Serumning reaktsiyasi faktor DeltaFosB ning indüksiyasiyasiga qarab surunkali ijtimoiy stressga chidamliligini oshiradi. (2010)

Izohlar: Har ikki stress bo'lsa-da, suiiste'mol dori va ayrim tabiiy sovrinlar DeltaFosB birikmasini tetiklasa-da, stress turli xil pastga qarab hujayralar va keyinchalik turli retseptorlari va genlarni faollashtiradi. Boshqacha qilib aytganda, stress va qarshilikka qarshilik asosan turli mexanizmlarga tayanadi

To'liq o'rganish

J Neurosci. 2010 oktyabr 27; 30 (43): 14585-92.

Vialou V, Maze I, Renthal Vt, LaPlant QC, Watts QO'LNING, Mouzon E, Ghose S, Tamminga CA, Nestler EJ.

manba

Fishberg Nevrologiya bo'limi, Sinay Tibbiyot maktabi, Nyu-York, 10029, AQSh.

mavhum

Stress va dori vositasida neyronal moslashuvlar ostida joylashgan molekulyar mexanizmlar to'liq tushunilmagan. Bunday adaptatsiyalarda ta'sirlangan bitta molekula - surunkali stress yoki surunkali stressga yoki dori-darmonlarga ko'p marotaba munosabatda bo'lishga javoban, bosh miya mukofoti hududi bo'lgan kemirgen yadroidagi akumbenslarda (NAc) yig'iladigan DFOSB. TUshbu ekologik ogohlantirishlar orqali DFOSB indüksiyonunu nazorat ostiga olgan yuqorida turgan transkripsiyonel mexanizmlar sust qoladi. Bu erda, faoliyatga bog'liq bo'lgan transkriptsion faktori, sarum reaktsiyasi omili (SRF), stressning yangi, lekin kokain emas-, DFB bilan bog'liq. SRF ikkala depressiyaga chalingan bemorlarda va sichqonlarda ijtimoiy mag'lubiyatga chalingan bemorlarda NAc darajasida pastga tushiriladi. SRF ning bu past darajadagi regulyatsiyasi sog'lom hayvonlarda yo'q. Inducible mutagenez yordamida biz asosan moslashuvchan sichqonlarda paydo bo'ladigan DFOSBning stressli vositachilik qilishini ushbu miya hududida SRF ekspresigiga bog'liq ekanligini ko'rsatamiz. Bundan tashqari, SRFning NAcga xos genetik siljishi turli xil prodepressantlar va proankimet-shunga o'xshash fenotiplarni ilgari suradi va hayvonlarni surunkali stressning zararli ta'siriga nisbatan sezgirroq qiladi. Buning aksincha, SRF surunkali giyoh ta'siriga javoban NAFda DFOSB to'plamida rol o'ynamaydi. Bundan tashqari, SRF-ning NAc-o'ziga xos taqiqoti kokain bilan bog'liq xatti-harakatlarga ta'sir qilmaydi, bu surunkali ijtimoiy mag'lubiyat stressi va takrorlangan kokain ta'sirining mustaqil mexanizmlar orqali DFOSB to'planishini va xulq-atvorini nazorat qiladi.

kirish

Nestler va Carleson, 2006, Sesack and Greys, 2010 kabi, motivatsiya bilan bog'liq xatti-harakatga keltiradigan hissiy va kognitiv kirishlarni integratsiyalashuvi uchun asosiy miya mukofot maydoni bo'lgan yadro akumbenslari (NAc) muhim ahamiyatga ega. NAc shuningdek, giyohvandlik va depressiya bilan bog'liq bo'lgan qiziqishlariga qarama-qarshiliklarga ham taaluqlidir. Shunga ko'ra, NAc ni chuqur miya stimulyatsiyasi bilan nishonga olish odamlarda va kemiruvchilarda depressiya va giyohvandlik kabi xatti-harakatlarni engillashtirdi (Shlaepfer va boshqalar, 2008; Vassoler va boshqalar, 2008; Heinze va boshqalar, 2009; Kuhn et al., 2009).

Noqonuniy ekspluatatsiya yoki stressdan dori-darmonlarga ta'sir qilish NAc-da o'zgaruvchan gen tushunchalarini o'zgartiradi, ehtimol, giyohvandlik va depressiyaning surunkali holatini keltirib chiqaradi (Berton va boshqalar, 2006; Krishnan va boshqalar, 2007; Maze va boshqalar, 2010, Vialou et al , 2010). Qizig'i shundaki, fosb genining birlashtiruvchi mahsuloti bo'lgan DFosB transkripsiyasi faktori takrorlangan dori yoki stress ta'siriga (Nestler, 2008, Perrotti va boshqalar, 2008, Vialou va boshqalar, 2010) javoban NAcda to'planadi. DF klassidagi birikma NAc'yi kuchaytiradi, chunki rekombinat giyohvanddan foydalanishni surunkali holatdagi holatga (Nestler va boshqalar, 1999; McClung va boshqalar, 2004; Renthal va boshq., 2009) o'tishga yordam beradigan salohiyatli molekulyar kaliti sifatida taklif qilingan. bir nechta giyohvand moddalarni suiiste'mol qilishlariga munosabat bildirgan. Yaqinda surunkali ijtimoiy mag'lublik stressidan so'ng NAc'de DFOSB indüksiyonunun o'rni oshkor bo'ldi (Nikulina va boshqalar, 2008, Vialou va boshqalar, 2010): DFOSB stressli ogohlantirishlarga qarshi faol javob berishni qo'llab-quvvatlaydi va moslashuvchanlikni oshiradi. DFOSB induktsiyasi rag'batlantiruvchi tarzda amalga oshirilgan bo'lsa-da, NAc-da DFOSB birikmalari va dori-darmon bilan bog'liq bo'lgan mexanizmlar noma'lum.

Sarum reaktsiyasi faktori (SRF) - bu bir nechta dastlabki erta genlarning, shu jumladan c-fos, fosb, Egr1 va Arc (Knöll va Nordxaym, 2009) ning faolligiga bog'liq transkripsiyaviy faollashishi uchun zarur bo'lgan transkriptsiya omili. Yaqinda o'tkazilgan tadqiqotlar SRFning neyronlarning morfologik va sitoarxitektura xususiyatlariga ta'sirini, shu jumladan kattalar miyasida sinaptik faollik va elektronlarning shakllanishini tartibga solishni ko'rsatdi (Knol va Nordxaym, 2009). Ushbu topilmalar bizni SRFni suiiste'mol qilish yoki stressga duchor bo'lishning surunkali ta'siri bilan funktsional ravishda tartibga solinadimi-yo'qligini tekshirishga undaydi, shuningdek, ushbu sharoitlarda DFOSB induksiyasiga bunday tartibga solishning potentsial ta'siri.

Bu erda biz SRFni NAc darajasida regulyatsiya qilish prodepressant va anksiyogen fenotiplarni rag'batlantiradigan, natijada hayvonlarning surunkali stressning zararli ta'siriga nisbatan zaifligini oshiradigan yangi mexanizmni tasvirlaymiz.. Ushbu ta'sirlar qisman stressli hayvonlarning NAc-dagi DFOSB induktsiyasini yo'qotish bilan bog'liq. Depressiya qilingan bemorlardan olingan postmortem NAc to'qimalarida SRF va DFosB ekspressionida kuzatilgan pasayishlar bizning topilmalarimizning inson tushkunligiga bog'liqligini qo'llab-quvvatlaydi. Qizig'i shundaki, DFOSB to'planishini boshqaruvchi ushbu mexanizm stressga xosdir: surunkali kokain ta'sirining SRF ekspresyoniga ta'siri yo'q, NAc dan SRF o'chirilishi surunkali kokain ta'siridan keyin DFOSB birikmasiga ta'sir qilmaydi va bunday SRF o'chirilishi kokainga ta'sir qilmaydi. kelib chiqadigan xatti-harakatlar. SRF va DFOSB o'rtasidagi ushbu yangi o'zaro bog'liqlik, stress sharoitida, odamning surunkali stressga sezgirligini tartibga soluvchi muhim gomeostatik mexanizmni aks ettirishi mumkin.

Materiallar va usullari

Hayvonlar

Sakkiz haftalik C57BL / 6J erkak sichqonlari (Jekson laboratoriyasi) barcha qiziqish va biokimyoviy tajribalarda qo'llanilgan. Barcha hayvonlarni hayvon vositasiga kamida 1 hafta davomida eksperimental manipulyatsiyadan oldin xamda joylashtirdilar va 23-25-da 12-soatlarda / quyuq aylanishlarda (7: 00 AM dan 7: 00-PMgacha) yoritilgan oziq-ovqat va suvga kirish. Tajribalar Neuroscience jamiyatining ko'rsatmalari va Sinay tibbiyot maktabi institutsional hayvonlarni parvarish qilish va ulardan foydalanish bo'yicha qo'mitaga muvofiq o'tkazildi.

Kokain tajribalari uchun [Western blotting va quantitative kromatin immunoprecipitation (ChIP)] 8-10-haftalik erkak C57BL / 6J sichqonchalari ishlatilgan. Hayvonlar sho'r yoki kokainning etti kunlik intraperitoneal in'ektsiyasini oldi (20 mg / kg kokain-HCl, Sigma). Sichqonlarga oxirgi davolanishdan so'ng 24 soat foydalanildi. Xulq-atvor tajribalari uchun sichqonlarga operatsiyadan keyingi davrda jarrohlik operatsiyasi o'tkazildi va quyida aytib o'tilganidek, 10 mg / kg (lokomotor sezuvchanlik) yoki 7.5 mg / kg (konditsioner joy tanlovi) kokain-HCl bilan davolash qilindi.

Srfl / fl sichqonchani ilgari ta'rif etilganidek, yaratilgan (Ramanan va boshq., 2005). Srfning NAcga xos urinishi stereotaksik in'ektsiyalash va keyinchalik adeno bilan bog'li virus (AAV) vektorlarini qo'llash orqali yashil floresansli oqsilga (GFP) birlashtirilgan Cre rekombinatsiyasining (Cre) virusli ovsiz ekspressioni orqali erishildi. O'zini yo'q qiladigan Cre ishlatilgan. AAV-GFP o'rniga AAV-GFP nazorat qilish uchun SFL / FL sichqonchasida AOK yuborildi. Qisqacha aytganda, sichqonlarga virusli etkazish uchun ishlatiladigan quyidagi stereotaksik koordinatalar bilan birga ketamin (10 mg / kg) va xylazine (10 mg / kg) aralashmasi yordamida behushlik qilindi: + 1.6 (oldingi / orqa), + 1.5 (lateral), - 4.4 (dorsal / ventral) o'rta yo'nalishda (bregma bilan) 10 ° burchagi bilan. Hammasi bo'lib 0.5 mili tozalangan virus 5 min davrida (0.1 mk / min) ikki marotaba ikki marotaba etkazib berildi va keyinchalik 5 min. Sichqonlarga operatsiyadan keyingi 2 hafta davomida, virusli ekspluatatsiya maksimal bo'lganida va barcha hayvonlarga standart gistologik usullar bilan tasdiqlangan virusli joylar tasdiqlangan. Virusli vositalar bilan ishlaydigan Crening ekspluatatsiyasi AAV-Cre-GFP va AAV-GFP berilgan NAc pulslarini NAc pulslarini immunohistokimyo va Srf uchun teskari transkriptaza PCR bilan tasdiqlangan. AAV-GFP va AAV-Cre-GFP viruslari ilgari ta'riflanganidek yaratilgan (Maze va boshq., 2010).

Xulq-atvor tartiblari

Ijtimoiy mag'lubiyat stress.

C57BL / 6J sichqonlari oldindan ta'riflanganidek, 10 ketma-ket kunida surunkali ijtimoiy mag'lubiyatga chalingan (Berton va boshqalar, 2006; Krishnan va boshq., 2007; Vialou va boshq., 2010). Qisqacha aytganda, har bir sichqonchani kuniga 1 daqiqa noma'lum va tajovuzkor erkak CD5 nafaqaga chiqqan naslchilik sichqoncha ta'sir qildi. CD1 tajovuzkori bilan bevosita shovqinni keyin hayvonlarni keyingi 24 h uchun bir xil kafesga ulashgan bir xonaga joylashtirildi, lekin ular sezgir, ammo jismoniy aloqa qilmasdi. Tekshirish hayvonlari bir xil jinsdagi a'zolar bilan bir xil hujayralarda joylashtirilgan. Ijtimoiy shovqin testlari mag'lubiyatning so'nggi kunidan keyingi 24 soatiga to'g'ri keldi.

Notanish CD1 erkak sichqonchani ijtimoiy qochish e'lon qilingan protokollarga muvofiq baholandi (Berton va boshq., 2006; Krishnan va boshq., 2007; Vialou va boshq., 2010). Eksperimental sichqonchani birinchi bo'lib bo'sh maydonchada 2.5 minut davomida bo'sh simli qafas mavjud edi. Ikkinchi seans davomida simsiz katakka notanish CD1 erkak sichqoncha kiritildi. O'zaro ta'sir zonasida bo'lgan vaqt (qafasni o'rab turgan 8 sm kenglikdagi yo'lak) o'lchandi. Mag'lub bo'lgan sichqonlarni sezgir va bardoshli subpopulyatsiyalarga ajratish avval aytib o'tilganidek amalga oshirildi (Krishnan va boshq., 2007; Vialou va boshq., 2010). Boshqaruv sichqonlarining aksariyati bo'sh maqsadli to'siqdan ko'ra ko'proq ijtimoiy maqsad bilan o'zaro aloqada bo'lishiga ko'proq vaqt sarflaganligi sababli, o'zaro ta'sir koeffitsienti 100 (ijtimoiy nishonning yo'qligi bilan solishtirganda o'zaro ta'sir zonasida o'tkazilgan teng vaqt) chegara sifatida belgilandi. <100 balli sichqonlar sezgir, ≥100 balli bo'lganlar esa bardoshli deb belgilandi. Keng qamrovli xatti-harakatlar, biokimyoviy va elektrofizyologik tahlillar ushbu aniq sezgir va bardoshli subpopulyatsiyalarning haqiqiyligini qo'llab-quvvatlaydi (Krishnan va boshq., 2007; Wilkinson va boshq., 2009; Vialou va boshq., 2010).

Srfl / sichqon sichqonlarining ijtimoiy mag'lubiyat stressiga zaifligini o'rganish uchun AAV-GFP yoki AAV-Cre-GFP bilan ikki tomonlama AOK qilingan sichqonchalar bir kunning uchta yo'lboshchidan mag'lubiyatga uchragan va undan keyin 24 soatiga ijtimoiy ta'sir o'tkazish uchun sinovdan o'tgan. Ushbu submaksimal mag'lubiyatga olish jarayoni genetik manipulyatsiyadan so'ng (Formula 1, 2007, Vialou va boshqalar, 2010) keyinchalik prozuseptivlik fenotiplarini aniqlash uchun tasdiqlangan.

Og'irligi o'rganildi.

AAV-GFP yoki AAV-Cre-GFP ni haddan tashqari ekspluatatsiya qilish oldindan ta'rif etilganidek, o'rganilayotgan charchoq tartibiga ta'sir qildi (Berton va boshq., 2007). Qisqacha aytganda, sichqonchani 1 soatlik aranjirovkali, ajralmas oyoq zarbalariga ta'sir o'tkazdi (2 mA, 0.45 s davomiyligi). Sinov kuni sichqon 5 ketma-ket qochish sinovlari uchun qutiga qayta kiritildi. Har bir sinov davomida doimiy shok etkazib berildi va sichqonlarga ulashgan, bo'lmagan qismga kirib qochish imkoniyati berildi. Muvaffaqiyatli qochishdan so'ng, eshik avtomatik ravishda yopildi va qochish kechiktirilishi qayd etildi. Sichqoncha 15-lar ichida qochib qutula olmaganida, sinov to'xtatildi va muvaffaqiyatsizlikka yozildi. Oldingi tadqiqotlar shuni ko'rsatdiki, NAc va boshqa mintaqalarda virusli ifoda stresssiz bo'lmaganda bazal qochish harakatlariga ta'sir qilmaydi (Newton va boshq., 25; Berton va boshqalar, 2002).

Lokomotivni sezgirlash.

AAV-GFP yoki AAV-Cre-GFP ning NAc ichidagi in'ektsiyasidan ikki hafta o'tgach, Srffl / fl sichqonlari lokomotor sezgirlikka duch kelishdi. Sichqonlar lokomotor maydonga kuniga 30 daqiqa davomida 4 kun davomida odatlanib qolishdi. Qabul qilinganidan so'ng, hayvonlar qorin bo'shlig'iga 10 mg / kg kokain-HCl bilan AOK qilindi va harakatlantiruvchi qutilarga joylashtirildi. Hayvonlarning harakatlanish harakati fotobam tizimi (San-Diego Instruments) yordamida kuniga 30 daqiqa davomida ambulator nurlanish tanaffuslari sifatida qayd etilgan. Lokomotor sezgirlik 6 kun davomida qayd etilgan.

Konditsioner joy tanlovi.

Joyni konditsionerlash protsedurasi ilgari ta'riflanganidek amalga oshirildi (Maze va boshq., 2010), quyidagi o'zgartirishlar bilan. Qisqacha aytganda, Srffl / fl sichqonlariga AAV-GFP yoki AAV-Cre-GFP ning intra-NAc infuziyalaridan 18 kun o'tgach, hayvonlar konditsioner xonalariga joylashtirildi, ular uchta kontekstli muhitdan iborat edi. Ikkala konditsioner xonaning har ikkalasi uchun katta afzalliklarga ega bo'lgan sichqonlar tadqiqotdan chiqarildi (barcha hayvonlarning <10%). Konditsionerlar guruhlari hali ham mavjud bo'lishi mumkin bo'lgan har qanday xona tanqisligini moslashtirish uchun muvozanatlashtirildi. Keyingi kunlarda hayvonlar fiziologik eritma bilan AOK qilindi va tushdan keyin bir kamerada 30 daqiqaga qamaldi, so'ngra kokain (7.5 mg / kg, ip) AOK qilindi va ertasi kuni boshqa kameraga 30 min davomida qamaldi, jami har bir davolanish uchun ikki turdagi assotsiatsiya mashg'ulotlari (ikkita sho'r suv va ikkita kokain juftligi). Sinov kuni sichqonlar 20 daqiqa davomida davolanmasdan apparatga joylashtirildi va yon tomonning afzalligini baholash uchun sinovdan o'tkazildi. Kokainga lokomotor reaktsiyalar giyohvand moddalarni davolash samaradorligini ta'minlash uchun kokain bilan bog'langan xonalarda nurlanish tanaffuslari orqali baholandi. Barcha guruhlar uchun lokomozga virusli davolash ta'sir qilmasligini ta'minlash uchun sho'r suvga javoban dastlabki harakatlanish baholandi.

Boshqa qiziqishlariga oid testlar.

Sfl / fl sichqonchalari ochiq joylarda, yorug'lik / qorong'i va bosilgan protokollarga asoslangan (Vialou va boshq., 2010) asoslangan majburiy-suzuvchi sinovlarda sinovdan o'tkazildi. Ochiq maydonda sichqonlar faolligi qizil nur sharoitida video kuzatuv tizimi (Ethovision) yordamida 5 min uchun qayd etildi. Yorug'lik / qorong'u sinov uchun sichqonlarga kichikroq yopiq arenaga ulangan bir katta yoritilgan arenadan iborat ikki kamerali qutini erkin o'rganishga ruxsat berildi. Sichqonlarning har ikkala qismida sarflangan vaqtni baholash uchun 5 daqiqa davomida sinovdan o'tkazildi. Ochiq maydon va yorug'lik / quyuq sinovlarda markazda va engil arenada o'tkaziladigan vaqt mos ravishda tashvish bilan bog'liq javoblarning teskari indekslari sifatida baholandi. 1 d ta majburiy suzish testi 5 daqiqa davomida o'tkazildi. Majburiy-suzish testi mobaynida harakatsizlikning ko'payishi prodepressantga o'xshash xatti-harakatlar deb talqin qilindi. 1 d siqilish sinovlari sichqonlarda keng qo'llanilgan va taxminiy kuchga ega bo'lgan o'lchov sifatida tasdiqlangan, bu antidepressant davolanishlarda harakatchanlik vaqtlarini kamaytiradi.

Immunohistokimyo

Srfl / fl sichqonchani behushlikda va xNUMX% paraformaldehid / PBS bilan intrasardial perfüze qilindi. Brainlar olib tashlandi va 4% sukroz / PBS da kriyo-muhofaza qilindi. Qorin bo'shlig'i qismlari (30 mmm) muzlatuvchi mikrotomada kesilgan va immunohistokimyoviy tahlillar uchun qayta ishlangan. Srffl / fl nekrozining tekshiruvi SRF (30 / 1, Santa Cruz Biotechnology) ga qarshi qaratilgan poliklonal antikor yordamida amalga oshirildi. Yaratish GFP (Tovuq poliklonal, 2000 / 1, Aves Labs) orqali ajratilgan beyinlarda tasdiqlangan, chunki Cre GFP bilan birlashtirildi. SFL / FLT sichqonlarida ijtimoiy mag'lubiyatdan so'ng DFOSB induktsiyasini aniqlash uchun DFOSB oqsilning N-terminal hududiga (8000 / 1, Santa Cruz Biotexnologiya) qarshi ko'tarilgan quyon poliklonal antikor yordamida aniqlandi. Rasmlar konfokal mikroskop bilan olingan (1000 × kattalashtirish, Zeiss). DFOS immunoreaktivligi uchun salbiy va ijobiy deb topilgan GFP-immunopozitiv hujayralar soni har bir hayvon uchun bir nechta tasvirlarda aniqlangan va keyinchalik har bir hayvon uchun o'rtacha qiymatlar aniqlangan. Har bir hayvon statistik tahlil uchun individual kuzatuv hisoblangan.

Inson postmortem NAc to'qimasi

Odamning o'limidan keyingi miya to'qimasi Dallasning Brain kollektsiyasidan olingan bo'lib, u erda to'qima Dallas Tibbiy ekspertiza idorasi va Texas universiteti (UT) janubi-g'arbiy qismida to'qimalarni transplantatsiya qilish dasturi yaqin qarindoshining roziligi bilan olinadi. To'qimalar yoshi, o'limdan keyingi interval, RNK yaxlitligi raqami (RIN) va pHga mos keladigan erkak va ayollardan tahlil qilindi. Koma, gipoksiya, pireksiya, tutilish, suvsizlanish, gipoglikemiya, ko'p organ etishmovchiligi va neyrotoksik moddalarni o'lim paytida iste'mol qilish kabi o'ziga xos agonal omillar postmortem miya to'qimalarida RNK yaxlitligiga ta'sir qiladi (Tomita va boshq., 2004). Ushbu sakkizta shartning har biri bo'yicha to'qima namunalarini tavsiflash uchun biz agonal omil ko'lamini (AFS) ishlatdik. Agonal omilning yo'qligi 0 ball bilan belgilandi va uning mavjudligi 1 dan 0 gacha baholandi, natijada AFSning jami 8 dan 0 gacha bo'lgan natijalari ta'minlandi, 1 yoki 1 agonal ball bilan to'qima yaxshi namunalarni aks ettiradi; demografik ko'rsatkichlar 40-jadvalda keltirilgan. To'qimalarning ajoyib sifati yuqori RIN qiymatlari bilan tasdiqlangan. Ishlar -80 ° C izopentan ichida tez muzlashdan va -XNUMX ° C darajasida saqlashdan oldin standart disektsiyaga uchragan; muzlatilgan to'qimalarda NAc ning keyingi parchalanishi amalga oshirildi. UT Janubi-G'arbiy institutsional tekshiruv kengashi ushbu to'qimalarni tadqiqot uchun foydalanish uchun ko'rib chiqdi va tasdiqladi. Keyinchalik har bir ruhiy tushkunlik holati bo'yicha to'g'ridan-to'g'ri ma'lumot beruvchi bilan intervyu o'tkazildi, bu erda ishning kasalligi to'g'risidagi ma'lumotlar hujjatlashtirildi; ikkita tadqiqotchi psixiatr tomonidan DSM-IV mezonlari yordamida katta depressiv buzuqlikning konsensus diagnostikasi o'tkazildi. Ushbu tadqiqotga kiritilgan holatlarning hech birida antidepressantlardan tashqari, suiiste'mol qilish, alkogol ichimliklari yoki retsept bo'yicha buyurilgan dorilar uchun qon toksikologiyasi ekranlari ijobiy bo'lmagan. Antidepressant davolashga qaramay, barcha sub'ektlar o'lim vaqtida klinik depressiyaga tushishdi. To'qimalar namunalari tahlil qilish uchun ko'r-ko'rona tarzda tarqatildi.

Jadval 1.

Inson postmortem o'rganish uchun demografik ma'lumotlar

Western blotting

Inson va sichqonchani NAc namunalari ilgari ta'riflanganidek qayta ishlangan (Maze va boshq., 2010). Muzlatilgan to'qimalar xNUMX% SDS ni proteaz (Roche) va fosfataz inhibitörleri (Sigma) o'z ichiga olgan 5 mM HEPES lizis tamponu ichida sonikleştirilmiştir. Protein konsentrasiyalari DC oqsili assotsiatsiyasi (Bio-Rad) tomonidan aniqlandi. Teng miqdordagi protein namunalari SDS-PAGE va Western blottingga ta'sir qilingan. G'arb bloklari SRF (1 / 1, Santa Cruz biotexnologiyasi) yoki GAPDH (2000 / 1; Abcam) uchun antikor yordamida tekshirildi va keyin Odyssey tasvirlash tizimi (Licor) yordamida skanerlash va miqdoriy baholandi.

RNK izolyatsiyasi va kantitativ PCR

RNK izolyatsiyasi, miqdoriy PCR (qPCR) va ma'lumotlar tahlillari ilgari ta'riflanganidek amalga oshirildi (Maze va boshqalar, 2010; Vialou va boshqalar, 2010). Qisqasi, RNK TriZol reaktifi (Invitrogen) bilan xavfsiz holatga qilindi va Qiagen'den RNAeasy mikro to'plamlari bilan yanada arındırıldı. Barcha RNK namunalari 260 / 280 va 260 / 230 qiymatlari ≥ 1.8 bo'lganligi aniqlandi. Teskari transkriptsiya iScript (Bio-Rad) yordamida amalga oshirildi. SYMB yashil (Quanta) dan foydalanib qPCR quyidagi cycle parametrlari bilan Applied Biosystems 7900HT RT PCR tizimi bilan bajarildi: 2 min 95 ° C da; 40 santimetr uchun 95 sxemasi, 15 s uchun 59 ° S, 30 s uchun 72 ° C; va bitta PCR mahsulotini tasdiqlash uchun ajratish chizig'ini hosil qilish uchun 33 ° C darajasiga qizdirilgan. Ma'lumotlar, D (T) usulida (Tsankova va boshqalar, 95) davolanish holatining (nazoratga qarshi va sezgir sichqonchani yoki inson nazorati va boshqalar bilan kasallangan bemorlarning) C (t) qiymatlarini taqqoslab tahlil qilindi. DFosB qPCR primerlari: foward, AGGCAGAGCTGGAGTCGGAGAT va teskari, GCCGAGGACTTGAACTTCACTCG.

ChIP

ChIP avvalgi ta'rif etilganidek (Maze va boshq., 2010) oxirgi nihoyasiga etgan tajribadan va sho'rlangan va kokain- dan olingan nazoratdan, sezgir va moslashuvchan sichqonlardan (to'rtta 14 gauge punches / sichqonchani) davolangan hayvonlarni oxirgi davolanishdan so'ng 1 soat davom etadi. To'qimalar 24% formaldegid bilan o'zaro bog'langan. Keyinchalik glitsin ilovasi orqali kesish to'xtatildi va to'qima yuvildi va ishlatilgunga qadar -1 ° C da saqlandi. Kesilgan kromatin kecha ilgari antitrotsit-SRF antikor (Santa Cruz biotexnologiyasi) bilan ilgari magnitli boncukla bog'langan (Dynabeads M-80; Invitrogen) inkübe qilindi. Orqaga o'zaro bog'lash va DNKni tozalashdan so'ng, SRFni fosb promoteriga ulash qPCR tomonidan ikki sarum reaktsiya elementi ulanish joylarini o'z ichiga olgan fosb promoterining hududini qamrab olgan primerlar yordamida aniqlandi. SRF inhibitlari no-antikor nazorati bilan solishtirganda ancha boyitilgan. Sichqoncha fosb gen promoteri primeri: oldinga, CCCTCTGACGTAATTGCTAGG va teskari, ACCTCCCAAACTCTCCCTTC.

Statistik tahlil

Bir tomonlama ANOVAlar biokimyoviy va xulq-atvor tahlillarida nazorat qiluvchi, sezgir va bardoshli sichqonlar o'rtasidagi vositalarni taqqoslash uchun ishlatilgan. DFOSB induksiyasini Srf mahalliy nokaut sichqonlarida ijtimoiy mag'lubiyat bilan solishtirish uchun, shuningdek Srf nokautining o'rganilgan nochorlik va lokomotor sezgirlik protokollarida ta'sirini solishtirish uchun ikki tomonlama ANOVAlar ishlatilgan. Talabaning t testlari Srf nokautining DFosB induksiyasiga va insonning o'limidan keyingi to'qimalar va sichqonchani ChIP tahlilidagi guruhlar o'rtasidagi vositalarni taqqoslash uchun ishlatilgan. Eksperimental sharoitlar o'rtasidagi farqlar p-0.05 bo'lganda statistik ahamiyatga ega deb hisoblangan.

natijalar

Inson depressiyasida va ijtimoiy jihatdan susayib qolgan sichqonlarda SRF va DFOSB ifodasi

Depressiyaga o'xshash xatti-harakatlarning rivojlanishida SRFning potentsial rolini o'rganish uchun biz birinchi bo'lib postmortem depressiyali odamlarning NAc-da SRF oqsil ekspresiyasini baholadik. Tushkunlikka tushgan sub'ektlar NAc-da SRF darajasini sezilarli darajada kamayganligini ko'rsatdi (t (19) = 1.9; p <0.05) (1A-rasm). SRFning faollikka bog'liq bo'lgan erta gen ekspressionini boshqarishda rolini hisobga olgan holda (Ramanan va boshq., 2005), biz SRF ushbu miya mintaqasida DFOSB ekspresiyasini boshqarishda ishtirok etishi mumkin deb taxmin qildik. Ushbu gipotezani qo'llab-quvvatlash uchun biz depressiyalangan odamlarning NAc-da (f (16) = 1.8; p <0.05) dfosb mRNA darajasi ham sezilarli darajada kamayganligini kuzatdik. Bu ushbu sharoitda DFOSB oqsilining kamayganligi haqidagi so'nggi topilmalarga ham mos keladi (Vialou va boshq., 1).

Shakl 1.

SRFning surunkali stressli repressiyasi NAcdagi DFOSB transkripsiyasining pasayishi bilan o'zaro bog'liq. A, B, Postmortem odam depressiyasida bemorlarda NAc (n = 10 / guruh; B) tarkibida SRF oqsilining (n = 8 / guruh; A) va Dfosb mRNA ekspresiyasining pasaytirilgan darajasi kuzatiladi. Surunkali (10 d) ijtimoiy mag'lubiyatga uchragan S, Sichqonlar sezgir va bardoshli subpopulyatsiyalarga guruhlangan. D, surunkali ijtimoiy mag'lubiyat stressi sezgir sichqonlarning NAc-da SRF oqsil darajasini pasaytiradi, ammo moslashuvchan sichqonlar emas, S-da ko'rsatilgan ijtimoiy ta'sir o'tkazish testidan 24 soat o'tgach, E bilan solishtirganda, NAcdagi fosB mRNA darajasi sezgir sichqonlarda o'zgarmas, ammo sezilarli darajada bardoshli hayvonlarda regulyatsiya qilingan (n = 7-15 / guruh). Surunkali ijtimoiy mag'lubiyat stressidan so'ng F, SRF oqsili fosb geni targ'ibotchisi bilan bog'lanishni kuchaytiradi va sezgir bo'lmagan sichqonlarda emas (n = 5 / guruh). Ko'rsatilgan ma'lumotlar o'rtacha ± SEM sifatida ifodalanadi (xatoliklar qatori sifatida ko'rsatilgan). Con., Nazorat qilish; Dep., Depressiya; Sus., Sezgir; Res., Bardoshli. * nazorat <p <0.05; *** p <0.001 versus control; #p <0.05 va sezgir; ## p <0.01 va sezgir; ### p <0.001 va sezgir.

Ushbu topilmalarni kengaytirish uchun biz sichqonlarda surunkali ijtimoiy mag'lubiyat stress protokolidan foydalandik. Ta'sirchan va bardoshli bo'lgan ikkita mag'lubiyatga uchragan sichqonlar guruhi aniq ko'rinib turardi (Krishnan va boshq., 2007), bu sezgir hayvonlar ham o'zaro ta'sirga ega, ham boshqaruvchi va bardoshli hayvonlar bilan solishtirganda ijtimoiy o'zaro ta'sirni sezilarli darajada kamaytirdi (F (2,23, 157.2) = 0.001; Bonferroni tuzatish bilan p <0.001; t sinovlari, sezgir va nazorat, p <0.05; moslashuvchan va nazorat, p <0.01; chidamli va sezgir, p <1) (2,32C-rasm). Oxirgi mag'lubiyat epizodidan ikki kun o'tgach, sezgir, bardoshli va noaniq nazorat sichqonlari NAc-da SRF ekspresiyasi uchun tahlil qilindi. Inson depressiyasidagi topilmalarga o'xshab, sezgir sichqonlarning NAc-da SRF oqsil darajasi sezilarli darajada pasaygan, SRF darajasi esa chidamli sichqonlarning NAc-da ta'sirlanmagan (F (4.7) = 0.05; p <0.05; t Bonferroni tuzatish, sezgir va nazorat, p <0.05; bardoshli va sezgir, p <1) (XNUMX-rasm).

Keyinchalik, biz ushbu uchta guruh hayvonlarining NAc tarkibidagi fosb mRNA ekspresiyasini tekshirdik va faqat moslashuvchan hayvonlarda Dfosb ekspresiyasining sezilarli darajada o'sishini kuzatdik, ammo sezgir sichqonlarda tendentsiya kuzatildi, ammo sezilarli o'sish kuzatilmadi (t (14) = 2.1; p <0.05 ) (1E-rasm). SRF darajalari va Dfosb transkripsiyasi o'rtasidagi mumkin bo'lgan o'zaro ta'sirlarni yanada o'rganish uchun biz sezgir va bardoshli sichqonlarning alohida guruhlarida surunkali ijtimoiy mag'lubiyat stressidan keyin SRFning fosb gen promotoriga bog'lanishining o'zgarganligini tekshirish uchun ChIP-dan foydalandik. Chidamli hayvonlar NAc-dagi fosb promoteriga sezilarli darajada yaxshilangan SRF ulanishini (t (8) = 2.1; p <0.05), shuningdek sezgir sichqonlar bilan taqqoslaganda (t (8) = 2.0; p <0.05). Nazorat qiluvchi va sezgir sichqonlar o'rtasida hech qanday farq kuzatilmadi, ehtimol sezgir sichqonlarda SRF induksiyasining etishmasligini aks ettiradi (1-rasm).

Surunkali ijtimoiy mag'lubiyat stressidan so'ng DRFning DFOSB-ni boshqarishda rolini tasdiqlash uchun SRFF / Sichqoncha SRF ning NAc dan tanlab o'chirilishining DFOSB ning stress indüksiyasiga ta'sirini o'rganish uchun ishlatilgan. Srffl / fl sichqonlariga stereotaksik ravishda GFP yoki Cre-GFP ni ifodalovchi AAV vektorlari bilan intra-NAc AOK qilindi. AAV-Cre-GFP tomonidan qo'zg'atilgan SRF ning NAc-ga xos nokauti immunohistokimyoviy tarzda tasdiqlandi (2A-rasm). Darhaqiqat, SRFni bo'yash va Cre ifodasi o'rtasida hech qanday to'qnashuv bo'lmagan va bu nokautning samaradorligini ko'rsatmoqda. Mikro dissektsiya qilingan NAc zarbalarida biz SRF oqsillari darajasida sezilarli darajada 50% pasayishni aniqladik (t (11) = 4.3; p <0.001). Kattaligi, ehtimol, bunday mikrodissektsiyalardagi to'qimalarning bir qismi virus bilan yuqmaganligini aks ettiradi.

Shakl 2.

SRF DFOSB induktsiyasini surunkali ijtimoiy mag'lubiyat stressi bilan vositachilik qiladi. A, AAV-Cre-GFP ning Srffl / fl sichqonlarining NAc-ga in'ektsiyasi Cre-expressing neyronlarda SRF oqsilini chiqarib tashlashga olib keladi. AAV-GFP in'ektsiyasi sezilarli ta'sir ko'rsatmadi. B, NRdan SRFni bunday tanlab olib tashlash surunkali ijtimoiy mag'lubiyat (n = 4 / guruh) dan keyin NAcdagi DFOSB induksiyasini to'liq bloklaydi. Ko'rsatilgan ma'lumotlar o'rtacha ± SEM sifatida ifodalanadi (xatoliklar qatori sifatida ko'rsatilgan). * p <0.05 AAV-GFP boshqaruviga qarshi; ** p <0.01 AAV-GFP mag'lubiyatiga qarshi.

Keyinchalik biz AAV-Cre-GFP yoki AAV-GFP bilan intra-NAc AOK qilingan mag'lubiyatga uchragan Srffl / fl sichqonlarining NAc-da DFosB uchun miqdoriy immunohistokimyani o'tkazdik. Surunkali ijtimoiy mag'lubiyat stressidan so'ng DFOSB ekspressioni AAV-GFP yuborilgan hayvonlarning NAc-da sezilarli darajada qo'zg'atildi (virus x bilan davolashning o'zaro ta'siri, F (1,12) = 6.4; Bonferroni tuzatish bilan t testlari, nazorat va mag'lubiyat, p <0.05; AAV-Cre va boshqalar AAV-GFP, p <0.01). Biroq, bu indüksiyon AAV-Cre-GFP (Shakl 2B) oladigan Srffl / fl sichqonlarida kuzatilmadi, bu esa surunkali stress bilan NAcdagi DFOSB indüksiyonunun SRF talab qilishini ko'rsatdi.

NAC-da SRF-nashri prodepressiya va proankimetsiyaga o'xshash fenotiplarni targ'ib qiladi

Surunkali ijtimoiy mag'lubiyat stressi bilan DFOSB induksiyasi ilgari elastiklik vositachiligida namoyon bo'lganligi sababli (Vialou va boshq., 2010), biz sezgir hayvonlardagi SRFning pasayishi va natijada DFOSB induksiyasining yo'qolishi deb taxmin qildik. hayvonlar stressning zararli ta'siriga ko'proq ta'sir qiladi. Ushbu gipotezani sinab ko'rish uchun biz yuqorida tavsiflangan kattalar Srffl / fl sichqonlarida Srf genining mahalliy NAc-ga xos o'chirilishini keltirib chiqardik va natijada paydo bo'lgan sichqonlar va ularning boshqaruv elementlari boshlang'ich depressiya va tashvishlarni baholash uchun xulq-atvor paradigmalarining batareyasida sinovdan o'tkazildi. xatti-harakatlar kabi. SRFning mahalliy NAc o'chirilishi majburiy suzish testi (t (30) = 2.5; p <0.05) orqali o'lchangan prodepressiyaga o'xshash ta'sirni, shuningdek ochiq maydonda o'lchangan anksiyogen ta'sirni (t (38) = 1.9; p <0.05) va ochiq / qorong'i sinovlar (t (8) = 1.9; p <0.05). Shunday qilib, AAV-Cre-GFP ni NAc ichiga olgan Srffl / fl sichqonlari majburiy suzish sinovida harakatsizlik kechikishining pasayishini, ochiq maydon markazida kamroq vaqtni va yorug'lik / qorong'i qutining yorug'lik qismida kam vaqtni ko'rsatdi. AAV-GFP yuborilgan hayvonlar bilan solishtirganda (3A-C-rasm). Shu bilan birga, SRFning NAc ichidagi o'chirilishi lokomotivning boshlang'ich darajasini o'zgartirmadi, bu SRFni nokaut qilgan hayvonlarda kuzatilgan xulq-atvor effektlari umumiy lokomotor faollikning anormalliklari bilan bog'liq emasligini ko'rsatdi (3-rasm). Ushbu ma'lumotlar avvalgi hisobotlarni hisobga olgan holda qiziqarli, garchi NAcdagi DFB depressivga o'xshash xatti-harakatlarni tartibga solsa-da, u tashvish bilan bog'liq javoblarga aloqador emas (Vialou va boshq., 2010). SRFni yo'qotish anksiyogen reaktsiyalarni keltirib chiqaradigan bizning hozirgi kashfiyotlarimiz buni buni DFOSB dan boshqa maqsadlar orqali amalga oshirilishini ko'rsatadi.

Shakl 3.

NAc dan SRF nokauti prodepressiya va proanksiyaga o'xshash fenotiplarni rivojlantiradi. A-C, SRffl / fl sichqonlarining NAc-ga AAV-Cre-GFP in'ektsiyasi orqali erishilgan NAc-dan SRFni tanlab olib tashlash, kechikishni harakatsiz holatga kamaytiradi (n = 14-18 / guruh; A) va mos ravishda markazda o'tkaziladigan vaqtni va ochiq maydonda (B) va yorug'lik / qorong'i (C) sinovlarda yorug'lik bo'linmasida bo'lgan vaqtni kamaytiradi (n = 5-15 / guruh). D, AAV-GFP yoki AAV-Cre-GFP ning intra-NAc in'ektsiyasini olgan sichqonlarning ochiq maydonida tayanch-harakat faolligida farq kuzatilmadi. E, F, o'rganilgan nochorlikka (n = 7-8 / guruh; E) va ijtimoiy mag'lubiyat stressiga (n = 5-6 / guruh; F) nisbatan sezgirlikning oshishi, mos ravishda qochish va ijtimoiy ta'sir o'tkazish vaqtining kechikishi bilan o'lchanadi. . Ko'rsatilgan ma'lumotlar o'rtacha ± SEM sifatida ifodalanadi (xatoliklar qatori sifatida ko'rsatilgan). * p <0.05 GFP ga qarshi yoki maqsadga nisbatan yo'q; ** p <0.01 ga nisbatan GFP; *** p <0.001 ga nisbatan GFP.

Keyinchalik, NAcdagi SRFni yo'q qilish, shuningdek, hayvonning takroriy stressning zararli ta'siriga nisbatan zaifligini oshiradimi yoki yo'qligini o'rganib chiqdik. NAVga AAV-Cre-GFP yoki AAV-GFP bilan yuborilgan Srffl / fl sichqonlari ikkita depressiya modelida tekshirildi, ojizlik va surunkali ijtimoiy mag'lubiyat stressini o'rgandilar. O'rganilgan nochorlikda, AAV-Cre-GFPni qabul qiladigan Srffl / fl hayvonlar oyoqning zarbasidan qochib qutulish uchun kechikishni kuchaytirdilar, bu oldin oyoqning zarba stresiga duchor bo'lgandan keyin (davolash × sinovlarning o'zaro ta'siri, F (14,180) = 10.2; Bonferroni tuzatish bilan t sinovlari, p <0.001; AAV-Cre va boshqalar AAV-GFP, p <0.01), bu stress tufayli kelib chiqadigan xulq-atvor etishmovchiligiga nisbatan sezgirlikni oshiradi (3E-rasm). Xuddi shu tarzda, NAc-dan mahalliy SRF o'chirilishi, shuningdek, surunkali ijtimoiy mag'lubiyat stressidan so'ng (A-10F) AAV-GFP tomonidan yuborilgan nazorat hayvonlari bilan solishtirganda ijtimoiy nafratni oshirdi (t (1.8) = 0.05; p <3), prodepressiyaga o'xshash ta'sir.

DFFning indossiyasida SRF ishtirok etmasligi va giyohga nisbatan xatti-harakatlari

DFOSB, shuningdek, giyohvand moddalar kabi giyohvand moddalarga javoban NAc da paydo bo'lganligini hisobga olsak, SRFning kokain ta'sirida potentsial rolini o'rganish qiziq edi. Surunkali ijtimoiy mag'lubiyat stressidan farqli o'laroq, takroriy kokain ta'sirida NAc (S (14) = 0.8; p> 0.05) da SRF oqsil ekspressioni o'zgargani yo'q (4A-rasm) va SRFning ushbu miya mintaqasida fosB gen promotoriga bog'lanishiga ta'sir ko'rsatmadi. (t (4) = 0.7; p> 0.05) (4B-rasm). Bu shuni ko'rsatadiki, stressdan farqli o'laroq, surunkali kokaindan keyin DFOSB indüksiyasi SRF orqali vositachilik qilmaydi. Surunkali kokaindan keyin DAVF birikmasi SRffl / fl hayvonlarida AAV-Cre-GFP va AAV-GFP ni NAc ga qabul qilgan holda o'zgarganligini tekshirish orqali biz buni to'g'ridan-to'g'ri sinab ko'rdik. SRFni yo'q qilish ushbu miya mintaqasida kokainga bog'liq DFosB birikmasiga hech qanday ta'sir ko'rsatmaganligini aniqladik (4C-rasm).

Shakl 4.

SRFning yo'qolishi DF yoki Kokain bilan boshqariladigan xatti-harakatlarda kokain indüksiyasiga ta'sir ko'rsatmadi. A, B, takrorlangan kokainga ta'sir qilish (7 d, 20 mg / kg kokain-HCl) NAc (A) da SRF proteini ifodasi yoki SRFda bu miya hududida (B) 24 soat keyin fosB gen promoteriga ulanishga ta'sir ko'rsatmadi dori ta'sir qilish (n = 5 / guruh). C, DFOSB to'planishi, o'lchangan immunotsitokimyoviy, surunkali giyoh ta'siridan keyingi SRF-ning NAc-o'ziga xos nuktası ta'sir qilmaydi. D, E, NSF dan SRFning mahalliy yo'qolishi, shuningdek kokain bilan indikatsiyalangan lokomotor faoliyat va shovqinlarni (n = 1 / gurux) (d 8-1; D) yoki sho'r suyuqlik quyish (d 7) dan keyin lokomotor ta'sirga ta'sir ko'rsatmadi kokain bilan shartlangan joyga nisbatan afzallik beriladi (n = 8 / group; E). Ko'rsatilgan ma'lumotlar o'rtacha ± SEM (ifoda chiziqlari sifatida ko'rsatilgan) sifatida ifodalanadi.

Ushbu ajablantiradigan topilmani kuzatib borish uchun biz NAc-dan tanlangan SRF nokautining kokainga bo'lgan xatti-harakatlarini o'zgartiradimi yoki yo'qligini tekshirdik. SRF ning kokain bilan DFOSB induksiyasini tartibga solmasligi bilan mos ravishda, SRFning NAc-ga xos taqsimlanishi, takroriy kokain ta'siridan keyin ko'rilgan o'tkir kokain yoki lokomotor sensitizatsiyadan kelib chiqadigan lokomotor faoliyatga ta'sir ko'rsatmadi (davolash vaqti bilan o'zaro ta'sir, F (4,80) = 0.3; p> 0.05) (4-rasm). Xuddi shu tarzda, SRFning NAc-ga xos taqsimlanishi kokain bilan shartlangan joy afzalligiga ta'sir ko'rsatmadi (t (14) = 0.1; p> 0.05) (Shakl 4E), bu bilvosita kokain mukofotini beradi.

muhokama

Ushbu tadqiqot SRFni surunkali ijtimoiy mag'lubiyatdan keyin NSFda DFOSBning yangi yuqori oqim vositachisi sifatida aniqladi va depressiv va xavotirga o'xshash xulq-atvorni rivojlantirishda SRFni aks ettiradi. Biz surunkali ijtimoiy mag'lubiyatning stressi NAc ning sezgir, lekin moslashuvchan bo'lmagan hayvonlarda SRF darajasini pasaytirishi va bu past regulatsiya biz ko'rsatgan bu miya hududida DFBning induktsiyasini to'xtatishi uchun surunkali stress bilan samarali kurashish uchun zarur bo'lgan to'g'ridan- ya'ni, moslashuvchanlik (Vialou va boshq., 2010). SRF ekspresyonunda shunga o'xshash pasayish DFOSB mRNA va protein ekspresyonu ham kamaygan, depresif insonlar NAc'de edi. Boshqa tomondan, DFOSB ekspresyonunu nazorat qilishda, boshqa transkripsiyonel mexanizmlarni hali ham noma'lum bo'lgan SRF'nin pastga regülasyonuna-da, sezgir sichqonchani NAc'de DFOSB darajalari azaltılmamıştır. Surunkali stressdan so'ng NAFda DFOSB indüksiyasini vositachilik qilishda SRF uchun neylon rol o'ynadi. Bu SRF ning bu miya hududidan indüklenebilen genetik silinmesinin foydalanish bilan belgilangan. Ushbu NAc-o'ziga xos SRF bilan taqqoslash bilan sichqonlarning o'zini tutish tahlili SRFni asosiy va stressga asoslangan depressiya va xavotirga o'xshash xatti-harakatlarning rivojlanishida muhim rol o'ynaganligi bilan izohlaydi. Ayniqsa, kontrastdan SRFni yo'q qilish surunkali giyoh qo'llanilishiga yoki kokainning xulq-atvor ta'siriga javoban DFOSB indüksiyasiga ta'sir ko'rsatmadi. Ushbu topilmalar DFF indüksiyonunun tartibga solinishi va atrof-muhitning turli tashvishlariga nisbatan qiziqishlariga javob berishda SRF uchun yangi rag'batlantiruvchi o'ziga xos rolni qo'llab-quvvatlaydi.

SRF vositachiligida transkripsiyadan oldin sinaptik faollikka javob berildi, asosan, kaltsiy oqimi ko'payishi bilan, shuningdek neyrostrofik faollikni oshiradi, ayniqsa miya manbalaridan kelib chiqqan neyrotrofik omil (BDNF) (Bading va boshq., 1993; Xia va boshqalar, 1996; Johnson va boshqalar, 1997; Chang va boshqalar, 2004; Kalita va boshqalar, 2006; Knöll and Nordheim, 2009). Bu SRF nima uchun SRCda mushkul, ammo sog'lom bo'lmagan sichqonlarning surunkali ijtimoiy mag'lubiyatdan so'ng stresslarni kamaytirishi haqida qiziqarli savol tug'diradi. Ushbu differensial regulyatsiya Dopamin yoki BDNF signalizatsiyasi bilan bog'liq emas, chunki sezgir sichqonlarda BDNF oqsil darajalari oshdi va NKda past oqimdagi BDNF signalizatsiyasi, shuningdek NAc ni innervatsiya qiluvchi ventral tegmental hududning (VTA) dopamin neyronlarining kuchli portlashi bo'ldi. moslashuvchan hayvonlar BDNF signalizatsiyasi va VTA otish stavkalarini normal darajada ko'rsatadi (Krishnan va boshq., 2007). Shu bilan bir qatorda, bu miya mintaqasidagi o'zgaruvchan glutamatergik innervasyonga javoban NAC'de SRF ekspresyonunun bastırılmasının muqobil bo'lishi mumkin, albatta, biz ko'rsatdikki, bu sezgir va moslashuvchan sichqonchani (Vialou va boshqalar, 2010) farqli ravishda tartibga solinadi. Ushbu va boshqa mumkin bo'lgan mexanizmlarni bevosita o'rganish uchun qo'shimcha ishlar qilish kerak.

Genom-keng va boshqa usullarni qo'llagan so'nggi tadqiqotlar, SRF maqsadidagi genlarning ~ NNXX-5% darhol erta genidir (Philippar va boshqalar, 10; Ramanan va boshqalar, 2004; faol va boshqalar, 2005; Knöll and Nordheim, 2006). Bu surunkali stress bilan fosbning darhol erta genining kesilgan mahsuloti bo'lgan DFB ning indüksiyonundaki SRF uchun muhim rolni ko'rsatadigan ma'lumotlarimizga mos keladi. Qizig'i shundaki, ushbu turli xil tadqiqotlarda aniqlangan SRF maqsadli ko'p sonli genlar NAc da DFF ning ma'lum maqsadlarini ifodalaydi (Kumar va boshq., 2009; Renthal va boshq., 2005, 2008; Maze va boshq., 2009). Ushbu keng tarqalgan regulyatsiya qilingan genlar orasida neyronal sitoskeletani (masalan, Cdk2010, arc va Actb) tartibga soluvchi ma'lum bo'lgan bir nechtasi mavjud. O'z navbatida, SRF bir nechta neyronal hujayralardagi aktin dinamikasi va nöronal harakatlanishiga ta'sir qiladi (Alberti va boshq., 5; Ramanan va boshq., 2005; Knöll va boshqalar, 2005), DF NAc nöronlarının dendritik orqa miya o'sishi ta'sir qiladi (Maze va boshq., 2006). Bunday keng tarqalgan funktsional so'nggi nuqtalar SRF ning kelishilgan ta'sirini aks ettirishi mumkin, bu esa uning nerv hujayralari morfologiyasini va natijada murakkab xulq-atvor ta'sirini kamaytirish uchun umumiy maqsadli genlar seriyasiga ta'sir qiladigan DFBning indüksiyasidir.

SRF shuningdek, sinaptik plastisitni va neyronal faoliyatga bog'liq genin ifodasi va xulq-atvorini boshqarishda muhim rol o'ynash uchun namoyon bo'ldi. Masalan, yangi atrof-muhitni yoki elektrokonvulsif seizlar orqali neyronlarning faollashuviga ixtiyoriy izlanishlarga javoban darhol erta genlarni SRF-ga bog'liq holda yo'qotish Srf mutantlarining hipokampusida uzoq muddatli sinaptik potentsializm buzilganligi bilan bog'liq (Ramanan va boshq. , 2005; faol va boshqalar, 2006). Bundan tashqari, hipokamplarda SRFning yo'qolishi uzoq muddatli sinaptik depressiyadan, yangi kontekst bilan yuzaga keladigan darhol erta gen ekspluatatsiyasida va yangi muhitni o'rganish paytida tanaffuslarga sabab bo'lganligi aniqlandi (Enf et al., 2006). Ushbu ma'lumotlar hayvonning atrof muhitni bezovtaligiga mos ravishda moslashish qobiliyatida SRFning ahamiyatini belgilaydi, chunki yuqorida aytib o'tilganidek, yangi muhitga odatlanishni o'rganishda yoki salbiy stressli stimullarga moslashganda, stressning tarqalishini oldini olishda. - bizning hozirgi ishimizdagi kabi xulq-atvor nuqsonlari. Shunday qilib, biz sezgir odamlarda ijtimoiy mag'lubiyat stressiga javoban yoki SRFni to'g'ridan-to'g'ri yiqitish orqali SRF ekspressionida defitsitni namoyish etadigan hayvonlar depressiv va xavotirga o'xshash xatti-harakatlarni namoyon etishini kuzatamiz. Depressiyaga tushgan insonlar NAc da SRF darajasining pasayishi bilan birga bo'lganligini hisobga olsak, SRFning shaxsning salbiy atrof-muhit stimullariga ijobiy moslashish qobiliyatini tartibga solishda, qisman NAcdagi DFOSB ekspresiyasini tartibga solish orqali asosiy rol o'ynashi mumkin.

TARKIBIY MEXANIZMALAR: QO'SHIMCHA VA STRESSGA DARAJADA

Ushbu tadqiqotning ajablanarli natijasi, SRF surunkali stressga javoban NAFda DFSB to'planishi uchun zarur bo'lsa-da, Surunkali kokainga javoban bir xil miya hududida DFOSB indüksiysi uchun talab qilinmaydi. Xuddi shunday, SRF odatdagi xatti-harakatlar uchun ham talab qilinmaydi. Ushbu ma'lumotlar, DFOSB ning ko'p turdagi ogohlantirgichlarga javoban (Nestler va boshq., 1999; Nestler, 2008) javob berganiga qaramay, DFOSB indüksiyasiga olib keladigan alohida molekulyar yo'llar mavjud. Ushbu topilmalar uchun mumkin bo'lgan tushuntirishlar qisman turli xil hujayra turlaridan iborat, bu esa stressga qarshi kurashda DFOSB birikmasini aks ettiradi. Surunkali stress, D1 dopamin retseptorlari bilan solishtirganda D2 va D1 dopamin retseptorlarini aks ettiradigan NAc o'rta tuproqli neyronlarning ikkita asosiy subpopulyatsiyasi ichida teng ravishda DFOSB ni keltirib chiqaradi, surunkali kokain DFNBX ni asosan D1999 + neyronlar ichida keltiradi (Kelz va boshqalar, 2004; Perrotti va boshqalar, 2) . Shunday qilib, DXNUMX + neyronlarda DFSga bog'liq bo'lgan yo'llar DFOSB indüksiyasi uchun muhim bo'lishi mumkin. Biroq, bu surunkali stressdan keyin SRF-ni sindirib tashlash sichqonchalarida DFOSB indüksiyasining to'liq yo'qolishini tushuntirmaydi, chunki indüksiyon neyronal subtipalarda ham uchraydi. Shu bilan bir qatorda tushuntirish, surunkali stress va surunkali kokainning NAc neyronlari bo'yicha turli xil ish usullari tufayli, ma'lum hujayra ichidagi signalizatsiya kaskaglariga putur etkazishi va ilgari ta'kidlanganidek, surunkali stress bilan o'zgargan glutamaterjik transmisyon orqali ishlaydigan va surunkali kokain asosan D1 retseptorlari signalizatsiyasi (Nestler, 2008). Surunkali stress va surunkali kokainga qarshi DFOSB indüksiyonu, turli xil glutamaterjik projektoriyalar hududlaridan NAc'yi innervatsiya qiladi, masalan, prefrontal korteks, hipokampus va amigdala kabi bir necha mintaqada turli Nöral kirishlar tomonidan turli xil nazorat ostida bo'lgan transkripsiyonel mexanizmlarga bog'liq. Ushbu va muqobil imkoniyatlarni o'rganish uchun juda ko'p ishlar qilinishi kerak.

Bizning topilmalarimiz bilan birga DFOSB ning stressli stimullarga qarshi repressiv javoblarga vositachilik qilish uchun NAc-ga kiritilgan yangi transkripsiya mexanizmi aniqlanadi. Ushbu tadqiqot shuningdek SRF darajasida NAc darajasida depressiya va xavotirga o'xshash xulq-atvorlarni tartibga solishda rol o'ynaydigan yangi tushunchalarni beradi.. Bunday xatti-harakatlarni tartibga solishda SRFning transkripsiyaviy rolini yaxshiroq tushunib olish, stress bilan bog'liq kasalliklarga chidamlilik bilan bog'liq bo'lgan yangi gen maqsadlarini aniqlashga yordam beradi va kelajakda yanada samarali antidepressant terapiyalarni rivojlantirishga yordam beradi.

Ushbu ish Milliy ruhshunoslik instituti va Narkotik moddalarni suiiste'mol qilish milliy instituti va AstraZeneca bilan tadqiqot alyansining grantlari bilan qo'llab-quvvatlandi. Srffl / fl sichqonchalarini taqdim qilish uchun David D. Ginty ga rahmat.

Xat yozishni Erik J. Nestler, Fishberg Nevrologiya bo'limi, Sinay tibbiyot maktabi, One Gustave L. Levy Pleys, Box 1065, Nyu-York, NY 10029-6574 bilan bog'lash kerak. [elektron pochta bilan himoyalangan]

Mualliflik huquqi © 2010 mualliflari 0270-6474 / 10 / 3014585-08 $ 15.00 / 0

Manbalar

1. ↵

1. Alberti S,

2. Krause SM,

3. Kretz O,

4. Philippar U,

5. Lemberger T,

6. Casanova E,

7. Wiebel FF,

8. Schwarz H,

9. Frotscher M,

10. Schütz G,

11. Nordheim A

(2005) Murik rostral migratsiya oqimidagi neyronal migratsiya sarum reaktsiyasini talab qiladi. Proc Natl Acad Sci AQSh 102: 6148-6153.

Xulosa / to'liq matn

2. ↵

1. Bading H,

2. Ginty DD,

3. Greenberg ME

(1993) Hipokampal neyronlarda gen ekspresyonini turli xil kaltsiy signalizatsiya yo'llari bilan tartibga solish. Fan 260: 181-186.

Xulosa / to'liq matn

3. ↵

1. Berton O,

2. McClung CA,

3. Dileone RJ,

4. Krishnan V,

5. Renthal Vt,

6. Russo SJ,

7. Graham D,

8. Tsankova NM,

9. Bolanos CA,

10. Rios M,

11. Monteggia LM,

12. O'z DW,

13. Nestler EJ

(2006b) Mezolimbik dopamin yo'lidagi BDNFning ijtimoiy ahamiyatga ega stressdagi asosiy roli. Fan 311: 864-868.

Xulosa / to'liq matn

4. ↵

1. Berton O,

2. Covington HE 3rd.,

3. Ebner K,

4. Tsankova NM,

5. Karle sh.b.,

6. Ulery R,

7. Bhonsle A,

8. Barrot M,

9. Krishnan V,

10. Singewald GM,

11. Singewald N,

12. Birnbaum S,

13. Neve RL,

14. Nestler EJ

(2007) Periaqueduktal kulranglarda DFO ning indulatsiyasi stress bilan faol javob berishga yordam beradi. Neuron 55: 289-300.

CrossRefMedline

5. ↵

1. Chang SH,

2. Poser S,

3. Xia Z

(2004) Neyronal omon qolishda sarum reaktsiyasi omili uchun yangi rol. J Neurosci 24: 2277-2285.

Xulosa / to'liq matn

6. ↵

1. Faol A,

2. Alarcón JM,

3. Weisberg SP,

4. Touzani K,

5. Huang YY,

6. Nordheim A,

7. Kandel ER

(2006) SRFni o'rganishdagi o'rni: kattalarga qarshi oldindan siljishlarni yo'qotish va yangi kontekstni darhol xotirlashni shakllantirish. Neuron 50: 127-143.

CrossRefMedline

7. ↵

1. Heinze HJ,

2. Heldman M,

3. Voges J,

4. Hinrichs H,

5. Marco-Pallares J,

6. Hopf JM,

7. Myuller UJ,

8. Galazky I,

9. Sturm V,

10. Bogertlar B,

11. Münte TF

(2009) Yadro akumbenslarining chuqur miya stimullanishini qo'llash orqali jiddiy spirtli ichkilikka bog'liqlikda rag'batlantirish xurujiga qarshi turish: klinik va asosiy fan yo'nalishlari. Front Hum Neurosci 3: 22.

Medline

8. ↵

1. Jonson CM,

2. Hill CS,

3. Chawla S,

4. Treisman R,

5. Bading H

(1997) Kaltsiy Ras / mitojen bilan ishlaydigan protein kinazlari (ERK) signalizatsiya kaskadidan mustaqil ravishda ishlaydigan uch xil yo'llar orqali gen ekspressionlarini nazorat qiladi. J Neurosci 17: 6189-6202.

Xulosa / to'liq matn

9. ↵

1. Kalita K,

2. Kharebava G,

3. Zheng JJ,

4. Hetman M

(2006) ERK1 / 1 ning megakaryoblastik aktiv lösemi-2 ning roli - BDNF tomonidan sarum reaktsiyasi omili bilan transkriptsiyasini stimulyatsiya qilish yoki sinaptik faollikni oshirish. J Neurosci 26: 10020-10032.

Xulosa / to'liq matn

10. ↵

1. Kelz MB,

2. Chen J,

3. Carlezon Vt Jr.,

4. Whisler K,

5. Gilden L,

6. Beckmann AM,

7. Steffen S,

8. Zhang YJ,

9. Marotti L,

10. O'z DW,

11. Tkatch T,

12. Baranauskas G,

13. Surmeier DJ,

14. Neve RL,

15. Duman RS,

16. Picciotto MR,

17. Nestler EJ

(1999) Mushak ichidagi transkriptsion faktori DFBning ifodasi giyohga sezgirlikni nazorat qiladi. Tabiat 401: 272-276.

CrossRefMedline

11. ↵

1. Knöll B,

2. Nordheim A

(2009) Nerv tizimida transkripsiyadan foydalanish omillarining funktsional ko'p qirrali: SRF paradigmasi. Trends Neurosci 32: 432-442.

CrossRefMedline

12. ↵

1. Knöll B,

2. Kretz O,

3. Fiedler C,

4. Alberti S,

5. Schütz G,

6. Frotscher M,

7. Nordheim A

(2006) Serumning javob faktorlari hipokampustaki nöronal kontaktlarning joylashishini nazorat qiladi. Nat Neurosci 9: 195-204.

CrossRefMedline

13. ↵

1. Krishnan V,

2. Xon MH,

3. Graham DL,

4. Berton O,

5. Renthal Vt,

6. Russo SJ,

7. Laplant Q,

8. Graham A,

9. Lutter M,

10. Lagace DC,

11. Ghose S,

12. Reister R,

13. Tannous R,

14. Yashil to,

15. Neve RL,

16. Chakravarty S,

17. Kumar A,

18. Eisch AJ,

19. O'z DW,

20. Lee FS,

21. va boshq.

(2007) Molekulyar moslashuvlar miya reja hududlarida ijtimoiy sezuvchanlik va qarshilikka asoslangan. Hujayra 131: 391-404.

CrossRefMedline

14. ↵

1. Kuhn J,

2. Bauer R,

3. Pohl S,

4. Lenartz D,

5. Huff V,

6. Kim EH,

7. Klosterkoetter J,

8. Sturm V

(2009) Nukleus akumbenslarining chuqur miya stimullanishidan so'ng chekishni tashlashda cheklovlar. Evr Addict Res 15: 196-201.

CrossRefMedline

15. ↵

1. Kumar A,

2. Choi KH,

3. Renthal Vt,

4. Tsankova NM,

5. Theobald, ShU,

6. Truong HT,

7. Russo SJ,

8. Laplant Q,

9. Sasaki vagon,

10. Whistler KN,

11. Neve RL,

12. O'z DW,

13. Nestler EJ

(2005) Xromatinni qayta tuzish striatumda kokain bilan indikatsiyalangan plastisitikaning asosiy mexanizmi. Neuron 48: 303-314.

CrossRefMedline

16. ↵

1. Maze I,

2. Covington HE 3rd.,

3. Dietz DM,

4. LaPlant Q,

5. Renthal Vt,

6. Russo SJ,

7. Mexanik M,

8. Mouzon E,

9. Neve RL,

10. Haggarty SJ,

11. Ren Y,

12. Sampath SC,

13. Hurd YL,

14. Greengard R,

15. Taraxovskiy A,

16. Schaefer A,

17. Nestler EJ

(2010) G9aning histon metiltransferazining asosiy vazifasi kokainga bog'liq plastika. Fan 327: 213-216.

Xulosa / to'liq matn

17. ↵

1. McClung CA,

2. Ulery PG,

3. Perrotti LI,

4. Zachariou V,

5. Berton O,

6. Nestler EJ

(2004) DeltaFosB: miyada uzoq muddatli moslashish uchun molekulyar kalit. Brain Res Mol Brain Res 132: 146-154.

Medline

18. ↵

1. Nestler EJ

(2008) Narkomaniyaning transkripsiya mexanizmlari: deltaFosBning ahamiyati. Filos Trans R Soc London B Biol Sci 363: 3245-3255.

Xulosa / to'liq matn

19. ↵

1. Nestler EJ,

2. Carlezon va boshqalar Jr.

(2006) Depressiyadagi mezolimbik dopamin mukofot davri. 59 biologik psixiatriya: 1151-1159.

CrossRefMedline

20. ↵

1. Nestler EJ,

2. Kelz MB,

3. Chen J.

(1999) DFOSB: uzoq muddatli neyral va xulq-atvorli plastisiyani molekulyar vositachisi. Brain Res 835: 10-17.

CrossRefMedline

21. ↵

1. Nyuton SS,

2. Thome J,

3. Wallace sh.b.,

4. Shirayama Y,

5. Schlesinger L,

6. Sakai N,

7. Chen J,

8. Neve R,

9. Nestler EJ,

10. Duman RS

(2002) Yadro akumbensidagi cAMP javob elementini bog'laydigan oqsil yoki dynorphin inhibitatsiyasi antidepressantga o'xshash effekt hosil qiladi. J Neurosci 22: 10883-10890.

Xulosa / to'liq matn

22. ↵

1. Nikulina EM,

2. Arrillaga-Romany I,

3. Miczek KA,

4. Hammer RP Jr.

(2008) Sichqonchalarda takroran takroran ijtimoiy mag'lubiyatdan keyingi mezokortikolimbik tuzilmalarda uzoq muddatli o'zgarishlar: mu-opioid retseptorlari mRNA va FosB / DeltaFosB ning immunoreaktivligi vaqtida. Eur J Neurosci 27: 2272-2284.

CrossRefMedline

23. ↵

1. Perrotti LI,

2. Hadeishi Y,

3. Ulery PG,

4. Barrot M,

5. Monteggia L,

6. Duman RS,

7. Nestler EJ

(2004) surunkali stressdan so'ng mukofotlash bilan bog'liq miya strukturalarida DFOSB indüksiyasidir. J Neurosci 24: 10594-10602.

Xulosa / to'liq matn

24. ↵

1. Perrotti LI,

2. Weaver RR,

3. Robison B,

4. Renthal Vt,

5. Maze I,

6. Yazdani S,

7. Elmore RG,

8. Knapp DJ,

9. Selley, ShU,

10. Martin BR,

11. Sim-Selley L,

12. Bachtell RK,

13. O'z DW,

14. Nestler EJ

(2008) DeltaFosB ning turli xil nayranglari miyadagi suiiste'mollik bilan bog'liq. Synapse 62: 358-369.

CrossRefMedline

25. ↵

1. Philippar U,

2. Schratt G,

3. Dieterich S,

4. Myuller JM,

5. Galgovichi R,

6. Engel FB,

7. Keating MT,

8. Gertler F,

9. Shule R,

10. Vingron M,

11. Nordheim A

(2004) SRF maqsadli gen Fhl2 SRF ning RhoA / MALga bog'liqligini faollashtiradi. Mol hujayra 16: 867-880.

CrossRefMedline

26. ↵

1. Ramanan N,

2. Shoh Y,

3. Sarsfild S,

4. Lemberger T,

5. Schütz G,

6. Linden DJ,

7. Ginty DD

(2005) SRF faoliyati bilan bog'liq gen ifodasini va sinaptik plastisitni vositachilik qiladi, ammo neyronal hayotiylikka ega emas. Nat Neurosci 8: 759-767.

CrossRefMedline

27. ↵

1. Renthal Vt,

2. Karle sh.b.,

3. Maze I,

4. Covington HE 3rd.,

5. Truong HT,

6. Alibhai I,

7. Kumar A,

8. Montgomery RL,

9. Olson EN,

10. Nestler EJ

(2008) Delta FosB surunkali amfetamin ta'siridan keyin c-fos genining epigenetik desensitizatsiyasiga vositachilik qiladi. J Neurosci 28: 7344-7349.

Xulosa / to'liq matn

28. ↵

1. Renthal Vt,

2. Kumar A,

3. Xiao G,

4. Wilkinson M,

5. Covington HE 3rd.,

6. Maze I,

7. Sikder D,

8. Robison AJ,

9. LaPlant Q,

10. Dietz DM,

11. Russo SJ,

12. Vialou V,

13. Chakravarty S,

14. Kodadek TJ,

15. Stack A,

16. Kabbaj M,

17. Nestler EJ

(2009) Kokaindan kromatinni boshqarishni genom-keng tahlil qilish sirtuinlar uchun ahamiyatga ega. Neuron 62: 335-348.

CrossRefMedline

29. ↵

1. Schlaepfer TE,

2. Cohen MX,

3. Frick C,

4. Kosel M,

5. Brodesser D,

6. Axmacher N,

7. Joe AY,

8. Kreft M,

9. Lenartz D,

10. Sturm V

(2008) Davolash uchun chuqur miya stimulyatori refrakter yirik depressiyani anhedoni kamaytiradi. Nöropsikofarmakologiya 33: 368-377.

CrossRefMedline

30. ↵

1. Sesack SR,

2. Grace AA

(2010) Cortico-bazal ganglion mukofotlari tarmog'i: mikrosxemalar. Nöropsikofarmakologiya 35: 27-47.

CrossRefMedline

31. ↵

1. Tomita X,

2. Vawter MP,

3. Walsh DM,

4. Evans SJ,

5. Choudary PV,

6. Li J,

7. Overman KM,

8. Atz ME,

9. Myers RM,

10. Jones EG,

11. Watson SJ,

12. Akil H,

13. Bunney WE Jr.

(2004) Agonal va postmortem omillarning gen ekspresyon profiliga ta'siri: mikroarray tahlillari sifat nazorati yoki inson miyasidan keyingi postmortem. Biol psychiatry 55: 346-352.

CrossRefMedline

32. ↵

1. Tsankova NM,

2. Berton O,

3. Renthal Vt,

4. Kumar A,

5. Neve RL,

6. Nestler EJ

(2006) Depressiya va antidepressant ta'sirining sichqoncha modelida doimiy hippokamp kromatinni regulyatsiyasi. Nat Neurosci 9: 519-525.

CrossRefMedline

33. ↵

1. Vassoler FM,

2. Shmidt HD,

3. Gerard ME,

4. Mashhur KR,

5. Ciraulo ULARNING,

6. Kornetskiy S,

7. Knapp CM,

8. Pirs RC

(2008) Nucleus accumbens qobig'ining chuqur miya stimulyatsiyasi kalamushlarda kokainning astarlanishga asoslangan dori-darmonlarni qayta tiklashini kuchaytiradi. J Neurosci 28: 8735-8739.

Xulosa / to'liq matn

34. ↵

1. Vialou V,

2. Robison AJ,

3. Laplant QC,

4. Covington HE 3rd.,

5. Dietz DM,

6. Ohnishi YN,

7. Mouzon E,

8. Rush AJ 3rd.,

9. Watts EL,

10. Wallace DL,

11. Iñiguez SD,

12. Ohnishi YH,

13. Steiner, Ma,

14. Warren BL,

15. Krishnan V,

16. Bolaños CA,

17. Neve RL,

18. Ghose S,

19. Berton O,

20. Tamminga shahri,

21. Nestler EJ

(2010) MF mukofotlari davrida stress va antidepressant javoblarga qarshilik ko'rsatadi. Nat Neurosci 13: 745-752.

CrossRefMedline

35. ↵

1. Wilkinson MB,

2. Xiao G,

3. Kumar A,

4. LaPlant Q,

5. Renthal Vt,

6. Sikder D,

7. Kodadek TJ,

8. Nestler EJ

(2009) Imipraminni davolash va moslashuvchanligi bosh miya mukofoti mintaqasida shunga o'xshash kromatinni boshqarishni namoyish etadi. J Neurosci 29: 7820-7832.

Xulosa / to'liq matn

36. ↵

1. Xia Z,

2. Dudek X,

3. Miranti CK,

4. Greenberg ME

(1996) NMDA retseptorlari orqali kaltsiy oqimi bir MAP kinase / ERKga qaram mexanizm bilan darhol erta gen transkripsiyasini keltirib chiqaradi. J Neurosci 16: 5425-5436.

Xulosa / to'liq matn