Reglering av DeltaFosB-stabilitet genom fosforylering (2006)

J Neurosci. 2006 May 10;26(19):5131-42.

Ulery PG, Rudenko G, Nestler EJ.

källa

Institutionen för psykiatri, Centrum för grundläggande neurovetenskap, University of Texas Southwestern Medical Center, Dallas, Texas 75390-9070, USA.

Abstrakt

Transkriptionsfaktom DeltaFosB (även hänvisad till som FosB2 eller FosB [korta formen]) är en viktig mediator av den långsiktiga plasticitet induceras i hjärnan genom kronisk exponering för flera olika typer av psykoaktiva stimuli, inklusive missbruksdroger, stress och elektrokonvulsiv kramper . Ett distinkt drag hos DeltaFosB är att det, när det induceras, kvarstår i hjärnan under relativt långa perioder i avsaknad av ytterligare stimulering. Mekanismerna bakom denna uppenbara stabilitet har emellertid förblev okända. Här visar vi att DeltaFosB är en relativt stabil transkriptionsfaktor med en halveringstid på ungefär 10 h i cellodling. Vidare visar vi att DeltaFosB är ett fosfoprotein i hjärnan och att fosforylering av en starkt konserverad serinrest (Ser27) i DeltaFosB skyddar den mot proteasomal nedbrytning. Vi tillhandahåller flera rader av bevis som antyder att denna fosforylering medieras av kasein kinas 2. Dessa fynd utgör de första bevisen på att DeltaFosB fosforyleras och visar att fosforylering bidrar till stabiliteten, vilket är kärnan i dess förmåga att mediera långvariga anpassningar i hjärnan.

Beskrivning

Transkriptionsfaktorn ΔFosB, även betecknad FosB2 eller FosB [kort form], är en C-terminalt-trunkerad splitsvariant av den omedelbara tidiga genen FosB (Dobrazanski et al., 1991; Nakabeppu och Nathans, 1991; Yen et al., 1991). Liksom full-längd-FosB har ΔFosB en DNA-bindande grunddomän och en leucin-blixtlås genom vilken den dimeriserar med Jun-proteiner för att bilda transkriptionsfaktorkomplex för aktivatorprotein-1 (AP-1) som reglerar uttrycket av många gener (Morgan och Curran, 1995; Rylski och Kaczmarek, 2004). Trots att en del saknas av transactivation domänen som finns i C-terminalen av FosB, fungerar AFosB som både en potent transkriptionsaktivator och repressor i odlade celler och i hjärnan (Dobrazanski et al., 1991; Nakabeppu och Nathans, 1991; Chen et al., 1997; McClung och Nestler, 2003; Kumar et al., 2005).

ΔFosB induceras till höga nivåer på ett regionspecifikt sätt i hjärnan efter kronisk men inte akut exponering för en mängd olika psykoaktiva stimuli, inklusive stress, vissa lesioner, antipsykotiska och antidepressiva läkemedel, missbruksmedel och naturliga belöningar (Hopp et al., 1994b; Hiroi och Graybiel, 1996; Moratalla et al., 1996; Bing et al., 1997; Mandelzys et al., 1997; Kelz et al., 1999; Werme et al., 2002; Andersson et al., 2003; Colby et al., 2003; Peakman et al., 2003; Perrotti et al., 2004; Zachariou et al., 2006). Induktionen av ΔFosB har varit direkt relaterad till de funktionella effekterna av flera av dessa stimuli i hjärnan. Persistensen av ΔFosB, även i frånvaro av ytterligare stimulering, skiljer den från alla andra Fos-familjetransskriptionsfaktorer, vilka induceras snabbt som svar på akuta stimuli, sönderfall tillbaka till basala nivåer inom några timmar och visar generellt desensibilisering efter kronisk stimulering (Hopp et al., 1992; Daunais et al., 1993; Persico et al., 1993; Hiroi och Graybiel, 1996; Perrotti et al., 2004). Detta gör ΔFosB till en attraktiv kandidat för att medla några av de långvariga förändringarna i genuttryck som ligger till grund för de stabila neuronala anpassningarna som orsakas av vissa kroniska stimuli.

Eftersom den långvariga närvaron av AFosB inträffar i frånvaro av ytterligare induktion av dess mRNA (Chen et al., 1995) spekulerade vi att, till skillnad från full längd FosB och alla andra Fos-familjeproteiner, som är i grunden instabila, kan ΔFosB vara en ovanligt stabil transkriptionsfaktor (Hopp et al., 1994b; Chen et al., 1997; Nestler et al., 2001; McClung et al., 2004). Vidare föreslog immunoblottande analys av akut-versus kronisk stimulerad hjärnvävnad att ΔFosB skiftar i uppenbart Mr (molekylmassa) från ~33 kDa i akut tillstånd till ~35-37 kDa under kronisk behandling (Hopp et al., 1994a; Chen et al., 1995). Eftersom det inte finns några bevis för förekomsten av ytterligare mRNA som kan kodas för dessa olika isoformer, spekulerade vi vidare att ΔFosB är posttranslationellt modifierad och det kan kanske bidra till dess ovanliga stabilitet. Hittills har dock inga biokemiska analyser av omsättning eller posttranslationella modifieringar av ΔFosB rapporterats. Målet med föreliggande studie var att avgöra om ΔFosB är ett fosfoprotein och om fosforylering spelar en roll i dess stabilitet.

Föregående avsnittNästa avsnitt

Material och metoder

Mammaliska cellinjer och DNA-konstruktioner.

PC12 celler (Clontech, Mountainview, CA) odlades i hög-glukos DMEM innehållande L-glutamin (L-Gin) och kompletterades med 5% fetalt bovint serum (FBS), 10% hästserum (båda från Invitrogen, Carlsbad, CA) , 100 U / ml penicillin och 100 μg / ml streptomycin (båda från Sigma-Aldrich, St. Louis, MO). HeLa-celler (American Type Culture Collection, Manassas, VA) odlades i DMG med hög glukos innehållande L-Gln och kompletterat med 10% FBS, penicillin och streptomycin. Båda cellinjerna bibehölls vid 37 ° C i en fuktig 5% CO2 atmosfär.

För de transienta transfektioner med DNA, var PC12 eller HeLa-celler såddes ut på sex-brunnars plattor (belagda med kollagen I för PC12 celler) så att den når 90-100% konfluens nästa dag och transfekterades sedan med användning av Lipofectamine 2000 (Invitrogen). I vissa experiment (se Fig. 1-7), ΔFosB uttrycktes transient i PC12-celler via infektion med rekombinant herpes simplexvirus (HSV).

ΔFosB- och FosB-cDNA erhölls från våra egna pTetop-konstruktioner (Chen et al., 1997) och subklonas i en pcDNA3.1 vektor (Invitrogen). Dessa pcDNA3.1-AFosB / FosB-konstruktioner användes för uttryck i däggdjursceller och som en mall för ställdriktad mutagenes. Rekombinant HSV-AFosB framställdes såsom beskrivits tidigare (Neve et al., 1997), och preparatet hade en titer av ~1 × 108 pfu / ml.

Pulse-chase-experiment.

Approximativt 24 h efter infektion / transfektion, celler (PC12 eller HeLa) i sex-brunnars plattor tvättades två till tre gånger med 2 ml PBS och inkuberades vid 37 ° C under ~1 h i 2 ml Cys / Met-fritt DMEM (Invitrogen) kompletterat med 5% dialyserad FBS (Hyclone, Logan, UT) för att bryta ut intracellulära pooler av Met and Cys. Vid slutet av denna "svält" -period tillsattes läkemedel (om celler skulle behandlas) och celler märktes (puls) med 12-25 μCi av 35S Protein Märkning Mix (SPerkinElmer, Wellesley, MA) för ~1 h vid 37 ° C för att märka alla nyssyntetiserade proteiner. Radiomärkaren avlägsnades sedan genom att tvätta cellerna två till tre gånger med 2 ml PBS och 35S-märkta proteiner följdes (chase) genom att ersätta mediet med "kallt" (icke-radioaktivt) medium kompletterat med 5% FBS och skörda cellerna vid olika tidpunkter. Cellbehandlingar upprätthölls under hela jakten. Alla siffror i dessa experiment visar liknande initiala mängder av de olika proteinerna för att optimera jämförelser av deras omsättningshastigheter.

Djur och kronisk elektrokonvulsiv anfallsprocess.

Vuxna Sprague Dawley hanrotter (200-300 g; Charles River Laboratories, Kingston, RI) behandlades en gång dagligen med elektrokonvulsiva anfall (ECS) för 7-9 d. ECS utfördes såsom beskrivits tidigare (Hopp et al., 1994a) med en Ugo Basile (Comerio VA, Italien) ECS-enhet med följande inställningar: frekvens, 100-pulser / s; puls med, 0.5 ms; chock varaktighet, 1.0 s; och ström, 75 mA. Sham-kontrolldjur behandlades parallellt genom att applicera öronklämmelektroderna utan någon elektrisk ström.

32 P metabolisk märkning.

För märkning av hjärnskivor deapiterades råttor, hjärnorna dissocierades snabbt och 300 μm främre kortikala skivor framställdes med en DSK-mikrosläckare (Ted Pella, Redding, CA). Skivorna inkuberades inuti plaströr i 2 ml fosfatbristig artificiell CSF (ACSF) och hölls vid 30 ° C under konstant mild bubbling med en O2/ CO2 blandning (Hemmings et al., 1989). Skivorna (två skivor per rör) märktes med 1.3 mCi för 8-10h i närvaro eller frånvaro av okadainsyra (100 ng / ml). Vid slutet av denna inkubation sköljdes skivorna åtminstone tre gånger med kall ACSF och homogeniserades sedan genom sonikering i 250 ^ i kall radioimmunutfällningsanalys (RIPA) -buffert [PBS, pH 7.4, 150 mm NaCl, 1% (volym / volym) ) Igepal, 0.5% (vikt / volym) natriumdeoxikolat, 0.1% (vikt / volym) SDS, 1 mm EDTA] tillsatt före användning med SDS upp till 0.6%, proteasinhibitorcocktail för däggdjursceller (använd vid 5 μl / ml; Sigma-Aldrich), fosfatasinhibitor cocktails I och II (används vid 1: 100; Sigma-Aldrich), 1 mm PMSF och 2% glycerol. Homogenat kokades sedan för 15 min och rensades genom centrifugering vid 15,000 × g för 15 min. Proteinkoncentrationen i de resulterande supernatanterna bedömdes med användning av BCA-proteinanalysen (Pierce, Holmdel, NJ).

För 32P-märkning av odlade celler, ~24h efter infektion / transfektion, celler tvättades två till tre gånger med fosfatfritt medium och inkuberades i detta medium för ~1 h. Efter denna svältperiod, 0.2-0.3 mCi av 32PH3PO4 (PerkinElmer) tillsattes till varje brunn och celler märktes för 4-12 h beroende på typen av experiment (se figurerna 1-7 för specifikationer). Cellerna tvättades sedan tre gånger med PBS och lyserades på is för 15 min med 50 / il kompletterad RIPA-buffert. Lysater uppsamlades genom skrapning och skedde 10 gånger genom en 25 ga nål till skjuv-DNA, kokades för 10 min och centrifugerades vid 15,000 rpm för 15-30 min vid 4 ° C. De rensade lysaten (supernatanter) överfördes till ett nytt rör och en BCA-proteinanalys (Pierce) utfördes. Alla figurer av dessa experiment visar liknande mängder av totalt vildtyp (WT) och S27A ΔFosB proteiner för att optimera jämförelser av deras relativa fosforyleringsnivåer.

Kemikalier och cellodlingsbehandlingar.

Okadainsyra (OA; Sigma-Aldrich) löstes i etanol och användes vid en slutlig koncentration av 100 ng / ml. 5,6-diklor-1-p-d-ribofuranosyl-bensimidazol (DRB; Biomol, Plymouth Meeting, PA) löstes i dimetylsulfoxid (DMSO; Sigma-Aldrich) och användes i cellodling vid en slutlig koncentration av 50 ^ im. Spermin (Sigma-Aldrich) löstes i vatten och användes vid en slutlig koncentration av 200 ^ im. Calphostin-C (Biomol) löstes i DMSO och användes vid 0.2 ^ im medan Phorbol 12-myristat 13-acetat (PMA; Promega, Madison, WI) löstes i DMSO och användes vid 0.1 ^ im. myristoylerad-autocamtid-2-relaterad hämmande peptid (m-AIP; Biomol) löstes i vatten och användes vid en slutlig koncentration av 1 och 10 ^ im. Bredspektrumproteinkinasinhibitorerna H-7 och H-8 (Biomol) löstes i vatten och användes vid en slutlig koncentration av 150 respektive 200 μm. MG132 (Calbiochem, San Diego, CA) och epoxomicin (Peptides International, Louisville, KY) löstes båda i DMSO och användes vid en slutlig koncentration av 12.5 respektive 7.5 μm. I alla experiment tillsattes DMSO (vehikel) till celler som är nödvändiga för att upprätthålla en konstant mängd DMSO över behandlingar. För 32P-märkningsexperiment, drogerna tillsattes omedelbart före etiketten och förvarades under de återstående av märkningstiden. För pulsjaktförsök tillsattes droger vid tiden för Cys / Met "svält", hålls genom märkningstiden och tillsattes sedan tillbaka i chase-mediet. Proteasomhämmarna spikades varje 3-4 h under hela jakten för att kompensera för dessa peptids snabba omsättning.

ΔFosB immunprecipitation, immunoblotting och autoradiografi.

För immunutfällningar späddes lysat 1: 5 med vanlig RIPA för att sätta SDS-koncentrationen ner till 0.1% innan man fortsatte med immunutfällning (IP). För att begränsa icke-specifik bindning, eliminerades lysaten först genom immunutfällning med nonimmun IgG och protein G-Sepharose (Sigma-Aldrich) för åtminstone 4 h. ΔFosB immunoprecipiterade sedan från de rensade lysaten med användning av en getpolyklonal antikropp som igenkänner en inre epitop närvarande i både FosB ochAFosB (SC-48G; Santa Cruz-bioteknik, Santa Cruz, CA) vid 0.5-1 / ig IgG per 10 / ig lysatprotein (50-300 μg totalprotein) i en total volym 0.5 ml. IP-skikten blandades försiktigt vid 4 ° C på en rotor i minst 8h och därefter tillsattes 15 / il protein G-Sepharose och IP-värden blandades i minst en annan 4 h. IP: er pelleterades genom att spinna vid 3000 × g för 3-5 min vid 4 ° C, tvättades tre gånger med 0.5 ml kall vanlig RIPA och två gånger med kallt PBS innehållande 0.1% Tween 20. IP-celler resuspenderades sedan i 0.5 ml kall PBS, överfördes, pelleterades i ett nytt rör och immunprecipiterade proteiner eluerades därefter genom tillsats av 15-25 / xl 2 × reducerande Laemmli proteinprovbuffert. Detta IP-protokoll resulterade i den specifika och effektiva fällningen av praktiskt taget alla AFosB i lysatet. De immunprecipiterade proteinerna utsattes för SDS-PAGE genom att ladda hela IP på en 12.5% Tris-HCl-kriterionsgel (Bio-Rad, Hercules, CA) och överfördes därefter till PVDF eller nitrocellulosa. Efter överföring lufttorkades membranet och 32P- och 35S-radiomärkta proteinband observerades genom autoradiografi med användning av Kodak (Rochester, NY) autoradiografisk film, såväl som genom fosforimaging med användning av en Storm (Amersham Biosciences, Piscataway, NJ) PhosphorImager. Totala (icke-fosforylerade och fosforylerade) FFosB i celllysat eller hjärnhomogenat detekterades genom immunoblottning av antingen det immunprecipiterade proteinet (med samma membran som användes för att detektera 32P-märkt protein) eller av lika stora mängder lysat / homogenatprotein utsatt för SDS-PAGE och överfört till PVDF eller nitrocellulosa. Membranet blockerades först genom att inkubera det med 1% (vikt / volym) icke-fet torrmjölk (Bio-Rad) i PBS kompletterad med 0.1% (volym / volym) Tween 20 (Sigma) för 1 h vid 25 ° C. Membranet immunblottades därefter över natten vid 4 ° C med vår egen kanin anti-FosB polyklonal antikropp genererad mot aminosyror 1-16 av FosB / FosB (använd vid 1: 10,000). Efter primär inkubation tvättades membran fyra gånger för 5 min med blockerande buffert och inkuberades sedan vid 25 ° C för ~1 h med en get anti-kanin-IgG konjugerad till pepparrotsperoxidas (använd vid 1: 5000 i blockerande buffert, från Vector Laboratories, Burlingame, CA). Membran tvättades sedan tre gånger för 10 min med blockeringsbuffert och en gång för 5 min med PBS. Totalt ΔFosB-proteinband visualiserades på Kodak MR-film genom förbättrad kemiluminescens (Pierce) och / eller genom detektion av fluorescens med användning av ECL-Plus-reagensema (Amersham Biosciences) och Storm PhosphorImager.

Overekspression och rening av rekombinantAFosB från insektsceller.

ΔFosB overexpressades i Sf9-insektsceller som ett N-terminus-hexa-His-märkt protein (N-His (6) FFB) med användning av Bac-to-Bac-baculovirusuttryckssystemet (Invitrogen) och följa tillverkarens instruktioner. I korthet subklonades ΔFosB-cDNA (rester 2-237) som föregick av den affinitets-N-terminala märkningen MGHHHHHHAG i pFASTBacTM1-vektorn, vilken användes för att generera rekombinant baculovirus. Sf9-celler infekterades med rekombinant virus och N-His (6) ΔFosB renades från celllysat genom flera kromatografiska steg innefattande affinitetskromatografi med användning av en nickelkolonn (Qiagen, Valencia, CA), anjonbytning med användning av en mono-Q-kolonn (Amersham Biosciences), och storlek uteslutning med hjälp av en gel filtrering kolonn (Amersham Biosciences).

In vitro fosforyleringsstudier.

In vitro fosforyleringsreaktioner för tidskurs och stökiometrianalys utfördes i en volym 30 ^ i innehållande 10 ^ m-substrat (N-His (6) FFosB eller ett positivt kontrollsubstrat), 250iM ATP och 1iCi / μl [y-32P] ATP, bufferten som levereras av kinasproducenten och en av följande kinaser: CK2 (20 ng / μl; Upstate, Charlottesville, VA), CaMKII (10 ng / μl; Upstate), PKC (1.6 ng / μl; Calbiochem) eller p70S6K (2.5 mU / μl; Upstate). Tidskursreaktioner utfördes genom att avlägsna 5 / I-alikvoter från reaktionslösningen vid de angivna tidpunkterna och tillsatte en lika stor volym 4 × reducerande Laemmli proteinprovbuffert. Michaelis-Menten-kinetiska parametrar för CK2-reaktionen bestämdes under empiriskt definierade linjära, stabila tillstånd. Dessa reaktioner utfördes för 15 min i en volym 10 / il innehållande 2 ng / μl enzym, 250 ^ ATP, 1 ^ Cl / μl [y-32P] ATP och N-His (6) FFosB-koncentrationer som sträcker sig från 2.5-30 ^ im. Alla reaktioner utfördes vid 30 ° C i ett vattenbad. Efter SDS-PAGE och färgning av gelén med Bio-Safe Coomassie (Bio-Rad) torkades gelén och 32P-fosfatinkorporering bedömdes genom fosforimaginganalys (se nedan, datakvantifiering, beräkningar och statistik).

Tweedimensionell fosfopeptidkarta och fosfosaminosyraanalys.

Båda dessa analyser utfördes såsom beskrivits av Ploegh och Dunn (2000). Kortfattat, torra gelfragment innehållande 32P-märkt ΔFosB (antingen från vitro reaktioner eller från immunoprecipitater av metaboliskt märkta celler), skäras ut, rehydreras, tvättas och utsätts för tryptisk digestion. Supernatanten innehållande tryptiska digestionsprodukterna lyofiliserades och lyofilatet tvättades flera gånger och resuspenderades i 10 / il elektroforesbuffert, pH 1.9. Prov (3 μl) upptäcktes på en cellulosa tunnskiktskromatografi (TLC) -platta (Analtech, Newark, DE) och separerades i en dimension genom elektrofores och den andra dimensionen genom stigande TLC. De resulterande fosfopeptidkartorna visualiserades genom autoradiografi och fosforimaging. För fosfonaminosyraanalys spjälkades 2 / il av de tryptiska digestema som hade återuppslamits i elektroforesbuffert ytterligare genom HCl-hydrolys vid 105 ° C för 25 min i 3 m HCl under en N2 atmosfär. Reaktionen stoppades genom en sexfaldig utspädning i vatten och blandningen lyofiliserades. Lyofilatet resuspenderades i 5 / il elektroforesbuffert, pH 1.9 och spotted på en cellulosa TLC-plattan tillsammans med fosfor-Ser, -Thr och -Tyr-standarder. Elektrofores utfördes över halva längden av TLC-plattan med användning av elektroforesbuffert, pH 1.9, och därefter överfördes plattan till pH 3.5-bufferten och elektrofores utfördes för att fullbordas. Fosforaminosyrastandarderna visualiserades genom sprayning av TLC-plattan med en 1% (volym / volym) ninhydrinlösning i aceton och 32P-märkta aminosyraprover visualiserades genom både autoradiografi och fosforimaging.

siRNA-inducerad CK2a-knock-down.

Vi använde en RNA-interferensmetod för att selektivt slå ner nivåerna av CK2 (Di Maira et al., 2005). PC12-celler såddes på kollagen I-belagda plattor med 6 brunnar för att nå ~70-80% konfluens nästa dag när de transientvis transfekterades med 20 nm (slutkoncentration) av antingen icke-målgivande siRNA eller siRNA riktade mot mRNA av katalytisk a-underenhet av råtta CK2, med användning av 5 / il av transfektionsmedlet SilentFectin (Bio-Rad) och enligt tillverkarens instruktioner. Cirka 24 h senare transfekterades celler transientvis med AFosB-plasmid, såsom angivits ovan. Cirka 24 h senare (~48h efter siRNA-transfektion) utsattes cellerna för antingen 32P metabolisk märkning eller puls-chase-analys som beskrivits ovan. Följande fyra CK2a siRNA användes med liknande resultat: 5'P-CAAACUAUAAUCGUACAUCUU3 ', 5'P-UCAAUCAU-GACAUUAUGCGUU3', 5'P-UAGUCAUAUAAAUCUUCCGUU3 ', 5'P-AAAUCCCUG ACAUCAUAUUUU3' (Dharmacon, Lafayette, CO). Som en negativ kontroll använde vi Ljuddämpare negativ kontroll #3 siRNA från Ambion (Austin, TX). Omfattningen av CK2-knock-downen övervakades genom immunoblottning med användning av en anti-CK2 polyklonal antikropp (katalog # 06-873 från Upstate) över natten vid en 1: 1000-spädning. p-tubulin användes som en laddningskontroll och detekterades med en monoklonal antikropp (katalog # 05-661 från Upstate) över natten vid en 1: 20,000-spädning.

Site-directed mutagenesis.

Mutation av Ser27 till Ala eller till Asp uppnåddes med användning av ett Quick Change Site-Directed Mutagenesis kit (Stratagene, La Jolla, CA) och följa tillverkarens instruktioner. För att introducera Ser27-mutationerna i musAFosB-proteinet användes följande mutagenesprimrar. Ser27 till Ala: (reverse primer) 5'GCCGAAGGAGTCCACCGAAGCCAGGTACTGAGACTCGGCGGAGGG3 ". Ser27 till Asp (framåtriktad primer) 5'CCCTCCGCCGAGTCTCAGTACCTGGATTCGGTGGACTCCTTCGGC3 ". De muterade baserna är i fetstil och Ser27-kodonen är kursiv.

Bioinformatik.

Potentiella fosforyleringsställen och kinaserna för ΔFosB söktes genom att inlämna musproteinsekvensen till specialiserade databaser inklusive ProSite (http://www.expasy.org/prosite/), PredictProtein (Rost et al., 2004) och NetPhosK (Blom et al., 2004).

Datakvantifiering, beräkningar och statistik.

Mängden protein närvarande i PVDF- eller nitrocellulosemembranet kvantifierades med användning av en Storm PhosphorImager och den medföljande ImageQuant mjukvaran (Amersham Biosciences / Molecular Dynamics). I cellkultur- och hjärnskiva-fosforyleringsstudierna uppnås de värden som erhållits för 32P-märkt protein dividerades därefter med de erhållna värdena för totalt ΔFosB och uttrycktes som ett förhållande. I vitro fosforyleringsstudier, mängden av 32P-märkt ΔFosB per mol avFosB (stökiometri) beräknades som beskrivits tidigare (Sahin et al., 2004). Alla mätningar gjordes inom linjäritetsområdet för det använda instrumentet. Kinetiska parametrar beräknades med användning av Michaelis-Menten-modellen, varigenom V = Vmax[S] / ([S]+KM) Och Vmax = k2[ETotalt]. Halveringstiden (t1 / 2) av ΔFosB och FosB uppskattades från pulschase-diagrammen (med den icke-linjära regressionen som bäst passade datapunkterna) och motsvarar den tid då mängden kvarvarande protein är 50% av originalet. I alla figurer är de visade resultaten representativa för minst två till tre oberoende experiment. I alla grafer är de visade uppgifterna medelvärden ± SEM (3 ≤ n ≤16). Den statistiska signifikansen av skillnaderna bedömdes med användning av en opparad t test, korrigerat för flera jämförelser, och asteriskerna indikerar p ≤ 0.05.

Föregående avsnittNästa avsnitt

Resultat

ΔFosB är en ovanligt stabil transkriptionsfaktor

Även om vi tidigare har spekulerat att ΔFosB är en relativt stabil transkriptionsfaktor (Nestler et al., 2001) har en direkt analys av proteinets omsättningsprofil hittills inte gjorts. För att ta itu med denna fråga utförde vi pulssökningsförsök med användning av PC12-celler, vilka har använts i stor utsträckning som en neuronliknande cellinje, där ΔFosB transient uttrycktes via infektion med ett rekombinant herpes simplexvirus (HSV-ΔFosB). Nya syntetiserade proteiner märktes metaboliskt med 35S-Met / Cys och nedbrytningsmönstret för 35S-märkt FFosB (35S-AFosB) övervakades genom immunutfällning av det från celllysat erhållna vid olika tidpunkter efter avlägsnande av de radioaktivt märkta aminosyrorna. Analys av immunprecipitaterna med SDS-PAGE och autoradiografi avslöjade att halveringstiden för FFosB i PC12-celler är ~10h (Fig 1). Dessa resultat visar att halveringstiden för ΔFosB är högre än för de flesta inducerbara transkriptionsfaktorerna (se Diskussion), inklusive full längd FosB, vars halveringstid i cellodling har rapporterats vara ~90 min (Dobrazanski et al., 1991; Carle et al. 2004). Dessutom är det värt att notera att nedbrytningen av ΔFosB inte passar en första gradens exponentiell sönderfallskurva, utan snarare är den bifasisk, och börjar med en långsammare nedbrytningshastighet. Detta föreslår förekomsten av mer än en ΔFosB-typ och / eller mer än en nedbrytningsväg.

Figur 1.

Visa större version:

Figur 1.

ΔFosB är en ovanligt stabil transkriptionsfaktor. Halveringstiden för ΔFosB är ~ 10h i cellodling. ΔFosB uttrycktes i PC12-celler genom antingen infektion med HSV-AFosB eller transienttransfektion med FFB-innehållande plasmid, och celler utsattes för pulsjaktförsök som beskrivs i Material och Metoder. Ekvivalenta resultat erhölls oavsett vilken metod som användes för att överuttrycka ΔFosB. Figuren visar tidskursen (och representativt autoradiogram) av ΔFosB-nedbrytning. De data som ritats är medelvärdet ± SEM av åtminstone 15 individuella datapunkter erhållna från åtminstone fem oberoende experiment. Som jämförelse anges den rapporterade halveringstiden för FosB med full längd.

ΔFosB är ett fosfoprotein i hjärnan

Vi har antagit att posttranslationell modifiering av ΔFosB kan bidra till dess uppenbara stabilitet. Eftersom fosforylering har visat sig modulera aktiviteten hos transkriptionsfaktorer på många sätt, inklusive deras stabilitet (för översyn, se Desterro et al., 2000; Whitmarsh och Davis, 2000) undersökte vi om ΔFosB är ett fosfoprotein. För detta ändamål inducerades ΔFosB-uttryck i råtthjärna med användning av kronisk ECS, en behandling som är känd för att inducera höga nivåer avFosB, särskilt i främre cortex (Hopp et al., 1994a). En dag efter den sista ECS-behandlingen, när ΔFosB-nivåer förblir höga, framställdes tunna främre kortikala skivor och metaboliserades med 32P-ortofosfat. En parallell uppsättning skivor var inte radiomärkt, och dessa användes för att detektera totala ΔFosB-nivåer. Efter immunutfällning med en specifik anti-FosB / AFosB-antikropp och separation av de immunprecipiterade proteinerna med SDS-PAGE fosforylerades 32P-märkt ΔFosB detekterades genom autoradiografi, medan totalt ΔFosB detekterades genom immunoblottning. Denna analys avslöjade att ΔFosB fosforyleras i hjärnan, vilket framgår av en specifik 32P-märkt band av ~35 kDa närvarande i de kroniskt behandlade hjärnproverna, men är praktiskt taget odetekterbar i de skambehandlade kontrollerna (Fig 2A). Detta stämmer överens med att basala nivåer av ΔFosB i avsaknad av kronisk stimulering är mycket låga. Specificiteten av immunutfällningsreaktionen illustreras genom avsaknaden av signal i den icke-immune IgG-fällningen.

Figur 2.

Visa större version:

Figur 2.

ΔFosB är ett fosfoprotein i hjärnan. A, ΔFosB fosforyleras i hjärnan. Endogena ΔFosB inducerades i råtthjärna genom kronisk ECS-behandling såsom beskrivits i Material och Metoder. Frontala kortikala skivor märktes metaboliskt med 32PH3PO4 i flera timmar. Efter homogenisering av skivorna immuniserades ΔFosB och fosforylerade ΔFosB (32P-ΔFosB) detekterades genom autoradiografi (topppanel). Totalt ΔFosB i icke-radioaktiva immunprecipitater detekterades genom immunoblottning (bottenpanel). Som negativa kontroller visas immunutfällningen av ett skambehandlat djur och icke-immun IgG. B, Kandidatfosforyleringsställen och kinaser med motsvarande prediktionspoäng för mus-AFosB-proteinsekvensen erhölls genom bioinformatisk analys. Kandidatställena med de högre prediktionsresultaten markeras i proteinsekvensen och anges i tabellen. Den DNA-bindande (basala) domänen och leucin-dragkedjan är djärva i proteinsekvensen. C, D, ΔFosB-fosforylering ökar med Ser / Thr-fosfatashämmaren OA. C, 32P-ΔFosB-nivåer i immunoprecipitater från frontala kortikala skivor märkta i frånvaro (Ctr) eller närvaro av 100 ng / ml OA (graf och topppanel) detekterades genom autoradiografi. Bottenpanelen visar totalt ΔFosB detekterat i immunprecipitater från omärkta skivor genom immunoblottning. D, PC12-celler infekterades med HSV-FosB eller HSV-LacZ (vektor) och metaboliserades med 32PH3PO4 i frånvaro (Ctr) eller närvaro av 100 ng / ml OA. 32P-ΔFosB-nivåer i immunoprecipitater detekterades genom autoradiografi (graf, topppanel). Bottenpanelen visar totalt ΔFosB detekterat i celllysat genom immunoblottning.

Som ett första steg mot att belysa vilka kinaser och satser som är involverade i fosfB-fosforylering utsattes vi dess aminosyrasekvens för flera bioinformatiska analyser. Detta avslöjade att även om ΔFosB inte innehåller några Tyr-fosforyleringskandidatställen innehåller den flera Ser / Thr-kinas-konsensusställen, innefattande tre CaMKII-ställen, tre CK2-ställen och två PKC-ställen med mycket höga fosforyleringspredictionspoäng (Fig 2B). Om, som förutsatt genom bioinformatik, endast fosfyleras på Ser eller Thr-rester, bör dess fosforylering moduleras signifikant genom aktiviteten av Ser / Thr-fosfataser. För att testa den här hypotesen märkte vi frontala kortikala skivor med 32P-ortofosfat i närvaro eller frånvaro av OA, en Ser / Thr-proteinfosfatashämmare. Som visas i Figur 2C, Orsakade OA en stor (~2.5-faldig) ökning i 32P-ΔFosB. Det orsakade också en liten ökning av totala ΔFosB-nivåer, vilket överensstämmer med tidigare rapporter som kopplar de cancerframkallande effekterna av OA till förmågan att inducera flera omedelbara tidiga gener inklusive Fos-proteiner (Miller et al., 1998; Choe et al., 2004). Nettoresultatet är en signifikant total ökning (~60%) i fosforylerade ΔFosB-nivåer.

Vi undersökte sedan huruvida i PC12-celler, vilka är mer mottagliga för experimentell manipulation, visar ΔFosB ett fosforyleringsmönster som liknar det som ses i hjärnan. Vi uttryckte ΔFosB i PC12-celler via infektion med HSV-FosB och metaboliserade cellerna med 32P-ortofosfat i närvaro eller frånvaro av OA. Det framgångsrika uttrycket och immunutfällningen av proteinet från HSV-AFosB-infekterade celler visas genom närvaron både i immunoblottet (Fig 2D, bottenpanel) och autoradiografen (topppanel) av ett ~35 kDa band, frånvarande i de vektorinfekterade cellerna. Som observerats i hjärnan orsakade OA en liten ökning av totala ΔFosB-nivåer men en mycket högre (ungefär tvåfaldig) ökning i 32P-ΔFosB, vilket resulterar i en signifikant (~50%) nettoökning i FFB-fosforylering. Vidare resulterade behandling av PC12-celler med en Tyr-fosfatashämmare inte i betydande förändringar i 32P-ΔFosB-nivåer (data ej visad). Tillsammans avslöjade dessa fynd att ΔFosB fosforyleras på ser och / eller Thr-rester i hjärnan och i PC12-celler och bekräftade att det senare är ett bra cellodlingssystem för att ytterligare studera fosforylerings- och nedbrytningsprofilerna avAFFB.

CK2 men inte PKC eller CaMKII fosforylerar ΔFosB vitro

Såsom beskrivits ovan avslöjade analysen av ΔFosB-aminosyrasekvensen höga prediktionsresultat för CK2-, PKC- och CaMKII-fosforyleringsställen. För att bestämma vilka av dessa kinaser som kan fosforylera ΔFosB utförde vi en serie av vitro fosforyleringsreaktioner med användning av renade kinaser och renad rekombinant ΔFosB. Som visas i Figur 3Aav de tre kandidatkinaserna, endast CK2-fosforylerade ΔFosB på ett signifikant sätt. Dessutom testades flera andra kinaser (t.ex. GSK3 och p70S6K) men misslyckades med att avsevärt fosforylera ΔFosB (data ej visade). Ytterligare karakterisering av CK2-reaktionen genom tidskursanalys visade att denna kinas kan katalysera inkorporeringen av ~0.5 mol fosfat per mol avFosB (Fig 3B). Det faktum att CK2 kan fosforylera ΔFosB vitro till en avsevärd stökiometri (~50%) tyder på en fysiologiskt relevant reaktion. Vi studerade sedan kinetiken för denna reaktion genom att inkubera CK2 i närvaro av ökande mängder renat FFosB, och vi bestämde att CK2 fosforylerar ΔFosB med en Vmax av 5.8 pmol · min-1 · Μg-1 av enzym, a KM av 18.4 μm och a khur av 0.2 / s (Fig 3C). De värden som erhållits för dessa kinetiska parametrar stöder vidare den fysiologiska relevansen av denna reaktion. Till exempel, KM av CK2 för DARPP32, ett av dess mest kända substrat, är 3.4 μm och khur är ~ 0.3 / s (Girault et al., 1989); de KM för ATP varierar från ~10-40 μm (Cochet et al., 1983; Silva-Neto et al., 2002) och att för kasein varierar från ~10-50 μm (Meggio et al., 1977; Pyerin et al., 1987). Tillsammans indikerar dessa data att ΔFosB är ett bona fide substrat för CK2 vitro.

Figur 3.

Visa större version:

Figur 3.

CK2 men inte PKC eller CaMKII fosforylerar ΔFosB vitro. Autoradiografen (toppanel) visar den fosforylerade produkten och den Coomassie-färgade gelén (bottenpanelen) visar totalt ΔFosB närvarande i reaktionen. ARenades rekombinant ΔFosB vitro fosforylering av olika kandidatkinaser (av vilka tre visas). B, Tidskurs och stökiometriska analyser indikerar att CK2 kan fosforylera ΔFosB vitro med en stökiometri av ~ 50%. CKinetisk analys av CK2-reaktionen avslöjade att ΔFosB är en bona fide vitro substrat. Linjäriseringen av reaktionen visas i en dubbel-reciprocal plot (botten), men de kinetiska parametrarna härleddes från Michaelis-Menten-kurvan (topp).

CK2 modulerar fosforyleringen och stabiliteten av FFosB i intakta celler

För att bedöma den fysiologiska relevansen av CK2-medierad fosforylering av ΔFosB utförde vi jämförande fosfopeptidkartläggning med användning av vitro fosforylerad och PC12-cell-fosforylerad ΔFosB. Efter SDS-PAGE och geleluering av 32P-ΔFosB (från vitro reaktioner eller från immunprecipitatet av 32P-märkta celler), proteinet digererades med trypsin och de resulterande fosfopeptiderna utsattes för tvådimensionell separation. Denna analys avslöjade att den huvudsakliga fosfopeptiden från CK2-reaktionen comigrerades med en av två huvudfosfopeptider från ΔFosB fosforylerad i PC12-celler (Fig 4A), medan fosfopeptiderna som resulterade från reaktionen PKC eller CaMKII (data ej visad) inte gjorde. Det fanns en andra FFB-fosfopeptid närvarande i kartan från PC12-celler, men på grund av oförmågan hos någon av kinaserna har vi testat för att alstra en liknande fosfopeptid vitro, vet vi inte för närvarande om den andra fosfopeptiden innehåller en fosforyleringsplats som skiljer sig från den andra fosfopeptiden eller huruvida den representerar en distinkt tryptisk peptid innehållande samma fosforyleringsställe.

Figur 4.

Visa större version:

Figur 4.

CK2 modulerar fosforyleringen och stabiliteten av FFosB i intakta celler. A, CK2 men inte PKC verkar fosforylera ΔFosB i celler. Tweedimensionella fosfopeptidkartor av ΔFosB fosforylerad av CK2 eller PKC vitro eller genom intakta PC12-celler. Pilarna visar komitrationen av den CK2-fosforylerade peptiden men inte den PKC-fosforylerade en med en av fosfB-fosfopeptiderna erhållna från PC12-celler. B, ΔFosB-fosforylering i PC12-celler ökar genom att behandla celler med den potenta CK2-aktivitetsspermin (SP) och minskas genom behandling med CK2-hämmaren DRB. I motsats till detta påverkades ΔFosB-fosforylering i PC12-celler inte av behandling med antingen en PKC-aktivator (PMA) eller den PKC-specifika hämmaren calphostin-C (Calph). Ett representativt autoradiogram (topppanel) och immunoblott (bottenpanel) visas. C-FEffekt av CK2-aktivitet på ΔFosB-stabilitet. Figurerna visar tidskursen (och representativt autoradiogram) av ΔFosB-nedbrytning. PC12-celler som transient uttryckte ΔFosB utsattes för puls-chase-experiment som utfördes i frånvaro eller närvaro av CK2-hämmaren DRB (C), CK2-aktivator-spermin (D) eller bredspektrumkinashämmaren H-8 (E), som användes för att kontrollera för de icke-specifika effekterna av DRB. FEffekt av att knacka ner den katalytiska subenheten av CK2 på ΔFosB-stabilitet. PC12-celler transfekterades med antingen en non-targeting siRNA (Ctr) eller siRNA-riktade råtta CK2a och 24 h transfekterades senare med en AFosB-plasmid. Den övre panelen avbildar immunoblots av helcellslysater som visar effekten av CK2 siRNA på CK2- och FFB-proteinnivåer. Den motsvarande immunobloten för p-tubulin visas som en laddningskontroll.

För att ytterligare adressera den fysiologiska relevansen av CK2 som ett FosB-kinas behandlade vi FFB-uttryckande PC12-celler med två läkemedel som modulerar CK2-aktivitet. Som visas i Figur 4B, ΔFosB-fosforylering minskade genom behandling av PC12-celler med den cellgenomsläppliga CK2-hämmaren DRB (Meggio et al., 1990; Szyszka et al., 1995) och ökat genom behandling med polyaminsperminen, som är känd för att vara en potent CK2-aktivator (Cochet och Chambaz, 1983; Meggio et al., 1983). I motsats härtill behandlades PC12-celler med PKC-hämmaren calphostin-C (Kobayashi et al., 1989; Tamaoki et al., 1990) eller PKC-aktivatorn PMA (Schmidt och Hecker, 1975; Beh et al., 1989) resulterade inte i signifikanta förändringar i ΔFosB-fosforylering. I fallet med PMA är den lilla (och inte signifikanta) ökningen i 32P-ΔFosB kunde redovisas genom en ökning av totala FFosB-nivåer orsakade av detta läkemedel; i själva verket har det rapporterats att fosbolestrar inducerar uttryck av flera Fos-familjeproteiner, inklusive FosB (Yoza et al., 1992; Suh et al., 2004). Vidare behandlas celler med den specifika cellgenomsläppliga CaMKII-hämmaren m-AIP (Ishida och Fujisawa, 1995; Stevens et al., 1999) resulterade inte heller i minskad ΔFosB-fosforylering (data ej visad). Tillsammans är dessa resultat förenliga med vårt vitro fynd och indikerar att i intakta celler är fosfB sannolikt fosforylerat med CK2 men inte PKC eller CaMKII. Det faktum att CK2-inhibering inte helt hindrar AFosB-fosforylering indikerar förekomsten av ytterligare fosforyleringsställen i proteinet.

Vi undersökte därefter om CK2 spelar en roll i omsättningen för ΔFosB och därigenom i dess stabilitet. För detta ändamål utförde vi pulssökningsförsök med användning av FFB-uttryckande PC12-celler behandlade med antingen CK2-hämmaren eller CK2-aktivatorn som användes i fosforyleringsstudien. Som visas i Figur 4Cbehandling av celler med CK2-hämmaren DRB hade en signifikant effekt på omsättningshastigheten för ΔFosB, vilket framgår av förändringen i formen av dess nedbrytningskurva, från bifasisk till en kurva som är närmare den för en exponentiell sönderfall. Omvänt orsakade närvaron av CK2-aktivatorns spermin en signifikant minskning av nedbrytningshastigheten för AFosB, vilket ledde till ackumulationen av proteinet under de första timmarna av jakten (Fig 4D).

Såsom är fallet med många kinasaktivatorer och inhibitorer kan spermin och DRB ha metaboliska effekter utanför moduleringen av CK2-aktivitet. I själva verket har DRB visat sig inhibera transkriptionsfaktorn IIH (TFIIH) -associerat kinas (Yankulov et al., 1995), vilket resulterar i inhibering av RNA-polymeras II-medierad transkription. Eftersom denna effekt skulle kunna påvisa stabiliteten hos ΔFosB analyserade vi effekten av den breda spektrumkinashämmaren H-8 (Hidaka och Kobayashi, 1992) på ΔFosB-omsättning vid en koncentration (200 μm) som är känd för att hämma TFIIH-associerad kinas men inte CK2 (Yankulov et al., 1995). Som visas i Figur 4E, påverkar behandlingen med H-8 inte omsättningshastigheten för ΔFosB. Liknande resultat erhölls med H-7, en annan bredspektrumkinashämmare, använd vid en koncentration som hämmar TFIIH-associerad kinas men inte CK2 (data ej visad). Dessa data stöder vidare tolkningen att minskningen av ΔFosB-stabilitet orsakad av DRB troligen är hänförlig till hämning av CK2.

För att ytterligare fastställa rollen som CK2 i ΔFosB omsättning undersökte vi konsekvenserna av att slå ner CK2 via siRNA. Vi utförde dessa experiment med användning av PC12-celler som först transfekterades med kontroll (nontargeting) siRNA eller ett siRNA som riktar sig mot mRNA för den katalytiska subenheten av råtta CK2 (CK2α) och 24 h transfekterad senare med ΔFosB. Som visas i Figur 4F, transfektion med CK2a siRNA effektivt och specifikt knackade ner CK2a proteinnivåer utan att påverka FosB-nivåer (topppanel). Pulssökanalys visade att nedslagning av CK2 resulterade i en signifikant ökning av ΔFosB-omsättningsgraden, vilket framgår av den snabbare försämringen av proteinet. Det faktum att inhibering av CK2-aktivitet (antingen via DRB-behandling eller siRNA) ökar omsättningen av ΔFosB och resulterar i försvinnandet av den långfrekventa komponenten i bifasisk kurva, medan CK2-aktivering ökar kurvens långa fas, ger starkt stöd för Tanken att CK2 spelar en roll för att reglera ΔFosB-stabilitet.

CK2 fosforylerar ΔFosB på Ser27

För att börja identifiera sätet / platserna på ΔFosB fosforylerat av CK2 utförde vi fosfonaminosyraanalys av rekombinant ΔFosB fosforylerad av CK2 vitro och av fosfosyleras i PC12-celler. Dessa försök avslöjade att i båda fallen den enda fosfonaminosyran detekterades var fosfor-Ser (Fig 5A). Detta resultat, tillsammans med stökiometrin erhållen för CK2 vitro fosforyleringsreaktion (~50%) (Fig 3B) och närvaron av endast en signifikant punkt på CK2 fosfopeptidkartan (Fig 4A), föreslår att CK2-fosforylering av ΔFosB troligen är begränsad till en enda serinrest. Denna slutsats överensstämmer med analysen av fosforyleringskonsensusställe (Fig 2B), som förutspådde endast en kandidat serin, dvs Ser27, för CK2. Taxonomisk analys avslöjade att Ser27 är starkt bevarad genom utveckling bland Fos familjemedlemmar (Fig 5B), vilket tyder på att det kan ha en viktig fysiologisk funktion.

Figur 5.

Visa större version:

Figur 5.

CK2 fosforylerar ΔFosB på Ser27. A, Fosforamino-syraanalys av CK2-fosforylerad (vitro) och PC12-cellfosforylerad ΔFosB som visar att i båda fallen den huvudsakliga återstoden fosforyleras serin. B, Korsanalys av FosB / ΔFosB-aminosyrasekvensen avslöjade hög bevarande av Ser27 bland Fos-familjemedlemmar från människa till zebrafisk (mörkmarkering). Den sura återstoden vid position + 3, som krävs för CK2-konsensusstället, är emellertid inte bevarad (ljusmarkering). CHeLa-celler transfekterades transientvis med antingen vildtyp ΔFosB (WT) eller AFosB innehållande en punktmutation för att ersätta Ser27 med Ala (S27A). Celler märktes metaboliskt med 32PH3PO4 och behandlas med vehikel eller med spermin (SP) för att aktivera CK2. Ett representativt autoradiogram (topppanel) och immunoblott (bottenpanel) av de erhållna FFB-immunprecipiterna visas. Immunutfällningen av mock-transfekterade celler (vektor) visas.

För att bestämma huruvida Ser27 fosforyleras i FFosB, muterade vi denna rest till Ala och analyserade konsekvenserna på fosforyleringsstatusen hos proteinet. För detta ändamål använde vi HeLa-celler (som kan transfekteras med högre effektivitet) för att transienta uttrycka antingen WT eller S27A-mutantAFFB. Cirka 24 h efter transfektion märktes cellerna metaboliskt med 32P-ortofosfat och helcellslysat framställdes. Efter immunutfällning och SDS-PAGE, 32P-ΔFosB detekterades genom autoradiografi och totalt ΔFosB genom immunoblottning. Som visas i Figur 5C (bottenpanel), ΔFosB detekterades inte i de vektortransfekterade cellerna, medan celler transfekterade med antingen WT- eller S27A-mutanten FFosB framgångsrikt uttryckte proteinet. Vi fann att S27A-mutationen orsakade en signifikant (~30%) reduktion i 32P-ΔFosB-nivåer (Fig 5C, topppanel och diagram), vilket indikerar att ΔFosB fosforyleras i Ser27 i levande celler. I ett försök att fastställa huruvida cellerna Ser27 faktiskt fosforyleras av CK2 jämförde vi förmågan hos CK2-aktivatorspermin att modulera fosforyleringen av WT och S27A ΔFosB. Som vi tidigare hade observerat i PC12-celler (Fig 4B), behandling av HeLa-celler med spermin ökade signifikant fosforylering av WT-proteinet. Det faktum att denna effekt minskades signifikant av S27A-mutationen (Fig 5C) stöder tolkningen att Ser27 i ΔFosB är ett fysiologiskt substrat för CK2.

Fosforylering av Ser27 reglerar stabiliteten av ΔFosB

Har fastställt att stabiliteten av ΔFosB minskar när CK2 hämmas och förstärks när CK2 aktiveras (Fig 4) och att CK2 fosforylerar ΔFosB på Ser27 (Fig 5) förutspådde vi att förhindrande av fosforylering av denna webbplats skulle destabilisera proteinet. Pulssökningsförsök utförda med HeLa-celler som transienter uttryckte antingen WT eller S27A-mutant FFosB avslöjade att S27A-mutationen, som förutsagt, resulterade i en signifikant ökning av graden av nedbrytning av ΔFosB och en samtidig minskning av halveringstiden för proteinet (Fig 6A). Vi undersökte sedan om denna regleringsmekanism också uppträder i den mer neuronliknande PC12-cellinjen. Dessa försök visade att, som vi hade observerat i HeLa-celler, orsakar S27A-punktmutationen en dramatisk minskning av halveringstiden för ΔFosB i PC12-celler (från ~11 till ~4 h) (Fig 6B). Det faktum att denna destabilisering liknar den som orsakas av CK2-inhibition eller knock-down (Fig 4) ger ytterligare stöd för tanken att CK2-medierad fosforylering av Ser27 reglerar stabiliteten av FosB. Ytterligare bevis för den regulatoriska rollen av Ser27-fosforylering på ΔFosB-proteinomsättning erhölls med användning av en fosfomimetisk Ser27 till Asp-mutation (S27D). S27D-mutationen betraktas som fosfomimetisk, eftersom den placerar en stor negativt laddad (karboxyl) grupp vid aminosyra 27 och därigenom mimar fosforyleringen av Ser27. Som visas i Figur 6C, orsakade S27D-mutationen motsatt effekt av S27A-mutationen och resulterade i ett protein som var signifikant stabilare än WT-proteinet. På samma sätt som effekten efter CK2-aktivering (Fig 4D) resulterade S27D-mutationen i ackumulationen och därmed ökade FosB-nivåer under de första timmarna av jakten.

Figur 6.

Visa större version:

Figur 6.

Fosforylering av Ser27 reglerar stabiliteten av ΔFosB. A, C, Pulse-chase-analys som visar effekten av Ser27-fosforylering på omsättningshastigheten för ΔFosB. Nedbrytningsprofilen och uppskattade halveringstider för vildtyp ΔFosB (WT), Ser27 till Ala-mutanten (S27A) och den fosfomimetiska Ser27 till Asp-mutanten (S27D) visas. Samma resultat erhölls i HeLa-celler (A) och PC12-celler (B, C).

Ser27-fosforylering stabiliserar FFosB genom att förhindra dess proteasomala nedbrytning

För att börja belysa mekanismen genom vilken fosforylering av Ser27 stabiliserar ΔFosB undersökte vi förmågan hos proteasominhibitorerna MG132 (Palombella et al., 1994; Tsubuki et al., 1996) och epoxomicin (Hanada et al., 1992; Kim et al., 1999) för att modulera nedbrytningshastigheten för WT och S27A-mutantAFFB. Pulsjaktförsök utfördes med användning av PC12-celler infekterade med en rekombinant HSV som uttrycker antingen WT eller S27AAFFB och behandlades med antingen DMSO eller en av de två proteasominhibitorerna. Dessa experiment avslöjade att även om nedbrytningshastigheten för WT-proteinet är relativt okänslig för närvaron av någon av de två proteasominhibitorerna (Fig 7A), den för S27A-mutanten är känslig för dessa läkemedel (Fig 7B). Detta indikerar att S27A-mutanten, till skillnad från WT-proteinet, är ett mål för proteasomal nedbrytning. Behandling av celler med antingen MG132 eller epoxomicin reverserade faktiskt effekten av S27A-mutationen på nedbrytningshastigheten för FFB, vilket framgår av en ökning i halveringstiden för S27A-mutanten från ~4 till ~ 9 h för MG132 och till ~ 12 h för epoxomicin (Fig 7B). Tillsammans indikerar dessa resultat att fosforylering av FosB på Ser27 skyddar proteinet från proteasomal nedbrytning och är därför väsentligt för dess ovanliga stabilitet.

Figur 7.

Visa större version:

Figur 7.

Fosforylering av Ser27 stabiliserar FFosB genom att förhindra dess proteasomal nedbrytning. A, B, Pulssökanalys med HSV-infekterade PC12-celler som visar nedbrytningsprofilen och uppskattade halveringstider för vildtyp ΔFosB (A) eller S27A ΔFosB (B) i frånvaro eller närvaro av någon av två proteasomhämmare [MG132 och epoxomicin (Epoxo)]. Notera det faktum att ingen drog har en signifikant effekt på omsättningen av vildtyp ΔFosB, medan behandling av celler med antingen proteasomhämmare resulterade i stabilisering av S27A ΔFosB. CEn modell för rollen av Ser27-fosforylering i förmågan hos ΔFosB att mediera långvarig hjärnplasticitet. När en gång inducerats stabiliseras en del av AFosB i hjärnan genom CK2-medierad fosforylering av S27. Detta leder till ackumulering, vilket i sin tur leder till långvariga förändringar i genuttryck. Dessa stabila förändringar i genuttryck bidrar till stabila beteendemässiga anpassningar. Omvänt resulterar defosforyleringen av S27 av Ser / Thr-fosfataserna PP1 och / eller PP2A i destabilisering av proteinet och dess behandling genom proteasomalmaskinen.

Föregående avsnittNästa avsnitt

Diskussion

I den föreliggande studien visar vi att ΔFosB har en halveringstid på ~10 h i cellodling, vilket gör den stabil jämfört med FosB i full längd och de flesta andra inducerbara transkriptionsfaktorer, vars halveringstid i cellodling kan vara så kort som några minuter och sällan överstiger 3 h (Hann och Eisenman, 1984; Dobrazanski et al., 1991; Roberts och Whitelaw, 1999; Ferrara et al., 2003; Hirata et al., 2004). Dessutom finner vi att ΔFosB fosforyleras i hjärnan och att dess fosforylering är känslig för PP1 / PP2A-hämmaren okadasyra. Våra cellodlingsstudier visar att stabiliteten av ΔFosB moduleras av CK2, med högre CK2-aktivitet som stabiliserar proteinet. Slutligen föreslår våra resultat att CK2 fosforylerar ΔFosB på en starkt konserverad N-terminus serin (S27) och visar att fosforylering av S27 skyddar FosB från proteasomal nedbrytning. Vi föreslår därför en modell där fosforylering av ΔFosB på S27 av CK2 är en kritisk regleringsmekanism för omsättning av ΔFosB (Fig 7C). Sådan fosforyleringsmedierad stabilisering av FFosB är funktionellt viktigt, eftersom ökade nivåer av FFosB i synnerhet hjärnregioner har visat sig direkt reglera många neuronala gener in vivo- och att utöva kraftiga beteendeeffekter i djurmodeller av flera neuropsykiatriska störningar (se Introduktion).

Fastän fosforylering är ett snabbt och reversibelt sätt att reglera transkriptionsaktiviteten hos vissa transkriptionsfaktorer, såsom CREB (cAMP-responselementbindande protein) (Bohmann, 1990), modulerar nedbrytningen av transkriptionsfaktorerna en ännu mer kraftfull (mindre lätt reversibel) form av reglering (Desterro et al., 2000). Transkriptionsfaktorer vars funktionella aktivitet regleras vid nivån av deras nedbrytning innefattar NFκB (Desterro et al., 2000), c-Myc (Sears et al., 1999) och c-Fos (Ferrara et al., 2003), bland andra. I många fall är fosforylering en nyckelregulator för stabiliteten hos en transkriptionsfaktor, vilket har visats för c-Fos (Okazaki och Sagata, 1995; Tsurumi et al., 1995), Fos-relaterat antigen-1 (Fra-1) (Flaska och Marshall, 2003), Fra-2 (Manabe et al., 2001), c-juni (Fuchs et al., 1996), JunB (Fuchs et al., 1997), ATF2 (Fuchs et al., 2000) och p53 (Buschmann et al., 2001). Våra studier lägger således ΔFosB till denna lista över transkriptionsfaktorer vars funktionella aktivitet regleras genom sin fosforylerade beroende stabilitet.

CK2 är ett allestädes närvarande och konstitutivt aktivt Ser / Thr-kinas som har> 300 påstådda substrat hittills identifierat och är inblandad i flera biologiska processer, inklusive celldöd och överlevnad (Litchfield, 2003; Unger et al., 2004), cellulära stressresponser (Yanagawa et al., 1997; Kato et al., 2003) och DNA-reparation och kromatinomvandling (Barz et al., 2003; Krohn et al., 2003). Mer än en tredjedel av de förmodade substraten av CK2 är proteiner som är involverade i reglering av genuttryck (Meggio och Pinna, 2003). Faktum är att CK2 har visat sig vara ett framträdande nukleärt kinas (Krek et al., 1992) (för granskning, se Yu et al., 2001) och att interagera med bZIP-domänerna av flera transkriptionsfaktorer (Yamaguchi et al., 1998). CK2-medierad fosforylering har också visat sig modulera nedbrytningen (antingen förstärkning eller minskning) av många proteiner, inklusive IkB (Schwarz et al., 1996), PTEN (Torres och Pulido, 2001), linsconnexin (Yin et al., 2000), kromatinassocierat protein HMG1 (Wisniewski et al., 1999) och flera transkriptionsfaktorer såsom HMGB (Stemmer et al., 2002), Myf-5 (Winter et al., 1997) och c-Myc (Channavajhala och Seldin, 2002). CK2 är mest riklig i hjärnan (Alcazar et al., 1988; Girault et al., 1990), och dess aktivitet har blivit implicerad i många aspekter av hjärnans funktion, inklusive neuronal överlevnad (Boehning et al., 2003), differentiering (Nuthall et al., 2004), jonkanalfunktion (Jones och Yakel, 2003; Bildl et al., 2004) och långsiktig potentiering och neuronal plasticitet (Diaz-Nido et al., 1992; Lieberman och Mody, 1999; Reikhardt et al., 2003).

Trots detta växande bevis för CK2s roll vid reglering av neuronfunktionen är lite känt om vad som styr dess aktivitet. CK2 anses vara konstitutivt aktiv med reglering av dess förmåga att fosforylera specifika substrat som förlitar sig mest på förändringar i dess intracellulära lokalisering (t.ex. cytosol mot kärna) (Ahmed och Tawfic, 1994; Yu et al., 1999). Denna information väcker en viktig fråga om vilka signaler som krävs för att inducera ΔFosB ackumulering i hjärnan efter kronisk stimulering (Fig 7C). Ett krav är upprepad aktivering av FosB gen och induktion av ΔFosB mRNA (Chen et al., 1995). Våra data indikerar att CK2 fosforylering av ΔFosB är kritisk för dess stabilitet, vilket tyder på att en andra signal kan vara nödvändig för de långsiktiga effekterna av ΔFosB på genuttryck, nämligen en signal som stimulerar fosforyleringen av protein med CK2. Detta kan innebära aktivering av CK2 med någon okänd mekanism eller dess translokation till kärnan. Alternativt kan CK2-fosforylering av FFosB vara konstitutiv, så att AsFosB-protein translateras som svar på varje stimulans, blir en del av den fosforylerad och därigenom stabiliserad, så att den med upprepad stimulation ackumuleras till höga nivåer i drabbade neuroner.

Våra resultat visar att CK2 och S27 sannolikt inte är det enda kinaset och den plats som är ansvarig för FosB-fosforylering, eftersom varken hämning av CK2 eller S27A-mutationen kunde fullständigt förhindra FosB-fosforylering. På samma sätt är det faktum att S27A-mutationen resulterar i en 30% -minskning i fosfor-FosB, vilket hävdar att S27 är en viktig fosforyleringsplats på proteinet. Vi undersöker emellertid andra förmodade kinaser och fosforyleringsställen på ΔFosB. I slutändan är det också viktigt att analysera fosforyleringen av S27 och andra fosforyleringsställen i FosB i hjärnan in vivo- efter olika typer av kronisk stimulering, exempelvis genom användning av masspektrometri eller fosfospecifika antikroppar.

Som nämnts ovan är S27 i ΔFosB högt bevarad under hela evolutionen och bland annat Fos-familjeproteiner. Konsensusplatsen för CK2 är emellertid inte: som visas i Figur 5B, endast FosB / AFosB (och Zebrafish xenolog), men inte c-Fos eller Fra-2, har en sur rest vid + 3, en nyckeldeterminant av CK2-fosforylering (Marin et al., 1986; Meggio et al., 1994). Således kan bristen på CK2-fosforylering på S27 förklara varför andra Fos-familjeproteiner inte är lika stabila som ΔFosB. Detta förklarar dock inte varför FOSB, som har samma CK2-konsensus som ΔFosB, inte stabiliseras på samma sätt. Vi vet inte om FosB i full längd fosforyleras av CK2 på denna konserverade återstod. De enda rapporterna från FosB (Skinner et al., 1997) och c-Fos (Okazaki och Sagata, 1995; Chen et al., 1996) fosforylering beskriver ställen i den C-terminala regionen av dessa proteiner, som är frånvarande i ΔFosB. Den potentiella fosforyleringen av FosB i full längd och andra Fos-familjeproteiner av CK2 kräver direkt undersökning. Men även om de fosforyleras är de andra Fos-familjeproteinerna kända för att innehålla motiv vid deras C-termini som riktar mot proteinerna för snabb nedbrytning (Papavassiliou et al., 1992; Jariel-Encontre et al., 1997; Acquaviva et al., 2002). Till exempel har det visat sig att en sträcka av ~21-rester närvarande i C-änden av alla Fos-familjeproteiner, men frånvarande iAFFosB, verkar som en destabiliserande domän för c-Fos (Acquaviva et al., 2001). Vi fann att även om denna sekvens destabiliserar på samma sätt FosB i full längd (Carle et al., 2004), saknar avsaknaden av denna domän i ΔFosB inte fullt ut sin stabilisering. Kombinationen av frånvaron av denna C-terminaldomän och Ser27-fosforylering verkar hellre fullt ut redogöra för den ungefär femfaldiga skillnaden i stabilitet mellan ΔFosB och FosB.

Fastän nedbrytningen av Fos-familjeproteiner är komplex och inte fullständigt förstått, verkar proteasomal nedbrytning vara den huvudsakliga vägen involverad (Salvat et al., 1999; Acquaviva et al., 2002; Ferrara et al., 2003). Data som presenteras här, där proteasomala hämmare inte signifikant förändrar ΔFosB-nedbrytningshastigheten, hävdar att ΔFosB, till skillnad från andra Fos-familjeproteiner, undviker 26S-proteasomet, och detta spelar en central roll vid stabiliseringen. Vi föreslår därför ett system där ökad stabilitet av ΔFosB kan hänföras till kombinationen av två huvudfaktorer: (1) frånvaron av en C-terminal destabiliserande domän och (2) fosforyleringen av S27 av CK2.

Sammanfattningsvis ger föreliggande studie mekanisk inblick i varför ΔFosB, en produkt av den omedelbara tidiga genen FosB, är, till skillnad från alla andra Fos-familjemedlemmar, ett relativt långlivat protein. Även om andra Fos-familjeproteiner menas att mediera snabb men transient stimulus-transkriptionskoppling (Morgan och Curran, 1995), ger den relativa stabiliteten av ΔFosB förmågan att mediera långvariga transkriptionsförändringar inducerad av kronisk stimulering. Detta stöder uppfattningen att ΔFosB fungerar som en hållbar molekylomkopplare i hjärnan, som gradvis omvandlar akuta svar till kroniska anpassningar. Identifiering av Ser27-fosforylering som en central mekanism för stabiliteten av ΔFosB öppnar nya vägar för utveckling av medel för att reglera funktionen av ΔFosB och därigenom modulera dess långsiktiga effekter på neural och beteendetsplasticitet.

Föregående avsnittNästa avsnitt

fotnoter

  • Mottaget November 21, 2005.
  • Revisionen fick februari 21, 2006.
  • Godkänd april 2, 2006.
  • Detta arbete stöddes av en nationell allians för forskning om schizofreni och depression Young Investigator Award till PGU, ett National Institute for Drug Abuse (NIDA) National Research Service Award till PGU, och bidrag från National Institute of Mental Health och NIDA till EJN We tack Dr. James Bibb för hans hjälp med vitro fosforyleringsanalyser, Dr Ming-Hu Han för hans hjälp med beredningen av hjärnskivor som användes för metabolisk märkning och Dr Rachael Neve för hennes hjälp med förpackningen av de rekombinanta HSV.
  • G. Rudenkos nuvarande adress: Life Sciences Institute och Department of Pharmacology, University of Michigan, 210 Washtenaw Avenue # 3163A, Ann Arbor, MI 48109-2216.
  • Korrespondens bör adresseras till Eric J. Nestler, 5323 Harry Hines Boulevard, Dallas, TX 75390-9070. E-post: [e-postskyddad]

Föregående avsnitt

 

referenser

Acquaviva C, Brockly F, Ferrara P, Bossis G, Salvat C, Jariel-Encontre I, Piechaczyk M (2001) Identifiering av ett C-terminalt tripeptidmotiv involverat i kontrollen av snabb proteasomal nedbrytning av c-Fos-protokoprotein under G (0) -to-S-fasövergången. Oncogene 20:7563-7572.

CrossRefMedline

Acquaviva C, Bossis G, Ferrara P, Brockly F, Jariel-Encontre I, Piechaczyk M (2002) Multipla nedbrytningsvägar för Fos-familjeproteiner. Ann NY Acad Sci 973:426-434.

Medline

Ahmed K, Tawfic S (1994) Mekanism för intracellulär reglering av proteinkinas CK2: Stimulans av stimulus-medierad subnuclear association. Cell Mol Biol Res 40:539-545.

Medline

Alcazar A, Martin E, Lopez-Fando J, Salinas M (1988) Ett förbättrat reningsprocedur och egenskaper hos kasein kinas II från hjärnan. Neurochem Res 13:829-836.

CrossRefMedline

Andersson M, Westin JE, Cenci MA (2003) Tidskurs för striatal DeltaFosB-liknande immunreaktivitet och prodynorfinmRNA-nivåer efter avbrytande av kronisk dopaminomimetisk behandling. Eur J Neurosci 17:661-666.

CrossRefMedline

Barz T, Ackermann K, Dubois G, Eils R, Pyerin W (2003) Genomövergripande expressionsskärmar indikerar en global roll för proteinkinas CK2 vid kromatinkonstruktion. J Cell Sci 116:1563-1577.

Sammanfattning / GRATIS Fullständig text

Beh I, Schmidt R, Hecker E (1989) Två isozymer av PKC som finns i HL-60-celler uppvisar en skillnad i aktivering av phorbolester TPA. FEBS Lett 249:264-266.

Medline

Bildl W, Strassmaier T, Thurm H, Andersen J, Eble S, Oliver D, Knipper M, Mann M, Schulte U, Adelman JP, Fakler B (2004) Proteinkinas CK2 är sammansatt med små konduktans Ca (2 +) - aktiverade K + kanaler och reglerar kanalgating. Neuron 43:847-858.

CrossRefMedline

Bing G, Wang W, Qi Q, Feng Z, Hudson P, Jin L, Zhang W, Bing R, Hong JS (1997) Långtidsuttryck av Fos-relaterat antigen och transientt uttryck av delta FosB associerat med anfall i råtthippocampus och striatum. J Neurochem 68:272-279.

Medline

Blom N, Sicheritz-Ponten T, Gupta R, Gammeltoft S, Brunak S (2004) Prediction av posttranslationell glykosylering och fosforylering av proteiner från aminosyrasekvensen. proteomik 4:1633-1649.

CrossRefMedline

Boehning D, Moon C, Sharma S, Hurt KJ, Hester LD, Ronnett GV, Shugar D, Snyder SH (2003) Kolmonoxid-neurotransmission aktiverad genom CK2-fosforylering av hemeoxygen-2. Neuron 40:129-137.

CrossRefMedline

Bohmann D (1990) Transskriptionsfaktor fosforylering: en länk mellan signaltransduktion och reglering av genuttryck. Cancerceller 2:337-344.

Medline

Buschmann T, Potapova O, Bar-Shira A, Ivanov VN, Fuchs SY, Henderson S, Fried VA, Minamoto T, Alarcon-Vargas D, Pincus MR, Gaarde WA, Holbrook NJ, Shiloh Y, Ronai Z (2001) Juni NH2-terminala kinasfosforylering av p53 på Thr-81 är viktigt för p53-stabilisering och transkriptionsaktiviteter som svar på stress. Mol Cell Biol 21:2743-2754.

Sammanfattning / GRATIS Fullständig text

Carle TL, Ulery PG, Nestler EJ (2004) Frånvaro av en konserverad Fos-familj C-terminal domän bidrar till deltaFosBs unika stabilitet. Soc Neurosci Abstr 30: 692.2.

Channavajhala P, Seldin DC (2002) Funktionell interaktion av proteinkinas CK2 och c-Myc i lymfomagenes. Oncogene 21:5280-5288.

CrossRefMedline

Chen J, Nye HE, Kelz MB, Hiroi N, Nakabeppu Y, Hopp BT, Nestler EJ (1995) Reglering av delta FosB och FosB-liknande proteiner genom elektrokonvulsiv anfall och kokainbehandlingar. Mol Pharmacol 48:880-889.

Abstrakt

Chen J, Kelz MB, Hopp BT, Nakabeppu Y, Nestler EJ (1997) Kroniska fosrelaterade antigener: stabila varianter av FosB inducerad i hjärnan genom kroniska behandlingar. J Neurosci 17:4933-4941.

Sammanfattning / GRATIS Fullständig text

Chen RH, Juo PC, Curran T, Blenis J (1996) Fosforylering av c-Fos vid C-änden ökar dess omvandlingsaktivitet. Oncogene 12:1493-1502.

Medline

Choe ES, Parelkar NK, Kim JY, Cho HW, Kang HS, Mao L, Wang JQ (2004) Proteinfosfatas 1 / 2A-inhibitor okadasyran ökar CREB och Elk-1-fosforylering och c-fos-expression i råtta striatum in vivo. J Neurochem 89:383-390.

CrossRefMedline

Cochet C, Chambaz EM (1983) Polyaminmedierade proteinfosforyleringar: ett möjligt mål för intracellulär polyaminverkan. Mol Cell Endocrinol 30:247-266.

CrossRefMedline

Cochet C, Feige JJ, Chambaz EM (1983) Katalytiska och molekylära egenskaper hos ett högrenat G-kaseininkinas från bovin lungvävnad. Biochim Biophys Acta 743:1-12.

Medline

Colby CR, Whisler K, Steffen C, Nestler EJ, Self DW (2003) Striatal celltypsspecifik överuttryck av DeltaFosB ökar incitamentet för kokain. J Neurosci 23:2488-2493.

Sammanfattning / GRATIS Fullständig text

Daunais JB, Roberts DC, McGinty JF (1993) Kokain självadministration ökar preprodynorfin, men inte c-fos, mRNA i råtta striatum. Neuroreport 4:543-546.

Medline

Desterro JM, Rodriguez MS, Hay RT (2000) Reglering av transkriptionsfaktorer genom proteinnedbrytning. Cell Mol Life Sci 57:1207-1219.

CrossRefMedline

Diaz-Nido J, Armas-Portela R, Avila J (1992) Ökning av cytoplasmatisk kasein II-typaktivitet åtföljer neuritutväxt efter DNA-synteshämning i NIA-103-neuroblastomceller. J Neurochem 58:1820-1828.

Medline

Di Maira G, Salvi M, Arrigoni G, Marin O, Sarno S, Brustolon F, Pinna LA, Ruzzene M (2005) Proteinkinas CK2 fosforylerar och uppregulerar Akt / PKB. Cell Death Differ 12:668-677.

CrossRefMedline

Dobrazanski P, Noguchi T, Kovary K, Rizzo CA, Lazo PS, Bravo R (1991) Båda produkterna från fosB-genen, FosB och dess korta form, FosB / SF, är transkriptionella aktivatorer i fibroblaster. Mol Cell Biol 11:5470-5478.

Sammanfattning / GRATIS Fullständig text

Ferrara P, Andermarcher E, Bossis G, Acquaviva C, Brockly F, Jariel-Encontre I, Piechaczyk M (2003) De strukturella determinanterna som är ansvariga för c-Fos proteinproteasomal nedbrytning skiljer sig beroende på expressionsbetingelserna. Oncogene 22:1461-1474.

CrossRefMedline

Fuchs SY, Dolan L, Davis RJ, Ronai Z (1996) Fosforyleringsberoende targeting av c-Jun ubiquitination av Jun N-kinas. Oncogene 13:1531-1535.

Medline

Fuchs SY, Xie B, Adler V, Fried VA, Davis RJ, Ronai Z (1997) c-Jun NH2-terminala kinaser riktar ubiquitinering av deras associerade transkriptionsfaktorer. J Biol Chem 272:32163-32168.

Sammanfattning / GRATIS Fullständig text

Fuchs SY, Tappin I, Ronai Z (2000) Stabiliteten hos ATF2 transkriptionsfaktorn regleras genom fosforylering och defosforylering. J Biol Chem 275:12560-12564.

Sammanfattning / GRATIS Fullständig text

Girault JA, Hemmings HC Jr, Williams KR, Nairn AC, Greengard P (1989) Fosforylering av DARPP-32, ett dopamin- och cAMP-reglerat fosfoprotein, med kasein kinas II. J Biol Chem 264:21748-21759.

Sammanfattning / GRATIS Fullständig text

Girault JA, Hemmings HC Jr, Zorn SH, Gustafson EL, Greengard P (1990) Karakterisering i däggdjurshjärnan av ett DARPP-32 serinkinas som är identiskt med kasein kinas II. J Neurochem 55:1772-1783.

Medline

Hanada M, Sugawara K, Kaneta K, Toda S, Nishiyama Y, Tomita K, Yamamoto H, Konishi M, Oki T (1992) Epoxomicin, ett nytt antitumörmedel av mikrobiellt ursprung. J Antibiot (Tokyo) 45:1746-1752.

Medline

Hann SR, Eisenman RN (1984) Proteiner kodade av den humana c-myc-onkogenen: differentialuttryck i neoplastiska celler. Mol Cell Biol 4:2486-2497.

Sammanfattning / GRATIS Fullständig text

Hemmings HC Jr, Girault JA, Williams KR, LoPresti MB, Greengard P (1989) ARPP-21, ett cykliskt AMP-reglerat fosfoprotein (Mr = 21,000) berikat i dopamin-innerverade hjärnregioner. Aminosyrasekvensen av platsen fosforylerades genom cyklisk AMP i intakta celler och kinetiska studier av dess fosforylering in vitro. J Biol Chem 264:7726-7733.

Hidaka H, ​​Kobayashi R (1992) Farmakologi av proteinkinasinhibitorer. Annu Rev Pharmacol Toxicol 32:377-397.

CrossRefMedline

Hirata H, Bessho Y, Kokubu H, Masamizu Y, Yamada S, Lewis J, Kageyama R (2004) Instabilitet av Hes7-protein är avgörande för segmentets klocka somite. Nat Genet 36:750-754.

CrossRefMedline

Hiroi N, Graybiel AM (1996) Atypiska och typiska neuroleptiska behandlingar inducerar distinkta program för transkriptionsfaktoruttryck i striatumet. J Comp Neurol 374:70-83.

CrossRefMedline

Hopp B, Kosofsky B, Hyman SE, Nestler EJ (1992) Reglering av omedelbart tidigt genuttryck och AP-1-bindning i råttkärnan accumbens av kronisk kokain. Proc Natl Acad Sci USA 89:5764-5768.

Sammanfattning / GRATIS Fullständig text

Hoppas BT, Kelz MB, Duman RS, Nestler EJ (1994a) Kronisk elektrokonvulsiv anfall (ECS) -behandling resulterar i uttryck för ett långvarigt AP-1-komplex i hjärnan med förändrad sammansättning och egenskaper. J Neurosci 14:4318-4328.

Abstrakt

Hoppas BT, Nye HE, Kelz MB, Self DW, Iadarola MJ, Nakabeppu Y, Duman RS, Nestler EJ (1994b) Induktion av ett långvarigt AP-1-komplex bestående av förändrade Fos-liknande proteiner i hjärnan av kronisk kokain och andra kroniska behandlingar. Neuron 13:1235-1244.

CrossRefMedline

Ishida A, Fujisawa H (1995) Stabilisering av kalmodulinberoende proteinkinas II genom den autoinhibitoriska domänen. J Biol Chem 270:2163-2170.

Sammanfattning / GRATIS Fullständig text

Jariel-Encontre I, Salvat C, Steff AM, Pariat M, Acquaviva C, Furstoss O, Piechaczyk M (1997) Komplexa mekanismer för c-fos och c-jun nedbrytning. Mol Biol Rep 24:51-56.

CrossRefMedline

Jones S, Yakel JL (2003) Caseinkinas ii (proteinkinas ck2) reglerar serotonin 5-ht (3) receptorkanalfunktionen i ng108-15-celler. Neuroscience 119:629-634.

CrossRefMedline

Kato T Jr, Delhase M, Hoffmann A, Karin M (2003) CK2 är en C-terminal IkappaB-kinas ansvarig för NF-kappaB-aktivering under UV-svaret. Mol Cell 12:829-839.

CrossRefMedline

Kelz MB, Chen J, Carlezon WA Jr, Whisler K, Gilden L, Beckmann AM, Steffen C, Zhang YJ, Marotti L, Själv DW, Tkatch T, Baranauskas G, Surmeier DJ, Neve RL, Duman RS, Picciotto MR, Nestler EJ (1999) Uttryck av transkriptionsfaktorn deltaFosB i hjärnan styr känsligheten för kokain. Natur 401:272-276.

CrossRefMedline

Kim KB, Myung J, Sin N, Crews CM (1999) Proteasominhibering av de naturliga produkterna epoxomicin och dihydroeponemycin: insikter på specificitet och potens. Bioorg Med Chem Lett 9:3335-3340.

CrossRefMedline

Kobayashi E, Nakano H, Morimoto M, Tamaoki T (1989) Calphostin C (UCN-1028C), en ny mikrobiell förening, är en mycket potent och specifik inhibitor av proteinkinas C. Biochem Biophys Res Commun 159:548-553.

CrossRefMedline

Krek W, Maridor G, Nigg EA (1992) Caseinkinas II är ett övervägande kärn-enzym. J Cell Biol 116:43-55.

Sammanfattning / GRATIS Fullständig text

Krohn NM, Stemmer C, Fojan P, Grimm R, Grasser KD (2003) Proteinkinas CK2 fosforylerar det höga mobilitetsgruppsdomänproteinet SSRP1, vilket inducerar igenkänningen av UV-skadat DNA. J Biol Chem 278:12710-12715.

Sammanfattning / GRATIS Fullständig text

Kumar A, Choi KH, Renthal W, Tsankova NM, Theobald DEH, Truong HT, Russo SJ, LaPlant Q, Whistler K, Neve RL, Self DW, Nestler EJ (2005) Chromatin remodeling är en nyckelmekanism som ligger bakom kokaininducerad plasticitet i striatum. Neuron 48:303-314.

CrossRefMedline

Lieberman DN, Mody I (1999) Caseinkinas-II reglerar NMDA-kanalfunktionen i hippocampala neuroner. Nat Neurosci 2:125-132.

CrossRefMedline

Litchfield DW (2003) Proteinkinas CK2: struktur, reglering och roll i cellulära beslut om liv och död. Biochem J 369:1-15.

CrossRefMedline

Manabe T, Kuramoto N, Nakamichi N, Aramachi K, Baba K, Hirai T, Yoneyama M, Yoneda Y (2001) Nedbrytning av c-Fos-protein uttryckt av N-metyl-d-asparaginsyra i kärnfraktioner av murin hippocampus. Brain Res 905:34-43.

Medline

Mandelzys A, Gruda MA, Bravo R, Morgan JI (1997) Frånvaro av ett ständigt förhöjt 37 kDa fosrelaterat antigen och AP-1-liknande DNA-bindande aktivitet i hjärnorna av kaininsyrabehandlade fosB null-möss. J Neurosci 17:5407-5415.

Sammanfattning / GRATIS Fullständig text

Marin O, Meggio F, Marchiori F, Borin G, Pinna LA (1986) Site-specificitet av kasein-kinas-2 (TS) från råttlevercytosol. En studie med modellpeptidsubstrat. Eur J Biochem 160:239-244.

McClung CA, Nestler EJ (2003) Reglering av genuttryck och kokainbelöning av CREB och DeltaFosB. Nat Neurosci 6:1208-1215.

CrossRefMedline

McClung CA, Ulery PG, Perrotti LI, Zachariou V, Berton O, Nestler EJ (2004) DeltaFosB: en molekylär växel för långsiktig anpassning i hjärnan. Brain Res Mol Brain Res 132:146-154.

Medline

Meggio F, Pinna LA (2003) Ett tusen-en-ett substrat av proteinkinas CK2? FASEB J 17:349-368.

Sammanfattning / GRATIS Fullständig text

Meggio F, Donella-Deana A, Pinna LA, Moret V (1977) Fosforylering av kaseinfraktioner med råttlever 'fosvitinkinas'. FEBS Lett 75:192-196.

Medline

Meggio F, Brunati AM, Pinna LA (1983) Autofosforylering av typ 2-kase-kinas TS på båda dess alfa- och beta-subenheter. Påverkan av olika effektorer. FEBS Lett 160:203-208.

CrossRefMedline

Meggio F, Shugar D, Pinna LA (1990) Ribofuranosyl-bensimidazolderivat som inhibitorer av kasein-2 och kasein-1-kasein. Eur J Biochem 187:89-94.

Medline

Meggio F, Marin O, Pinna LA (1994) Substratspecificitet av proteinkinas CK2. Cell Mol Biol Res 40:401-409.

Medline

Miller C, Zhang M, Han Y, Zhao J, Pelletier JP, Martel-Pelletier J, Di Battista JA (1998) Transkriptionell induktion av cyklooxygenas-2-gen genom okadinsyrainhibering av fosfatasaktivitet i humana kondrocyter: co-stimulering av AP-1- och CRE-nukleära bindningsproteiner. J Cell Biochem 69:392-413.

CrossRefMedline

Moratalla R, Elibol B, Vallejo M, Graybiel AM (1996) Nätverksnivå förändras i uttryck av inducerbara Fos-Jun proteiner i striatum under kronisk kokainbehandling och uttag. Neuron 17:147-156.

CrossRefMedline

Morgan JI, Curran T (1995) Omedelbara tidiga gener: tio år på. Trender Neurosci 18:66-67.

CrossRefMedline

Nakabeppu Y, Nathans D (1991) En naturligt förekommande trunkerad form av FosB som hämmar Fos / Jun transkriptionsaktivitet. Cell 64:751-759.

CrossRefMedline

Nestler EJ, Barrot M, Self DW (2001) Delta FosB: en hållbar molekylärbrytare för missbruk. Proc Natl Acad Sci USA 98:11042-11046.

Sammanfattning / GRATIS Fullständig text

Neve RL, Howe JR, Hong S, Kalb RG (1997) Introduktion av glutamatreceptor-subenheten 1 till motorneuroner in vitro och in vivo med användning av ett rekombinant herpes simplexvirus. Neuroscience 79:435-447.

CrossRefMedline

Nuthall HN, Joachim K, Stifani S (2004) Fosforylering av serin 239 av Groucho / TLE1 av proteinkinas CK2 är viktig för hämning av neuronal differentiering. Mol Cell Biol 24:8395-8407.

Sammanfattning / GRATIS Fullständig text

Okazaki K, Sagata N (1995) Mos / MAP-kinasvägen stabiliserar c-Fos genom fosforylering och förstärker dess transformerande aktivitet i NIH 3T3-celler. EMBO J 14:5048-5059.

Medline

Palombella VJ, Rando OJ, Goldberg AL, Maniatis T (1994) Ubiquitin-proteasomvägen krävs för behandling av NF-kappa B1-prekursorproteinet och aktiveringen av NF-kappa B. Cell 78:773-785.

CrossRefMedline

Papavassiliou AG, Treier M, Chavrier C, Bohmann D (1992) Målad nedbrytning av c-Fos, men inte v-Fos, med en fosforyleringsberoende signal på c-Jun. Vetenskap 258:1941-1944.

Sammanfattning / GRATIS Fullständig text

Peakman MC, Colby C, Perrotti LI, Tekumalla P, Carle T, Ulery P, Chao J, Duman C, Steffen C, Monteggia L, Allen MR, lager JL, Duman RS, McNeish JD, Barrot M, Self DW, Nestler EJ , Schaeffer E (2003) Inducerbart hjärnområde-specifikt uttryck av en dominant negativ mutant av c-Jun i transgena möss minskar känsligheten för kokain. Brain Res 970:73-86.

CrossRefMedline

Perrotti LI, Hadeishi Y, Ulery PG, Barrot M, Monteggia L, Duman RS, Nestler EJ (2004) Induktion av DeltaFosB i belöningsrelaterade hjärnstrukturer efter kronisk stress. J Neurosci 24:10594-10602.

Sammanfattning / GRATIS Fullständig text

Persico AM, Schindler CW, O'Hara BF, Brannock MT, Uhl GR (1993) Braintransskriptionsfaktoruttryck: Effekter av akut och kronisk amfetamin och injektionsspänning. Brain Res Mol Brain Res 20:91-100.

Medline

Ploegh HL, Dunn BM (2000) Post-translationell modifiering: fosforylering och fosfataser. I: Nuvarande protokoll i proteinvetenskap (Dunn BM, red.) Pp. 13.01-13.02. New York: Wiley och Sons.

Pyerin W, Burow E, Michaely K, Kubler D, Kinzel V (1987) Katalytiska och molekylära egenskaper hos högrenad fosvitin / kasein kinas typ II från humana epitelceller i kultur (HeLa) och relation till ecto-proteinkinas. Biol Chem Hoppe Seyler 368:215-227.

Medline

Reikhardt BA, Kulikova OG, Borisova GY, Aleksandrova IY, Sapronov NS (2003) Status för proteinkinas CK2-HMG14-systemet i åldersrelaterad amnesi hos råttor. Neurosci Behav Physiol 33:799-804.

Medline

Roberts BJ, Whitelaw ML (1999) Nedbrytning av den grundläggande helix-loop-helixen / Per-ARNT-Sim-homologidomändioxinreceptorn via ubiquitin / proteasomvägen. J Biol Chem 274:36351-36356.

Sammanfattning / GRATIS Fullständig text

Rost B, Yachdav G, Liu J (2004) PredictProtein-servern. Nukleinsyror Res 32:W321-W326.

Sammanfattning / GRATIS Fullständig text

Rylski M, Kaczmarek L (2004) Ap-1 mål i hjärnan. Front Biosci 9:8-23.

CrossRefMedline

Sahin B, Kansy JW, Nairn AC, Spychala J, Ealick SE, Fienberg AA, Greene RW, Bibb JA (2004) Molekylär karakterisering av rekombinant musadenosinkinas och utvärdering som ett mål för proteinfosforylering. Eur J Biochem 271:3547-3555.

Medline

Salvat C, Aquaviva C, Jariel-Encontre I, Ferrara P, Pariat M, Steff AM, Carillo S, Piechaczyk M (1999) Finns det flera proteolytiska vägar som bidrar till c-Fos, c-Jun och p53-proteinnedbrytning in vivo? Mol Biol Rep 26:45-51.

CrossRefMedline

Schmidt R, Hecker E (1975) Autoxidering av fosbolestrar under normala lagringsförhållanden. Cancer Res 35:1375-1377.

GRATIS fullständig text

Schwarz EM, Van Antwerpen D, Verma IM (1996) Konstitutiv fosforylering av IkappaBalpha med kasein kinas II uppträder företrädesvis vid serin 293: krav på nedbrytning av fri IkappaBalpha. Mol Cell Biol 16:3554-3559.

Sammanfattning / GRATIS Fullständig text

Sears R, Leone G, DeGregori J, Nevins JR (1999) Ras förbättrar Myc-proteinstabilitet. Mol Cell 3:169-179.

CrossRefMedline

Silva-Neto MA, Fialho E, Paes MC, Oliveira PL, Masuda H (2002) Cyklisk nukleotidoberoende fosforylering av vitellin med kasein kinas II renat från Rhodnius prolixus-oocyter. Insekts Biochem Mol Biol 32:847-857.

CrossRefMedline

Skinner M, Qu S, Moore C, Visdom R (1997) Transkriptionell aktivering och transformation med FosB-protein kräver fosforylering av den karboxyl-terminala aktiveringsdomänen. Mol Cell Biol 17:2372-2380.

Sammanfattning / GRATIS Fullständig text

Stemmer C, Schwander A, Bauw G, Fojan P, Grasser KD (2002) Proteinkinas CK2 fosforyliserar differentiellt fosforyler av majs kromosomala högmobilitetsgrupp B (HMGB) som modulerar deras stabilitet och DNA-interaktioner. J Biol Chem 277:1092-1098.

Sammanfattning / GRATIS Fullständig text

Stevens I, Derua R, Rondelez E, Waelkens E, Merlevede W, Goris J (1999) Identifiering av cyk, en cyklin B2-kinas, som ett nytt kalcium / kalmodulinberoende proteinkinas II och dess roll under Xenopus laevis-oocytmognad. Exp Cell Res 252:303-318.

CrossRefMedline

Suh HW, Choi SS, Lee JK, Lee HK, Han EJ, Lee J (2004) Reglering av c-fos och c-jun genuttryck av lipopolysackarid och cytokiner i primär odlade astrocyter: effekt av PKA och PKC-vägar. Arch Pharm Res 27:396-401.

Medline

Szyszka R, Boguszewska A, Grankowski N, Ballesta JP (1995) Differentiell fosforylering av ribosomalsyraproteiner från jästcell med två endogena proteinkinaser: kase-kinas-2- och 60S-kinas. Acta Biochim Pol 42:357-362.

Medline

Tamaoki T, Takahashi I, Kobayashi E, Nakano H, Akinaga S, Suzuki K (1990) Calphostin (UCN1028) och kalfostinrelaterade föreningar, en ny klass av specifika och potenta inhibitorer av proteinkinas C. Adv Andra Messenger Phosphoprotein Res 24:497-501.

Medline

Torres J, Pulido R (2001) Tumörundertryckaren PTEN fosforyleras av proteinkinaset CK2 vid dess C-terminus. Inverkan på PTEN-stabilitet mot proteasomedierad nedbrytning. J Biol Chem 276:993-998.

Sammanfattning / GRATIS Fullständig text

Tsubuki S, Saito Y, Tomioka M, Ito H, Kawashima S (1996) Differentiell inhibering av kalpain och proteasomaktiviteter genom peptidylaldehyder av di-leucin och tri-leucin. J Biochem (Tokyo) 119:572-576.

Sammanfattning / GRATIS Fullständig text

Tsurumi C, Ishida N, Tamura T, Kakizuka A, Nishida E, Okumura E, Kishimoto T, Inagaki M, Okazaki K, Sagata N (1995) Nedbrytning av c-Fos med 26S proteasomen accelereras av c-Jun och multipla proteinkinaser. Mol Cell Biol 15:5682-5687.

Sammanfattning / GRATIS Fullständig text

Unger GM, Davis AT, Slaton JW, Ahmed K (2004) Proteinkinas CK2 som regulator för cellöverlevnad: konsekvenser för cancerterapi. Curr Cancer Drug Mål 4:77-84.

CrossRefMedline

Flaska E, Marshall CJ (2003) Förhöjd ERK-MAP-kinasaktivitet skyddar FOS-familjemedlemmen FRA-1 mot proteasomal nedbrytning i kolonkarcinomceller. J Cell Sci 116:4957-4963.

Sammanfattning / GRATIS Fullständig text

Werme M, Messer C, Olson L, Gilden L, Thoren P, Nestler EJ, Brene S (2002) ΔFosB reglerar hjullöpning. J Neurosci 22:8133-8138.

Sammanfattning / GRATIS Fullständig text

Whitmarsh AJ, Davis RJ (2000) Reglering av transkriptionsfaktor funktion genom fosforylering. Cell Mol Life Sci 57:1172-1183.

CrossRefMedline

Vinter B, Kautzner I, Issinger OG, Arnold HH (1997) Två förmodade proteinkinas-CK2-fosforyleringsställen är viktiga för Myf-5-aktivitet. Biol Chem 378:1445-1456.

Medline

Wisniewski JR, Szewczuk Z, Petry I, Schwanbeck R, Renner U (1999) Konstitutiv fosforylering av de sura svansarna i 1-proteiner med hög rörlighet genom kasein II av II ändrar deras konformation, stabilitet och DNA-bindningsspecificitet. J Biol Chem 274:20116-20122.

Sammanfattning / GRATIS Fullständig text

Yamaguchi Y, Wada T, Suzuki F, Takagi T, Hasegawa J, Handa H (1998) Caseinkinas II interagerar med bZIP-domänerna av flera transkriptionsfaktorer. Nukleinsyror Res 26:3854-3861.

Sammanfattning / GRATIS Fullständig text

Yanagawa T, Yuki K, Yoshida H, Bannai S, Ishii T (1997) Fosforylering av A170-stressprotein med kasein-kase-liknande aktivitet i makrofager. Biochem Biophys Res Commun 241:157-163.

CrossRefMedline

Yankulov K, Yamashita K, Roy R, Egly JM, Bentley DL (1995) Den transkriptionella förlängningsinhibitoren 5,6-diklor-1-beta-d-ribofuranosylbensimidazol hämmar transkriptionsfaktor IIH-associerat proteinkinas. J Biol Chem 270:23922-23925.

Sammanfattning / GRATIS Fullständig text

Yen J, Visdom RM, Tratner I, Verma IM (1991) En alternativ spliced ​​form av FosB är en negativ regulator för transkriptionell aktivering och transformation med Fos-proteiner. Proc Natl Acad Sci USA 88:5077-5081.

Sammanfattning / GRATIS Fullständig text

Yin X, Jedrzejewski PT, Jiang JX (2000) Caseinkinas II fosforylerar linsconnexin 45.6 och är involverad i dess nedbrytning. J Biol Chem 275:6850-6856.

Sammanfattning / GRATIS Fullständig text

Yoza BK, Brooks JW, Mizel SB (1992) Induktion av AP-1 transkriptionsfaktorkomponenter under T-cellaktivering med interleukin 1 och fosbolestrar. Celltillväxt Differ 3:677-684.

Abstrakt

Yu S, Wang H, Davis A, Ahmed K (2001) Konsekvenser av CK2-signalering till kärnmatrisen. Mol Cell Biochem 227:67-71.

CrossRefMedline

Yu S, Davis AT, Guo C, Gröna JE, Ahmed K (1999) Differentiell målning av proteinkinas CK2 till kärnmatrisen vid övergående överuttryck av dess subenheter. J Cell Biochem 74:127-134.

CrossRefMedline

Zachariou V, Bolanos CA, Selley DE, Theobald D, Cassidy MP, Kelz MB, Shaw-Lutchmann T, Berton O, Sim-Selley LJ, DiLone RJ, Kumar A, Nestler EJ (2006) ΔFosB: En väsentlig roll för ΔFosB i kärnans accumbens i morfinåtgärd. Nat Neurosci 9:205-211.

CrossRefMedline

Artiklar som citerar denna artikel

  • Behavioral och strukturella reaktioner på kronisk kokain Kräver en feedforward-loop som involverar {Delta} FosB och Calcium / Calmodulin-Beroende Proteinkinas II i Nucleus Accumbens Shell Journal of Neuroscience, 6 Mars 2013, 33(10):4295-4307
  • Striatal överuttryck av {Delta} FosB reproducerar kronisk levodopa-inducerad ofrivillig rörelse Journal of Neuroscience, 26 maj 2010, 30(21):7335-7343
  • Abstrakt
  • Hela texten
  • Fulltext (PDF)
  • Abstrakt
  • Hela texten
  • Fulltext (PDF)
  • Abstrakt
  • Hela texten
  • Fulltext (PDF)
  • Abstrakt
  • Hela texten
  • Fulltext (PDF)
  • Transkriptionsmekanismer för missbruk: roll av {Delta} FosB Filosofiska transaktioner av Royal Society B: Biological Sciences, 12 oktober 2008, 363(1507):3245-3255
  • Uppehållande sårbarhet för återinförande av metamfetamin-sökande beteende hos glialcellslinje-härledda neurotrofiska faktormutantmöss FASEB Journal, 1 juli 2007, 21(9):1994-2004
  • Aktivatorprotein-1-transkriptionsfaktorn vid respiratorisk epitelcancercinogenes Molekylär cancerforskning, 1 februari 2007, 5(2):109-120