Överuttryck av DeltaFosB i nukleinsymboler efterliknar fenomenet skyddsberoende, men inte skyddsdepressionsfenotypen för miljöanrikning (2014)

PMCID: PMC4148937

Abstrakt

Miljöanrikning producerar skyddsberoende och depression fenotyper hos råttor. ΔFosB är en transkriptionsfaktor som reglerar belöning i hjärnan och induceras av psykisk stress och missbruk. Den roll som ΔFosB spelar i de skyddande fenotyperna för miljöanrikning har dock inte studerats väl. Här visar vi att ΔFosB är differentiellt reglerad hos råttor uppfödda i ett isolerat tillstånd (IC) jämfört med de i ett berikat tillstånd (EC) som svar på spärrbelastning eller kokain.

Kronisk stress eller kronisk kokainbehandling höjer ΔFosB-proteinnivåer i nukleär accumbens (NAc) hos IC-råttor, men inte av EC-råttor på grund av en redan förhöjd basal ackumulering av FFosB sedd under EC-förhållanden.

Viralmedierad överuttryckning av ΔFosB i NAc-skalet hos parhuserade råttor (dvs. oberoende av miljöanrikning / isolering) ökar operant svarande på sackaros när det är motiverat av hunger, men minskar svara på mättade djur. Vidare minskar ΔFosB-överuttryck kokain-självadministrering, ökar utrotning av kokainsökning och minskar kokaininducerad återinställning av intravenös kokain självadministrering; alla beteendemässiga fynd som överensstämmer med berikningsfenotypen.

I motsats härmed förändrade ΔFosB-överuttryck inte svaren hos parhus-råttor i flera test av ångest- och depressionrelaterat beteende.

Således ΔFosB i NAc-skalet efterliknar fenotypen för skyddande beroende, men inte den skyddande depressionfenotypen av miljöanrikning.

Nyckelord: [ökning]FosB, miljöanrikning, depression, självkokande kokain, adenoassocierat virus (AAV), överuttryck

Beskrivning

Livserfarenhet, särskilt i de tidiga stadierna av livet, har en djupgående inverkan på djurens beteende under hela livet. Miljö spelar en viktig roll i sårbarheten och motståndet mot mentala störningar hos människor (Elisei et al., 2013; Akdeniz et al., 2014; Kato och Iwamoto, 2014; van Winkel et al., 2014). I gnagaremodeller rapporterades att de levde i en berikad miljö från avvänjning genom ung vuxen ålder producera skyddsberoende och depression fenotyper (Green et al., 2002, 2003, 2010; Laviola et al., 2008; Solinas et al., 2008, 2009; El Rawas et al., 2009; Thiel et al., 2009, 2010). I det här paradigmet tilldelas djur antingen ett berikat tillstånd (EG) där djur är grupphus och har daglig tillgång till nya föremål, eller ett isolerat tillstånd (IC), där djur är ensamma inrymda utan nyhet eller social kontakt. Djur som odlas i berikat tillstånd, som inkluderar social kontakt, övning och nyhet, uppvisar mindre förstärkning och sökande av kokain eller amfetamin i det intravenösa läkemedlets självadministrationsparadigm (Green et al., 2002, 2010). Förutom beroendefenotypen ger sådan exponering för anrikning en antidepressiv-liknande effekt i djurmodeller av depression (Green et al., 2010; Jha et al., 2011). Specifikt uppvisar berikade djur minskat anhedonikniknande beteende i sackarospreferensprovet, mindre socialt tillbakadragande i ett socialt interaktionstest och mindre obeveklighet i det tvångsvimmade testet (FST). Trots de anti-beroende och antidepressiva effekterna av anrikning förblir mekanismerna som ligger till grund för dessa skyddande fenotyper för miljöanrikning okomplicerad, även om vår tidigare forskning har medfört en roll för minskad aktivitet hos transkriptionsfaktorn CREB i nukleär accumbens (NAc ) för att förmedla några av effekterna av miljöanrikning (Green et al., 2010; Larson et al., 2011). Sålunda är målet med dessa differentialstudier att använda en grundläggande vetenskaplig metod för att identifiera molekylära mekanismer av motståndskraft som senare kan översättas till kliniken. Detta tillvägagångssätt är miljökvivalenten med väl etablerade genetiska strategier, såsom selektiv uppfödning (McBride et al., 2014).

Här fokuserar vi på en annan transkriptionsfaktor, ΔFosB, som induceras framträdande i NAc genom vissa former av stress eller av nästan alla missbruksmedel, inklusive kokain, morfin, alkohol, nikotin och amfetamin (Hope et al., 1992; Kelz och Nestler, 2000; Perrotti et al., 2004, 2008). Som en transkriptionsfaktor dimmerar ΔFosB med Jun-familjeproteiner, företrädesvis JunD, för att bilda ett aktivt AP-1-komplex som binder till AP-1-responselementet för att förbättra eller undertrycka transkriptionen av dess målgener (Nestler, 2001), även om ny forskning föreslår att ΔFosB också kan fungera som en homodimer (Wang et al., 2012). ΔFosB-proteinet är en trunkerad splitsvariation av FosB genen, vilket gör att ΔFosB-proteinet saknar två C-terminala degron-domäner, vilket förhindrar ΔFosB-proteinet från den snabba nedbrytningen som ses med FosB och alla andra Fos-familjeproteiner. Eftersom ΔFosB är utomordentligt stabil i NAc, fungerar AFosB väldigt annorlunda som svar på akut vs kronisk stimuli jämfört med andra Fos-proteiner. Vid upprepad exponering för droger eller missbruk av ΔFosB-protein ackumuleras och förblir gradvis i dagar till veckor, medan FosB och andra Fos-proteiner induceras endast under kort tid (timmar) och utvecklar en försvagad induktion vid efterföljande exponering (Nestler et al. 2001; Nestler, 2008).

Betydelsen av ΔFosB är inte bara att den är starkt inducerad av missbruk och stressmissbruk, men att manipulation av ΔFosB i hjärnan har visat sig påverka djurens beteende. Selektivt inducerande ΔFosB i dynorfinmediet ökar spinyauroner hos vuxna möss i stället för akut och upprepad kokain, liksom de givande svaren på kokain i det konditionerade platspreferensparadigmet och förstärkning i självadministrationsparadigmet (Kelz et al., 1999; Kelz och Nestler, 2000; Colby et al., 2003).

Även om skyddsberoende och depression fenotyper har beskrivits i detalj för miljömässigt berikade råttor, har en möjlig roll för ΔFosB för att mediera dessa skyddande fenotyper inte utvärderats fullständigt. Tidigare studier av miljöanrikning visade att en berikad miljö jämfört med standardmiljön (SE) ökar basala FosB-nivåer i både D1- och D2-mediumspina neuroner av striatala regioner i möss (Solinas et al., 2009; Lobo et al., 2013). Dessutom visade berikade Wistar-råttor ökade ΔFosB-positiva celler i NAc och prefrontal cortex jämfört med SE-råttor, vilket föreslog en möjlig roll av FFB i skyddsberoende fenotypen mot nikotin (Venebra-Muñoz et al., 2014). Vidare ökar överuttryck av ΔFosB genom musens striatum ökar daglig körning, vilket kan vara analogt med den ökade aktiviteten hos råttor i en berikad miljö (Werme et al., 2002).

I den aktuella studien antog vi att: (1) miljöanrikning skulle öka ackumuleringen av basala FosB-nivåer i NAc; och (2) skulle denna ackumulering av ΔFosB bidra till de skyddande effekterna av miljöanrikning.

Material och metoder

djur

För miljöanrikning tilldelades manliga Sprague-Dawley-råttor (Harlan, Houston, TX, USA) slumpmässigt till antingen EC eller IC-hus från postnatal dag 21 till dag 51. EC-råttor var grupphus (20 per bur) i en stor metallbur (70 × 70 × 70 cm) med flera hårda plastobjekt (barnleksaker, plastbehållare, PVC-rör etc.). Dessa objekt ersattes med nya objekt och omordnades till en ny konfiguration dagligen. IC-råttor hölls enstaka i standardpolykarbonatburar. Råttor kvarstod under dessa betingelser under experimenten och alla beteendestest och biokemiska tester började efter 51-åldersdagar (dvs. minst 30-dagar för berikning / isolering). För överexpression av ΔFosB rades Sprague-Dawley-råttor (Harlan, Houston, TX, USA), som erhållits vid storlek 225-250 g och som hålls i par i standardpolykarbonatburar innan den stereotaktiskt injicerades med en adeno-associerad viral vektor (AAV2) överuttrycker ΔFosB med grönt fluorescerande protein (GFP) eller bara GFP som kontroll (se nedan). Standard råtta och vatten var fritt tillgängliga för alla råttor utom vid beteendestest och livsmedelsreglering. Alla råttor bibehölls i en kontrollerad miljö (temperatur, 22 ° C, relativ fuktighet, 50% och 12 h ljus / mörk cykel, lyser på 600 h) i en godkännande för ackreditering av laboratorie djurvård (AAALAC) godkänd koloni . Alla experiment överensstämde med NIH Guide för vård och användning av laboratoriedjur och University of Texas Medical Branch Institutionella djurvård och användningskommitté.

Miljöberikning är en sammansatt manipulation som består av nyhet, social kontakt och motion. Parhus ger social kontakt och representerar därmed ett EG (se NIH Guide). Den lämpliga kontrollgruppen för ett tillstånd med nyhet, social kontakt och motion skulle således vara en grupp utan nyhet, social kontakt eller övning, IC-villkoret. IC-råttor visar färre tecken på kronisk stress än EG-råttor. Speciellt har EC-råttor förstorade binjurar (Mlynarik et al., 2004), trubbiga CORT-svar (Stairs et al., 2011), dämpad omedelbar tidig geninduktion (Zhang et al., manuskript i beredning) och ΔFosB-ackumulation (Solinas et al., 2009; Lobo et al., 2013), alla tecken på kronisk stress (Crofton et al., i granskning).

Psykologisk stress

Berikade och isolerade råttor placerades i engångsbehållare av mjuk plast (DecapiCone®, Braintree Scientific Inc., MA, USA) för 60-min för antingen 1-dag (akut) eller 9-dagar (upprepade). För mRNA-test med kort exponering avföddes 30-råttor (5-råttor per grupp) 30-min efter början av den sista perioden av fasthållningsspänning, råtthjärnor extraherades och NAc dissekerades för mRNA-analys. För immunhistokemi perfusioniserades 12-råttor med saltlösning och 4% paraformaldehyd, hjärnor extraherades, postfixerades i 4% paraformaldehyd och lagrades i 20% glycerol i 1xPBS vid 4 ° C. Råtthjärnor skivades på 40 μm med en frysande mikrotom. Hjärnor skördades 24 h efter den sista spänningen för att låta FosB-proteinet i full längd nedbryta (Perrotti et al., 2008).

Intravenös kokain självförvaltning med miljöanrikning

Intravenös kateterimplantation

Råttor bedövades med användning av ketamin (100 mg / kg IP) och xylazin (10 mg / kg IP) och en Silastic-kateter infördes och fästes i jugularvenen och lämnade huden på djurets rygg. Varje dag infusionerades katetrarna med 0.1 ml av en steril saltlösning innehållande heparin (30.0 U / ml), penicillin G kalium (250,000 U / ml) och streptokinas (8000 IE / ml) för att förhindra infektion och upprätthålla kateter patency under hela varaktigheten av experiment.

Kokain självadministration med miljöanrikning

Tjugo berikas och 20 isolerade råttor placerades i operant kamrar 30 × 24 × 21 cm (Med-Associates, St. Albans, VT) och fick pressa en hävstång för infusioner av kokain (0.5 mg / kg / infusion, NIDA läkemedelstillförsel, Research Triangle Institute, NC, USA) eller saltlösning under ett fast förhållande 1 (FR1) schema för 2 h per dag under totalt 14 dagar. För att upprätthålla liknande kokainintag mellan EC och IC-grupperna var det högst 30-infusioner per session. Vävnadshanteringskapaciteten var begränsad till 30-prover, så att de svagaste råttorna från varje grupp inte behandlades, vilket gav Ns av 8 för kokain och 7 för saltlösningsgrupper. Det fanns således ingen EC / IC-skillnader i totalt kokainintag eller tidsåtgång för infusioner mellan EC- och IC-råttor. Rått hjärnor extraherades 3 h efter början av den sista självadministrationssessionen och NAc dissekerades för mRNA och proteinanalys. En sida av NAc användes för Western blot, den andra sidan användes för qPCR.

Okontingent kokainadministration med miljöanrikning

För direkt jämförelse med tidigare publicerad litteratur (Hope et al., 1994; Chen et al., 1995), EG (N = 12) och IC-råttor (N = 12) injicerades med saltlösning eller 20 mg / kg kokain intraperitonealt (IP) för 1-dag (akut) eller 9-dagar (upprepad). Ett EG-prov förlorades under bearbetningen. Den akuta gruppen fick injektioner av saltlösning för 8-dagar och en injektion av kokain på dag 9 så att alla råttor fick samma antal injektioner. Hjärnor extraherades 30 min efter den sista injektionen och NAc dissekerade för mRNA-analys.

Kvantifiering av mRNA med användning av qPCR

RNA extraherades genom homogenisering i RNA STAT-60 (Teltest, Friendswood, TX), separering av RNA från DNA och protein med användning av kloroform och utfällning av det totala RNA med isopropanol. Förorenande DNA avlägsnades (TURBO DNA-Free, Life Technologies, CA, USA) och 5 ug av det renade RNA omvänt transkriberades till cDNA (SuperScript III First Strand Synthesis: Invitrogen catalog # 18080051). ΔFosB mRNA kvantifierades med användning av kvantitativ realtids-PCR (SYBR Green: Applied Biosystems, Foster City, CA) på en Applied Biosystems 7500 snabb termocykler med primers utformade för att detektera endast ΔFosB (framåt: AGGCAGAGCTGGAGTCGGAGAT; omvänd: GCCGAGGACTTGAACTTCACTCG) och normaliserades till primrar utformade att detektera råtta GAPDH (framåt: AACGACCCCTTCATTGAC; omvänd: TCCACGACATACTCAGCAC). Alla primrar validerades och analyserades för specificitet och linearitet före experiment (Alibhai et al., 2007).

Western blot

Den högra sidan av NAc från kokain eller saltlösning som självförvaltande EC- och IC-råttor homogeniserades i en buffert innehållande sackaros, Hepes-buffert, natriumfluorid, 10% SDS och proteas- och fosfatashämmare (Sigma-Aldrich: P-8340, P -2850, P-5726). Proteinkoncentrationen bedömdes med användning av Pierce BCA Protein Assay Kit (Thermo Scientific, IL, USA). Eftersom protein extraherat från en råtta inte var tillräcklig för analys, samlades 2-prover från samma grupp tillsammans och producerade 4-prover för varje grupp. Proteinprover denaturerades vid 95 ° under 5 minuter och kördes på en 10-20% polyakrylamid gradientgel (Criterion TGX, Bio-Rad Laboratories, CA, USA) överfördes sedan till en polyvinylidenfluorid (PVDF) membran (Millipore, MA, USA ). Membranet blockerades med blotting-grade blockerare (fettfri torrmjölk), inkuberades med ΔFosB primära antikroppen (kanin, 1: 1000, #2251, Cell Signaling Technology, MA, USA) och β-aktin primär antikropp (mus, 1: 1000 , Cell Signal Technology, MA, USA), tvättades med TBST och inkuberades sedan med fluorescerande sekundära antikroppar (åsna-anti-kanin (780 nm), åsnor-anti-mus (680 nm), 1: 15000, Li-Cor Biosciences, NE, USA). Western blottar avbildades sedan (Odyssey, Li-Cor Biosciences, NE, USA) och proteinhalter kvantifieras med Odyssey-mjukvaran.

immunohistokemi

För Figur Figure11 (N = 3) visualiserades celler som innehöll ΔFosB och räknades genom immunohistokemisk märkning av ΔFosB i NAc-skivor färgade med DAB (DAB peroxidas-substratsats, Vector Laboratories, CA, USA). Hjärnorna extraherades, postfixerades, kryoprotekterades och delades in i 40 ^ m-skivor innehållande NAc på en glidfrysande mikrotom (Leica Biosystems, IL, USA). Skivorna förblev flytande och sköljdes med 1xPBS innan endogena peroxidaser släcktes, före blockering med 3% normalt getserum (Jackson ImmunoResearch, PA, USA) med 0.3% triton och avidin D (Vector Laboratories, CA, USA). NAc-skivor inkuberades med FosB-primär antikropp över natten (1: 1000, Santa Cruz Biotechnology, Dallas, TX, USA) med 3% get serum, 0.3% triton, 1xPBS och biotinlösning (Vector Laboratories, CA, USA). Fastän denna antikropp känner igen både FosB och AFosB, visade tidigare Western-blottstudier att vid den 24 efter stimuleringen är den stora majoriteten av den immunohistokemiska signalen sammansatt av AFosB eftersom FosB försämras väl före 24 h (Perrotti et al., 2008). Efter tvättning inkuberades skivor med en biotinylerad anti-kanin sekundär antikropp IgG (Vector Laboratories, CA, USA), get serum och 1xPBS. Därefter inkuberades skivor med en avidin-biotinkomplex (ABC) peroxidasfärgning för 15 min (Thermo Scientific, IL, USA). Slutligen monterades skivor, dehydratiserades med användning av etanol och CitriSolv (Fischer Scientific, MA, USA) och täcktes med DPX (Fisher Scientific). För cellräkning samlades prover från Bregma + 1.80 till + 1.44 från varje djur. Det totala antalet ΔFosB immunopositiva celler räknades från fyra NAc-sektioner från kärna och skal av varje råtta.

Figur 1  

stress och [ökning]FosB i EC och IC råttor. (A.D) Representativ immunohistokemi DAB-färgning av FFosB i NAc-skal och kärna av IC (A och B) och EG (C och D) råttor med (B och D) och utan (A och C) upprepad stress (N = (E) Kvantifiering .

Adeno-associerad virus överuttrycker [ökning]FosB

En AAV2-baserad vektor som uttrycker ΔFosB och humaniserad renilla GFP (hrGFP; Winstanley et al., 2007, 2009,b) eller HRGFP kontrollvektor (N = 10 vardera) injicerades bilateralt i råttan NAc. Eftersom det inte finns några IC-personer, användes parhus-råttor istället för IC-råttor för denna studie för att öka relevansen för det vetenskapliga samfundet genom att demonstrera effekterna av ΔFosB oberoende av EC / IC-paradigmet. En AAV som uttrycker hrGFP men som inte överuttrycker ΔFosB användes som en kontroll. Uttrycket av ΔFosB in vivo- validerades genom immunofluorescensfärgning med FosB-primär antikropp (1: 200, kanin, cellsignalteknik, MA, USA). AAV-vektorer injicerades i NAc-skalet bilateralt (1 / 1 / sida över 10 min) med användning av koordinater (AP = 1.7, L = 2.0, D = -6.5). Beteendestesten startade 3 veckor efter den stereotaxiska operationen. Noggrann placering bestämdes immunohistokemiskt efter avslutad beteendestestning.

Sackarosneophobia

ΔFosB överuttryckta råttor (N = 10) och kontrollråttor (N = 8) hanterades under 1-veckan före starten av beteendestest. För att testa för ångestliknande beteende utvärderades råttor för neofobi till en ny smak (sackaros). Råttor separerades i enskilda burar och vatten avlägsnades vid 1600 h. Standard råttvattenflaskor fylldes med en 1% vikt / volym sackaroslösning i råttans normala "kran" vatten och vägdes innan de placerades på varje bur vid 1800 h. Efter 30 min avlägsnades flaskorna och återvägdes och skillnaden i vikten av sackarosflaskor före och efter testet beräknades. Därefter ersattes sackaros i burarna under ytterligare 2-dagar för att låta råttorna bekanta sig med sackarosmak före förekomst av sackarospreferens.

Förhöjd plus labyrint

Ett annat test av ångestliknande beteende, den förhöjda plus labyrinten (EPM), testades 2 dagar efter sackarosneofobi. EPM mäter vektormodifierat utforskande beteende i en ny och ångestproducerande miljö (Green et al., 2008). Två stängda armar och två öppna armar (Med Associates Inc., VT, USA) som mäter 12 × 50 cm var 75 cm ovanför golvet och hade fotstrålar vid ingången till varje arm. Tid som spenderades på de öppna armarna övervakades för 5 min genom fotblocksbrott med Med-PC-programvara.

Kallstressinducerad avföring

På dagen efter EPM användes ett tredje ångestest: avföring som svar på en mildt stressfull miljö (kall). Polykarbonatmusburar (33 × 17 × 13 cm) förkyldes på is för 10 min. Råttorna placerades i burarna på is för 30 min och antalet fekala bolier registrerades varje 5 min.

Social kontakt

Påföljande dag uppmättes depressionsliknande beteende med hjälp av ett socialt interaktionstest. Råttor separerades för 24 h före testning. På testdagen placerades råttorna i en ny miljö (plastbehållare, 45 × 40 × 45 cm) med deras burkspädare och beteende var videoinspelad för 30 min. Den tid som råttparet spenderade varandra var mätt av en utredare som var blind för råttans tillstånd.

Sackarospreferens

Efter social kontakt användes sackarospreferensprovet som en modell av anhedonia. Parhuserade råttor separerades vid 1600 h med mat men inte tillåtet tillgång till vatten för 2 h. Vid 1800 h placerades två förvägda vattenflaskor på varje bur, en innehållande vatten, den andra en xNUMX% sackaroslösning i vatten. Vattenflaskorna placerades i normal position medan sackarosen placerades ungefär 1 cm bort. Flaskorna avlägsnades och vägdes efter 10 min.

Lokomotorisk aktivitet

Tre dagar efter sackarospreferensen utvärderades lokomotorisk aktivitet under normala ljusförhållanden genom att placera råttorna i klara plexiglaskammare (40 × 40 × 40 cm) med ett tunt skikt av sängkläder, omgiven av två 4 × 4 fotstrålematriser, en 4 cm ovan marken och en 16 cm över marken för att spela in horisontell ambulation och vertikal aktivitet. Photobeambrott övervakades för 2 h genom ett modifierat öppen fältaktivitetssystem (San Diego Instruments, CA, USA).

Tvingat simprov

Det sista spontana beteendestestet var FST, en modell som är känslig för antidepressiva medel. Råttor placerades i en plexiglascylinder fylld med ungefär 14 L rumstemperatur (24 ± 0.5 °) vatten för 15 min på Session 1 och 5 min på Session 2 följande dag. Råttorna torkades och placerades tillbaka i sina hemburar. Badaktivitet var videoinspelad och latensen till den första immobilitetsperioden (1 s) och den totala tiden immobila bestämdes för Session 2 av en utredare blindad till förhållandena.

Sackarosoperant svarar

Kontroll av AAV-råttor och ΔFosB-överuttryckta råttor reglerades till 85% fri matningsvikt över 7-dagar. Alla råttor utbildades till barpress för sackarospellets (Bio-Serv, NJ, USA) på ett FR1-schema för förstärkning för 15-mina sessioner på 5-dagar i följd. Råttor gavs sedan fri tillgång till mat under 3-dagar och fick igen att pressa för sackarospellets på ett FR1-schema för 15 min, den här gången vid 100% fri matningsvikt.

Kokain självadministration

Förvärvs

En vecka efter kateterkirurgi (som beskrivits ovan) placerades alla råttor (7-kontrollråttor och 10 ΔFosB-överuttryckta råttor, en kontrollråtta från kateterkirurgi) i operativa kamrar 30 × 24 × 21 cm (Med-Associates, St. Albans, VT) och fick själv administrera 0.2 mg / kg / infusionsenhetsdos av kokain för 2 h per session för 4-dagar; sedan 0.5 mg / kg / infusion för 3 dagar på ett FR1 schema. Varje infusion levererades intravenöst i en volym 0.01 ml över 5.8 s. Infusionen signalerades genom belysning av två cue-lampor för 20 s, vilket signalerade en timeoutperiod under vilken inga ytterligare infusioner kunde uppnås.

Extinction

Eftersom kronisk kokainexponering sannolikt skulle ge upphov till ackumulering av ΔFosB i kontrollråttor, vilket skulle få råttorna i båda vektorförhållandena att ha höga nivåer av FosB i hjärnan, begränsades råttorna till sina hemburar för 4-dagar utan självförvaltning för att tillåta ΔFosB-proteinhalter att minska i kontrollvektorråttor. Efter 4-dygns abstinens placerades råttor i operantkammaren och fick själv administrera saltlösning i stället för kokain under ett FR1-schema för 1-h sessioner under 3-dagar i följd.

Fast doseringssvar

Varje råtta (kontroll och ΔFosB överuttryckt) fick själv administrera 0.00325, 0.0075, 0.015, 0.03, 0.06, 0.125, 0.25, 0.5 mg / kg / infusionskokain i stigande ordning på ett FR1 schema varje dag i 5-dagar i följd. Råttor administrerade varje dos kokain för 30 min.

Kokaininducerad återinställning

Råttor genomgick ett återinsättningsförfarande inom sessionen. Råttor fick 0.5 mg / kg / infusion på ett FR1 schema för 60 min följt av 3 h av utrotning (med kontingent kokain cues). Därefter fick de en IP-injektion (Green et al., 2010) kokain av en av fem doser (0, 2.5, 5, 10 eller 20 mg / kg) i en slumpmässig ordning för varje råtta över 5-sessionerna för återinställning. Den sista 3 h-fasen av sessionen var återupptagning, återigen med kokainanordningar men fortfarande utan kokaininfusioner. Efter varje kokaininducerad återinställningsperiod mottog råttorna 2 mellanliggande dagar av hög dos (0.5 mg / kg / infusion) kokain på ett FR1 schema för 2 h för att upprätthålla höga svarhastigheter över sessioner. Under kokain självadministrationsprocessen förlorade katetrarna hos vissa råttor gradvis patentering; Därför användes data för 6-kontrollråttor och 7AFosB-överuttryckta råttor i denna analys.

Statistisk analys

Tvåvägsanalyser av varians (ANOVA) och tvåvägsrepeterande åtgärder ANOVAs gjordes för att jämföra de fyra behandlingsgrupperna och planerade jämförelser användes för att jämföra skillnaderna mellan förhållandena. Betydelsen mellan endast två villkor analyserades med hjälp av en student t-testa. Allt t-testdata passerade Shapiro-Wilk-testet av normalitet. Alla data uttrycks som medelvärde ± SEM. Statistisk signifikans sattes till p <0.05. Alla berikade råttor för ett enda experiment hölls i en bur men behandlades som separata försökspersoner, vilket gav implikationer angående frågan om potentiell pseudoreplikering.

Resultat

EC-råttor visar högre basala nivåer av [ökning]FosB i NAc än IC-råttor

Jämfört med IC-råttor har EC-råttor ett signifikant högre antal ΔFosB-positiva celler i både NAc-kärnan (t(4) = -3.31, p <0.05) och skal (t(4) = -6.84, p <0.05) (figurer 1A, C, E, F), vilket tyder på att basfrekvensen av ΔFosB är högre hos EC-råttor jämfört med IC-råttor. Dessutom visade västerländska blötresultat en stark trend för råttor av saltlösning med högre basal nivå av ΔFosB-protein i NAc jämfört med IC-saltrottor (t(6) = -2.03, p = 0.089; Figur Figure2A) 2A) med hjälp av ett tvåstansstest. Men med tanke på det ökade uttrycket i figurerna 1A-F och de ökningar som ses i andra papper (Solinas et al., 2009), vi är övertygade om denna effekt. Western blot-fynden verifierar också att praktiskt taget all FosB-liknande immunoreaktivitet som detekterats av immunhistokemi var FFosB och inte FosB, som inte kunde detekteras vid 24 h.

Figur 2  

Kokain och [ökning]FosB i EC och IC råttor. (A-B) Mean ΔFosB-protein (A) och mRNA (B) nivå (± SEM) i NAc efter 14-dagar med saltlösning eller kokain självadministration i IC- och EC-råttor (N = 7-8). Röda band i panelen en beteckning .

[ökning]FosB induceras differentiellt i EC- och IC-råttor genom stress

Det var en signifikant huvudverkan av upprepad spärrspänning i båda skalen (F(1, 8) = 16.6, P <0.005) och kärna (F(1, 8) = 7.9, P <0.05) av NAc och en huvudeffekt av miljöanrikning i skal (F(1, 8) = 22.3, P <0.005; Siffror 1A-F). Viktigare är att interaktionen mellan stress och miljöanrikning också var signifikant i både skalet (F(1, 8) = 25.6, P <0.01) och kärna (F(1, 8) = 6.7, P <0.05). Interaktionen var sådan att, efter upprepad återhållfasthetsstress, ökade antalet ΔFosB-positiva celler signifikant hos IC-råttor, medan detta antal inte förändrades i EC-råttor efter upprepad stress.

För att ytterligare undersöka hur ΔFosB är dynamiskt reglerad av akut vs upprepad stress och för att möjliggöra jämförelse med tidigare forskning (Alibhai et al., 2007), induktion av ΔFosB mRNA studerades med akut och upprepad spärrspänning (Figur (Figure1G) .1G). Det var en signifikant huvudverkan av stress (F(2, 24) = 31.9, P <0.001) och miljöanrikning (F(1, 24) = 5.1, P <0.05). I IC-råttorna inducerades ΔFosB-mRNA starkt efter akut återhållsamhet. Men vid upprepad stress dämpades induktionen av ΔFosB mRNA signifikant jämfört med den akuta induktionen. Det fanns också en betydande interaktion (F(2, 24) = 4.6, P <0.05), vilket visar att den akuta induktionen av ΔFosB mRNA var mindre hos EC-råttor jämfört med IC-råttor. Således har EC-råttor högre basala nivåer av ΔFosB proteinet i NAc, men mindre ΔFosB mRNA induktion som svar på en akut stressor.

[ökning]FosB induceras differentiellt av kokain i NAc av EC och IC-råttor

För att avgöra om EC och IC-råttor svarar annorlunda mot kokain studerade vi reglering av ΔFosB-protein och mRNA i råtta NAc efter kokain självadministration (figurer 2A, B respektive). En Western blot avslöjade en signifikant huvudverkan av kokain (F(1, 12) = 24.9, P <0.001) och en signifikant interaktion (F(1,12) = 5.5, P <0.05). Interaktionen var sådan att ΔFosB ökade mer hos IC-råttor än EC-råttor (Figur (Figure2A) .2A). I själva verket, efter kokainens självadministrering var ΔFosB-proteinnivåerna signifikant förhöjda endast i IC-råttor. När det gäller mRNA-nivåer avslöjade qPCR-resultaten också en signifikant huvudverkan av kokain (F(1, 26) = 47.1, P <0.001) och huvudeffekten av miljöanrikning (F(1, 26) = 13.8, P <0.005). Även om de totala nivåerna var lägre i EC-råttor, ökade båda grupperna ΔFosB mRNA (figur (Figure2B2B).

Trots att proteindata stödde den ursprungliga hypotesen var det hypotesen från Figur Figure1G1G att EG-råttor skulle visa mindre mRNA induktion än isolerade råttor i ovanstående kokain experiment, vilket inte hände, troligen på grund av Figur Figure1G1G utnyttjade en 30 min tidpunkt och kokainexperimentet utnyttjade en 3 h-tidpunkt. För att ytterligare undersöka mRNA-hypotesen användes en 30 minpunkt för att undersöka både akut och upprepad kokainbehandling som en bättre jämförelse med Figur Figure1G.1G. Eftersom akut kokain självadministration är problematisk av natur (dvs. förvärvsinlärning), gavs EC och IC-råttor akuta eller 9-dagar med upprepade icke-kontingenta IP-injektioner (20 mg / kg). Som hypotesen var det en signifikant huvudverkan av miljöanrikning (F(1, 17) = 14.3, P <0.005), men kokainbehandlingens huvudsakliga effekt (F(2, 17) = 3.4, P = 0.057) och interaktionen (F(2, 17) = 3.4, P = 0.055) visade bara starka trender med ett tvåstansstest. Men med tanke på att vi hade riktlinjära hypoteser från Figur Figure1G, 1G, vi är mycket bekväma enligt vår mening att EC-råttor visar mindre induktion än IC-råttor (Figur (Figure2C2C).

Överuttryck av [ökning]FosB i NAc-skalet liknar den skyddande anrikningsinducerade beroendefenotypen

För att undersöka effekten av ΔFosB på råttbeteende oberoende av miljöanrikning / isolering (dvs. för att göra dessa resultat mer relevanta för icke-EC / IC-studier) användes adenoassocierat virus (AAV) för att överuttrycka ΔFosB bilateralt i NAc i icke-berikade parhus-råttor. Enligt våra tidigare studier är NAc-skalet mest känsligt för kontrolldepressionsrelaterat och läkemedelsupptagande / sökande beteende så att AAV-vektorer injicerades i NAc-skalet i denna studie (Green et al., 2006, 2008, 2010). siffror 3A, B visa den representativa immunohaltiga fluorescensen av ΔFosB med kontrollvektorn (panel A, dvs endogena FFB-uttryck) och FFB-overuttryckande vektor (panel B) i NAc-skalet.

Figur 3  

Överuttryck av [ökning]FosB i NAc-skalet liknar fenomenet för skyddsberoende av miljöanrikning. (A-B) Representativ immunohistokemi av FFosB för HRGFP-kontroll (A) och ΔFosB-överuttryckande (B) AAV vektorer. .

Efter att ha validerat titern, in vivo- uttryck och generell placering av viralvektorn studerade vi först effekten av överuttryck av ΔFosB i ångestmodeller. Överuttryck av ΔFosB i NAc-skalet var inte tillräckligt för att reproducera den anxiogena effekten av miljöanrikning i sackarosneophobia och koldspänningsinducerade avfekningsparadigmer (data ej visad). Dessutom var ingen effekt på EPM (data ej visad). Eftersom miljöanrikning ger en antidepressiv-liknande effekt hos råttor, genomförde vi därefter depressionsrelaterade test på ΔFosB-överuttryckta råttor. I likhet med ångestmodeller visade resultaten att överuttryck av ΔFosB i NAc-skalet inte var tillräcklig för att minska depressionliknande beteende i sackarospreferensprovet, socialt interaktionstest eller FST (data ej visad).

I miljöanrikningsparadigmet uppvisar EC-råttor lägre basal lokomotorisk aktivitet än IC-råttor (Bowling et al., 1993; Bowling och Bardo, 1994; Smith et al., 1997; Green et al., 2003, 2010). För att undersöka effekten av att överuttrycka ΔFosB i NAc-skalet, testades spontan lokomotorisk aktivitet för 120 min. Med hjälp av ett tvåstansstest visade resultaten att överuttryck av ΔFosB i NAc-skalet gav en stark trend för minskad basal lokomotorisk aktivitet hos råttor (Figur (Figure3C; 3C; t(16) = 1.84, p = 0.084). Trots att de inte är ganska statistiskt signifikanta med ett tvåstansstest, är dessa data fortfarande spännande, eftersom de överensstämmer med vår uttryckliga riktningshypotes baserad på Green et al. (2010), vilket överensstämmer med effekten av miljöanrikning.

In-kontrast till depressions- och ångestmodeller kunde överuttryck av FosB i NAc-skalet producera en EG-liknande fenotyp i multipla missions- / förstärkningsparadigmer. jagn sackarospelletsoperantens självadministrationsprov, fanns det en signifikant interaktion mellan ΔFosB-överuttryck och hungermotivation hos råttor (F(1, 16) = 7.4, P <0.01). Råttor som överuttrycker ΔFosB i NAc-skalet tog betydligt mer sackarospellets under hungermotiverade förhållanden (dvs. vid 85% fri foderkroppsvikt), men färre pellets under lågt motiverat tillstånd (dvs 100% fri fodervikt; Figur Figure3D), 3D), som efterliknar EG-fenotypen perfekt (Green et al., 2010).

I miljöanrikningsparadigen visade EC-råttor minskat kokainsökande beteende vid utrotning och kokaininducerad återinställning (Green et al., 2010). Således mättes kokain-och sökande beteende i ΔFosB-uttryckande råttor med användning av det intravenösa kokain-självadministrationsparadigmet. Som en modell av begär, avslöjade kokainutrotningsparadigmet att ΔFosB-överuttryck i NAc-skalet minskade läkemedelssökande beteender (F(1, 15) = 6.7, P <0.05; Figur Figure3E) .3E). Det var också en signifikant huvudverkan av sessionen (F(2, 30) = 74.0, P <0.001). För underhåll som svarar enligt ett FR1-schema, var det en signifikant huvudeffekt av dosen (F(7, 105) = 222.6, P <0.001) och en signifikant interaktion (F(7, 105) = 2.3, P <0.05) i kumulativt kokainintag. Interaktionen var sådan att skillnaderna var uppenbara endast vid högre doser kokain (Figur (Figure3F) .3F). Slutligen var det vid kokaininducerad återinställning en signifikant huvudverkan av dosen (F(4, 44) = 15.5, P <0.001) och en trend för en huvudeffekt av ΔFosB-överuttryck med hjälp av ett tvåsidigt test (F(1, 11) = 4.1, P = 0.067). Emellertid, med tanke på riktningshypotesen från Green et al. (2010) och de statistiskt signifikanta och konsekventa resultaten i figurerna 3D, E, F, är det troligt att ΔFosB minskar återinställning (Figur (Figure3G) .3G). Reagemang vid dosen 10 mg / kg var signifikant lägre för ΔFosB-uttryckande råttor. Resultaten som helhet indikerar att överuttryck av ΔFosB i råtta NAc-skal minskar kokainintag och sökande beteende, vilket överensstämmer med beteendeeffekterna av miljöanrikning.

Diskussion

Sårbarheten hos individer till missbruk och depression påverkas kraftigt av miljöfaktorer. Miljöanrikning är ett paradigm som manipulerar djurens levnadsmiljö, vilket ger skyddande effekter mot många psykiatriska förhållanden. ΔFosB spelar en nyckelroll för att reglera belöningsfunktionen i flera hjärnregioner, inklusive NAc och dorsalstriatum (Koob et al., 1998; Klok, 1998; Wallace et al., 2008; Grueter et al., 2013; Pitchers et al., 2013). I det här projektet studerade vi den dynamiska regleringen av ΔFosB genom restrientspänning och kokain i berikade och isolerade råttor. De viktigaste resultaten i projektet är:

(1) EC-råttor har förhöjda FosB-nivåer i NAc vid baslinjen jämfört med IC-råttor;

(2) endast IC-råttor ackumulerar ytterligare ΔFosB-protein med upprepad stress;

(3) EC-råttor uppvisar försvagad induktion av ΔFosB mRNA efter stress eller kokain; och

(4) överuttryckande ΔFosB i NAc av parhuserade råttor liknar fenotypen för skyddande beroende, men inte skyddsdepressionsfenotypen.

Man kan förvänta sig från den publicerade litteraturen, som visar att transgena ΔFosB-överuttryckta möss visar ökad känslighet för kokainbelöning och självadministrering vid låga doser av läkemedel (Kelz et al., 1999; Colby et al., 2003; Vialou et al., 2010; Robison et al., 2013), att de ΔFosB-överuttryckta råttorna i det aktuella experimentet skulle visa ökad benägenhet för kokain självadministrering och sökande. In de nuvarande experimenten, men överuttryckt ΔFosB i NAc-skalet minskade kokainintag och kokain som sökte under utrotning och återinställning, vilket indikerar minskad motivation för kokain. Discrepansen kan bero på det faktum att de transgena mössen uttryckte ΔFosB under hela striatumet, men endast i dynorfin + celler (Colby et al., 2003). I det aktuella experimentet overfrukades ΔFosB genom en AAV-vektor som infekterar dynorfin + och enkefalin + neuroner. För det andra fokuserade den aktuella studien på NAc-skalet i stället för hela striatalområdet.

Förutom beroendet fenotyp producerar miljöanrikning antidepressiva och anxiogenlika profiler på råttor (Green et al., 2010; Vialou et al., 2010). I den aktuella studien misslyckades överuttryck av ΔFosB i NAc att producera effekter i någon av de tre depressionerna eller tre ångesttest. Även om det finns många möjliga faktorer som kan bidra till att ΔFosB efterliknar berikningsberoende men inte depressionfenotypen, är det möjligt att NAc-skalet är mer dominerande för beroendeberoende beteende, medan depressionrelaterat beteende kan medieras mer robust av andra regioner. De nuvarande resultaten ligger i strid med studierna i möss där ΔFosB-överuttryck i NAc (där man inte på ett tillförlitligt sätt kan skilja skalet mot kärnan) producerade robusta antidepressiva-liknande effekter i flera beteendeanalyser (Vialou et al., 2010). En möjlig orsak är att det kan vara lättare att se effekten av ΔFosB på svåra beteendemodeller som social nederlagsspänning. Den aktuella överexpressionsstudien undersökte depressionsliknande beteende i avsaknad av en allvarlig stressor.

Konsekvent genom hela denna studie korrelerade höga basala nivåer av ΔFosB (t.ex. från berikning, upprepad stress eller kokain) med svagare efterföljande induktion av ΔFosB. Detta kan representera en takeffekt, utan ytterligare induktion möjlig ovanpå förhöjda basala nivåer av proteinet. Det är också möjligt att ackumulerade nivåer av ΔFosB kan mata tillbaka för att inhibera ytterligare induktion av FFB-mRNA efter stress eller kokain som en negativ återkopplingsslinga. Till exempel, EC-råttor hade höga nivåer av FFosB och visade en försvagad induktion av ΔFosB efter stress eller kokain. Detta understryker den negativa korrelationen mellan ΔFosB-proteinnivåer och dess mRNA-induktion. Den negativa återkopplingen av ackumulerade ΔFosB står också för försvagad induktion av ΔFosB med upprepad stress i IC-råttor.

För att vara tydlig gör vi inte några påståenden om att miljöanrikningsparadigmet har direkt translationell relevans, eftersom det är mycket få barn som uppstår i sant deprivation (det bör noteras att socioekonomisk svaghet inte motsvarar miljöbrist). Nyttjandet av detta paradigm är att det är en icke-medicinsk, icke-kirurgisk, icke-genetisk manipulation som producerar skyddande beteendemässiga fenotyper för beroende och depression som kan utnyttjas i en laboratoriekontrollerad miljö som ett grundläggande vetenskapligt verktyg för att identifiera molekylära mekanismer underliggande motståndskraft mot psykiatriska förhållanden. Tidigare forskning har beskrivit beteendefenotyperna i detalj (Bowling et al., 1993; Bowling och Bardo, 1994; Bardo et al., 1995; Green et al., 2002, 2003; El Rawas et al., 2009) och senare studier (Solinas et al., 2009; Green et al., 2010; Lobo et al., 2013), tillsammans med den aktuella studien, ger ledtrådar om de transkriptionsmekanismer som ligger till grund för dessa beteendefenotyper. De nedströms transkriptionella målgenerna / proteinerna som producerar de skyddande fenotyperna undersöks för närvarande (Fan et al., 2013,b; Lichti et al., 2014).

Vår konceptualisering av miljöanrikning är att anrikning är ett kontinuum med isolering vid låga änden och full berikning vid högänden. ”Full "anrikning" i detta fall definieras som en miljö där ämnena utsätts för nyhet, icke-hotande social kontakt med specifika ämnen och får utrymme och föremål för motion. TDessa tre faktorer utgör alla de sammansatta tillstånden för "berikning" eftersom de är givande och varje frisättning av dopamin i NAc, och som sådan aktiverar en gemensam neurobiologisk krets (Louilot et al., 1986; Calcagnetti och Schechter, 1992; Crowder och Hutto, 1992; Rebec et al., 1997; Bevins et al., 2002). I denna konceptualisering anses isolering som kontrollgruppen eftersom den representerar frånvaron av manipulering (dvs berikning, Crofton et al., I granskning). Andra konceptualiseringar är emellertid möjliga. I en alternativ konceptualisering är kontinuumet detsamma, men isolationsgruppen är den experimentella gruppen och den berikade gruppen är kontrollen. jagn denna modell, berövar ämnena för normal anrikning is den faktiska manipulationen. II detta fall, istället för att säga att anrikning är skyddande, skulle man säga att isolering ger känslighet. Fortfarande utgör en tredje konceptualisering att det inte finns något kontinuum och att anrikning och isolering är två fundamentalt olika manipuleringar. I denna uppfattning bör anrikning och isolering separeras och båda jämförs med en parhushushållning. Bristande universell konsensus om anriknings natur representerar en begränsning av paradigmet, men ger vägledning för framtida studier. Oavsett resultatet av dessa experiment står fast oberoende av den efterföljande tolkningen.

Miljö och livserfarenheter har ett starkt inflytande på utvecklingen och uttrycket av många psykiatriska förhållanden. Förståelsen av mekanismen för skyddsberoende och depression fenotyper av miljöanrikning tar upp en grundläggande fråga i psykisk störningsforskning, nämligen miljöbidraget till mottaglighet eller motståndskraft mot psykiatriska tillstånd. Denna studie understryker betydelsen av ΔFosB vid reglering av beroendeberoende beteenden. I framtida studier behöver åtgärderna av ΔFosB och dess aktiverande och inhiberande effekter på specifika målgener undersökas ytterligare inom miljöanrikningsmodellen.

Finansiering och offentliggörande

Yafang Zhang, ingen; Elizabeth J. Crofton, ingen; Dingge Li, ingen; Mary Kay Lobo, ingen; Xiuzhen Fan, ingen; Eric J. Nestler, R37DA007359; Thomas A. Green, DA029091.

Intresset om intressekonflikter

Författarna förklarar att forskningen genomfördes i avsaknad av kommersiella eller finansiella relationer som kan tolkas som en potentiell intressekonflikt.

Erkännanden

Dessa experiment finansierades med bidrag från National Institute on Drug Abuse, DA029091 och R37DA007359. Kokain som tillhandahålls av National Institute on Drug Abuse.

referenser

  1. Akdeniz C., Tost H., Meyer-Lindenberg A. (2014). Neurobiologin av social miljörisk för schizofreni: ett utvecklande forskningsfält. Soc. Psykiatri Psykiatr. Epidemiol. 49, 507-517 10.1007 / s00127-014-0858-4 [PubMed] [Cross Ref]
  2. Alibhai IN, Green TA, Potashkin JA, Nestler EJ (2007). Reglering av fosB- och DeltafosB-mRNA-uttryck: in vivo och in vitro studier. Brain Res. 1143, 22-33 10.1016 / j.brainres.2007.01.069 [PMC gratis artikel] [PubMed] [Cross Ref]
  3. Bardo MT, Bowling SL, Rowlett JK, Manderscheid P., Buxton ST, Dwoskin LP (1995). Miljöanrikning dämpar lokomotorisk sensibilisering, men inte in vitro-dopaminfrisättning, inducerad av amfetamin. Pharmacol. Biochem. Behav. 51, 397-405 10.1016 / 0091-3057 (94) 00413-d [PubMed] [Cross Ref]
  4. Bevins RA, Besheer J., Palmatier MI, Jensen HC, Pickett KS, Eurek S. (2002). Novell-objekt-konditionering: beteendemässiga och dopaminerga processer i uttryck för nyhetsbelöning. Behav. Brain Res. 129, 41-50 10.1016 / s0166-4328 (01) 00326-6 [PubMed] [Cross Ref]
  5. Bowling SL, Bardo MT (1994). Lokomotoriska och givande effekter av amfetamin i berikade, sociala och isolerade råttor. Pharmacol. Biochem. Behav. 48, 459-464 10.1016 / 0091-3057 (94) 90553-3 [PubMed] [Cross Ref]
  6. Bowling SL, Rowlett JK, Bardo MT (1993). Effekten av miljöanrikning på amfetaminstimulerad lokomotorisk aktivitet, dopaminsyntes och dopaminfrisättning. Neurofarmakologi 32, 885-893 10.1016 / 0028-3908 (93) 90144-r [PubMed] [Cross Ref]
  7. Calcagnetti DJ, Schechter MD (1992). Platskonditionering avslöjar den givande aspekten av social interaktion hos unga råttor. Physiol. Behav. 51, 667-672 10.1016 / 0031-9384 (92) 90101-7 [PubMed] [Cross Ref]
  8. Chen J., Nye HE, Kelz MB, Hiroi N., Nakabeppu Y., Hope BT, et al. (1995). Reglering av delta FosB och FosB-liknande proteiner genom elektrokonvulsiv anfall och kokainbehandlingar. Mol. Pharmacol. 48, 880-889 [PubMed]
  9. Colby CR, Whisler K., Steffen C., Nestler EJ, Self DW (2003). Striatal celltypsspecifik överuttryck av DeltaFosB ökar incitamentet för kokain. J. Neurosci. 23, 2488-2493 [PubMed]
  10. Crowder WF, Hutto CW (1992). Operativa ställningsbekämpningsåtgärder undersöktes med hjälp av två nondrugförstärkare. Pharmacol. Biochem. Behav. 41, 817-824 10.1016 / 0091-3057 (92) 90233-6 [PubMed] [Cross Ref]
  11. Elisei S., Sciarma T., Verdolini N., Anastasi S. (2013). Resilience and depressive disorders. Psychiatr. Danub. 25 (Suppl. 2), S263-S267 [PubMed]
  12. El Rawas R., Thiriet N., Lardeux V., Jaber M., Solinas M. (2009). Miljöanrikning minskar de givande men inte de aktiviserande effekterna av heroin. Psykofarmakologi (Berl) 203, 561-570 10.1007 / s00213-008-1402-6 [PubMed] [Cross Ref]
  13. Fan X., Li D., Lichti CF, Green TA (2013a). Dynamisk proteomik hos kärnan accumbens som svar på akut psykologisk stress i miljöanriktade och isolerade råttor. PLoS One 8: e73689 10.1371 / journal.pone.0073689 [PMC gratis artikel] [PubMed] [Cross Ref]
  14. Fan X., Li D., Zhang Y., Green TA (2013b). Differentiell fosfoproteomreglering av kärnan accumbens i miljömässigt berikade och isolerade råttor som svar på akut stress. PLoS One 8: e79893 10.1371 / journal.pone.0079893 [PMC gratis artikel] [PubMed] [Cross Ref]
  15. Grön TA, Alibhai IN, Hommel JD, Dileone RJ, Kumar A., ​​Theobald DE, et al. (2006). Induktion av inducerbart cAMP-tidigt repressoruttryck i kärnan accumbens genom stress eller amfetamin ökar beteenderesponser mot känslomässiga stimuli. J. Neurosci. 26, 8235-8242 10.1523 / jneurosci.0880-06.2006 [PubMed] [Cross Ref]
  16. Grön TA, Alibhai IN, Roybal CN, Winstanley CA, Theobald DE, Birnbaum SG, et al. (2010). Miljöanrikning ger en beteendemässig fenotyp medierad av låg cyklisk adenosinmonofosfatresponselementbindande (CREB) -aktivitet i kärnans accumbens. Biol. Psykiatri 67, 28-35 10.1016 / j.biopsych.2009.06.022 [PMC gratis artikel] [PubMed] [Cross Ref]
  17. Grön TA, Alibhai IN, Unterberg S., Neve RL, Ghose S., Tamminga CA, et al. (2008). Induktion av aktiverande transkriptionsfaktorer (ATF) ATF2, ATF3 och ATF4 i nucleus accumbens och deras reglering av känslomässigt beteende. J. Neurosci. 28, 2025-2032 10.1523 / jneurosci.5273-07.2008 [PubMed] [Cross Ref]
  18. Grön TA, Cain ME, Thompson M., Bardo MT (2003). Miljöanrikning minskar nikotininducerad hyperaktivitet hos råtta. Psykofarmakologi (Berl) 170, 235-241 10.1007 / s00213-003-1538-3 [PubMed] [Cross Ref]
  19. Grön TA, Gehrke BJ, Bardo MT (2002). Miljöanrikning minskar intravenös amfetamin självadministration hos råttor: dosresponsfunktioner för tidsplaner med fast och progressiv förhållande. Psykofarmakologi (Berl) 162, 373-378 10.1007 / s00213-002-1134-y [PubMed] [Cross Ref]
  20. Grueter BA, Robison AJ, Neve RL, Nestler EJ, Malenka RC (2013). ΔFosB modulerar differentiellt kärnan accumbens direkt och indirekt vägfunktion. Proc. Natl. Acad. Sci. USA 110, 1923-1928 10.1073 / pnas.1221742110 [PMC gratis artikel] [PubMed] [Cross Ref]
  21. Hopp B., Kosofsky B., Hyman SE, Nestler EJ (1992). Reglering av omedelbart tidigt genuttryck och AP-1-bindning i råttkärnan accumbens av kronisk kokain. Proc. Natl. Acad. Sci. USA 89, 5764-5768 10.1073 / pnas.89.13.5764 [PMC gratis artikel] [PubMed] [Cross Ref]
  22. Hoppas BT, Nye HE, Kelz MB, Self DW, Iadarola MJ, Nakabeppu Y., et al. (1994). Induktion av ett långvarigt AP-1-komplex bestående av förändrade Fos-liknande proteiner i hjärnan av kronisk kokain och andra kroniska behandlingar. Neuron 13, 1235-1244 10.1016 / 0896-6273 (94) 90061-2 [PubMed] [Cross Ref]
  23. Jha S., Dong B., Sakata K. (2011). Berikad miljöbehandling reverserar depressionliknande beteende och återställer minskad hippocampal neurogenes och proteinnivåer av hjärnavledad neurotrofisk faktor hos möss som saknar sitt uttryck genom promotor IV. Övers. Psykiatri 1: e40 10.1038 / tp.2011.33 [PMC gratis artikel] [PubMed] [Cross Ref]
  24. Kato T., Iwamoto K. (2014). Omfattande DNA-metylering och hydroximetyleringsanalys i människans hjärna och dess konsekvenser i psykiska störningar. Neurofarmakologi 80, 133-139 10.1016 / j.neuropharm.2013.12.019 [PubMed] [Cross Ref]
  25. Kelz MB, Chen J., Carlezon WA, Whisler K., Gilden L., Beckmann AM, et al. (1999). Uttryck av transkriptionsfaktorn deltaFosB i hjärnan styr känsligheten för kokain. Natur 401, 272-276 10.1038 / 45790 [PubMed] [Cross Ref]
  26. Kelz MB, Nestler EJ (2000). deltaFosB: en molekylär omkopplare som ligger bakom den långsiktiga neurala plasticiteten. Curr. Opin. Neurol. 13, 715-720 10.1097 / 00019052-200012000-00017 [PubMed] [Cross Ref]
  27. Koob GF, Sanna PP, Bloom FE (1998). Neurovetenskap av beroende. Neuron 21, 467-476 [PubMed]
  28. Larson EB, Graham DL, Arzaga RR, Buzin N., Webb J., Green TA, et al. (2011). Överuttryck av CREB i kärnan accumbens skal ökar kokain förstärkning i självförvaltande råttor. J. Neurosci. 31, 16447-16457 10.1523 / JNEUROSCI.3070-11.2011 [PMC gratis artikel] [PubMed] [Cross Ref]
  29. Laviola G., Hannan AJ, Macr. S., Solinas M., Jaber M. (2008). Effekter av berikad miljö på djurmodeller av neurodegenerativa sjukdomar och psykiatriska störningar. Neurobiol. Dis. 31, 159-168 10.1016 / j.nbd.2008.05.001 [PubMed] [Cross Ref]
  30. Lichti CF, Fan X., English RD, Zhang Y., Li D., Kong F., et al. (2014). Miljöanrikning förändrar proteinuttryck såväl som det proteomiska svaret på kokain i råttkärnan accumbens. Främre. Behav. Neurosci. 8: 246 10.3389 / fnbeh.2014.00246 [PMC gratis artikel] [PubMed] [Cross Ref]
  31. Lobo MK, Zaman S., Damez-Werno DM, Koo JW, Bagot RC, Dinieri JA, et al. (2013). ΔFosB-induktion i striatala medium-spiny neuron-subtyper som svar på kronisk farmakologisk, känslomässig och optogenisk stimuli. J. Neurosci. 33, 18381-18395 10.1523 / JNEUROSCI.1875-13.2013 [PMC gratis artikel] [PubMed] [Cross Ref]
  32. Louilot A., Le Moal M., Simon H. (1986). Differentiell reaktivitet hos dopaminerga neuroner i kärnan accumbens som svar på olika beteende situationer. En in vivo voltammetrisk studie i fria rörliga råttor. Brain Res. 397, 395-400 10.1016 / 0006-8993 (86) 90646-3 [PubMed] [Cross Ref]
  33. McBride WJ, Kimpel MW, Mcclintick JN, Ding ZM, Edenberg HJ, Liang T., et al. (2014). Förändringar i genuttryck inom den förlängda amygdala efter binge-liknande alkoholdrinkning av tonåriga alkoholföreträdande (P) råttor. Pharmacol. Biochem. Behav. 117, 52-60 10.1016 / j.pbb.2013.12.009 [PMC gratis artikel] [PubMed] [Cross Ref]
  34. Mlynarik M., Johansson BB, Jezova D. (2004). Berikad miljö påverkar adrenokortiskt svar på immunutmaning och glutamatreceptor-genuttryck i råtthippocampus. Ann. NY Acad. Sci. 1018, 273-280 10.1196 / annals.1296.032 [PubMed] [Cross Ref]
  35. Nestler EJ (2001). Molecular neurobiology of addiction. Am. J. Addict. 10, 201-217 10.1080 / 105504901750532094 [PubMed] [Cross Ref]
  36. Nestler EJ (2008). Recension. Transkriptionsmekanismer för missbruk: DeltaFosBs roll. Philos. Trans. R. Soc. Lond. B Biol. Sci. 363, 3245-3255 10.1098 / rstb.2008.0067 [PMC gratis artikel] [PubMed] [Cross Ref]
  37. Nestler EJ, Barrot M., Self DW (2001). DeltaFosB: en hållbar molekylärbrytare för missbruk. Proc. Natl. Acad. Sci. USA 98, 11042-11046 10.1073 / pnas.191352698 [PMC gratis artikel] [PubMed] [Cross Ref]
  38. Perrotti LI, Hadeishi Y., Ulery PG, Barrot M., Monteggia L., Duman RS, et al. (2004). Induktion av deltaFosB i belöningsrelaterade hjärnstrukturer efter kronisk stress. J. Neurosci. 24, 10594-10602 10.1523 / jneurosci.2542-04.2004 [PubMed] [Cross Ref]
  39. Perrotti LI, Weaver RR, Robison B., Renthal W., Maze I., Yazdani S., et al. (2008). Distinkta mönster av DeltaFosB induktion i hjärnan av missbruk. Synapse 62, 358-369 10.1002 / syn.20500 [PMC gratis artikel] [PubMed] [Cross Ref]
  40. Platser KK, Vialou V., Nestler EJ, Laviolette SR, Lehman MN, Coolen LM (2013). Natur- och drogbelöningar agerar på gemensamma neurala plasticitetsmekanismer med ΔFosB som en nyckelmedlare. J. Neurosci. 33, 3434-3442 10.1523 / jneurosci.4881-12.2013 [PMC gratis artikel] [PubMed] [Cross Ref]
  41. Rebec GV, Christensen JR, Guerra C., Bardo MT (1997). Regionala och tidsmässiga skillnader i realtid dopaminutflöde i kärnan accumbens under fritt val nyhet. Brain Res. 776, 61-67 10.1016 / s0006-8993 (97) 01004-4 [PubMed] [Cross Ref]
  42. Robison AJ, Vialou V., Mazei-Robison M., Feng J., Kourrich S., Collins M., et al. (2013). Behaviorella och strukturella svar på kronisk kokain kräver en frammatningsslinga som involverar ΔFosB och kalcium / kalmodulinberoende proteinkinas II i nukleär accumbens-skalet. J. Neurosci. 33, 4295-4307 10.1523 / jneurosci.5192-12.2013 [PMC gratis artikel] [PubMed] [Cross Ref]
  43. Smith JK, Neill JC, Costall B. (1997). Post-weaning bostadsförhållanden påverkar beteendeeffekterna av kokain och d-amfetamin. Psykofarmakologi (Berl) 131, 23-33 10.1007 / s002130050261 [PubMed] [Cross Ref]
  44. Solinas M., Chauvet C., Thiriet N., El Rawas R., Jaber M. (2008). Återföring av kokainberoende genom miljöanrikning. Proc. Natl. Acad. Sci. USA 105, 17145-17150 10.1073 / pnas.0806889105 [PMC gratis artikel] [PubMed] [Cross Ref]
  45. Solinas M., Thiriet N., El Rawas R., Lardeux V., Jaber M. (2009). Miljöanrikning under tidiga stadier av livet minskar de beteende, neurokemiska och molekylära effekterna av kokain. Neuropsykofarmakologi 34, 1102-1111 10.1038 / npp.2008.51 [PubMed] [Cross Ref]
  46. Trappor DJ, Prendergast MA, Bardo MT (2011). Miljökonducerade skillnader i kortikosteron- och glukokortikoidreceptorblocket av amfetamin självadministration hos råttor. Psykofarmakologi (Berl) 218, 293-301 10.1007 / s00213-011-2448-4 [PMC gratis artikel] [PubMed] [Cross Ref]
  47. Thiel KJ, Pentkowski NS, Peartree NA, Målare MR, Neisewander JL (2010). Miljömässiga levnadsvillkor införs under tvungen avhållsamhet förändrar kokainsökande beteende och Fos-proteinuttryck. Neurovetenskap 171, 1187-1196 10.1016 / j.neuroscience.2010.10.001 [PMC gratis artikel] [PubMed] [Cross Ref]
  48. Thiel KJ, Sanabria F., Pentkowski NS, Neisewander JL (2009). Anti-craving effekter av miljöanrikning. Int. J. Neuropsychopharmacol. 12, 1151-1156 10.1017 / s1461145709990472 [PMC gratis artikel] [PubMed] [Cross Ref]
  49. van Winkel M., Peeters F., Van Winkel R., Kenis G., Collip D., Geschwind N., et al. (2014). Effekter av variation i BDNF-genen på social stresskänslighet och buffertpåverkan av positiva känslor: replikering och förlängning av en genmiljöinteraktion. Eur. Neuropsychopharmacol. 24, 930-938 10.1016 / j.euroneuro.2014.02.005 [PubMed] [Cross Ref]
  50. Venebra-Muñoz A., Corona-Morales A., Santiago-García J., Melgarejo-Gutiérrez M., Caba M., García-García F. (2014). Berikad miljö dämpar nikotin självadministration och inducerar förändringar i ΔFosB-uttryck i råtta prefrontal cortex och kärnan accumbens. Neuroreport 25, 694-698 10.1097 / wnr.0000000000000157 [PubMed] [Cross Ref]
  51. Vialou V., Robison AJ, Laplant QC, Covington HE, Dietz DM, Ohnishi YN, et al. (2010). DeltaFosB i hjärnbelöningskretsar medierar motståndskraft mot stress och antidepressiva reaktioner. Nat. Neurosci. 13, 745-752 10.1038 / nn.2551 [PMC gratis artikel] [PubMed] [Cross Ref]
  52. Wallace DL, Vialou V., Rios L., Carle-Florence TL, Chakravarty S., Kumar A., ​​et al. (2008). DeltaFosBs inflytande i kärnan accumbens på naturligt belöningsrelaterat beteende. J. Neurosci. 28, 10272-10277 10.1523 / jneurosci.1531-08.2008 [PMC gratis artikel] [PubMed] [Cross Ref]
  53. Wang Y., Cesena TI, Ohnishi Y., Burger-Caplan R., Lam V., Kirchhoff PD, et al. (2012). Små molekyl screening identifierar regulatorer av transkriptionsfaktorn ΔFosB. ACS Chem. Neurosci. 3, 546-556 10.1021 / cn3000235 [PMC gratis artikel] [PubMed] [Cross Ref]
  54. Werme M., Messer C., Olson L., Gilden L., Thorén P., Nestler EJ, et al. (2002). Delta FosB reglerar hjulkörning. J. Neurosci. 22, 8133-8138 [PubMed]
  55. Winstanley CA, Bachtell RK, Theobald DE, Laali S., Green TA, Kumar A., ​​et al. (2009a). Ökad impulsivitet vid uttag från kokain självadministration: roll för DeltaFosB i orbitofrontal cortex. Cereb. Cortex 19, 435-444 10.1093 / cercor / bhn094 [PMC gratis artikel] [PubMed] [Cross Ref]
  56. Winstanley CA, Green TA, Theobald DE, Renthal W., LaPlant Q., DiLeone RJ, et al. (2009b). DeltaFosB-induktion i orbitofrontal cortex förstärker lokomotorisk sensibilisering trots att den kognitiva dysfunktionen orsakas av kokain dämpas. Pharmacol. Biochem. Behav. 93, 278-284 10.1016 / j.pbb.2008.12.007 [PMC gratis artikel] [PubMed] [Cross Ref]
  57. Winstanley CA, LaPlant Q., Theobald DE, Green TA, Bachtell RK, Perrotti LI, et al. (2007). DeltaFosB-induktion i orbitofrontal cortex medger tolerans mot kokaininducerad kognitiv dysfunktion. J. Neurosci. 27, 10497-10507 10.1523 / jneurosci.2566-07.2007 [PubMed] [Cross Ref]
  • Wise RA (1998). Drug-aktivering av hjärnbelöningsbanor. Drogalkohol Beroende. 51, 13-22 10.1016 / s0376-8716 (98) 00063-5 [PubMed] [Cross Ref]