Cdk5 ea S321 ho D2i3 e hlokometsoe ho a vitro le litsamaiso tsa setso sa sele.
Re boetse re hlokometse hore phosphorylation ea S321 e sitisitse polelo ea lefats'e ea DRD2 mme e fokotse ho kopanya ha liprotheine ho DRD2. Ho feta moo, tsela e tlase ea cAMP e ile ea ameha tsamaisong ea heterologous le litsong tsa mantlha tsa methapo ho tsoa maikutlong a p35 a tsoang ka ntle ho nako ka lebaka la ts'ebetso e fokotseng ea inhibitory ea DRD2. Liphetho tsena li bontša hore phofo ea Cdk5-Mediated phosphorylation ea S321 e thibela mosebetsi oa DRD2, e fana ka mokhoa o laoloang oa taolo ea ho hlahisa dopamine.
lipalo
Tlhaloso: Jeong J, Park YU, Kim DK, Lee S, Kwak Y, et al. (2013) Cdk5 Phosphorylates Dopamine D2 Receptor le Attenuates Downfall Signaling. PloS ONE 8 (12): e84482. Doi: 10.1371 / journal.pone.0084482
mohlophisi: James Porter, Univesithi ea North Dakota, United States of America
Re amohetse: Kajeno 20, 2013; E amohetse: Novemba 14, 2013; E phatlalalitsoe: December 31, 2013
Copyright: © 2013 Jeong et al. Ena ke sengoloa se bulehileng se fihletsoeng ka tlase ho License ea Boikarabelo ba Creative Commons, e lumellang hore ho sebelisoe, ho abeloa, le ho beleha ho sa sebelisetsoe, ho fana ka moqapi le mohloli oa pele.
Lithuso: Mosebetsi ona o ne o tšehelitsoe ke lithuso (NRF-2012R1A2A2A01012923 le NRF-2012R1A4A1028200) ho tsoa ho mmuso oa Korea (MSIP) hape o tšehelitsoe tlasa moralo oa ts'ebetso ea tšebelisano ea machaba e laoloang ke NRF ea Korea (2012KXNXNUMNNXNXNXNXNXNXNXNXNXNXNXNXNXXXXX) Lenaneo la Lipatlisiso la Motheo la MSIP (2-1). SKP e ne e le moamoheli oa 2033117 le 2031 National Alliance bakeng sa Patlisiso mabapi le Schizophrenia and Depression (NARSAD) Litefiso tsa Mofuputsi tse Nyane. Bafani ba lichelete ba ne ba sena karolo morerong oa ho ithuta, ho bokella data le ho hlahlobisisa, qeto ea ho phatlalatsa, kapa ho hlophisa sengoloa.
Lithahasello tse tsitsitseng: Bangoli ba boletse hore ho na le lithahasello tsa tlhōlisano tse teng.
Selelekela
Ho supa dopamine ho ameha mesebetsing e fapaneng ea boko ho kenyelletsa ho hokahanya koloi, taolo ea maikutlo le mekhoa ea moputso [1]. Karolo e kholo ea dopamine signaling ho li-vertebrates e hlahisoa ke striatal medium spiny neurons (MSNs) e khethang ka mokhoa o khethollang sethala sa li-dopamine receptors mme e amohela tlhahiso ea dopaminergic haholo-holo ho tsoa sebakeng sa ventral tegmental sebakeng (VTA) le substantia nigra (SN) [2]. Li-receptor tsa Dopamine ke li-receptor tsa G protein-coupled (GPCR) tse nang le likarolo tse supileng tsa transmembrane mme li na le li-subtypes tse peli, D1-like le li-receptor tse kang D2, tse arabelang liketsong tsa boiphetetso ho dopamine ho supa [1]. Mohlala, dopamine D1-like receptors (D1, D5) activate adenylyl cyclase ka GLing le ho eketsa tekanyo e kenelletseng ea cAMP, empa dopamine D2-receptors (D2, D3, D4) inhibit adenylyl cyclase ka Gíi le ho fokotsa sekhahla sa cAMP se ikhethileng [1], [3].
Har'a li-receptor tsa dopamine, D2 receptor (DRD2) e bohlokoa ho pathophysiology ea mafu a mangata a maholo a kelello a kenyeletsang schizophrenia le ho lemalla lithethefatsi. [4], joalo ka hore lithethefatsi tse ngata tsa antipsychotic bonyane li shebile DRD2. Hoa tsebahala hore ts'ebetso ea DRD2 e lumellana hantle le litlamorao tsa boitšoaro ba lithethefatsi tsa tlhekefetso mefuteng ea liphoofolo [5]. Li-antidepressants le ho sebetsa ha mohopolo ka mokhoa o tsitsitseng li boetse li hokahantsoe le liphetoho lipontšong tsa sele ea DRD2 kapa li-signature intracellular signature e tsamaisanang le PKA, ERK le GSK3 [1], [4], [6]. Ntle le likarolo tsena tsa bohlokoa tsa DRD2 bokong, mekhoa e fupereng melao e fanang ka hore heterogeneity le ho rarahana ha thepa ea DRD2 ha li utloisisehe ka botlalo.
Melao e fetolang ea bopaki e bonts'a hore liphetoho tse ngata tsa posttranslational li kentse letsoho tokisetsong e ntle ea ts'ebetso ea DRD2. Glycosylation e pharalletseng ea DRD2 e senotsoe lithutong tsa ho ngolla lifoto tsa batho ba pele [7], le ho senya sebopeho sa bond ka hare ho DRD2 e ile ea boela ea tsebahatsoa e le phetoho ea bohlokoa bakeng sa ho tlama ligand [8]. Ho feta moo, libaka tsa phosphorylation tsa DRD2 li ne li khethiloe qalong ke a vitro lekana le radioisotopes, ho fana ka litsela bakeng sa litsela tse fapaneng tsa taolo tse kopanetsoeng ke li-kinase tse fapaneng [9]. Ka sebele, protheine kinase C (PKC) e laola tšusumetso ea calciumDD2-mediated activation ea intracellular calcium mme e hlophisa tšebelisano ea DRD2 ka liprotheine tsa cytoskeletal [10]. Phosphorylation ke GPCR kinase 2 (GRK2) e laola mekhoa ea phetoho ea agonist-induction [11].
Cyclin-based kinase 5 (Cdk5) ke serine / threonine kinase e tsamaisitsoeng ke proline e nang le ts'ebetso e khethiloeng ka lebaka la polelo e ikhethang ea boko ba ts'ebetso ea eona e sebetsang, p35 le p39 [12]. Cdk5 e ameha lits'ebetsong tse fapaneng tsa neuronal ho kenyelletsa ho tsamaisoa ha methapo ea methapo le tataiso ea axon, 'me Cdk5 le p35 null mice li bontša bofokoli ho cortical layering [13]. Haufinyane, ho ile ha bonts'oa hore phosphorylation ea WAVE1 le ephexin ka Cdk5 e laola dendritic spine morphophois [14]. Ntle le moo, Cdk5 e boetse e laola maemo a polelo a holimolimo a NMDA receptor, NR2B, le NR2A-Mediated NMDA [15], [16]. Hoa hlokomeleha hore likarolo tse ngata tsa bopaki li fana ka maikutlo a kamano e haufi pakeng tsa Cdk5 le sisteme ea dopamine. Phdph5 phosphorylates tyrosine hydroxylase (TH), e laola botsitso ba eona, 'me ka hona e boloka dopaminergic homeostasis [17]. Ho li-neurons tsa postynaptic, ha masala a T75 a dopamine le cyclic-AMP e laoloang phosphoprotein-32kD (DARPP-32) e entsoe ka phosphorylated ke Cdk5, e ka sitisa ts'ebetso ea PKA mme ka hona e emisa dopamine DRD1-medi [18]. Ho khahlisang, ha cocaine, agonist e sa tobang ea dopamine receptors, e laoloa ka mokhoa o sa lekanyetsoang ho litoeba, mRNA le liprotheine tsa Cdk5 e eketseha ka li-neuron tsa spiny tse bohareng. [19]. Ka kopanelo, Cdk5 e bonahala e kenya letsoho litloaelanong tse khothalletsoang ke lithethefatsi. Thutong ena, re bonts'a tšebelisano e sebetsang ea DRD2 le Cdk5 e eketsang karolo ea Cdk5 ho saena dopamine.
Lisebelisoa le mekhoa
Li-antibodies
Li-serum tse khahlanong le rabi li ile tsa phahamisoa khahlanong le li-peptide tse nang le phospho-serine 321 (pS321) ea loop ea boraro ea intracellular ea DRD2 (D2i3). Phospho-peptide, CNPDpSPAKPEK (PEPTRON), e ne e sebelisetsoa ho etsa pilara e kopantsoeng le peptide-tlhoekiso bakeng sa tlhoekiso ea ho amana (20401, PIERCE). Anti-pS321 antibody e ile ea matlafatsoa ke sistimi ea tlhoekiso ea tumellano ka mor'a taelo ea moetsi. Phospho-antibody e hloekisitsoeng e ne e bolokiloe ho PBS e nang le 0.1% sodium azide le 0.1% gelatin. Anti-mouse anti-Cdk5 antibody (sc-249) le anti-rabi anti-p35 antibody (sc-820) li ne li sebelisoa bakeng sa blotting le immunocytochemistry ea Bophirimela ea Cdk5 / p35. Anti-mouse anti-GFP antibody (sc-9996) e ne e sebelisoa bakeng sa thibelo ea thibelo le ho fifala ka bophirima ha DRD2-GFP. Li-anti-le-anti-rab-anti-rab-anti-rab-anti-rab-anti-ray (anti-rab anti anti-ray (sc-807)), anti-mouse anti-GST antibody (sc-805), anti-mouse anti-GAPDH antibody (sc- 138) li rekiloe ho tsoa ho Santa Cruz Biotechnologies.
Animals
P35 knockout mouse e ne e le mpho e mosa e tsoang ho Dr. Katsuhiko Mikoshiba ho RIKEN Brain Science Institute e Japane mme e sebelisitsoe moetlong oa mantlha oa neuron. Primer sets bakeng sa genotyping e ne e le 5'- GGTCTCCTCTTCTGTCAAGAAG, 5'-GCTCTGCTAGACACATACTGTAC le 5'- TCCATCT GCACGAGACTAGT joalo ka ha ho hlalositsoe pele. [20]. Linta tsa ICR le Sprague Dawley likhoto li ile tsa sebelisetsoa ho lokisa lysate ea boko. Ts'ebetso tsohle tsa liphoofolo li amohetsoe ke Komiti ea Tlhokomelo ea Liphoofolo le Tloaelo ea Pohang ea Pohang.
Plasmid Litholoana
Human DRD2 long isoform in EGFP-N1 plasmid vector and the third intracellular loop of DRD2 (212-373 amino acid residues including the 29 eketsehileng amino acid respecies to DRD2 long isoform Human Cdk2 e kentsoe ka har'a pCMV-HA plasmid vector mme p5 ea motho e kentsoe ka har'a pcDNA 35 plasmid vector. Human Cdk3.1 e kentsoe tlasa mochini oa papali oa cytomegalovirus (CMV) hammoho le p5 ea motho ka har'a pcDNA 35 vector ho etsa polelo e habeli (Cdk3.1 / p5) bakeng sa immunocytochemistry, receptor Internization assay, [35S] -GTPγS e tlamang assay, radioligand e tlamang assay le cAMP enzyme immunoassay.
In Vitro Kinase Assay
E amanang le IP a vitro kinase assay e entsoe tjena. Boko bo le bong ba panya e ne e kentsoe ho 3 mL erythrocyte lysis buffer (ELB) (50 mM Tris (pH 8.0), 250 mM NaCl, 5 mM EDTA, 0.1% NP-40) ke 20% NP-30) ka 16,000 stroke of a lomogen hosesgen. . Linoko li ne li kentsoe leqhoeng bakeng sa XNUMX min, sonication, le centrifuged ho XNUMX × g bakeng sa 10 min. Li-supernatants li ne li entsoe ka mokhoa o khahlanong le rabi anti-p35 antibody ho fumana mochini o sebetsang oa Cdk5 / p35. Cdk5 / p35 protheine e tsoakiloeng le e hloekisitsoeng ea GST e ne e kopantsoe le adenosine 5'-triposphate, [γ-32P] (NEG-502H, PerkinElmer) le incubated ho kinase buffer (30 mM HEPES (pH 7.2), 10 mM MgCl2, 0.2 mM DTT) ea 1 h ka mocheso oa kamore [18], [21]. Morero o hloekisitsoeng oa Cdk5 / p25 (14-516, Millipore) le ona o ile oa sebelisetsoa a vitro kinase assay joalo ka ha ho hlalositsoe kaholimo. BuNer ea 2 x ea ho jarolla sampole e ile ea eketsoa ka motsoako oa karabelo mme ea pheha ka 100 ° C. Mehlala eo e ile ea kenngoa SDS-PAGE mme gel e omisitsoeng e ile ea hlahlojoa ke autoradiography.
Liquid Chromatography (LC) -Mass Spectrometry (MS) / MS Analysis
Proteinant ea GST-D2i3 e recombin e ile ea hlahlojoa ke LC-MS / MS ka mor'a IP e hokahaneng a vitro kinase assay. Re sebelitse peptide tlhahlobo ea LC-MS / MS ya data re sebelisa X !! Tandem (mofuta oa Des-01-2008). Faele e 'ngoe le e' ngoe ea RAW ea data e ne e fetotsoe pele ho MzXML e sebelisa phala ea trans-proteinomic (TPP; mofuta 4.3). Scans tsa MS / MS ho li-mazXML tse fetotsoeng li ne li kenngoa ho batla khahlanong le database ea tatellano ea khomphutha ea UniProt (ho lokolla 2010_07) ho kenyelletsa tatellano ea GST-D2i3 e sebelisang X !! Tandem. Mamello e ne e behiloe 3 Da bakeng sa li-ion tse tlileng pele le 2 Da bakeng sa li-ion tsa likotoana. Ho ile ha sebelisoa tlhahiso ea enzyme bakeng sa trypsin. Likhetho tse fapaneng tse fetotsoeng li ile tsa sebelisoa bakeng sa carbamidomethylation ea cysteine (57.021 Da), oxidation ea methionine (15.995 Da), hydrolysis ea asparagine (0.987 Da) le phosphorylation ea serine (79.966 Da).
Ho itšireletsa mafung
Ho itšireletsa mafung ho ile ha etsoa lysates tsa sele ho ELB lysis buffer. Anti-GFP antibody e kentsoe lysates 'me e kentsoe 3 h ho 4 ° C. Li-immunocomplexes li ile tsa hloekisoa ho sebelisoa protheine-A agarose. Li-precipitates li ne li kopantsoe le SDS sampuli ea ho jarolla buffer bakeng sa 30 min ho 37 ° C, 'me e behiloe ka tlas'a SDS-PAGE le blots Western.
GST Ho theola Assay
10 µg ea GST e hloekisitsoeng le GST-D2i3 li ne li entsoe ka ligys lysate ea 1.5 h ho 4 ° C. 30 µL ea lieta tsa glutathione (GSH) -conjugated Sepharose 4B (17-0756-01, GE Healthcare) e lekantsoeng le lysis buffer e ile ea eketsoa mme ea kenella bakeng sa 1 e eketsehileng. Lieta li ne li bokelloa ke centrifugation ho 2,000 ×g hape e rinsed ka lysis buffer 4 makhetlo a [22], [23]. Li-precipitates li ile tsa hlahlojoa ke blotting ea Bophirimela e sebelisang anti-Cdk5 le anti-p35 antibodies.
Immunocytochemistry
Lisele tse fetotsoeng tsa HEK 293 tse fetotsoeng le li-neuron tsa striatal cultured liaparong li ile tsa hlatsuoa hang ka phosphate buffered saline (PBS) mme tsa emisoa ka ho qoelisoa meea e batang ea 4% paraformaldehyde / PBS bakeng sa 30 min. Antibody ea mantlha e ne e kenelletsoe tharollong e thibelang (2% serum ea pere le 1% Triton X-100 ho PBS). Alexafluor-647-conjugated anti-mouse antibody (A20990, Invitrogen) le antiaforor-568-conjugated anti-rabi antibody (A11011, Invitrogen) li ne li sebelisoa e le li-antibodies tsa bobeli. Hoechst e ne e sebelisetsoa ho etsa lits'oants'o tsa methapo. Litšoantšo li fumanoe ke confocal microscopy (Olympus, FluoView-1000).
Recay ea Interiorization Assay
24 h ka mor'a phetisetso, lisele li ile tsa alafshoa ka 1 µM quinpirole (Q102, Sigma) ea 30 min le 90 min ho 37 ° C. Lisele li ile tsa emisoa hape kahar'a li-PBS tsa 2 mL le 200 µL li sebelisitsoe bakeng sa karabelo e 'ngoe le e' ngoe. Phekolo ea lithethefatsi e ne e etsoa ka mocheso oa kamore bakeng sa 3 h litsing tse latelang; 3 nM [3H] -spiperone (NET-565, PerkinElmer), 3 µM sulpiride (895, TOCRIS), 10 µM haloperidol (H1512, Sigma). Hydrophobic [3H] -piperone e ne e sebelisetsoa ho ngola lipalo tse hlalositsoeng ka botlalo mme hydrophilic sulpiride e sebelisitsoe ho nkela membrous receptor-bind [3H] Lipontšo tsa -piperone. Matšoao a amanang le li-receptor a amanang le Membrane a ne a baloa ka ho tlosa litekanyetso tsa "intracellular receptor" ho tsoa ho boleng bo hlalositsoeng ka botlalo ba receptor. Lisele li ne li hloekisoa sefofaneng sa GF / B (Millipore) ebe li hlatsoa makhetlo a 3 ka li-buffer (50 mM Tris-HCl (pH 7.4), 100 mM NaCl). Metlhotlo e ne e omisitsoe ebe masala a radio a lekantsoe a sebelisa k'homphieutha ea scintillation [24].
Litokisetso tsa Cell Membrane
Lisele tse kopaneng ka har'a lijana tsa setso tsa 100 mm kamora phetiso li ile tsa hlatsuoa ka PBS e batang leqhoa mme tsa kotuloa ka 1 mL HME buffer (25 mM HEPES (pH 7.5), 2 mM MgCl2, 1 mM EDTA). Li-lysates tsa Homogenized li ne li le lipakeng tsa 500 × g bakeng sa 15 min mme tse phahameng ka mor'a moo li ile tsa kenngoa bohareng ba 36,000 × g bakeng sa 30 min. Li-pellets tse emisitsoeng hape ho HME buffer li ne li sebelisoa bakeng sa lits'oants'o.
[35S] -GTPγS Ho tlama Assay
Likaroloana tsa membrane ea lisele li ne li entsoe ka nakoana ka 1 µM quinpirole (Q102, Sigma) ka har'a assay buffer (25 mM HEPES (pH 7.5), 1.5 mM MgCl2, 100 mM NaCl, 1 mM EDTA le 0.01 mM GDP) bakeng sa 10 min. [35S] -GTPγS (NET-030H, PerkinElmer) e ile ea eketsoa kopanong ea ho qetela ea 3 nM ho 30 µL mme ea kenella ka ho eketsehileng bakeng sa 90 min. 170 µL ea li-buffer tse batang leqhoa (10 mM Tris-HCl (pH 8.0), 100 mM NaCl, 10 mM MgCl2, le 0.1 mM GTP) e kentsoe ho emisa karabelo. Li-membranes li ne li tlhotiloe sefofaneng sa GF / B (Millipore) ebe li hlatsoa makhetlo a 3 ka lijana tse hlatsoang (50 mM Tris-HCl (pH 7.4), 100 mM NaCl). Metlhotlo e ne e omisitsoe mme seea-le-moea se lekantsoe ho sebelisoa k'homphieutha ea scintillation [25], [26].
Radioligand Binding Assay
Li-membranes tsa lisele tse lokiselitsoeng li ne li chekiloe ka 0.01 nM [3H] -spiperone (NET-565, PerkinElmer) le likhahla tse ntseng li eketseha tsa quinpirole (Q102, Sigma) ea 30 min ho assay buffer (25 mM HEPES (pH 7.5), 1.5 mM MgCl2, 100 mM NaCl, 1 mM EDTA). Li-membranes li ne li tlhotiloe sefofaneng sa GF / B (Millipore) ebe li hlatsoa makhetlo a 3 ka lijana tse hlatsoang (50 mM Tris-HCl (pH 7.4), 100 mM NaCl). Karabelo e ile ea felisoa ka ho fifala kapele ka lifilimi tsa GF / C. Ts'oaetso ea radioacuction e lekantsoe ho sebelisoa k'haontara ea scintillation [27]-[29].
cAMP Enzyme Immunoassay
Lisele tse fetotsoeng tsa HEK 293 li ile tsa etsoa pele ka 10 µM rolipram (R6520, Sigma) bakeng sa 1 h, 'me ka mor'a moo tsa alafshoa ka 0.1 µM forskolin (F6886, Sigma) le ho eketseha ha quinpirole (Q102, Sigma) ho 30. Li-neurons tsa "criured striatal neurons" tsa kalafo li ile tsa phekoloa ka 10 µM rolipram bakeng sa 1 h, le 1 µM dopamine ea 1 h [22]. Li-lysates tsa sele li ne li lokisitsoe ka 0.1 M HCl mme maemo a cAMP a fumanoe ke cAMP enzyme immunoassay kit (Sapphire Bioscience) kamora taelo ea moetsi.
Mokhatlo oa mathomo oa Criatal Neuron
Sebaka sa Striatal se ne se arotsoe ho bokong ba "embryonic brain" (E15). Lithane tse lahliloeng li ile tsa qaqisoa ka har'a media e nyane ea bohlokoa (MEM) (11095, Invitrogen) e nang le 0.25% trypsin (T4549-100, Sigma) le 0.1% DNase I bakeng sa 6 min ho 37 ° C. Lisele li ile tsa emisoa bocha mecheng ea lipolanete (MEM e nang le 0.01 M HEPES (pH 7.4) le 10% (vol / vol) serum ea lipere (16050-122, GIBCO). Li-Neurons li ne li qhekelloa ka matsatsi a 7 a vitro (DIV 7) ho MEM e nang le tlatsetso ea B27 (17504-044, Invitrogen) pele e kenngoa ho cAMP enzyme immunoassays.
Results
Phdph5 Phosphorylates Serine 321 ho Boroko ba Boraro ba Intracellular ba DRD2 a vitro
Ho tseba nalane e ncha ea Cdk5, re ile ra etsa lipatlisiso ka tatellano re sebelisa (S / T) PX (K / H / R) joalo ka tatellano ea tumellano ea Cdk5 [30] mme a supa DRD2 e le substrate ea mokhethoa. Tatellano ea tumellano, ho kenyelletsa serine 321, e sebakeng sa boraro sa marang-rang sa DRD2 (D2i3) moo mekhoa e fapaneng ea taolo e kentsoeng ts'ebetsong [3], [10], [11]. Tatellano e bolokiloe ka mokhoa oa tlhaho ho DRD2 ka li-vertebrates, ho bolelang bohlokoa bo sebetsang ba masala (Setšoantšo sa 1A).
Setšoantšo sa 1. Cdk5 phosphorylates serine 321 ho lesela la boraro le ikhethileng la DRD2 in vitro.
(A) Khokahano ea Amino acid e latellanang e bonts'ang libaka tse bolokiloeng tsa DRD2 ho tsoa ho mefuta e fapaneng (e shaded). Sebaka sa phosphorylation sa Cdk5 se ka hlahisoang ke asterisk. (B) E amanang le IP a vitro kinase assay e nang le protheine ea phetoho ea GST-D2i3 le GST-D2i3. Cdk5 / p35 e ntlafalitsoeng ka bokong ba mouse ka anti-p35 immunoprecipitation e sebelisitsoe bakeng sa karabelo ea kinase. Autoradiograph ea liprotheine tsa phosphorylated e bonts'oa hammoho le lits'oants'o tse bosehla tsa Coomassie tse 'mala o moputsoa oa' mala o tšoanang. Arrowhead e bonts'a lets'oao la radioactive le tsamaisanang le GST-D2i3s mme motsu o bulehileng o bonts'a matšoao a radio radio a tsoang p35 (C) MS / MS pontso ea karolo ea phosphorylated peptide ea D2i3. Mekhoa ea likheo tsa theoretical e bonts'itsoe ka tlase ho sebopeho. Har'a likarolo tsohle tsa sekhechana, li-y-b-ion tse bonojoang li bonoa moo ho hlahelletseng. Y6 y7 ions li bontša ka matla phosphorylation ea serine 321. (D) In vitro kinase assay e nang le protheine ea Cdk5 / GST-p25 e hloekisitsoeng e sebelisang li-protein tsa GST-D2i3 le GST-D2i3. Liprotheine tsa phosphorylated li ile tsa bontšoa ka har'a autoradiograph, hammoho le lits'oants'o tse ntle tsa Coomassie. Arrowhead e bonts'a lets'oao la radioactive le tsamaisanang le GST-D2i3 mme motsu o bulehileng o bonts'a matšoao a radio radio a tsoang GST-p25.
doi: 10.1371 / journal.pone.0084482.g001
Ho lekola bokhoni ba Cdk5 ho phosphorylate D2i3, re entse IP e hokahaneng a vitro kinase assays e sebelisa protheine ea Cdk5 / p35 e ntlafalitsoeng ho tsoa ho lysate ea bokong ka p35 immunoprecipitation ka li-protein tsa GST-D2i3 (amino acid tse setseng) e le likhakanyo tsa "li-protein" tsa "212-373". Re hlokometse lipontšo tsa phosphorylation ho liprotheine tse hloekisitsoeng tsa GST-D2i3 le GST-D2i3 S297A, empa lets'oao le ne le fokotsehile haholo ho sebelisoa GST-D2i3 S321A (Setšoantšo sa 1B). Ho netefatsa le ho feta phosphorylation ea serine 321 ho GST-D2i3, re entse tlhahlobo ea LC-MS / MS ea disampole tse tsoang ho IP e hokahaneng a vitro kinase assays sebelisa LTQ XL boima ba li-spectrometry. Nako le nako, phospho-peptide e tsamaellanang le boima ba li-peptide tsa phospho-serine 321 li ile tsa khutlisoa (Setšoantšo sa 1C). Ho nka hore ts'ebetso e itšetlehileng ka data nakong ea tlhahlobo ea LC-MS / MS e sekamela ho bona liprotheine tse ngata mohlaleng [31], data ena e fana ka maikutlo a hore masala a serine 321 ke sebaka se hlahelletseng sa phosphorylation ea Cdk5 sebakeng sa D2i3. Ho paka phosphorylation e tobileng ea serine 321 ho GST-D2i3 ka Cdk5, a vitro kinase assay e sebelisang mofuta o hloekisitsoeng oa Cdk5 / GST-p25 e nang le protheine e hloekisitsoeng ea GST-D2i3 e entsoe. Re fumane letšoao la phosphorylation la bohlokoa ho GST-D2i3 le neng le le sieo ho GST-D2i3 S321A (Setšoantšo sa 1D). Ha li kopantsoe hammoho, liphetho tsena li bonts'a hore masala a D2i3 S321 ke sepheo sa khetho bakeng sa phosphorylation ea Cdk5-Mediated.
Phdph5 Phosphorylates Serine 321 ho Boroko ba Boraro ba Intracellular ba DRD2 ho Lisele
Ho tseba phosphorylation ea serine 321, re phahamisitse antibody e khethehileng bakeng sa phospho-serine 321 (pS321). Mehlala e tsoang ho IP e hokahaneng a vitro kinase assay ba ile ba hlahlojoa ke blotting Bophirimela ba sebelisa anti-pS321 antibody. Blots e bonts'itse sehlopha se ikhethileng ka karabelo ea kinase e neng e itšetlehile ka GST-D2i3 (Setšoantšo sa 2A). Ho netefatsa phosphorylation e ka bang teng ea serine 321 ho DRD2 ke Cdk5 ka liseleng, li-anti-GFP immunoprecipitates tse tsoang liseleng tsa HEK 293 le DRD2-GFP le DRD2 S321A-GFP tse nang le HA-CGkPX li bile li sena le GPPX. anti-pS5 li-antibodies. Matšoao a bosholu a tšoailoeng ke anti-GFP antibody a tsejoang hore a bakoa ke glycosylation e feteletseng ea DRD35 a bonoa feela boteng ba DRD321-GFP, le li-anti-pS2 antibody tse fumanoeng matšoao a tšoanang a DRD2 feela ka Cdk321 / p2 co expressionSetšoantšo sa 2B) [7]. Ho netefatsa hape phosphorylation ea serine 321 ka Cdk5, D2i3 (FLAG-D2i3) le mofuta oa mutant oa D2i3 (FLAG-D2i3 S321A) li hlahisitsoe. FLAG-D2i3 le FLAG-D2i3 S321A e hlahisitsoeng ka kapa ntle le HA-Cdk5 le p35 ka har'a lisele tsa HEK 293 li ile tsa hlahlojoa ke sehlopha sa SDS-gel motsamao oa phetoho. Phetoho ea bohlokoa ea Cdk5 e tsamaeang le ho tsamaisoa e bonts'itsoe bakeng sa FLAG-D2i3, empa eseng bakeng sa FLAG-D2i3 S321A (Setšoantšo sa 2C). Re boetse re sekasekile boemo ba phosphorylation ba DRD2 ho Ser321 hodima tsusumetso ea agonist. Lisele tsa HEK 293 tse hlalosang DRD2-GFP le Cdk5 / p35 li ne li susumetsoa ke quinpirole, mme li-anti-GFP immunoprecipitates tse tsoang lysates tsa sele li ile tsa hlahlojoa ke ho phatloha hoa Bophirimela ho sebelisa li-anti-GFP le anti-pS321 antibodies. Re fumane hore phosphorylation ea Cdk5-mediated ea DRD2 ho Ser321 ha e anngoe ke ts'usumetso ea agonist, e hlahang e fapane le phosphorylations ea GRK- le PKC-Mediated (Setšoantšo sa 2D) [32], [33]. Ka bobeli, liphetho tsena li bonts'a hore Cdk5 e ka etsa phosphorylate serine 321 masalela a DRD2 tikolohong ea maqhubu.
Setšoantšo sa 2. Cdk5 phosphorylates serine 321 karolong ea boraro ea makenete ea DRD2 liseleng.
Cdk5-mediated phosphorylation ea serine 321 e ile ea hlahlojoa ho sebelisoa anti-pS321 antibody. (A) Mehlala e tsoang ho IP e hokahaneng a vitro kinase assay e sebelisang liprotheine tsa GST-D2i3 li ile tsa hlahlojoa ke blotting Western (WB) ka li-antibodies tse bonts'itsoeng. Maqhubu a matsoho a bontša li-GST-D2i3s. (B) DRD2-GFP le DRD2 S321A-GFP e hlahisitsoe ka ntle le HA-Cdk5 le p35 liseleng tsa HEK 293. Li-immunoprecipitates tsa anti-GFP li ile tsa hlahlojoa ke ho fifala ha Bophirimela ho sebelisa li-anti-GFP le anti-pS321 antibodies. Bracket e bonts'a matšoao a DRD2 mme motsu o otlolohileng o bonts'a matšoao a senang maikutlo a tsoang ho li-immunoprecipitates tsa anti-GFP. '% ea ho kenya' ke% bophahamo ba lysate bo phethahetseng bakeng sa karabelo ea IP. Matšoao a fokolang a Cdk5 a fokolang a ile a bontšoa ke asterisks. (C) Tsamaiso ea phetoho ea ho tsamaea ha Gel. Lisele tsa HEK 293 tse fetisitsoeng joalo ka ha li bonts'itsoe li ile tsa hlahlojoa ke ho fifala ha Bophirima. (D) Lisele tse fetisitsoeng tsa HEK 293 tse fetotsoeng li ile tsa tšoaroa ka li-quinpirole mme li-anti-GFP immunoprecipitates li ile tsa hlahlojoa ka ho thibeloa ha Bophirimela ka li-anti-GFP le anti-pS321 antibodies. Open arrowhead e bontša matšoao a nonspecific a tsoang ho anti-GFP immunoprecipitates.
doi: 10.1371 / journal.pone.0084482.g002
Cdk5 / p35 Complex le DRD2 li Kopantsoe 'meleng
Re fuputse tšebelisano e ka bang teng lipakeng tsa setlamo sa Cdk5 / p35 le DRD2 hobane li-subdates tse ngata tsa Cdk5 li tsejoa li amana ka botlalo le Cdk5 / p35 [23], [34], [35]. Taba ea pele, ho ile ha etsoa liteko tsa GST. Protheine e hloekisitsoeng e kopantsoeng ea GST-D2i3 e ne e entsoe ka lysate ea bongoaneng le li-preipitates tsa GST tse ileng tsa hlahlojoa bakeng sa ho thibeloa ha Bophirima. Joalokaha ho bontšitsoe Setšoantšo sa 3A, endo native Cdk5 le p35 li ile tsa bonoa sebakeng se hulang-tlase, se bontšang tšebelisano ea 'mele lipakeng tsa DRD2 le Cdk5 / p35 (Setšoantšo sa 3A). Ho feta moo, HA-Cdk5 le p35 li ile tsa fumanoa li-immunoprecipitates tse khahlanong le GFP tse tsoang li-lysates tsa sele ea HEK 293 tse hlalosang DRD2-GFP le Cdk5 / p35 (Setšoantšo sa 3B). Ntle le moo, re entse tlhahlobo ea immunocytochemical mme re hlokometse hore DRD2-GFP, HA-Cdk5 le p35 li bonts'a matšoao a bohlokoa a kopanetsoeng ho tsa lehae sebakeng sa membranous sa lisele tsa HEK 293 (Setšoantšo sa 3C, liphanele tse holimo). Re boetse ra etsa lipatlisiso tsa co-localization ea DRD2 le Cdk5 / p35 maemong a methapo ea kutlo. Nako le nako, DRD2-GFP e boetse e bonts'itse ts'ebelisano e kholo ea ts'ebelisano 'moho le endo native Cdk5 le p35 ho cultured striatal neurons (DIV7), e ts'ehetsang maqhama a tšehelitsoeng pakeng tsa DRD2 le Cdk5 / p35 (Setšoantšo sa 3C, liphanele tse ka tlase). Liphetho li bonts'a hore DRD2 le Cdk5 / p35 e ka theha mofuta o rarahaneng, ka hona, ba tšehetsa taba ea hore DRD2 ke karoloana ea 'mele ea Cdk5.
Setšoantšo sa 3. Cdk5 / p35 e ka theha mochine o nang le DRD2.
(A) GST e hulang mochini o sebelisa protheine e hloekisitsoeng ea GST-D2i3 e nang le boko ba rat. Li-precipitate tsa GST tse theotsoeng tlase li ile tsa etsoa tlhahlobisong ea bophirima ea bophirima. 'Bead' e bonts'a ho thella ha pula ntle le liprotheine tsa GST. (B) Immunoprecipitation ea DRD2 le Cdk5 / p35. Anti-GFP IP e tsoang lysates tse tsoang liseleng tse fetotsoeng e ile ea etsoa tlhahlobisong ea Bophirima ea Western. Bracket e bonts'a matšoao a DRD2 mme motsu o otlolohileng o bonts'a matšoao a senang maikutlo a tsoang ho li-immunoprecipitates tsa anti-GFP. Ho na le letheba le tlotsitsoeng ka mokhoa o pharaletseng bakeng sa lintho tse kenyellelitsoeng. (C) Litlhahlobo tsa immunocytochemical tsa DRD2 le Cdk5 / p35. Lisele tsa HEK 293 tse hlalosang DRD2-GFP le Cdk5 / p35 li ne li entsoe ka li-anti-Cdk5 le li-anti-pods tsa anti-p35 (liphanele tsa Upper). DRD2-GFP e hlahisitsoe e le 'ngoe ka har'a li-neurons tsa "criured" tsa striatal mme e entsoe ka li-anti-Cdk5 le anti-p35 antibodies (Lower panels). Hoechst e ne e sebelisetsoa ho etsa lits'oants'o tsa methapo. Bara e boholo ke 5 µm. Litšoantšo tsohle li fumanoe li sebelisoa ka li-microscopy tsa sephiri (Olympus, FluoView-1000).
doi: 10.1371 / journal.pone.0084482.g003
Phdph5-Mediated Phosphorylation ea DRD2 Attenuates Receptor Activity
Ho tlalehiloe hore phosphorylation e hlophisa thepa ea bohlokoa ea GPCR joalo ka protheine ea G, ho kenella kahare ho receptor, intracellular, le ho ikamahanya le liprotheine tsa modulator. [9], [11], [24]. Agonist-indied receptor Internation ke mokhoa oa bohlokoa oa taolo ea phetiso ea matšoao. Re fuputse phetiso ea Cdk5-mediated moduction ea li-internalised tsa DRD2. Lisele tsa HEK 293 tse hlalosang DRD2-GFP le DRD2 S321A-GFP kapa ntle le Cdk5 / p35 li ne li entsoe ka 1 µM quinpirole ho susumetsa ho kenella ha Agonist-ho hlohlelletsoa ha DRD2 (Setšoantšo sa 4A). [3Lipontšo tsa H] -piperone tsa lisele tse hlalosang tsa DRD2-GFP li ile tsa fokotsoa haholo kalafong ea 30 min quinpirole mme tsa hlaphoheloa ho 90 min. Ho khahlisang, [3Lipontšo tsa H] -piperone tsa DRD2-GFP le Cdk5 / p35 lisele tse hlalosang le tsona li ile tsa fokotsoa kalafong ea XinUMX min quinpirole empa ha lia ka tsa hlaphoheloa ho 30 min (Setšoantšo sa 4A, karolo ea bobeli). Ka hlakoreng le leng, [3H] - Lipontšo tsa Spiperone tsa lisele tse hlalosang tsa DRD2 S321A-GFP li ile tsa fokotsoa ho 30 min mme tsa hlaphoheloa ho 90 min, ho sa tsotellanoe tšebelisano-mmoho le Cdk5 / p35. Boithuto ba nakong e fetileng bo bonts'itse hore bokhoni ba ka hare ba DRD2 bo khutlisetsa membrane ea plasma holim'a ts'usumetso e telele ea agonist [11]. Thus ho bonahala eka Cdk5-Mediated phosphorylation ea DRD2 e ameha lits'ebetsong tsa phetisetso ea ts'ebetso e latelang ho kenella ka hare ho agonist-induction DRD2 Internation.
Setšoantšo sa 4. Cdk5-Mediated phosphorylation e bonts'a polelo ea holimo ea DRD2 le ho tšoaea liphororo.
(A) DRD2 polelo ea lefatše e lekantsoeng ke [3H] -piperone e tlamang. Lisele tse fetotsoeng tsa HEK293 li ile tsa susumetsoa ka quinpirole ea 1 µM bakeng sa nako e boletsoeng 'me ea kotuloa, ea lateloa ke 3 nM [3H] -spiperone kalafo ea 3 h. Mahlaseli a kotsi a ile a metoa 'me ha baloa matšoao a holim'a metsi. Mekoallo ea liphoso e emela ± SE (n = 8; * p <0.05, ** p <0.01; ANOVA ea tsela e le 'ngoe e nang le Dunnett post hoc test: bapisa likholomo tsohle vs. kholomo ea taolo). (B) [35S] -GTPγS e tlamang Likarolo tsa lisele li ne li hlophisitsoe ho tloha lisele tse fetisitsoeng joalokaha ho bontšitsoe. Litokisetso tsa Membrane li ne li entsoe ka 1 µM quinpirole e lateloang ke 3 nM [35S] -GTPγS bakeng sa 90 min. Mekoallo ea liphoso e emela ± SE (n = 8; * p <0.05, ** p <0.01, *** p <0.001; ANOVA ea tsela e le 'ngoe le tlhahlobo ea Bonferroni post hoc: bapisa lipara tsohle tsa likholomo). (C) Tlholisano ea Quinpirole [3H] -piperone e tlamang. Litokisetso tsa Membrane tse tsoang lisele tse fetisitsoeng li ne li entsoe ka 0.01 nM [3H] -spiperone le likhahla tse ntseng li eketseha tsa quinpirole bakeng sa 30 min. Phetolo e seng molaong e fumanoe ke GraphPad. Mekoallo ea liphoso e supa ± SE (n = 3). (D) li-enzyme tsa enzyme immunoassays ka lisele tse fetisitsoeng tsa HEK 293. Lisele tse fetisitsoeng li ile tsa etsoa pele ka 10 µM rolipram bakeng sa hora e le 'ngoe,' me hamorao tsa phekoloa ka 1 0.1M forskolin le ho eketsa likhakanyo tsa quinpirole bakeng sa 30 min. Phetolo e seng molaong e fumanoe ke GraphPad. Mekoallo ea liphoso e emela ± SE (n = 4; ** p <0.01; two-tailed t-liteko). (E) Cultured striatal neurons e tsoang ho mofuta oa hlaha le p35 Knoutout embryos (DIV 7) li ile tsa alafshoa ka 10 µM rolipram bakeng sa 1 h e lateloe ke 1 µM dopamine bakeng sa 1 h. Lithapo tsa liphoso li emela "± SE (n = 4; **p<0.01; e mehatla e 'meli t-liteko).
doi: 10.1371 / journal.pone.0084482.g004
Re boetse re lekotse phetoho e ka bang teng lipakeng tsa protheine ea agonist-e susumetsoang ke GD2 e amanang le phosphorylation ea Cdk5-Mediated35S] -GTPγS e tlamang [25], [26]. DRD2-GFP le DRD2 S321A-GFP e nang le Cdk5 / p35 e hlahisitsoe ka lisele tsa HEK 293. Li-membranes li ne li lokisitsoe li bile li susumetsoa ka quinpirole ea 1 µM mme li lumelletsoe hape [35S] -GTPγHo kenella. DRD2-GFP le Cdk5 / p35 e hlahisang membrane ea sele e bonts'a ho senyeha haholo [35S] -GTPγHo tlama ho bapisoa le lisele tse ling tsohle tsa sele (Setšoantšo sa 4B). Liphetho tsena li bontša hore phofo ea Cdk5-Mediated phosphorylation e tlase-e laola li-protein tsa "agonist-tse susumetsoang" tsa DRD2.
Ho feta moo, tlholisano ea quinpirole [3H] -piperone e tlamang e ile ea etsoa ho fuputsa phetoho efe kapa efe e ka bang teng ho agonist-affity ho DRD2 ke Cdk5-Mediated phosphorylation. Tlholisano e tlamang ea [3H] -piperone holim 'a kalafo ea ho ho tsepamisa mohopolo ha quinpirole ho lokisoa ha membrane ho tloha phetoho e ile ea lekanngoa. Tlholisano ea tlholisano ea quinpirole le [3H] -piperone ho DRD2-GFP le DRD2 S321A-GFP e entse logK e tšoanangi boleng (−9.789 bakeng sa DRD2-GFP; −9.691 bakeng sa DRD2 S321A-GFP), e bonts'a hore kamano ea ligand ho DRD2 ha e anngoe haholo ke Cdk5-Mediated phosphorylation ho DRD2 (Setšoantšo sa 4C).
Cdk5-Mediated Phosphorylation Down-e laola IDD2-cAMP Signaling Pathway
Ka mor'a moo, re fuputse hore na ho fetoloa ha DRD2 ke Cdk5 ho ama tsela e tšoaeang liphororo. Re hlokometse ts'ebetso ea DRD2-Mediated inhibition ea forskolin-e susumetsang tlhahiso ea cAMP ka lisele tsa adenylyl ka har'a lisele tse hlalosang DRD2-GFP le DRD2 S321A-GFP re sebelisa cAMP enzyme immunoassay. Lisele tse hlalosang tsa DRD2 li bontsitse litekanyetso tsa cAMP li fokotsehile ka karabelo ea quinpirole ka mokhoa o itšetlehileng ka tekanyetso. Ho makatsang ke hore, tšebelisano-'moho ea Cdk5 / p35 e fokotsehile haholo thibelo e kholo ea sebopeho sa cAMP (Feiga. 4D, phanele e siiloeng). Ka lehlakoreng le leng, liseleng tse hlalosang tsa DRD2 S321A-GFP, mekhoa ea cAMP e ne e thibetsoe ka nepo ho arabela kalafo ea quinpirole ho sa tsotelehe polelo ea Cdk5 / p35 (Feiga. 4D, phanele e nepahetseng). Liphetho tsena li bontša hore phofo ea Cdk5-Mediated phosphorylation ea DRD2 e bonts'a ts'ebetso ea inhibitory ea DRD2 tseleng e tlase ea CAMP e bontšang tsela. Ho netefatsa liketsahalo tsena ka nepo e loketseng boemo ba 'mele, re sebelisitse li-neurons tsa mantlha tse tsoang ho li-emboutos tse haelloang ke p35, activator ea bohlokoa ea Cdk5. Li-neurons tsa "criured striatal neurons" li ile tsa phekoloa ka 1 µM dopamine mme tsa hlahlojoa ke cAMP enzyme immunoassay. Li-Neurons tse tsoang ho p35 li -outout tsa litoeba tse bonts'itsoeng li fokotsitse maemo a cAMP ha a bapisoa le li-neurons tsa mofuta o hlaha ha li hlohlona le dopamine (Setšoantšo sa 4E). Thammoho, re ile ra fihlela qeto ea hore Cdk5-mediated phosphorylation ea DRD2 e baka ho fokotseha ha molumo oa thibelo tseleng ea CAMP e hlahisitsoeng ke DRD2.
Puisano
Re khethile DRD2 e le karoloana e ncha ea Cdk5. Phosphorylation e bonahala e le tlase-e laola boemo ba sebopeho sa DRD2 ka ho ama pheletso ea DRD2 kamora ho amohela kahare kahare ka tsela eo ka hona ho fokotsa DRD2 Gi-coupling le tsela e tlase ea CAMP. Ha masala a phosphorylation S321 a le teng ka bobeli ho DRD2 nako e telele le e khuts'oane ea isoforms, mochine o hlahisitsoeng thutong ena e ka ba mokhoa o akaretsang oa taolo ho DRD2-Mediated signaling.
DRD2 ka li-spiny neurons tse mahareng ha e nkuoe feela e le karolo e kholo ea dopamine receptor subtype empa e boetse e ananetsoe ka lebaka la ts'ebetso ea eona ea liphetoho tse fumanehang mabapi le ts'usumetso ea tikoloho. Takatso ea takatso le boiphetetso ba Agonist tse theotsoeng Agonist le lipatlisiso tse entsoeng bocha tsa DRD2 li ithutile haholo [11], [24]. Haholo-holo, lithuto tse 'maloa li bontšitse hore litlamorao tsa ho pepeseha hoa psychostimulant e sa foleng, joalo ka cocaine le amphetamine, tse phahamisang boemo ba dopamine bo kantle ho phetoho ea methapo ea methapo, li tsamaisana le liphetoho tse matla tsa litsoalo tsa DRD2 postynaptically [36]. Ho joalo, basebelisi ba koae ba sa foleng ba tsejoa ba fokotse litekanyetso tsa DRD2 sebakeng sa striatal, mme ho fumaneha ha DRD2 sebakeng sa li-nucleus accumbens (NAcc) ho supa kamano e mpe le ts'ebeliso ea lithethefatsi le boits'oaro bo matlafatsang litoeba le litloholo. [37]-[39]. Liphumano tsena li bonts'a hore ts'ebetso ea DRD2 e kotsing e kholo ea ho feto-fetoha ha melaoana e lumellanang kapa e lumellanang le ts'usumetso ea maikutlo a fapaneng a kenyelletsang ho pepesoa ha lithethefatsi tse sa foleng. Liphetho tsa rona li bonts'a hore masala a S321 kahare ho karolo ea boraro ea methapo ea DRD2 a ka phosphorylated ke Cdk5, e lebisang ho fokotseha hoa tšusumetso ea inhibitory ea DRD2 tseleng ea cAMP. Ts'ebelisano ena e fana ka maikutlo a mokhoa oa taolo o hlophisitsoeng o amanang le Cdk5 ho li-dopaminocepts neurons tse ka amanang le sebopeho se matla sa ho fumaneha ha lefats'e la DRD2.
Re lokela ho hlokomela hore Cdk5 e tsejoa e le karolo ea bohlokoa ho arolelanang liphetoho tse feto-fetohang tikolohong ea neuronal. Mohlala, liphetoho tse sebetsang tsa tšebetso ea methapo ea methapo methapong ea methapo ea kutlo ke e 'ngoe ea litlamorao tsa ho pepeseha hoa psychostimulant khafetsa. [40]. Liphetoho tsena li tsamaisana le liphetoho tse fapaneng tsa limolek'hule ho kenyelletsa tlhahiso ea protheine e tlamang cAMP (CREB) le ΔFosB, lintlha tse bonts'ang ts'ebetso e tsitsitseng mabapi le taolo ea koae e sa foleng. [41], [42]. Habohlokoa, Cdk5 ke sepheo sa ΔFosB [19], le likarolo tse ngata tse mahlonoko tse kenyellelitsoeng ho dendritic spine dynamics, joalo ka PSD-95, p21-activated kinase (PAK), β-catenin, le spinophilin, li tlalehiloe e le li-subdates tsa Cdk5 [43]-[46]. Nako le nako, manolo a liphatsa tsa lefutso kapa a mahlale a Cdk5 a etsa liphetoho tsa dendritic spine morphology le boits'oaro ba boitšoaro ho cocaine, e bolelang likarolo tse bohlokoa tsa Cdk5 phetohong ea limolek'hule le morphological ea mesolimbic dopamine circuits [47], [48]. Liphetho tsa rona tse bonts'ang hore DRD2 ke sepheo sa nalane ea Cdk5 e fana ka leseli le tlatselletso mabapi le liphetoho tse feto-fetohang tsa dopamine tsamaisong ea tlhahiso ea lithethefatsi tse sa feleng ka lebaka la morao-rao ΔFosB-Mediated up-regulation of Cdk5 . Ntle le moo, DRD2 e tsejoa ho ama mekhoa e mengata ea selefounu, ho kenyelletsa taolo ea cAMP le MAP kinase pathways le liketsahalo tse tlase tsa mongolo [42], [49]. Kahoo, lintlha tse fumanoeng thutong ena li ka 'na tsa se hlahise feela taelo e tobileng ea DRD2 ke Cdk5 empa hape e fana ka leseli la karabo mabapi le likarabo tse lumellanang tsa sistimi ea dopamine ho pepesehela lithethefatsi ho sa feleng.
Menehelo ea Mongoli
O tseba le ho rala liteko: JJ YUP DH SKP. O entse liteko: JJ YUP DKK YK. Ho hlahlobisisa data: JJ YUP DKK SL YK SAL HL YSG DH SKP. Li-reagents tse kentsoeng / lisebelisoa / lisebelisoa tsa tlhahlobo: YHS. O ngotse pampiri: JJ SKP.
References
- 1. Li-missale C, Nash SR, Robinson SW, Jaber M, Caron MG (1998) Dopamine receptors: ho tloha sebopeho ho sebetsa. Physiol Rev 78: 189-225.
- 2. Wise RA (2002) Bry potoloho ea moputso: lintlha tse tsoang litsing tse khothatsang. Neuron 36: 229-240. doi: 10.1016 / s0896-6273 (02) 00965-0
- Sheba Article
- PubMed / NCBI
- Google Setsebi
- Sheba Article
- PubMed / NCBI
- Google Setsebi
- Sheba Article
- PubMed / NCBI
- Google Setsebi
- Sheba Article
- PubMed / NCBI
- Google Setsebi
- Sheba Article
- PubMed / NCBI
- Google Setsebi
- Sheba Article
- PubMed / NCBI
- Google Setsebi
- Sheba Article
- PubMed / NCBI
- Google Setsebi
- Sheba Article
- PubMed / NCBI
- Google Setsebi
- Sheba Article
- PubMed / NCBI
- Google Setsebi
- Sheba Article
- PubMed / NCBI
- Google Setsebi
- Sheba Article
- PubMed / NCBI
- Google Setsebi
- Sheba Article
- PubMed / NCBI
- Google Setsebi
- Sheba Article
- PubMed / NCBI
- Google Setsebi
- Sheba Article
- PubMed / NCBI
- Google Setsebi
- Sheba Article
- PubMed / NCBI
- Google Setsebi
- Sheba Article
- PubMed / NCBI
- Google Setsebi
- Sheba Article
- PubMed / NCBI
- Google Setsebi
- Sheba Article
- PubMed / NCBI
- Google Setsebi
- Sheba Article
- PubMed / NCBI
- Google Setsebi
- Sheba Article
- PubMed / NCBI
- Google Setsebi
- Sheba Article
- PubMed / NCBI
- Google Setsebi
- Sheba Article
- PubMed / NCBI
- Google Setsebi
- Sheba Article
- PubMed / NCBI
- Google Setsebi
- Sheba Article
- PubMed / NCBI
- Google Setsebi
- Sheba Article
- PubMed / NCBI
- Google Setsebi
- Sheba Article
- PubMed / NCBI
- Google Setsebi
- Sheba Article
- PubMed / NCBI
- Google Setsebi
- Sheba Article
- PubMed / NCBI
- Google Setsebi
- Sheba Article
- PubMed / NCBI
- Google Setsebi
- Sheba Article
- PubMed / NCBI
- Google Setsebi
- Sheba Article
- PubMed / NCBI
- Google Setsebi
- Sheba Article
- PubMed / NCBI
- Google Setsebi
- Sheba Article
- PubMed / NCBI
- Google Setsebi
- Sheba Article
- PubMed / NCBI
- Google Setsebi
- Sheba Article
- PubMed / NCBI
- Google Setsebi
- Sheba Article
- PubMed / NCBI
- Google Setsebi
- Sheba Article
- PubMed / NCBI
- Google Setsebi
- Sheba Article
- PubMed / NCBI
- Google Setsebi
- Sheba Article
- PubMed / NCBI
- Google Setsebi
- Sheba Article
- PubMed / NCBI
- Google Setsebi
- Sheba Article
- PubMed / NCBI
- Google Setsebi
- Sheba Article
- PubMed / NCBI
- Google Setsebi
- Sheba Article
- PubMed / NCBI
- Google Setsebi
- Sheba Article
- PubMed / NCBI
- Google Setsebi
- Sheba Article
- PubMed / NCBI
- Google Setsebi
- Sheba Article
- PubMed / NCBI
- Google Setsebi
- Sheba Article
- PubMed / NCBI
- Google Setsebi
- 3. Neve KA, Seamans JK, Trantham-Davidson H (2004) Dopamine receptor signaling. J Recept Signal Transduct Res 24: 165-205. Doi: 10.1081 / lrst-200029981
- 4. Amar S, Shaltiel G, Mann L, Shamir A, Dean B, et al. (2008) Ho kenyelletsa ho nka karolo ha li-post-dopamine D2 receptor signature ho pathophysiology ea schizophrenia. Int J Neuropsychopharmacol 11: 197-205. Doi: 10.1017 / s1461145707007948
- 5. Caine SB, Negus SS, Mello NK, Patel S, Bristow L, et al. (2002) Karolo ea li-receptor tsa dopamine D2-liketsong tsa koae: ho ithutoa le litoeba tsa D2 receptor mutant mutice le nova ea D2 receptor antagonists. J Neurosci 22: 2977-2988.
- 6. Lee S, Jeong J, Park YU, Kwak Y, Lee SA, et al. (2012) Alproate alter dopamine signaling e kopantsoeng le tlhahiso ea polelo ea protheine ea Par-4. PloS One 7: e45618. Doi: 10.1371 / journal.pone.0045618
- 7. Fishburn CS, Elazar Z, Fuchs S (1995) phapang e khethollang glycosylation le ho ts'oaroa ho ts'oarellang ha nako e telele le ho khuts'oane ha isoforms ea D2 dopamine receptor. J Biol Chem 270: 29819-29824. Doi: 10.1074 / jbc.270.50.29819
- 8. Reader TA, Molina-Holgado E, Lima L, Boulianne S, Dewar KM (1992) E tobileng [3H] raclopride e tlamang ho li-receptor tsa neostriatal dopamine D2: karolo ea discride le lihlopha tsa sulfhydryl. Neurochem Res 17: 749-759. Doi: 10.1007 / bf00969008
- 9. Ng GY, O'Dowd BF, Caron M, Dennis M, Brann MR, et al. (1994) Phosphorylation le Palmitoylation ea motho ea D2L dopamine receptor liseleng tsa Sf9. J Neurochem 63: 1589-1595. Doi: 10.1046 / j.1471-4159.1994.63051589.x
- 10. Li M, Bermak JC, Wang ZW, Zhou QY (2000) Modulation of dopamine D (2) receptor signaling by protein-binding protein (ABP-280). Mol Pharmacol 57: 446-452.
- 11. Cho D, Zheng M, Min C, Ma L, Kurose H, et al. (2010) endocytosis e kenyellelitsoeng ke "agonist-induction endocytosis" le "receptor phosphorylation" e sebelisang li-receptor tsa dopamine D (2). Mol Endocrinol 24: 574-586. Doi: 10.1210 / me.2009-0369
- 12. Tsai LH, Delalle I, Caviness VS Jr, Chae T, Harlow E (1994) p35 ke tsamaiso ea taolo e ikhethileng ea neural e tobileng ea cyclin-inaseaseaseaseasease. Nature 5: 371-419. Doi: 423 / 10.1038a371419
- 13. Dhavan R, Tsai LH (2001) Lilemo tse leshome tsa CDK5. Nat Rev Mol Cell Biol 2: 749-759. Doi: 10.1038 / 35096019
- 14. Fu AK, Ip NY (2007) cyclin-based kinase 5 e hokahanya lintlha tse tsoang kantle ho li-actin cytoskeleton nakong ea nts'etsopele ea lesapo la mokokotlo. Cell Adh Migr 1: 110-112. Doi: 10.4161 / cam.1.2.4617
- 15. Wang J, Liu S, Fu Y, Wang JH, Lu Y (2003) Cdk5 activation induces hippocampal CA1 cell shoa ka ho toba li-receptor tsa NMDA ka kotloloho. Nat Neurosci 6: 1039-1047. Doi: 10.1038 / nn1119
- 16. Zhang S, Edelmann L, Liu J, Crandall JE, Morabito MA (2008) Cdk5 e laola phosphorylation ea tyrosine 1472 NR2B le sebopeho sa li-receptor tsa NMDA. J Neurosci 28: 415-424. Doi: 10.1523 / jneurosci.1900-07.2008
- 17. Moy LY, Tsai LH (2004) physphorylates serine 5 ea serine 31 ea tyrosine hydroxylase mme e laola botsitso ba eona. J Biol Chem 279: 54487-54493. Doi: 10.1074 / jbc.m406636200
- 18. Bibb JA, Snyder GL, Nishi A, Yan Z, Meijer L, et al. (1999) Phosphorylation ea DARPP-32 ka Cdk5 modulates dopamine signaling in neurons. Nature 402: 669-671.
- 19. Bibb JA, Chen J, Taylor JR, Svenningsson P, Nishi A, et al. (2001) Liphello tsa ho pepesetsoa ha koae e sa laoleheng li laoloa ke protheine ea neuronal Cdk5. Nature 410: 376-380.
- 20. Ohshima T, Ogawa M, Veeranna, Hirasawa M, Longenecker G, et al. (2001) Likabelo tsa Synergistic tsa cyclin-based kinase 5 / p35 le Reelin / Dab1 maemong a li-neuron tsa cortical bokong ba mouse bo ntseng bo hola. Proc Natl Acad Sci USA 98: 2764-2769. Doi: 10.1073 / pnas.051628498
- 21. Morabito MA, Sheng M, Tsai LH (2004) physphorylates ea cyclin-e itšetlehileng ka cyclin-phosphorylates N-terminal domain name ea postynaptic density protein PSD-5 in neurons. J Neurosci 95: 24-865. Doi: 876 / jneurosci.10.1523-4582
- 22. Park SK, Nguyen MD, Fischer A, Luke MP, Affar el B, et al. (2005) Par-4 e hokahanya matšoao a dopamine le khatello ea maikutlo. Cell 122: 275-287. Doi: 10.1016 / j.cell.2005.05.031
- 23. Niethammer M, Smith DS, Ayala R, Peng J, Ko J, et al. (2000) NUDEL ke palese e ncha ea Cdk5 e amanang le LIS1 le cytoplasmic dynein. Neuron 28: 697-711. doi: 10.1016 / s0896-6273 (00) 00147-1
- 24. Kim KM, Valenzano KJ, Robinson SR, Yao WD, Barak LS, et al. (2001) Phapang e fapaneng ea taolo ea dopamine D2 le li-D3 li-receptor ke G protein-coupled receptor kinases le beta-bindins. J Biol Chem 276: 37409-37414. Doi: 10.1074 / jbc.m106728200
- 25. Waldhoer M, Bofill-Cardona E, Milligan G, Freissmuth M, Nanoff C (1998) Phapang e sa khethollang ea A1 adenosine le D2 dopamine receptors ka suramin le suramin le didemethylated (NF037). Mol Pharmacol 53: 808-818.
- 26. Bofill-Cardona E, Kudlacek O, Yang Q, Ahorn H, Freissmuth M, et al. (2000) Ho tlangoa ha "choleodulin" ho D2-dopamine receptor ho fokotsa ho sa sebetse ha "cell protheine activation". J Biol Chem 275: 32672-32680. Doi: 10.1074 / jbc.m002780200
- 27. Lenane SJ, Seeman P (1981) Qeto ea dopamine le likarolo tsa li-receptor tsa serotonin tsa [3H] spiperone e tlamang ho lekola libaka tsa boko. Proc Natl Acad Sci USA 78: 2620-2624. Doi: 10.1073 / pnas.78.4.2620
- 28. Gardner B, Strange PG (1998) Ketso ea Agonist ho D2 (e telele) dopamine receptors: ligand e tlamang le e sebetsang. Br J Pharmacol 124: 978-984. Doi: 10.1038 / sj.bjp.0701926
- 29. Seeman P, Tallerico T, Ko F (2003) Dopamine libaka tsa maqhubu [3H] domperidone tse tsoang libakeng tse phahameng tsa tumellano ea dopamine D2 receptor, empa eseng [3H] raclopride kapa [3H] spiperone in isotonic medium: Liphetho tsa tsamaiso ea batho ea positron. Synfall 49: 209-215. Doi: 10.1002 / syn.10232
- 30. Obenauer JC, Cantley LC, Yaffe MB (2003) Scansite 2.0: Bophatlalatsi bo bongata ba phallo ea lisele tse sebelisang mela e mokhuts'oanyane e latellanang. Nucleic Acids Res 31: 3635-3641. Doi: 10.1093 / nar / gkg584
- 31. Liu H, Sadygov RG, Yates JR 3rd (2004) Mohlala oa sampole e sa reroang le khakanyo ea bongata ba liprotheine tse ngata liprotheiniking tsa shotgun. Anal Chem 76: 4193-4201. Doi: 10.1021 / ac0498563
- 32. Ito K, Haga T, Lameh J, Sadee W (1999) Ho latellana ha li-receptor tsa dopamine D2 ho latela coexpression ea li-receptor tsa G-protein-coupled receptor kinases 2 kapa 5. Euro J Biochem 260: 112-119. Doi: 10.1046 / j.1432-1327.1999.00125.x
- 33. Namkung Y, Sibley DR (2004) Protein kinase C mediates phosphorylation, desensitization, and trailer of D2 dopamine receptor. J Biol Chem 279: 49533-49541. Doi: 10.1074 / jbc.m408319200
- 34. Wong AS, Lee RH, Cheung AY, Yeung PK, Chung SK, et al. (2011) Cdk5-Mediated phosphorylation ea endophilin B1 e hlokahala bakeng sa ho qobelloa ha autophagy mehlaleng ea lefu la Parkinson. Nat Cell Biol 13: 568-579. Doi: 10.1038 / ncb2217
- 35. Kesavapany S, Lau KF, McLoughlin DM, Brownlees J, Ackerley S, et al. (2001) p35 / cdk5 e tlama le phosphorylates beta-catenin mme e laola ts'ebelisano ea beta-catenin / presenilin-1. Euro J Neurosci 13: 241-247. Doi: 10.1046 / j.1460-9568.2001.01376.x
- 36. Kuhar MJ, Ritz MC, Boja JW (1991) Tekanyetso ea dopamine ea thepa e matlafatsang ea koae. Mekhoa ea Neurosci 14: 299-302. Doi: 10.1016 / 0166-2236 (91) 90141-g
- 37. Volkow ND, Fowler JS, Wolf AP, Scilyer D, Shiue CY, et al. (1990) Liphello tsa tlhekefetso e sa feleng ea koae ho li-receptors tsa postynaptic dopamine. Am J Psychiatry 147: 719-724.
- 38. Dalley JW, Fryer TD, Brichard L, Robinson ES, Theobald DE, et al. (2007) Li-nyutlelie tsa nyutlelie li phatlalatsa tšusumetso ea matla le ho ts'oaroa ha koae. Saense 2: 3-315. Doi: 1267 / science.1270
- 39. Nader MA, Morgan D, Gage HD, Nader SH, Calhoun TL, et al. (2006) PET imaging ea dopamine D2 receptors nakong ea boits'oaro bo sa feleng ba koae ho litšoene. Nat Neurosci 9: 1050-1056. Doi: 10.1038 / nn1737
- 40. Robinson TE, Kolb B (1997) Liphetoho tsa sebopeho tse tsoelang pele ho li-nucleus accumbens le li-neuron tsa preortal tsa cortex tse hlahisoang ke boiphihlelo bo fetileng le amphetamine. J Neurosci 17: 8491-8497.
- 41. Robinson TE, Kolb B (1999) Alterations in morphology of dendrites and dendritic spines in the nucleus accumbens le preortal ea cortex e latelang kalafo e phetoa-phetoang le amphetamine kapa cocaine. Euro J Neurosci 11: 1598-1604. Doi: 10.1046 / j.1460-9568.1999.00576.x
- 42. McClung CA, Nestler EJ (2003) Taolo ea polelo ea liphatsa tsa lefutso le moputso oa koae ka CREB le DeltaFosB. Nat Neurosci 6: 1208-1215. Doi: 10.1038 / nn1143
- 43. Feng J, Yan Z, Ferreira A, Tomizawa K, Liauw JA, et al. (2000) Spinophilin e laola sebopeho le ts'ebetso ea methapo ea methapo. Proc Natl Acad Sci USA 97: 9287-9292. Doi: 10.1073 / pnas.97.16.9287
- 44. Prange O, Murphy TH (2001) Tsamaiso ea nako le nako ea li-postynaptic density-95 lihlopha le setsoalle le metlae e tsitsitseng ea lesapo nakong ea nts'etsopele ea li-neuron tsa cortical. J Neurosci 21: 9325-9333.
- 45. Murase S, Mosser E, Schuman EM (2002) Depolarization e khanna beta-Catenin ho methapo ea methapo ea kutlo e khothalletsang liphetoho moahong le tšebetsong ea synaptic. Neuron 35: 91-105. Doi: 10.1016 / s0896-6273 (02) 00764-x
- 46. Hayashi ML, Choi SY, Rao BS, Jung HY, Lee HK, et al. (2004) Alphortic captical synaptic morphology e fetotsoeng le tšebeliso e mpe ea mohopolo bakeng sa ho itšireletsa mafung. Neuron 42: 773-787. Doi: 10.1016 / j.neuron.2004.05.003
- 47. Benavides DR, Quinn JJ, Zhong P, Hawasli AH, DiLeone RJ, et al. (2007) Cdk5 modulates moputso oa koae, tšusumetso, le striatal neuron thabo. J Neurosci 27: 12967-12976. Doi: 10.1523 / jneurosci.4061-07.2007
- 48. Meyer DA, Richer E, Benkovic SA, Hayashi K, Kansy JW, et al. (2008) dysregulation ea methapo ea li-cdk5 alters locomotor e arabela cocaine, motor ithuta, le dendritic morphology. Proc Natl Acad Sci USA 105: 18561-18566. Doi: 10.1073 / pnas.0806078105
- 49. Impey S, Obrietan K, Storm DR (1999) Ho etsa likhokahano tse ncha: karolo ea ERK / MAP kinase ho saena hoa polanete ea neuronal. Neuron 23: 11-14. doi: 10.1016 / s0896-6273 (00) 80747-3