Dori bilan og'rigan bemorlarda sichqonchani yadrosidagi accumbens (2012) da Fosb gen induksiyasini epigenetik tarzda boshdan kechiradi.

Izohlar: Deltafosb giyohvandlikdan qutulgandan keyin uzoqroq iz qoldirgan dalillar. Ayniqsa, giyohvandlik epigenetik o'zgarishlarni keltirib chiqaradi, natijada relapse paydo bo'lganda deltafosbning tezroq indüksiyasiga olib keladi. Bu esa, ko'p yillar o'tgach, tez-tez shikastlangan, giyohvandlikka uchragan davlatga qaytib kelishi mumkinligini tushuntiradi.



J Neurosci. Muallifning qo'lyozmasi; PMC 2013-da yanvar 25-da mavjud.

 

mavhum

DFOSB, a Fosb gen mahsuloti, giyoh kabi giyohvandlikka duchor bo'lgan giyohvandlarga qayta-qayta ta'sir qilish orqali yadroli akumbens (NAc) va kaudat piteni (CPu) hosil bo'ladi. Ushbu indüksiyon, takrorlab, dori maruziyetiyle ko'rilgan gen ekspresyonunun va xatti-anormalliklerinin saptanamayan shakllariga hissa qo'shadi.

Bu erda, faralarning uzoq vaqt davomida dori ta'siriga duchor bo'lishining sababi, indikatorlikning o'zgarishiga olib kelishi mumkinmi? Fosb keyingi kokain ta'sirida paydo bo'ladigan gen. Biz ilgari surunkali giyohiy amaliyotni keyinchalik uzoqlashib ketganidan so'ng, indivilizatsiyani oshiradi Fosb NAFda DFOSB mRNA'sining aktiv tarzda kiritilishi va takroriy kokainni qayta tiklashdan so'ng DFOSB oqsili tezroq to'planishi ko'rsatilgan.. Hech qanday asossiz yo'q Fosb CPUda indüksiya kuzatildi, aslida CPU ichida DFOSB mRNA ning o'tkir induktsiyasi boshlandi.

Bu anormal naqshlar Fosb ifodasi, kromatin o'zgarishlar bilan bog'liq Fosb gen promoteri. Ilgari surunkali giyoh qo'llanishi RNK polimeraza II (Pol II) ning Fosb faqatgina NAcdagi targ'ibotchi, Pol II ning "to'xtab turuvchi" tovushlarni bildiradi Fosb giyohvand moddalarni qayta tiklashda ushbu mintaqada indüksiyon uchun. Agar kokain muammosi, Pol II'nin ozod qilishini gen promoteridan tetiklasa, bu tezroq bo'ladi Fosb transkripsiya. Kokain muammosi, shuningdek, bunda repressiv gistondagi o'zgarishlar kamayadi Fosb NAc-da targ'ibotchi, ammo repressiv belgilarni kuchaytiradi va CPu'dagi faollashtirilgan belgilarni pasaytiradi.

Ushbu natijalar kromatin dinamikasiga yangi tushunchalarni beradi Fosb targ'ibotchisi va asta-sekin yangi mexanizmni ochib beradi Fosb giyohvandlikka uchraganida NAc ning indüksiyonu.

kirish

Giyohvandlikka chalingan giyohvand moddalarni iste'mol qilishning og'ir oqibatlariga qaramay,Kalivas va boshq., 2005; Hyman va boshq., 2006). Surunkali dorilarga ta'sir qilish ventral striatum (yoki yadro akumbens, NAc) va dorsal striatum (yoki kaudat plyamen, CPu), giyohvandlik mukofotlari va giyohvandlik bilan bog'liq bo'lgan striatal tuzilmalarda gen ekspressionida doimiy o'zgarishga sabab bo'ladi (Freeman va uning hamkorlari, 2001; Robinson va Kolb, 2004; Shaham va Umid, 2005; Maze va Nestler, 2011). DFosB, tezda erta gen tomonidan kodlangan kesilgan va barqaror oqsil, FosbNAc va CPu-da paydo bo'lgan yaxshi ma'lum bo'lgan transkriptsiya faktori surunkali zararli deyarli barcha dori-darmonlarga duchor qilinib, takrorlantirilgan dori vositalariga (Nestler, 2008). Ammo, oldindan surunkali shikast etkazilishiga ta'sir qilish DF ning keyingi indüksiyasini o'zgartirganligi noma'lum.

Biz surunkali dori ta'siriga javoban kromatinli modifikatsiyalar yaqinda maqsadli miya hududlarida ma'lum genlarni uyg'unlashishini o'zgartirishi mumkinligini taxmin qildik (Robison va Nestler, 2011). Surunkali davolashdan keyin suiiste'mol qilinadigan giyohvandlar kromatinning transkripsiyadan foydalanish imkoniyatini turli xil modifikatsiyalari, jumladan fosforillanish, asetilatsiyalash va histon quyruqlarining metilifikatsiyasi orqali o'zgartirganligini ko'rsatdi. Hujayra madaniyati tizimlarida yangi ishlar RNK polimeraz II (Pol II) ni "indüklenebilen" genlarni promoteri bilan oldindan ifoda etishga qaratdi, Pol II esa proksimal promoter mintaqalariga va transkripsiyon boshlash maydoniga (TSS ) "to'xtab turgan" holatida (Core va Lis, 2008; Nechaev va Adelman, 2008). Keyinchalik to'xtab qolgan Pol II ni faollashtirilishi, uning promouter va TSS hududlaridan qochishi va ushbu "primed" genlarning transkripsiyasi (masalan,Zeitlinger va boshq., 2007; Saha va boshq., 2011; Bataille va boshq., 2012).

Bu erda, oldindan surunkali kokainga maruziyetinin so'ng, uzoq vaqt orqaga chekinishi davri, Fosb keyinroq kokainga administratsiyaga gen, NAc esa CPU bo'lmaganda indüksiyon uchun primer bo'ladi. Keyinchalik, biz aniq kromatin imzolarini aniqladik Fosb NAc va CPu ning gen promoteri Fosb gen, shu jumladan, to'xtab turgan Pol II ni ishga tushirish Fosb nafaqat proksimal promoter va na miya hududlarida bir necha faollashtiruvchi yoki repressiv geston modifikatsiyasining o'zgarishi. Ushbu natijalar kromatin dinamikasiga yangi tushunchalarni beradi Fosb gen promoteri va birinchi marotaba Pol II primesining to'xtash mexanizmini ko'rsatadi Fosb kokainga qayta ta'sirlanganda NAc da ko'proq faollashtirish uchun.

Materiallar va usullari

Hayvonlar

Barcha tajribalarda ishlatilgan erkak Sprague Dawley kalamushlari (250-275 g, Charlz River laboratoriyalari) 12 soatlik yorug'lik / qorong'u davrda (7 AMdagi chiroqlar) oziq-ovqat va suv ad libitum. Barcha hayvonlar kuniga ikki marta hujayralarida kokain (15 mg / kg, ip) yoki sho'r (ip) bilan o'n kun davomida AOK qilingan. Hayvonot eksperimentlari Mount Sinayda Institutsional Hayvonlarni Qo'llab-quvvatlash va Foydalanish Qo'mitasi (IACUC) tomonidan tasdiqlangan.

Lokomotor o'lchovlari

Hayvonlar 1 soat uchun birinchi kunida lokomotor xonada joylashtirilgan va keyin Photobeam Activity System (San-Diego Instruments) yordamida sho'rni in'ektsiyasidan keyin lokomotor faoliyat uchun kuzatilgan. Har kungi lokomotor kameralarda 1 soatdan keyin odatlanib, kuniga 15 kun davomida kokain (2 mg / kg, ip) qo'llanildi va hayvonlar 1 soat uchun lokomotor faoliyat uchun yana tekshirildi.

Immunohistokimyo

Hayvonlar oxirgi dori ta'siridan so'ng 24 soatdan oshib ketdi. Ta'riflanganidek, DFOSB / FosB immunoreaktivligiPerrotti va boshq., 2004). G'arb blokirovkasi koksayli in'ektsiyalardan so'ng DFosB / FosB o'xshash immunoreaktivlikning 24 soat yoki undan ko'p vaqt davomida kuzatilganligini tasdiqladi, FosB aniqlanmagan (ko'rsatilmagan).

RNK izolyatsiyasi, teskari transkriptsiya va PCR

NAc va dorsolateral / dorsomedial CPu ning o'zaro 12-gauge punchesPerrotti va boshq., 2004), quruq muzda muzlatilgan va chop etilgan protokollarga muvofiq qayta ishlangan (Covington va uning hamkorlari, 2011). DFOSB va FosB mRNA izoformga xos bo'lgan DFOSB va FosB primerlari bilan kantitativ PCR (qPCR) yordamida o'lchandiAlibhai va boshq., 2007). DFOSB va FosB mRNA darajalari GAPDH mRNA darajalariga mos keladi, ular giyoh ta'siridan ta'sir qilmaydi (ko'rsatilmaydi).

Western blotting

NAc va CPu zımbaları yuqorida aytilganidek yig'ilgan va Western blotting uchun ta'riflanganidekCovington va uning hamkorlari, 2011ERK44 / 42 [hujayra tashqari signalni boshqaradigan kinaz-44 / 42] va fosfoterk44 / 42 (perk), AKT [thymoma virus proto-onkogen] va p-AKT, SRF (sarum javob omil) va pSRF, CREB [cAMP javob elementlari majburiy protein] va pCREB. Har bir chiziqqa yopishtirilgan oqsil miqdori kokainga ta'sir etmasdan ta'sirlanmagan aktin yoki tubulin darajasiga to'g'ri keladi.

Kromatin immunopreptitatsiyasi (ChIP)

Yangi ochilgan NAc va CPu zımbaları tasvirlanganMaze va boshq., 2010). Har bir eksperimental holat mustaqil guruhlardan uch marta tahlil qilingan. Har bir ChIP namunasi uchun ikkala NAc va CPu punchlar beshta kalamush (10 punk) bilan to'plangan. Maxsus histon modifikatsiyalari uchun ishlatiladigan antikorlar nashr etilganMaze va boshq., 2010); uning SerxNUMX da uning karboksil terminal maydoni (CTD) takrorlangan mintaqasida (Pol II-pSer5) fosforli qilingan Pol IIga qarshi antikorlar 5 abstraktsiyasidan olingan. To'rt to'siqlik primerlar uchun mo'ljallangan Fosb (Lazo va boshqalar, 1992; Mandelzys va boshq., 1997): 1F: GTACAGCGGAGGTCTGAAGG, 1R: GAGTGGGATGAGATGCGAGT; 2F: CATCCCACTCGGCCATAG, 2R: CCACCGAAGACAGGTACTGAG; 3F: GCTGCCTTTAGCCAATCAAC, 3R: CCAGGTCCAAAGAAAGTCCTC; 4F: GGGTGTTTGTGTGTGAGTGG, 4R: AGAGGAGGCTGGACAGAACC. Kromatinning modifikatsiyalari darajasi DNKning kirib kelishi bilan solishtirilganMaze va boshq., 2010).

Statistik tahlil

Hisobot qilingan barcha qiymatlar o'rtacha ± semadir. Harakatlanish faolligi va hujayralarni hisoblash bo'yicha ma'lumotlar ikki tomonlama ANOVAlar yordamida davolash va in'ektsiya bilan tahlil qilindi. qPCR eksperimentlari vaqt oralig'ida bir tomonlama ANOVAlar tomonidan omil sifatida davolash bilan tahlil qilindi. Muhim asosiy ta'sirlar kuzatilganda (p <0.05), Bonferroni post-hoc testlari giyohvand moddalar bilan tuzsizlangan hayvonlar (^ rasmlarda) va giyohvand moddalar bilan kasallangan kokain bilan ishlangan hayvonlar (* rasmlarda) bilan taqqoslash uchun o'tkazildi. Western blotting va ChIP ma'lumotlari uchun birlashtirilmagan ikkita dumli Student t-testlari ishlatilgan va ko'p marta taqqoslash uchun tuzatishlar kiritilgan.

natijalar

Kattaroq Kokain tajribasiga ega kalamushlarda NAc ichida Fosb indimentatsiyasi, ammo CPU emas

Ilgari surunkali kokain kursining ta'sirini o'rganish, keyinchalik uzoq muddat orqaga chekinishi, Fosb 15 kun davomida sho'r yoki kokain (10 mg / kg) bilan kuniga ikki marta ip yuborilgan kalamushlarni 28 kundan keyin (masalan, XNUMX kundan keyin)Fig 1A). Dastlabki kokain ta'sirida lokomotor sezuvchanlikning indikatsiyasini tasdiqlash uchun, dori vositasini qo'llash kutilgan natijani tasdiqlash uchun, avvalo, bir guruh hayvonlarga lokomotor javoblarni o'lchagan edik. Kokainga tajribali va boshlang'ich kalamushlar mos keladigan asosiy lokomotor faollikni ko'rsatdi, giyohvand moddalarga qarshi giyohvandlikka qarshi kurashish bilan ularning harakatlanishiFig 1B. Takrorlangan choralar ikki tomonlama ANOVA, davolash: F1,66 = 30.42, p <0.0001; kokain muammosi: F2,66= 58.39, p <0.0001; davolash x kokain muammosi: F2,66= 8.56, p = 0.0005, Bonferroni post-testlari ^p <0.001). Ushbu kokain muammosi kokain bilan tajribali kalamushlarda sezilarli darajada lokomotor faollikni, ya'ni sensitizatsiyani keltirib chiqardi (Bonferroni post-testlari * p <0.001).

Shakl 1  

Oldinga surunkali giyoh ta'sirini lokomotor faoliyatga ta'siri va Fosb preparatni qayta tiklashda NAc va CPu da indüksiya

NAc va CPu dagi DFOSB ekspressioniga ushbu kokain-oldingi davolanish rejimining ta'sirini baholash uchun koksin-naif va kokain tajribali hayvonlarga 24, 0, 1 yoki 3 kundalik kokain muammosi bilan davolanganidan so'ng immunohistokimyoviy usullar bilan 6 soatlik DFOSB oqsili aniqlandi In'ektsiya (15 mg / kg; Fig 1A). Oldindan belgilangan (Nye va boshq., 1995), 3 kokaina in'ektsiyasi NAc va Dori-naif hayvonlarning CPu'sida DFOSB proteini sezilarli darajada indiretmek uchun etarli bo'lgan va uning to'planishi 6 kunlik kokain in'ektsiyasidan (Fig 1C. Ikki tomonlama ANOVA, NAc yadrosi, davolash: F1,28= 23.5, p <0.0001; kokain muammosi: F3,28= 49.16, p <0.0001; davolash x kokain muammosi: F3,28= 6.83, p = 0.0014; NAc qobig'i, davolash: F1,28= 18.69, p <0.0001; kokain muammosi: F3,28= 31.52, p <0.0001; davolash x kokain muammosi: F3,28= 3.21, p <0.05; CPu, davolash: F1,28= 9.47, p <0.001; kokain muammosi: F3,28= 19.74, p <0.0001; davolash x kokain muammosi: F3,28= 0.94, p> 0.05. NAc yadrosi, qobig'i va CPu-da, Bonferroni post-testlari ^p <0.05). Kokain bilan tajribali hayvonlarda, 28 kunlik chekinishdan keyin NAc yoki CPu-da DFOSB indüksiyonunun davom etishi haqida hech qanday dalil yo'q edi, DFB signalining ushbu vaqtgacha to'liq tarqalishi haqidagi oldingi xabarlarga muvofiq (Nye va boshq., 1995), bu safar bu nuqta ushbu tadqiqotda ishlatilgan. Biroq, 3 yoki 6 kokain qarshi in'ektsiyasini olgan kokain tajribasiga ega bo'lgan kalamushlarda NAc ichida DFosB proteinining indüksiyasini sezilarli darajada oshirdi, bu ikkala yadro va qobiq osti hududlarida ham ta'sir ko'rsatdiFig 1C. Bonferroni keyingi sinovlari * p <0.05). Aksincha, CPu da DFosB oqsilining bunday katta induktsiyasi kuzatilmagan; Buning o'rniga, ushbu mintaqada kokain-naif va tajribasiz kalamushlarga 3 yoki 6 kunlik kokain chaqirish in'ektsiyasidan so'ng ekvivalent DFB induksiyasi kuzatildi (Fig 1C).

Kokain muammosiga javoban NAc va CPu'lardagi transkripsiyona o'zgarishlarni o'rganish uchun biz berilgan DFosB va FosB mRNA transkriptlarining uyg'unlikdagi bir vaqtning kursini (45, 90 va 180 min) bitta kokain yoki sho'r ekish usuli bilan o'rganib oldik 28 kundan so'ng chechak kokain-naif va tajribasiz kalamushlarga qarshi (qarang Fig 1A). Sho'r suv muammosi bilan bog'liq bo'lgan kokain muammosi, NAA va Kokain-naif hayvonlarning CPu-laridagi uch vaqtning barcha nuqtalarida DFOSB va FosB mRNA darajalarining tez o'sishini keltirib chiqardi (Fig 1D. Vaqt nuqtasiga bir marta ANOVA takrorlash choralari; Bonferroni post-testlari ^p <0.05). NAc-da kokainga qarshi tajribadan o'tgan hayvonlarda kokain-naif hayvonlar bilan taqqoslaganda ko'proq DFosB va FosB mRNA induktsiyasini kuzatdik, bu ta'sir 90 daqiqada sezilarli bo'lib, aksincha CPu-dagi FosB va FosB mRNA ning induktivligi sezilarli darajada edi. kokain tajribasi bo'lgan hayvonlarda kamayadi (Fig 1D. Bonferroni post-testlari %p = 0.08, * p <0.05).

NAc va Cocaine-tajribali kalamushlarni CPu-da yuqori oqim signalizatsiyasi yo'llarining tavsifi

O'zgaruvchanlikning o'zgaruvchanligi uchun mumkin bo'lgan tushuntirishlar Fosb oldingi surunkali kokain kursidan so'ng NAc va CPu ning genlari kokainga ta'sir qilishning uzoqda joylashgan tarixi tarixning yuqorisida bo'lgan signalizatsiya yo'llarining davomiy o'zgarishini keltirib chiqarishi mumkin. Fosb kokain muammosi genni aberrant darajaga keltirib chiqaradigan gen indüksiyonudur. Ushbu gipotezani o'rganish uchun biz so'nggi paytlarda bu miya hududlarida DFB ning kokain indüksiyasi uchun zarur bo'lgan ikki transkriptsiya omilini, SRF va CREBni tahlil qildik (Vialou va boshq., 2012), shuningdek, yuqorida turgan oqsil kinazlari, ERK va AKT bilan birga kokain ta'sirida hamValjent va boshq., 2000; Lu va boshq., 2006; Boudreau va boshq., 2009). Ushbu turli oqsillarning umumiy yoki fosforli darajadagi o'zgarishlarini aniqlay olmadik va bu o'zgaruvchan indükativligini Fosb SRF, CREB yoki AKTda o'zgarishlarsizFig 2B, C). Qo'ziqorin muammolariga javob sifatida NAQdagi pSRF va pCREBdagi o'zgarishlar etishmovchiligi so'nggi paytlarda tayyorlangan hisobotga mos keladi va bu faqat surunkali kokainga sabab bo'lganVialou va boshq., 2012).

Shakl 2  

Ilgari surunkali giyoh ta'sirini NAc va CPu da yuqori molekulyar signaling kaskaglariga ta'siri

Dori-darmonli hayvonlarning NAc va CPu'larida, dastlabki dori ta'siridan keyin 20 min (Fig 2A), bitta kokain muammosi pERK42 / 44 (Fig 2B, C. Ikki dumli talabalar t-testi: * p <0.05). O'tkir kokain yuborilgandan keyin ushbu hududlarda PERK darajasi oshgani haqida avvalgi xabarlar mavjud edi (Valjent va boshq., 2000). NSKda ERK fosforillanishini takroriy kokainli in'ektsiyalardan (masalan,Boudreau va boshq., 2007; Shen va boshq., 2009), chunki bizning tadqiqimiz PERK 28 kundan keyin va kokain yoki sho'rlanish muammosidan keyin aniqlandi. Birinchi marta giyohvand moddalarni iste'mol qiladigan giyohvand moddalarga qaram bo'lgan, 28 kundan keyin kokain tajribasiga ega bo'lgan kalamushlarda kokainga qayta ta'sir qilish CPu (PERK42 / 44) darajasida sezilarli darajada o'sishiga olib keldiFig 2B, C. Ikki dumli talaba t-testi: * p <0.05).

Kromatin peyzaji NAcdagi Fosb gen promoteri va kokain tajribali kalamushlarni CPu

Keyinchalik, biz o'zgarishlar sodir bo'lganligini tekshirdik Fosb genin indüklenebilirliği kromatin tuzilishi o'zgarishlar bilan bog'liq. ChIP histone modifikatsiyalarining uchta xarakterli shakllariga qarshi yo'naltirilgan antikorlar yordamida amalga oshirildi: gen aktivatsiyasiga bog'liq bo'lgan H4 (H3K3me4) ning Lys3 ning trimetilasyonu va gen repressiyasiga bog'liq bo'lgan H3K27me3 va H3K9me2. Biz 28 kundan so'ng yoki kokainni chaqirtirmasdan, hayvonlarni 1 soatdan keyin tekshirgan holda kokain-naip va tajribali kalamushlarni tahlil qildikFig 3A). NAc'de, ushbu uch histon o'zgarishlar biron-birining bağlanmasında hech qanday muhim o'zgarishlar topilmadi Fosb giyohvandlik muammosi bo'lmasa, gen promoteri, ammo past darajadagi H3K9me2 (Fig 3B-D. Talabalar uchun ikkita t-test. #p = 0.2 ga mos keladigan dori-darmon nazorati bilan solishtirganda). Ushbu ta'sir kokain muammosidan keyin sezilarli bo'lib, genning proksimal promoter qismiga xos bo'lgan (Fig 3C. * p <0.05). Ba'zi genlarda H3K9me2 darajasi juda past bo'lsa ham Fosb gen promoteri, NAc'de nazorat qilish shartlariga muvofiq, bu belgini sezilarli darajada ko'rsatadi (Maze va boshq., 2010, ma'lumotlar ko'rsatilmagan). Aksincha, CPU da biz kichik hajmda, lekin H3K4me3 ulanishida sezilarli pasayishlarni topdik va H3K27me3 ulanishida Fosb giyohvandlik muammosi bo'lmagan taqdirda, targ'ibotchiFig 3D. * p <0.05).

Shakl 3  

Epigenetik priminga qarshi surunkali giyoh ta'sirining ta'siri Fosb NAc va CPu ning genlari

Keyin biz Pol II ni tekshiramiz Fosb hujayra madaniyatidagi so'nggi natijalarga asoslanib, TSS-larda Pol II ning to'xtab qolishi, bu uning CTD-qayta mintaqasida Ser 5-da fosforillanishi bilan tavsiflanadi, genlarni primingi bilan bog'lanadi (Kirish-ga qarang). Shuning uchun Pol II-pSer5 ga ulanish uchun tahlil qildik Fosb genning to'rtta alohida mintaqasidaFig 3B). Ushbu tahlillar Pol II-pSer5 ni sezilarli darajada boyitdi Fosb proksimal promoter mintaqasida genlarni va kokainga tajribali hayvonlarning NCdagi TSS atrofida uzoq vaqt orqaga chekinishdan keyin, kokainga qarshi kurashda tekshiruvlarga nisbatan (masalan,Fig 3E. * p <0.05). Ushbu boyitish gen tanasining ikkita mintaqasida sezilmadi FosbBundan tashqari, oddiy tajribaviy tizimlarda tavsiflangan II. Qizig'i shundaki, kokain muammosidan so'ng Pol II-pSer5 ulanish hali boyitilgan belgilarni namoyon etdi Fosb proksimal promoter mintaqasi (Fig 3E. %p = 0.1), ammo TSS da nazorat darajalariga qaytdi. CPU natijalari ko'proq o'zgaruvchan bo'lib, pol II-pSer5 ulanishining aniq namunasi kuzatilmagan.

muhokama

Ushbu izlanishda doimiy tartibga solish bo'yicha yangi tushuncha mavjud Fosb kokain ta'siriga uchraganidan keyin bir necha hafta o'tgach. Biz ilgari surunkali giyohlarni boshqarishni ko'rsatib turibdi Fosb NAc ichida ko'proq moslashuvchan gen, bu dori qayta ta'sirlanganda DFBning tezroq to'planishiga olib keladi. NAF dagi DFOSB indikatsiyasi kokainga sezgir bo'lgan xatti-harakatlarga vositachilik qiladi (Nestler, 2008), bizning topilmalarimiz uzayganidan so'ng bunday sezgirlangan javoblarni tezroq tiklash uchun yangi mexanizmni ochib beradi.

NAc'deki DFB'nin rivojlangan indüksiyonunun kromatin o'zgarishlar bilan bog'liq ekanligini ko'rsatamiz Fosb undan katta indüksiyon uchun primer bo'lishi kutilgan gen. Shunday qilib, oldingi surunkali giyoh qo'llanilganda 4 haftadan keyin mavjud bo'lgan genning proksimal promoteri va TSS hududlariga Pol II ga ulanishni kuchaytirdik. TSSda bunday Pol II zenginlashuvi kokainga qarshi kurashda tezda yo'qotiladi Fosb Pol II ning to'xtab turuvchi hujayra madaniyatidagi namuna bilan uyg'unlashuvi genlarni aktivlashtirganda TSS dan chiqariladi (Kirishga qarang). Kokainga qarshi kurash shuningdek, H3K9me2-ning gen repressiyasini belgisi bilan bog'lanish tezligining pasayishiga sabab bo'ladi. Fosb promouter. Buning aksincha, biz vositachiligimiz bilan ma'lum bo'lgan transkriptsiya omillarining yoki ularning yuqorida turgan kinazlarining doimiy ravishda indüksiyasini topdik. Fosb giyoh tomonidan indüksiyon. Ushbu natijalar bizning gipotezasini qo'llab-quvvatlaydi, chunki NAFdagi DFB ning indüksiyonu epigenetik astarlanishga bog'liq. Fosb genlar va yuqorida turgan voqealarni upregulatsiyasi orqali emas.

CPu uchun juda ko'p farqlar olingan. Pol II ning qo'zg'oloni haqida hech qanday dalil yo'q edi Fosb kokain-tajribali kalamushlarda, gen reproduksiyasiga mos keladigan kichik, lekin muhim bo'lgan gistondagi o'zgarishlar mavjud bo'lgan bo'lsa-da: H3K27me3 ga ulanishni kuchaytirdi va H3K4me3 ulanishini kamaytirdi. Yuqori oqim transkripsiyasi omillari yoki kinazlarning kamayishi bilan bog'liq o'zgarishlar kuzatilmadi Fosb indüksiyon. Ushbu topilmalar surunkali giyoh qo'llanilgandan so'ng, epigenetik o'zgarishlarni kamaytirishga xizmat qiladi Fosb NAc ichida ko'rilgan astarlardan farqli o'laroq, CPU ichida gen induktsitivligi. Biroq, bu ta'sirlar kokainga qayta ta'sirlanganda DFosB mRNA induksiyasini bostirganda, DFB proteinining birikmasida hech qanday yo'qotish yo'q. Ushbu paradoksning asosiy mexanizmi endi tergovni talab qiladi.

Keyinchalik, umuman olganda, natijalarimiz surunkali giyohni administratsiyasiga javoban muayyan genlardagi kromatin peyzajidagi o'zgarishlarni ushbu genlarni preparatga qayta ta'sir qilish uchun keyingi indüksiyani boshlash yoki to'sish uchun xizmat qiladigan modelni qo'llab-quvvatlaydi. "Epigenetik izlar" deb qarash mumkin bo'lgan bunday kromatin o'zgarishlari genlarning barqaror-davlat mRNA darajalarini tahlil qilishda o'tkazib yuboriladi. Shu tarzda giyohvandlik epigenomining xarakteristikasi bu yangi kasallikning rivojlanishi uchun qazib olinadigan buzilishning molekulyar patogenezi to'g'risida yangi ma'lumotni va'da qiladi.

Rahmatlar

Ushbu ish Milliy giyohvandlik milliy institutining grantlari bilan qo'llab-quvvatlandi.

Manbalar

  • Alibhai IN, Green TA, Potashkin JA, Nestler EJ. FosB va DeltafosB mRNA ifodasini tartibga solish: in vivo va in vitro tadqiqotlarda. Brain Res. 2007;1143: 22-33. [PMC bepul maqola] [PubMed]
  • Bataille AR, Jeronimo S, Jacques PE, Laramee L, Fortin ME, Forest A, Bergeron M, Hanes SD, Robert F. Umumjahon RNK polimeraz II CTD aylanishi genlar bo'ylab kinaz, fosfataz va izomeraz fermentlari orasidagi kompleks interplaylar tomonidan orkestrlangan. Mol hujayralari. 2012;45: 158-170. [PubMed]
  • Boudreau AC, Reimers JM, Milovanovich M, Wolf ME. Sichqoncha hujayra sirtida AMPA retseptorlari kokain chiqarish vaqtida kuchayib boradi, ammo kokainning chaqiruvidan so'ng mitojen bilan faollashtirilgan protein kinazlarining faollashtirilishi bilan ichki holatga tushadi. J Neurosci. 2007;27: 10621-10635. [PMC bepul maqola] [PubMed]
  • Boudreau AC, Ferrario CR, Glucksman MJ, Wolf ME. Signalning yo'llari moslashuvchanligi va yangi protein kinaz A kokainga nisbatan xulq-atvori bilan bog'liq substratlar. J Neurochem. 2009;110: 363-377. [PMC bepul maqola] [PubMed]
  • Core LJ, Lis JT. RNK polimerazining promoter-proksimal pauza orqali transkripsiyaning regulyatsiyasi. Ilmiy. 2008;319: 1791-1792. [PMC bepul maqola] [PubMed]
  • Covington HE, 3rd, Maze I, Sun H, Bomze HM, DeMaio KD, Wu EY, Dietz DM, Lobo MK, Ghose S, Mouzon E, Neve RL, Tamminga CA, Nestler EJ. Kokain orqali stressni kuchaytirishi uchun repressiv gistondagi metilatsiyani ta'minlash. Neyron. 2011;71: 656-670. [PMC bepul maqola] [PubMed]
  • Freeman WM, Nader Ma, Nader SH, Robertson DJ, Gioia L, Mitchell SM, Daunais JB, Porrino LJ, Fredman DP, Vrana KE. Non-inson primat yadrosidagi accumbens genining ekspreditsiyasida surunkali kokainga bog'liq o'zgarishlar. J Neurochem. 2001;77: 542-549. [PubMed]
  • Hyman SE, Malenka RC, Nestler EJ. Narkologik qaramlik mexanizmlari: mukofot bilan bog'liq o'rganish va xotiraning ahamiyati. Annu Rev Neurosci. 2006;29: 565-598. [PubMed]
  • Kalivas PW, Volkow N, Seamans J. Narkomaniyadagi noqulay motivatsiya: prefrontal-akumbenslarda glutamatning tarqalishi patologiyasi. Neyron. 2005;45: 647-650. [PubMed]
  • Lazo PS, Dorfman K, Noguchi T, Mattei MG, Bravo R. FosB geni tuzilishi va xaritalash. FosB fosb promoterining faoliyatini pasaytiradi. Nuklein kislotalar. 1992;20: 343-350. [PMC bepul maqola] [PubMed]
  • Lu L, Koya E, Zhai H, Hope BT, Shaham Y. ERK ning kokainlarga qaramlikdagi roli. Trends Neurosci. 2006;29: 695-703. [PubMed]
  • Mandelzys A, Gruda Ma, Bravo R, Morgan JI. Kinetik kislota bilan muomala qilingan fosB null sichqon miyalarida doimiy ravishda ko'tarilgan 37 kDa fos bilan bog'liq antigen va AP-1 kabi DNKni majburiy faoliyatning yo'qligi. J Neurosci. 1997;17: 5407-5415. [PubMed]
  • Maze I, Nestler EJ. Narkomaniyaning epigenetik ko'rinishi. Ann NY Acad Sci. 2011;1216: 99-113. [PMC bepul maqola] [PubMed]
  • Maze I, Covington HE, 3rd, Dietz DM, LaPlant Q, Renthal Vt, Russo SJ, Mexanik M, Mouzon E, Neve RL, Xaggarty SJ, Ren Y, Sampath SC, Hurd YL, Greengard P, Taraxovskiy A, Schaefer A, Nestler EJ. Giyoxin bilan bog'liq bo'lgan plastisitivada histon metiltransferaza G9a ning asosiy roli. Ilmiy. 2010;327: 213-216. [PMC bepul maqola] [PubMed]
  • Nechaev S, Adelman K. Promoter-proksimal Pol II: to'xtash vaqtida narsalarni tezlashtiradi. Hujayra aylanishi. 2008;7: 1539-1544. [PubMed]
  • Nestler EJ. Ko'rib chiqish. Narkomaniyaning transkripsiya mexanizmlari: DeltaFosB ning ahamiyati. Filos Trans R Soc London B Biol Sci. 2008;363: 3245-3255. [PMC bepul maqola] [PubMed]
  • Nye HE, Hope BT, Kelz MB, Iadarola M, Nestler EJ. Striatum va nukleus akumbenslaridagi kokain tomonidan FOSga bog'liq surunkali antijenni induksiyalash to'g'risidagi farmakologik tadqiqotlar. J Pharmacol Exp Ther. 1995;275: 1671-1680. [PubMed]
  • Perrotti LI, Hadeishi Y, Ulery PG, Barrot M, Monteggia L, Duman RS, Nestler EJ. Surunkali stressdan so'ng mukofot bilan bog'liq miya strukturasida deltaFosB ning paydo bo'lishi. J Neurosci. 2004;24: 10594-10602. [PubMed]
  • Robinson TE, Kolb B. Dori-darmonlar bilan aloqadorligi bilan bog'liq strukturaviy plastika. Neurofarmakologiya 47 Suppl. 2004;1: 33-46. [PubMed]
  • Robison AJ, Nestler EJ. Narkomaniyaning transkripsiya va epigenetik mexanizmlari. Nat Rev Neurosci. 2011;12: 623-637. [PMC bepul maqola] [PubMed]
  • Saha RN, Vissink EM, Bailey ER, Zhao M, Fargo DC, Hwang JY, Daigle KR, Fenn JD, Adelman K, Dudek SM. Arkt va boshqa IEG-larning tezkor faoliyatga asoslangan transkripsiyasi RNK polimeraza II ga asoslangan. Nat Neurosci. 2011;14: 848-856. [PMC bepul maqola] [PubMed]
  • Shaham Y, Hope BT. Neyrokodnostiyalarning dori izlashga qaytishi roli. Nat Neurosci. 2005;8: 1437-1439. [PubMed]
  • Shoh XV, Toda S, Moussavi K, Bouknight A, Zahm DS, Kalivas PW. Kokaindan olib tashlangan kalamushlarda dendritik o'murtqa plastinkasi o'zgargan. J Neurosci. 2009;29: 2876-2884. [PMC bepul maqola] [PubMed]
  • Valjent E, Corvol JC, Sahifalar C, Besson MJ, Maldonado R, Caboche J. Kokainni mukofotlash xususiyatlariga qarshi hujayra tashqari signallarni tartibga soluvchi kinaz kaskadining ishtiroki. J Neurosci. 2000;20: 8701-8709. [PubMed]
  • Zeitlinger J, Star A, Kellis M, Gong GW, Nechaev S, Adelman K, Levine M, Yosh RA. Drosophila melanogaster embrionidagi rivojlanish nazoratidagi genlarda RNK polimerazini to'xtatish. Nat Genet. 2007;39: 1512-1516. [PMC bepul maqola] [PubMed]
  • Vialou VF, Feng J, Robison AJ, Ferguson D, Scobie KN, Mazei-Robison M, Mouzon E, Nestler EJ. Serumning javob omili va cAMP javob elementining majburiy oqimi DFFning kokain indüksiyasini talab qiladi. J Neurosci. 2012 qabul qilindi. [PMC bepul maqola] [PubMed]