Fosforiliyin DeltaFosB sabitliyinin tənzimlənməsi (2006)

J Neurosci. 2006 May 10;26(19):5131-42.

Ulery PG, Rudenko G, Nestler EJ.

mənbə

Psixiatriya Departamenti, Basic Neuroscience Mərkəzi, Texas Southwestern Medical Center Universiteti, Dallas, Texas 75390-9070, ABŞ.

mücərrəd

Transkripsiya faktoru DeltaFosB (həmçinin FosB2 və ya FosB (qısa forma) kimi istinad edilir) istifadəsi, stress və elektrokonvulsif nöbetlər daxil olmaqla, psixoaktiv stimulların bir neçə növünə xroniki məruz qalma ilə beynə gətirilən uzunmüddətli plastisitənin mühüm vasitəçisidir . DeltaFosB'nin fərqli bir xüsusiyyəti, bir dəfə törədildikdə, daha çox stimullaşdırma olmadığı zaman beynində nisbətən uzun müddət ərzində davam edir. Bununla belə, bu sabit sabitliyin təməl mexanizmləri hələ də məlum deyil. Burada DeltaFosB'nin, nisbətən sabit bir transkripsiyon faktoru olduğunu, hüceyrə mədəniyyətində yarım ömrü təxminən 10 h olduğunu göstəririk. Bundan başqa, DeltaFosB'nin beyində fosfoprotein olduğunu və DeltaFosB-də yüksək səviyyədə qorunan bir serin qalıqının (SerxNUMX) fosforiliyasını proteazomal degradasiyadan qoruduğunu göstərir. Bu fosforilimin kasein kinaz 27 tərəfindən vasitəçilik etdiyini göstərən bir sıra dəlillər təmin edirik. Bu tapıntılar DeltaFosB'nin fosforilatlandığını və fosforiliyanın beynin uzunmüddətli uyğunlaşmalarına vasitəçilik etmək qabiliyyətində olan sabitliyinə təsir göstərdiyini göstərir.

giriş

FosB2 və ya FosB (qısa form) kimi təyin edilən transkripsiyanın faktoru ΔFosB, dərhal erkən genin C terminus-kəsikli bir splice variantidir fosb (Dobrazanski və digərləri, 1991; Nakabeppu və Nathans, 1991; Yen və digərləri, 1991). Tam uzunluqlu FosB kimi, ΔFosB DNA-məcburi bir əsas domen və onun bir çox genlərin ifadəsini tənzimləyən aktivator protein-1 (AP-1) transkripsiyası faktoru kompleksləri yaratmaq üçün Jun proteinləri ilə dimerizes olan bir lösin fermuarına malikdirMorgan və Curran, 1995; Rylski və Kaczmarek, 2004). FosB'nin C terminusunda tapılan transaktivasiya domeninin bir hissəsinə baxmayaraq, ΔFosB həm kültürlü hüceyrələrdə, həm də beyində güclü transkripsiya aktivator və repressor kimi fəaliyyət göstərirDobrazanski və digərləri, 1991; Nakabeppu və Nathans, 1991; Chen et al., 1997; McClung və Nestler, 2003; Kumar və al., 2005).

ΔFosB, stress, müəyyən lezyonlar, antipsikotik və antidepresan preparatlar, sui-istifadələr və təbii mükafatlar daxil olmaqla müxtəlif növ psixoaktiv stimullara məruz qaldıqdan sonra kronik, lakin kəskin olmayan bir beyində bölgəyə xüsusi bir şəkildə yüksək səviyyəyə səbəb olur (Hope və digərləri, 1994b; Hiroi və Graybiel, 1996; Moratalla və digərləri, 1996; Bing və digərləri, 1997; Mandelzys və digərləri, 1997; Kelz və digərləri, 1999; Werme və ark., 2002; Andersson və digərləri, 2003; Colby və digərləri, 2003; Peakman et al., 2003; Perrotti və digərləri, 2004; Zachariou et al., 2006). ΔFosB'nin induksiyası birbaşa bu xəbərdarlıqların beynin üzərində funksional təsiri ilə əlaqələndirilmişdir. Əlavə stimullaşdırma olmadıqda belə ΔFosB-nin əzmini kəskin stimullara cavab olaraq sürətlə endirilən bütün Fos ailənin transkripsiyası amillərindən fərqləndirir, bir neçə saat ərzində bazal səviyyələrə geri dönür və ümumiyyətlə xroniki stimullaşdırmadan sonra desensitizasiyanıHope və digərləri, 1992; Daunais və digərləri, 1993; Persico və digərləri, 1993; Hiroi və Graybiel, 1996; Perrotti və digərləri, 2004). Bu, ΔFosB-yi bəzi kronik stimulların gətirdiyi stabil nöronal uyğunlaşmaların əsasını təşkil edən gen ifadəsində uzun müddət davam edən dəyişikliklərə vasitəçilik etmək üçün cəlbedici bir namizəd təşkil edir.

ΔFosB'nin uzun müddətli olması mRNA-nın daha da induksiyası olmadığı təqdirdə (Chen et al., 1995), biz tam olaraq FosB və özbaşına qeyri-sabit olan digər Fos ailə zülallarından fərqli olaraq, ΔFosB qeyri-adi sabit transkripsiyaya malik ola bilərHope və digərləri, 1994b; Chen et al., 1997; Nestler və digərləri, 2001; McClung et al., 2004). Bundan əlavə, kəskin xroniki stimullaşdırılmış beyin toxumasının immunoblotinq təhlili göstərir ki, ΔFosB görünən şəkildə dəyişir Mr (molekulyar kütlə) xroniki xroniki müalicə zamanı kəskin vəziyyətdə ~ 33-35 kDa-dan xNUMX kDa-danHope et al., 1994a; Chen et al., 1995). Bu müxtəlif izoformları kodlaya biləcək əlavə mRNA varlığına dair heç bir sübut yoxdur, çünki ΔFosB'nin posttranslasyonla dəyişdirilmiş olduğunu və bəlkə də bunun qeyri-adi sabitliyinə qatqı olduğunu düşündük. Ancaq bu günə qədər ΔFosB dövriyyəsinin və ya posttranslatsional dəyişikliklərin biokimyəvi analizləri barədə məlumat verilməyib. Bu işin məqsədi ΔFosB'nin bir fosfoprotein olub olmadığını və fosforiliyanın onun sabitliyində rol oynadığını müəyyən etməkdir.

Əvvəlki BölməSonrakı Bölmə

Material və metodlar

Memeli hüceyrə xətləri və DNT quruluşları.

PC12 hüceyrələri (Clontech, Mountainview, CA) yüksək glyukoza malik olan l-glutamin (L-Gln) içərisində kültürlenmiş və 5% fetal sığır serumu (FBS), 10% at serumu (həm də Invitrogen, Carlsbad, CA) , 100 U / ml penisilin və 100 μg / ml streptomisin (hər ikisi Sigma-Aldrich, Sent-Luis, MO). HeLa hüceyrələri (American Type Culture Collection, Manassas, VA) L-Gln olan yüksək qlükoza DMEM-də kültürlənmiş və 10% FBS, penisilin və streptomisin ilə tamamlanmışdır. Hər iki hüceyrə xətti də 37 ° C dərəcədə nəmli 5% CO səviyyəsində saxlanılırdı2 atmosfer.

DNT ilə keçici ötürülmələr üçün PC12 və ya HeLa hüceyrələri növbəti gün 12-90% birləşməyə çatmaq üçün Lipofectamine 100 (Invitrogen) istifadə edərək altı hüceyrə plitələrinə (PC2000 hüceyrələri üçün kollajen I ilə örtülmüş) toxumlaşdırılmışdı. Bəzi təcrübələrdə (bax İncir. 1-7), ΔFosB rekombinant herpes simplex virusu (HSV) ilə infeksiya vasitəsilə keçidlə PC12 hüceyrələrində ifadə edilmişdir.

ΔFosB və FosB cDNAları öz pTetop konstruksiyalarından əldə edilmişdir (Chen et al., 1997) bir pcDNA3.1 vektor (Invitrogen) alt klonlanır. Bu pcDNA3.1-ΔFosB / FosB quruluşları memeli hüceyrələrində və site yönümlü mutagenez üçün şablon kimi ifadələr üçün istifadə edilmişdir. Rekombinant HSV-ΔFosB daha əvvəl təsvir edildiyi kimi hazırlanmışdır (Neve və digərləri, 1997) və hazırlıq bir xətt idi ~ 1 × 108 pfu / ml.

Pulse-təqib təcrübələri.

Infeksiya / transfeksiyondan təxminən 24 h, altı qövs plitələrində hüceyrələr (PC12 və ya HeLa) 2 ml PBS ilə iki dəfə üç dəfə yuyulur və 37 ° C'de 1 sində 2 ml Cys / Met-free DMEM (Invitrogen) 5 ilə dialis edilmiş FBS (Hyclone, Logan, UT) ilə Met və Cys-in hüceyrə hovuzlarını təmizləmək üçün əlavə olunmuşdur. Bu "aclıq" dövrünün sonunda narkotiklər (əgər hüceyrələr müalicə olunarsa) əlavə edildi və hüceyrələr 12-25 μCi ilə 35S Protein Etiketleme Miksı (PerkinElmer, Wellesley, MA) xNUMX-da bütün yeni sintez edilmiş zülalları etiketləmək üçün 1 ° C-də. Radiolabel daha sonra xNUMX ml PBS ilə iki ilə üç dəfə hüceyrələri yuyaraq çıxarılmışdır 35S-etiketli proteinlər 5% FBS ilə tamamlanan və müxtəlif vaxt nöqtələrində hüceyrələri yığan "soyuq" (qeyri-radioaktiv) mühit ilə əvəz olunaraq təqib edildi (təqib). Hüceyrə müalicələri kovalamaca boyunca davam etdi. Bu təcrübələrin bütün rəqəmləri onların dövriyyəsinin nisbətlərinin müqayisəsini optimallaşdırmaq üçün müxtəlif zülalların başlanğıc miqdarlarını göstərir.

Heyvanlar və kronik elektrokonvulsif nöbet müalicəsi.

Adult Sprague Dawley kişi sıçanları (200-300 g, Charles River Laboratories, Kingston, RI) gündə bir dəfə 7-9 d üçün elektrokonvulsif nöbetlerle (ECS) müalicə edildi. ECS daha əvvəl təsvir edilən kimi icra edilmişdir (Hope et al., 1994a) istifadə edərək Ugo Basile (Comerio VA, İtaliya) aşağıdakı parametrləri olan ECS vahidi: tezlik, 100 pulslar / s; 0.5 ms ilə pulse; şok müddəti, 1.0 s; və cari, 75 mA. Sham nəzarət heyvanları, elektrik cərəyanı olmadan qulaq-klipsli elektrodları tətbiq edərək paralel olaraq müalicə edildi.

32 P metabolik etiketləmə.

Beyin dilimlərinin etiketlənməsi üçün siçovulların dekapitasiyası, beyinlərin tez kəsilməsi və 300 μm frontal kortikal dilimlər bir DSK mikrosuli ilə hazırlanmışdır (Ted Pella, Redding, CA). Dilimlər 2 ml fosfat çatışmazlığı olan süni CSF (ACSF) içərisində plastik borular içərisində kuluçkalanmış və 30 ° C səviyyəsində saxlanılmış, O2/ CO2 qarışıq (Hemmings et al., 1989). Xəndək turşusu (1.3 ng / ml) olan və ya olmaması halında dilimlər (boru başına iki dilim) 8-10 h üçün 100 mCi ilə etiketlənmişdir. Bu inkübasyonun sonunda dilimlər ən azı üç dəfə soyuq ACSF ilə durulanmış və sonra 250 μl soyuq radioimmunoprecipitasiya təhlili (RIPA) tamponları (PBS, pH 7.4, 150 mm NaCl, 1% (v / v 0.5% -ə qədər SDS ilə istifadə edilməzdən əvvəl əlavə edilmiş 0.1% (w / v) sodyum deoksikolat, 1% (w / v) SDS, 0.6 mm EDTA], memeli hüceyrələri üçün proteaz inhibitor kokteyli (5 μl / ml; Sigma-Aldrich), fosfataz inhibitor kokteylləri I və II (1: 100, Sigma-Aldrich), 1 mm PMSF və 2% gliseroldə istifadə olunur. Homojenatlar daha sonra 15 dəqiqə qaynadılmış və 15,000 × -də santrifüqasiya ilə təmizlənmişdir g 15 dəq. Nəticədə supernatantlarda zülal konsentrasiyası BCA protein testi (Pierce, Holmdel, NJ) istifadə edərək qiymətləndirilmişdir.

Üçün 32Kəsilmək hüceyrələrinin P infeksiyası / transfeksiyasından sonra xNUMX h etiketlənməsi, hüceyrələr fosfatsız orta ilə iki dəfə üç dəfə yuyulurdu və bu ortamda ~ 24 h üçün inkübe edildi. Bu aclıqdan sonra 1-0.2 mCi 32PH3PO4 (PerkinElmer) hər bir quyuya əlavə edildi və hüceyrələr 4-12 h tipinə görə sınaqdan keçirildi (baxın 1-7 spesifikasiyalar üçün). Hüceyrələr PBS ilə üç dəfə yuyulurdu və 15 min 50 μl əlavə RIPA tamponu ilə buz üzərində qarışdırıldı. Lysates qazma üsulu ilə toplanmış və 10 dəfə bir 25 iynəsi vasitəsilə 10 dəqiqə üçün qaynadılmış DNA kəsməklə və 15,000-15-30-da 4 rpm-də santrifüjlənmişdir. Təmizlənmiş lizatlar (supernatantlar) yeni bir boruya ötürülmüş və BCA protein testi (Pierce) həyata keçirilmişdir. Bu təcrübələrin bütün rəqəmləri nisbi fosforilyasiya səviyyələrinin müqayisələrini optimallaşdırmaq üçün cəmi vahşi tipli (WT) və S27A ΔFosB proteinlərinin oxşar miqdarlarını göstərir.

Kimyəvi maddələr və hüceyrə mədəniyyəti müalicəsi.

Okadaik turşusu (OA, Sigma-Aldrich) etanolda məhv edilmişdir və son xnumx ng / ml konsentrasiyasında istifadə edilmişdir. 100-Dichloro-5,6-β-d-ribofuranosyl-benzimidazole (DRB, Biomol, Plymouth Meeting, PA) dimetil sülfoksid (DMSO; Sigma-Aldrich) ilə həll edilmişdir və hüceyrə mədəniyyətində son xNUMX μm konsentrasiyasında istifadə edilmişdir. Sümük (Sigma-Aldrich) suda həll edilərək son xNUMX μm konsentrasiyasında istifadə edilmişdir. Calphostin-C (Biomol) DMSO'da eritildi və 1 μm-də istifadə edildi, halbuki XOR-X-NMX-siristat 50-asetat (PMA; Promega, Madison, WI) DMSO-da həll edildi və 200 μm-də istifadə edildi. Myristoylated-autocamtide-0.2-ilə əlaqəli inhibitor peptid (m-AIP, Biomol) suda məhv edilib və son xnumx və 12 μm konsentrasiyasında istifadə edilmişdir. Geniş spektrli protein kinaz inhibitorları H-13 və H-0.1 (Biomol) suda həll edilmiş və son olaraq 2 və 1 μm konsentrasiyalarında istifadə edilmişdir. MG10 (Calbiochem, San Diego, CA) və epoxomicin (Peptides International, Louisville, KY) həm də DMSO-da həll edilmiş və son olaraq 7 və 8 μm konsentrasiyasında istifadə edilmişdir. Bütün tədqiqatlarda DMSO (vasitə) müalicələr arasında sabit miqdarda DMSO saxlamaq üçün lazım olan hüceyrələrə əlavə edildi. Üçün 32P etiketləmə təcrübələrində, dərhal etiketdən əvvəl dərman əlavə edildi və etiketləmə müddətinin qalan hissəsi üçün saxlandı. Pulse-kovalamaca sınaqları üçün Cys / Met zamanı "açlıq" zamanı etiketlər əlavə olundu, sonra etiketləmə dövründə saxlanıldı və sonra kəşfiyyat mühitinə əlavə edildi. Proteazome inhibitorları bu peptidlərin sürətli dövriyyəsini kompensasiya etmək üçün hər bir 3-4 h sürətinə çatdılar.

ΔFosB immünopresipitasiyası, immunoblotting və autoradioqrafiya.

İmmünoprecipitasyonlar üçün lizatlar 1: 5 ilə düz RIPA ilə seyreltildi, SDS konsentrasiyası immunoprecipitation (IP) ilə başlamazdan əvvəl 0.1% -ə çatdı. Nonspesifik bağlamanı məhdudlaşdırmaq üçün, lizatlar ilk növbədə qeyri-immün IgG və protein G-Sefaroz (Sigma-Aldrich) ilə ən az 4 h üçün immunoprecipitating tərəfindən təmizlənmişdir. ΔFosB daha sonra 48 μg lizat proteininə qarşı 0.5-1 μg IgG-da FosB və ΔFosB (SC-10G, Santa Cruz Biotexnology, Santa Cruz, CA) da mövcud olan bir epitopu tanıyan keçi poliklonal antikorunu istifadə edərək təmizlənmiş lizatlardan immunoprecipitasiya edilmişdir (50-300 μg ümumi protein) ümumi həcmdə 0.5 ml həcmindədir. IP-lər ən azı 4 h üçün bir rotorda 8 ° C-də qarışdırıldı və sonra 15 μl protein G-Sepharose əlavə edildi və IP-lər ən azı başqa bir 4 h üçün qarışdırıldı. IP'ler 3000 × 'da ipliklə pellet edilmişdir g 3-5 min xNUMX ° C-də 4 ml soyuq düz RIPA ilə iki dəfə və 0.5% Tween 0.1 olan soyuq PBS ilə iki dəfə yuyulur. IP'ler daha sonra 20 ml soyuq PBS'de yeniden süspansiyon haline getirildi, aktarıldı, yeni bir tüp içinde toplandı ve immunopresipitasyona uğramış proteinler 0.5-15 μl 25 × ilavesiyle Laemmli protein numune tamponunun azalmasıyla elüt edildi. Bu IP protokolu lizatdakı ΔFosB-nin faktiki olaraq bütününün xüsusi və effektiv çökməsi ilə nəticələndi. İmmünopresipitləşdirilmiş zülallar bütün 2% Tris-HCl Kriteri gel (Bio-Rad, Hercules, CA) üzərində yüklənərək SDS-PAGE-ə tabedir və sonra PVDF ya da nitroselüloza köçürülür. Transferdən sonra membran hava qurudu və 32P- və 35S-radiolabeled protein bantları autoradiografi ilə Kodak (Rochester, NY) autoradiografik filmi istifadə edərək və bir Storm (Amersham Biosciences, Piscataway, NJ) PhosphorImager istifadə edərək fosforimaging tərəfindən müşahidə edilmişdir. Hüceyrə lizatlarında və ya beyin homojenatlarında total (fosforlanmamış və fosforli) ΔFosB immunoprebsitləşdirilmiş proteinin immunoblotinqi ilə müəyyən edilmişdir (eyni zamanda, 32P-etiketli protein) və ya SDS-PAGE-ə tabe olan və PVDF ya da nitroselülozun üzərinə köçürülmüş bərabər miqdarda lizat / homogenate proteininin. 1% (h / h) Tween 0.1 (Sigma) ilə təchiz edilmiş 20% (w / v) qeyri-quru quru süd (Bio-Rad) ilə 1 ° C'de 25 ° C səviyyəsində kuluçkalamaq yolu ilə ilk dəfə bloklandı. Membrana 4 ° C'de bir gecədə immunoblotlanmış idi. FosB / ΔFosB (1: 16 istifadə) amin turşuları 1-10,000 qarşı öz quş anti-FosB poliklonal antikoru ilə yaradılmışdır. Birincil inkübasyondan sonra membranlar blokaj tamponu ilə 5 min dəfə dörd dəfə yuyulurdu və sonra 25 ° C-də xNUMX-da horseradish peroksidazla əlaqəli bir keçi anti-qucaqğası IgG ilə inkubasiya edildi (1-də istifadə edilən 1-də bloklama tamponunda, Vector Laboratories, Burlingame, CA). Membranlar 5000 min üçün üç dəfə yandırılaraq blokaj tamponu və PBS ilə 10 min üçün bir dəfə. Total ΔFosB protein zonaları Kodak MR filmində gücləndirilmiş chemiluminescence (Pierce) və / və ya ECL-Plus reaktivləri (Amersham Biosciences) və Storm PhosphorImager istifadə edərək floresan aşkar edərək görselleştirildi.

Həşərat hüceyrələrindən rekombinant ΔFosB'nin aşkara çıxarılması və təmizlənməsi.

ΔFosB Bac-Bac Baculovirus ifadə sistemini (Invitrogen) istifadə edərək və istehsalçının göstərişlərindən istifadə edərək, N-terminus hexa-His-etiketli protein (N-His (9) ΔFosB) kimi Sf6 həşərat hüceyrələrində olduqca təzyiq göstərdi. Qısaca, yaxın ΔFosB cDNA (qalıqları 2-237) yaxınlıqdakı N-terminal etiket MGHHHHHHAG rekombinant baculovirus yaratmaq üçün istifadə edilən pFASTBacTM1 vektorunda alt klonlandı. Sf9 hüceyrələri rekombinant virus ilə yoluxdu və N-His (6) ΔFosB bir mono-Q sütununu (Amersham) istifadə edərək bir nikel sütunu (Qiagen, Valencia, CA), anyon mübadiləsi istifadə edərək, bir neçə kromatoqrafik addımlar vasitəsilə hüceyrə lizatlarından təmizləndi Biosciences), və bir filtrasiya sütunu (Amersham Biosciences) istifadə edərək ölçülmə xaricidir.

In vitro fosforilyasiya tədqiqatları.

In vitro 30 μm substrat (N-His (10) ΔFosB ya da müsbət nəzarət substratı), 6 μm ATP və 250 μCi / μl [γ-32P] ATP, kinaz istehsalçısı tərəfindən təmin edilən tampon və aşağıdakı kinazlardan biri: CK2 (20 ng / mL; Upstate, Charlottesville, VA), CaMKII (10 ng / mL; Upstate), PKC (1.6 ng / μl; Calbiochem) və ya p70S6K (2.5 mU / μl; Upstate). Time kurs reaksiyaları təyin olunan zaman nöqtələrində reaksiya solüsyonundan 5 μl aliquots aradan qaldırılması və 4 × bərabər Laemmli protein nümunə tampon həcmi əlavə tərəfindən reaksiya edildi. CK2 reaksiya üçün Michaelis-Menten kinetik parametrləri empirik şəkildə müəyyən edilmiş linear sabit vəziyyət şərtləri ilə müəyyən edilmişdir. Bu reaksiyalar 15 ng / ml enzim, 10 μm ATP, 2 μCi / μl [γ-32P] ATP və N-His (6) ΔFosB konsentrasiyaları arasında dəyişən 2.5-30 μm. Bütün reaksiyalar su banyosunda 30 ° C-də ifa edilmişdir. SDS-PAGE və Bio-Safe Coomassie (Bio-Rad) ilə gelin boyanmasından sonra, gel qurudulmuş və 32P-fosfatın birləşməsi fosforimaj analizləri ilə qiymətləndirilmişdir (aşağıda baxın, məlumatın ölçülməsi, hesablamalar və statistika).

İki ölçülü fosfopeptid xəritəsi və fosfoamino turşu analizi.

Bu analizlərin hər ikisi tərəfindən təsvir olunduğu kimi həyata keçirildi Ploegh və Dunn (2000). Qısaca quru gel parçaları 32P-etiketli ΔFosB (ya da vitro reaksiyalar və ya metabolik olaraq etiketli hüceyrələrin immunoprecipitatlarından) eksize edildi, reydrated, yuyuldu və triptik həzmə məruz qaldı. Triptik həzm məhsulları olan süpernatant liyofilləşdi və liofilat bir neçə dəfə yuyuldu və 10 μl elektroforez tamponu, pH 1.9-də yenidən susuldu. Nümunə (3 μl) bir selüloz yüngül təbəqə kromatoqrafiyası (TLC) plitəsi (Analtech, Newark, DE) üzərində aşkar edilmiş və bir ölçüdə elektroforez və digər ölçüdə artan TLC ilə ayrılmışdır. Nəticədə ortaya çıxan fosfopeptid xəritələri autoradioqrafiya və fosforimələşmə ilə görüntülendi. Fosfoamino turşu analizi üçün, elektroforez tamponunda yenidən süspansiyona alınmış olan XTNUMX μl triptik digestləri 2 ° C'de 105 dəqiqə HCl hidrolizi ilə 25 m HCl-də N2 atmosfer. Reaksiya suda altı qat süzülmə ilə dayandırılmış və qarışıq liyofilize edilmişdir. Liyofilat 5 μl elektroforez tamponunda, pH 1.9-də yenidən salıb və fosfor-Ser, -Thr və -Tyr standartları ilə birlikdə selüloz TLC plastmasında lekelenmişdir. Elektroforez, elektroforez tamponu, pH 1.9 istifadə edərək TLC plakasının uzunluğunun yarısından çoxunda həyata keçirildi və sonra plaka pH 3.5 tamponuna köçürüldü və elektroforez tamamlandıqda yerinə yetirildi. Fosfoamino turşu standartları TLC plakasını asetonda bir 1% (h / h) ninhidrin həllini sprey edərək, görüldü. 32P-etiketli amin turşu nümunələri həm autoradioqrafiya, həm də fosforimələşmə ilə görüntülendi.

siRNA-in səbəbli CK2α sökülməsi.

CK2 səviyyələrini seçici şəkildə pozmaq üçün RNT müdaxilə üsulunu istifadə etdik (Di Maira və digərləri, 2005). PC12 hüceyrələri kollagen I-örtülmüş altı pilləli plitələr üzərinə sanki ertəsi gün, zaman keçidlə 70 nm (yekun konsentrasiyası) və ya katalizatorun mRNA'sına yönəldilmiş siRNA ya da nontargeting siRNA ilə transfekte edildikdə, 80-20% Rat CK2 α subunit, 5 μl transfektasiya agenti SilentFectin (Bio-Rad) istifadə edərək və istehsalçının göstərişlərini yerinə yetirir. Təxminən 24 h sonra, hüceyrələr yuxarıda göstərildiyi kimi ΔFosB plazmidlə transiently transfekte edilmişdir. Təxminən 24 h sonra (siRNA transfeksiyonundan sonra, xNUMX h) hüceyrələr ya ya 32P metabolik etiketleme və ya yuxarıda təsvir edilən pulse-kəşf analizi. aşağıdakı dörd CK2α siRNAs oxşar nəticələri ilə istifadə edilmişdir: 5'P-CAAACUAUAAUCGUACAUCUU3, 5'P-UCAAUCAU-GACAUUAUGCGUU3, 5'P-UAGUCAUAUAAAUCUUCCGUU3, 5'P-AAAUCCCUG ACAUCAUAUUUU3 (Dharmacon, Lafayette, CO). Mənfi bir nəzarət olaraq istifadə etdik səsboğan Ambion'dan (Austin, TX) gələn #3 siRNA mənfi nəzarət. CK2 pozuntularının miqdarı bir 2: 06 dilüsyonunda gecə bir anti-CK873 poliklonal antikor (Upstate tərəfindən 1-1000 kataloq) istifadə immunoblotting tərəfindən monitorinq edilmişdir. β-Tubulin bir yükləmə nəzarəti olaraq istifadə edilmiş və bir 05: 661 dilüsyonunda bir gecədə gecə bir monoklonal antikor (Kataloq Upstate-dən 1-20,000) ilə aşkar edilmişdir.

Site-yönümlü mutagenez.

SerxNUMX-in Ala və ya Asp-ə Mutasiya edilməsi Quick Change Site-Directed Mutagenesis kiti (Stratagene, La Jolla, CA) istifadə edərək və istehsalçının göstərişlərinə əsasən həyata keçirildi. Siçan ΔFosB proteindəki Ser27 mutasiyalarını təqdim etmək üçün aşağıdakı mutagenez primerləri istifadə edilmişdir. SerxNUMX to Ala: (əks primer) 27'GCCGAAGGAGTCCACCGAAGCCAGGTACTGAGACTCGGCGGAGGG3 '. SerxNUMX - Asp (irəli primer) 27'CCCTCCGCCGAGTCTCAGTACCTGGATTCGGTGGACTCCTTCGGC3 '. Mutated bazalar qalın və Ser27 kodonu italikdir.

Bioinformatika.

ΔFosB üçün potensial fosforilasiya sahələri və kinazları ProSite (ProSite)http://www.expasy.org/prosite/), PredictProtein (Rost və ark., 2004) və NetPhosK (Blom et al., 2004).

Məlumatın ölçülməsi, hesablanması və statistikası.

PVDF və ya nitroselüloz membranında mövcud olan protein miqdarı Storm PhosphorImager və onunla birlikdə olan ImageQuant proqramı (Amersham Biosciences / Molecular Dynamics) istifadə olundu. Hüceyrə mədəniyyətində və beyin dilimində fosforilyasiya işlərində, əldə edilən dəyərlər 32P-etiketli protein daha sonra cəmi ΔFosB üçün əldə edilmiş və nisbət kimi ifadə olunan dəyərlərə bölünmüşdür. İçində vitro fosforlama tədqiqatları; 32P-etiketli ΔFosB molekulunun başına (stokiometriya) əvvəllər təsvir edilən kimi hesablanmışdırŞahin et al., 2004). Bütün ölçülər istifadə olunan alətin linearlığı üçündür. Kinetik parametrlər Michaelis-Menten modelindən istifadə edərək hesablanmışdır V = VMax[S] / ([S]+KM) Və VMax = k2[EÜmumi]. Yarım ömür (t1 / 2) ΔFosB və FosB, pulse-kovuşma sahələrindən (məlumatların ən yaxşı şəkildə uyğunlaşdırılmış olmayan qeyri-xətti reqressiya istifadə edərək) qiymətləndirilmiş və qalan protein miqdarı orijinalın 50% olduğu vaxta bərabərdir. Bütün rəqəmlərdə nümayiş olunan nəticələr ən azı iki-üç müstəqil təcrübənin nümayəndəsidir. Bütün qrafiklərdə göstərilən məlumatlar ortalama ± SEM'dir (3 ≤ n ≤16). Farklılıkların statistik əhəmiyyəti, bir ödənişsiz istifadə edilməklə qiymətləndirilmişdir t test, çox müqayisə üçün düzəldilmişdir və yıldızlar göstərir p ≤ 0.05.

Əvvəlki BölməSonrakı Bölmə

Nəticələr

ΔFosB qeyri-adi sabit keçid faktorudur

Əvvəllər biz ΔFosB nisbətən sabit bir transkripsiya faktoru olduğunuNestler və digərləri, 2001), proteinlərin dövriyyəsi profilinin birbaşa təhlili bu günə qədər aparılmamışdır. Bu suala cavab vermək üçün, ΔFosB bir rekombinant herpes simplex virusu (HSV-ΔFosB) ilə infeksiyaya yoluxa bilən bir nöron kimi hüceyrə xətti kimi geniş şəkildə istifadə edilmiş olan PC12 hüceyrələrini istifadə edərək pulse-kəşf təcrübələrini həyata keçirmişik. Yeni sintez edilmiş zülallar metabolik olaraq etiketli idi 35S-Met / Cys, və deqradasiya modeli 35S-etiketli ΔFosB (35S-ΔFosB) radiolabeled amin turşularının çıxarılmasından sonra müxtəlif vaxt nöqtələrində əldə edilən hüceyrə lizatlarından immunopresipitasiya edilərək izlənildi. SDS-PAGE və autoradioqrafiya ilə immunoprecipitatların təhlili göstərir ki, PC12 hüceyrələrində ΔFosB yarım ömrü ~ 10 h (Əncir 1). Bu nəticələr göstərir ki, ΔFosB-in yarım ömrünü hüceyrə mədəniyyətində yarım ömrünün ~ 90 dəqiqə olduğu bildirilən FosB-nin tam uzunluğu daxil olmaqla ən çox cəlb edilən transkripsiyaya aid amillərdən daha çox (bax. Bax)Dobrazanski və digərləri, 1991; Carle və digərləri 2004). Bununla yanaşı, ΔFosB-nin degradasiyasının birinci dərəcə eksponensial tənəzzül meylinə uyğun olmadığını, daha yavaş bir azalma dərəcəsi ilə başlayan bifazik olduğunu qeyd etmək lazımdır. Bu birdən çox ΔFosB növünün və / və ya birdən artıq pozulma yolunun varlığını göstərir.

Şəkil 1.

Daha böyük versiyanı bax:

Şəkil 1.

ΔFosB qeyri-adi sabit keçid faktorudur. ΔFosB'nin yarı ömrü hüceyrə mədəniyyətində ~ 10 h dir. ΔFosB, HSV-ΔFosB ilə infeksiya ya da ΔFosB-containing plazmid ilə müvəqqəti transfeksiya ilə PC12 hüceyrələrində ifadə edildi və hüceyrələr Materiallar və metodlarda təsvir edilən pulse-kəşf təcrübələrinə məruz qaldı. ΔFosB'yi aşındırmaq üçün istifadə edilən metoddan asılı olmayaraq, bərabər nəticələr əldə edilmişdir. Bu rəqəm ΔFosB deqradasiyasının vaxt kursunu (və nümayəndənin autoradiogramını) göstərir. Ən azı beş müstəqil təcrübədən əldə edilən ən azı 15 fərdi məlumat nöqtələrinin ortalama ± SEM olduğu məlumatlar verilmişdir. Müqayisə üçün, FosB-nin tam uzunluğu bildirilən yarım ömrü göstərilir.

ΔFosB beyində fosfoproteindir

Biz ΔFosB posttranslational modifikasiyasının onun aydın sabitliyinə kömək edə biləcəyini fərz etdik. Fosforiliyin transkripsiyanın fəallığını bir çox istiqamətdə, onların sabitliyi də daxil olmaqla modullaşdırdığına görə (nəzərdən keçirmək üçün bax Desterro və digərləri, 2000; Whitmarsh və Davis, 2000), biz ΔFosB bir fosfoprotein olub olmadığını araşdırdıq. Bu məqsədlə, ΔFosB ifadəsi kronik ECS istifadə edərək siçovul beyinində endirildi, xüsusilə frontal korteksdə (ΔFosB yüksək səviyyələrə səbəb olan bir müalicəHope et al., 1994a). Son ECS müalicəsindən bir gün sonra, ΔFosB səviyyələri yüksək olduqda, nazik frontal kortikal dilimlər hazırlanmış və metabolik olaraq 32P-ortofosfat. Paralel dilim dəsti radiolabeled deyil və bunlar ümumi ΔFosB səviyyələrini aşkar etmək üçün istifadə edilmişdir. Müəyyən bir anti-FosB / ΔFosB antikoru və immunoprecipitated proteinlərin SDS-PAGE ilə ayrılması immunoprecipitation sonra, fosforli 32P-etiketli ΔFosB, autoradioqrafiya tərəfindən təsbit edildi, total ΔFosB immunoblotinq tərəfindən aşkar edildi. Bu analiz ΔFosB'nin spesifik olaraq sübuta yetirildiyi kimi beyində fosforilatlandığını ortaya qoydu 32Kronik müalicə olunan beyin nümunələrində P-etiketli bandı olan 35 kDa, lakin xamla müalicə olunan nəzarətlərdə faktiki olaraq təsbit edilə bilməzdir (Əncir 2A). Bu, xroniki stimullaşdırma olmadığı təqdirdə, ΔFosB bazal səviyyələri çox aşağıdır. İmmunoprecipitasyon reaksiyasının spesifikliyi qeyriimmun IgG çöküntüsündeki siqnalın olmaması ilə təsvir edilir.

Şəkil 2.

Daha böyük versiyanı bax:

Şəkil 2.

ΔFosB beyində fosfoproteindir. A, ΔFosB beyində fosforilat edilir. Endogenik ΔFosB, materiallarda və metodlarda təsvir edilən kronik ECS müalicəsi ilə siçovul beyində endikasiyaya səbəb oldu. Frontal kortikal dilimlər metabolik olaraq etiketli idi 32PH3PO4 bir neçə saatdır. Dilimlərin homogenləşdirilməsindən sonra, ΔFosB immünopresipitasiya olunmuş və fosforli ΔFosB (32P-ΔFosB) otoradyografi (üst panel) tərəfindən aşkar edilmişdir. Radyoaktiv olmayan immunoprecipitatlarda Total ΔFosB immunoblotting (alt panel) tərəfindən aşkar edilmişdir. Negativ nəzarət kimi, xamla müalicə olunan heyvan və immunmigung IgG immunoprecipitatasiyası göstərilir. B, Bioinformatik analiz ilə siçan ΔFosB protein sekansı üçün müvafiq proqnozlaşdırma skorları olan namizəd fosforilasiya sahələri və kinazlar əldə edilmişdir. Yüksək proqnozlaşdırma balları olan namizəd saytları protein sekansında vurğulanır və cədvəldə verilir. DNT-bağlayıcı (əsas) domen və lösin fermuarları protein seksiyasında qalındır. C, D, ΔFosB fosforilasyon Ser / Thr fosfataz inhibitoru OA ilə artır. C, 32Avtomatoqrafiya yolu ilə olmadığı (Ctr) etiketli frontal kortikal dilimlərdən və ya 100 ng / ml OA (graph və üst panel) varlığından immunoprecipitatlarda P-ΔFosB səviyyələri aşkar edilmişdir. Alt panel immunoblotting tərəfindən immunoprecipitates ildə unlabeled dilim aşkar aşkar ΔFosB ümumi göstərir. D, PC12 hüceyrələri HSV-ΔFosB ya da HSV-LacZ (vektor) ilə yoluxmuş və metabolik olaraq 32PH3PO4 yoxsa (Ctr) və ya 100 ng / ml OA varlığı. 32İmmunoprecipitatlarda P-ΔFosB səviyyələri autoradioqrafiya (qrafik, üst panel) tərəfindən aşkar edilmişdir. Alt panel, hüceyrə lizatlarında immunoblotinq tərəfindən aşkar edilmiş ΔFosB-nin ümumi göstəricisidir.

ΔFosB fosforilasyonuna hansı kinaz (s) və site (lər) in aşkar olunduğuna dair ilk addım olaraq, onun amin turşu dizisini bir neçə bioinformatik analizə tabe etdik. Bu, ΔFosB heç bir Tyr fosforilyasiya namizəd saytına malik olmasa da, üç CaMKII sahəsini, üç CK2 sahəsini və çox yüksək fosforilyasiya proqnozlaşdırma skorlarına malik iki PKC saytını ehtiva edən bir neçə Ser / Thr kinaz konsensus saytınıƏncir 2B). Bioinformatika vasitəsi ilə proqnozlaşdırıldığı kimi, ΔFosB yalnız Ser və ya Thr qalıqları üzərində fosforilat edilirsə, onun fosforiliyi Ser / Thr fosfatazların fəaliyyəti ilə əhəmiyyətli dərəcədə modüle edilməlidir. Bu hipotezi test etmək üçün, frontal kortikal dilimlə etiketledik 32P-ortofosfat, bir Ser / Thr protein fosfataz inhibitoru olan və ya olmaması halında. Göstərildiyi kimi Şəkil 2C, OA böyük bir (~ 2.5 qat) artım meydana gətirdi 32P-ΔFosB. Bundan əlavə, əvvəlki hesabatlarla əlaqəli olan ΔFosB səviyyələrində kiçik bir artım meydana gəldi, OA-nın kanserogen effektlərini Fos proteinləri (Miller et al., 1998; Choe və digərləri, 2004). Xalis nəticə fosforlu ΔFosB səviyyəsində əhəmiyyətli bir artım (~ 60%) təşkil edir.

Daha sonra empirik manipulyasiya üçün daha uyğun olan PC12 hüceyrələrində ΔFosB beynində görülən fosforilasiya nümunəsini göstərdi. Biz HSV-ΔFosB ilə infeksiya vasitəsilə PC12 hüceyrələrində ΔFosB ifadə etdik və metabolik olaraq hüceyrələri 32P-ortofosfat OA varlığında və ya olmaması. HSV-ΔFosB-yoluxmuş hüceyrələrdən proteinin müvəffəqiyyətli ifadəsi və immunoprecipitasiyası həm immunoblotdaƏncir 2D, alt panel) və vektorda yoluxmuş hüceyrələrdə olmayan bir xNUMX kDa bandının autoradioqrafiyası (üst panel). Beyində müşahidə olunduğu kimi, OA cəmi ΔFosB səviyyəsində kiçik bir artım meydana gətirdi, lakin daha çox (təxminən iki dəfə) artım 32P-ΔFosB, ΔFosB fosforilasyonunda əhəmiyyətli (~ 50%) xalis artımla nəticələnir. Bundan əlavə, bioinformatik proqnozlara uyğun olaraq PC12 hüceyrələrinin bir Tyr fosfataz inhibitoru ilə müalicəsi, 32P-ΔFosB səviyyələri (məlumat göstərilmir). Birlikdə bu nəticələr ΔFosB'nin beyin və PC12 hüceyrələrində Ser və / və ya Thr qalıqları üzərində fosforilat olduğunu və sonuncunun ΔFosB'nin fosforilasyon və degradasiya profillərini öyrənmək üçün yaxşı bir hüceyrə mədəniyyəti sistemi olduğunu təsdiq etdi.

CK2, lakin PKC və ya CaMKII fosforilatları olmayan ΔFosB vitro

Yuxarıda təsvir olunduğu kimi, ΔFosB amino asit sekansının təhlili CK2, PKC və CaMKII fosforilyasiya sahələri üçün yüksək proqnozlaşdırma skorlarını tapdı. Bu kinazlardan hansıları ΔFosB-yə fosforilyasiya edə biləcəyini müəyyən etmək üçün bir sıra aparat aparmışdır vitro təmizlənmiş kinazlar və təmizlənmiş rekombinant ΔFosB istifadə edərək fosforilasyon reaksiyaları. Göstərildiyi kimi Şəkil 3A, üç namizəd kinazdan, yalnız CK2 fosforlu ΔFosB ilə əhəmiyyətli bir şəkildə. Bundan əlavə, bir neçə digər kinaz sınaqdan keçirilmişdir (məsələn, GSK3 və p70S6K), lakin ΔFosB (data göstərilməyib) əhəmiyyətli dərəcədə fosforilat edilməmişdir. CK2 reaksiyasının vaxt kursu təhlili ilə əlavə xarakterizə edilməsi bu kinazın ΔFosB molekulunun molekusuna ~ 0.5 mol fosfatınƏncir 3B). CK2'in ΔFosB fosforilat edə bilməsi vitro xeyli stokiometriyaya (~ 50%) fizioloji cəhətdən müvafiq reaksiyanı əks etdirir. Daha sonra bu reaksiyanın kinetikasını CK2'yi artan miqdarda təmizlənmiş ΔFosB varlığında inkübləşdirməklə tədqiq etdik və biz CK2 fosforilatlarının ΔFosB Vmax 5.8 pmol min-1 · Μg-1 fermenti, a KM 18.4 μm və a kpişik 0.2 / s (Əncir 3C). Bu kinetik parametrlər üçün əldə edilən dəyərlər bu reaksiyanın fizioloji əhəmiyyətini daha da artırır. Məsələn, KM DARPP2 üçün CK32, ən yaxşı substratlarından biri, 3.4 μm və kpişik ~ 0.3 / s (Girault və digərləri, 1989); Xəbərlər KM ATX-lər üçün ~ 10-40 μm (Cochet et al., 1983; Silva-Neto və digərləri, 2002) və kazein üçün ~ 10-50 μm (Meggio və ark., 1977; Pyerin və digərləri, 1987). Birlikdə bu məlumatlar ΔFosB'nin CK2 üçün səliqəli substrat olduğunu göstərir vitro.

Şəkil 3.

Daha böyük versiyanı bax:

Şəkil 3.

CK2, lakin PKC və ya CaMKII fosforilatları olmayan ΔFosB vitro. Autoradiograph (üst panel) fosforlaşmış məhsulu göstərir və Coomassie boyalı gel (alt panel) reaksiyada mövcud olan ΔFosB toplamını göstərir. A, Purified recombinant ΔFosB məruz qaldı vitro müxtəlif namizəd kinazları tərəfindən fosforilaşma (bunlardan üçü göstərilmişdir). B, Time kursu və stokiometrik analizlər göstərir ki, CK2 fosforlana bilər ΔFosB vitro ~ 50% bir stoichiometry ilə. C, CK2 reaksiyasının kinetik analizi ΔFosB-nin nadir haldır vitro substrat. Reaksiya xətti lineerləşmə ikiqat qarşılıqlı təsvirdə (altda) göstərilmiş, lakin kinetik parametrlər Michaelis-Menten əyri (yuxarı) tərəfindən tərtib olunmuşdur.

CK2 pozğun hüceyrələrdə ΔFosB'nin fosforiliyi və sabitliyini modullaşdırır

ΔFosB'nin CK2-mediated fosforilasyonunun fizioloji əhəmiyyətini qiymətləndirmək üçün biz istifadə edərək müqayisəli fosfopeptid xəritəsini vitro fosforli və PC12-hüceyrəli fosforli ΔFosB. SDS-PAGE və jel elüsyonundan sonra 32P-ΔFosB ( vitro reaksiyalar və ya immunopresipitatadan 32P-etiketli hüceyrələr), proteinin tripsinlə həzm edildiyi və yaranan fosfopeptidlərin ikiölçülü ayrılmasına məruz qaldı. Bu analiz CK2 reaksiyasından olan əsas fosfopeptidin PC12 hüceyrələrində fosforilatlaşdırılmış ΔFosB-dən iki əsas fosfopeptiddən birinə bölünmüş olduğunuƏncir 4A), PKC və ya CaMKII (data göstərilməmiş) reaksiyasından meydana gələn fosfopeptidlər olmadı. Xəritədə PC12 hüceyrələrindəki ikinci bir ΔFosB fosfopeptidi var idi, lakin biz oxşar fosfopeptidin yaranması üçün sınaqdan keçmiş kinazlardan hər hansı birinin qeyri- vitrobu ikinci fosfopeptidin digər fosfopeptiddən fərqli bir fosforiliya sahəsi və ya eyni fosforiliya sahəsini ehtiva edən fərqli bir triptik peptidi təmsil edirmi olmadığını hələlik bilmirik.

Şəkil 4.

Daha böyük versiyanı bax:

Şəkil 4.

CK2 pozğun hüceyrələrdə ΔFosB'nin fosforiliyi və sabitliyini modullaşdırır. A, CK2 lakin PKC deyil hüceyrələrdə fosfor fosforilat görünür. ΔFosB'nin iki ölçülü fosfopeptid xəritələri CK2 və ya PKC tərəfindən fosforlaşdırılır vitro və ya sağlam PC12 hüceyrələri ilə. Oklar, CX2-fosforilatlı peptidin fərziyyəsini göstərir, lakin PC12 hüceyrələrindən əldə edilən ΔFosB fosforopeptidlərindən biri ilə PKC-fosforilatlı deyildir. B, PC12 hüceyrələrində ΔFosB fosforilasyonu potensial CK2 aktivator sperma (SP) ilə hüceyrələrin müalicəsi ilə artır və CK2 inhibitor DRB ilə müalicə ilə azalır. Əksinə, PC12 hüceyrələrində ΔFosB fosforilasiyası PKC aktivatoru (PMA) və ya PKC-nin xüsusi inhibitoru olan calfostin-C (Calph) ilə müalicə olunmadı. Təqdimat autoradiogram (üst panel) və immunoblot (alt panel) göstərilir. C-F, CK2 aktivliyinin ΔFosB sabitliyinə təsiri. Rəqəmlər ΔFosB deqradasiyasının vaxt kursunu (və nümayəndənin autoradiogramını) göstərir. ΔFosB keçici şəkildə ifadə edən PC12 hüceyrələri CK2 inhibitoru olmayan DRB (yoxsulluq) və ya mövcudluğu ilə aparılan pulse-kəşf təcrübələrinə məruz qaldıC), CK2 aktivator sperma (D) və ya geniş spektrli kinaz inhibitoru H-8 (E), DRB'nin qeyri-müəyyən təsirləri üçün nəzarət etmək üçün istifadə edilmişdir. F, CK2-in katalitik alt birliyini ΔFosB sabitliyinə salmaq təsiri. PC12 hüceyrələri daha sonra bir ΔFosB plazmidi ilə transfekte edilmiş sıçan CK2α və 24 h'yi hədəf alan nontargeting siRNA (Ctr) ya da siRNA ilə transfekte edilmişdir. Üst panel, CK2 siRNA'nın CK2 və ΔFosB protein səviyyələrinə təsiri göstərən bütün hüceyrəli lizatların immunoblotlarını əks etdirir. Β-tubulin üçün müvafiq immunoblot bir yükləmə nəzarəti kimi göstərilir.

CK2-in ΔFosB kinaz kimi fizioloji əhəmiyyətini daha da araşdıran biz CX12 aktivliyini modul edən iki dərman ilə ΔFosB-ifadə edən PC2 hüceyrələrini müalicə etdik. Göstərildiyi kimi Şəkil 4B, ΔFosB fosforilasyonu PC12 hüceyrələrinin hüceyrə-permeable CK2 inhibitor DRB (Meggio və ark., 1990; Szyszka et al., 1995) və güclü bir CK2 aktivatoru olduğu bilinən poliamin sperma ilə müalicə ilə artmışdır (Cochet və Chambaz, 1983; Meggio və ark., 1983). Əksinə PC12 hüceyrələrinin PKC inhibitoru olan calphostin-C (Kobayashi və digərləri, 1989; Tamaoki və digərləri, 1990) və ya PKC aktivatoru PMA (Schmidt və Hecker, 1975; Beh et al., 1989) ΔFosB fosforilasiyasında əhəmiyyətli dəyişikliklərə səbəb olmayıb. PMA iddiasında, yüngül (və əhəmiyyətli olmayan) artım 32P-ΔFosB bu dərman səbəb olduğu ΔFosB səviyyəsinin artması ilə hesablana bilər; əslində, phorbol esterlərinin bir neçə Fos ailə zülalının, FosB (Yoza et al., 1992; Suh et al., 2004). Bundan əlavə, hüceyrələrin xüsusi hüceyrə-permeable CaMKII inhibitoru m-AIP (Ishida və Fujisawa, 1995; Stevens və ark., 1999) da azalmışdır ΔFosB fosforilasyon (data göstərilməyib). Birlikdə bu nəticələr bizimlə tutarlıdır vitro bulgulara və göstərir ki, zədələnməmiş hüceyrələrdə ΔFosB ehtimalsa CK2 ilə fosforlaşdırılır, lakin PKC və ya CaMKII deyildir. CK2 inhibisyonunun tamamilə qarşısını almadığı faktı ΔFosB fosforilasyonu proteində əlavə fosforiliya sahələrinin varlığını göstərir.

Daha sonra CK2, ΔFosB dövriyyəsində rol oynadığını və bununla da sabitliyində olub-olmadığını araşdırdıq. Bu məqsədlə, CK12 inhibitoru və ya fosforilyasiya tədqiqatında istifadə edilən CK2 aktivatoru ilə müalicə olunan ΔFosB-ifadə edən PC2 hüceyrələri istifadə edərək pulse-kovalamaq təcrübələrini həyata keçirdik. Göstərildiyi kimi Şəkil 4CCK2 inhibitoru DRB ilə hüceyrələrin müalicəsi ΔFosB dövriyyəsinin dərəcəsinə əhəmiyyətli təsir göstərmişdir, bu, onun degradasiya əyri şəklində dəyişikliyindən bifazikdən bir eksponensial çürükə yaxın olan bir əyriğa qədərdir. Əksinə, CK2 aktivator sperminin mövcudluğu ΔFosB-nin azalma dərəcəsinin əhəmiyyətli dərəcədə azaldılmasına gətirib çıxardı ki, bu da kəşfiyyatın ilk saatlarında proteininƏncir 4D).

Bir çox kinaz aktivatörü və inhibitoru olduğu kimi, spermin və DRB CK2 aktivliyinin modulasiyası xaricində metabolik təsirə malik ola bilər. Əslində, DRB transkripsiyası faktoru IIH (TFIIH) -sabit kinaz (Yankulov et al., 1995), RNA polimeraz II-mediatlı transkripsiyanın inhibisyonuna səbəb olur. Bu təsirin ΔFosB-nin sabitliyinə təsir edə biləcəyi üçün geniş spektrli kinaz inhibitoru H-8 (Hidaka və Kobayashi, 1992) TFIIH bağlı kinazın inhibe etdiyi bilinən konsentrasiyadan (200 μm) olan ΔFosB dövriyyəsi haqqında, lakin CK2 (Yankulov et al., 1995). Göstərildiyi kimi Şəkil 4E, H-8 ilə müalicə ΔFosB-nin dövriyyəsinə təsir etməmişdir. Benzer nəticələr TFIIH ilə əlaqəli kinaza inhibe edən konsentrasiyada istifadə edilən, lakin CK7 (məlumat göstərilməyib) olan H-2, digər geniş spektrli kinaz inhibitoru ilə əldə edilmişdir. Bu məlumatlar, DRF'nin səbəb olduğu ΔFosB stabilliyində azalmanın CK2-in inhibisyonuna əsasən ehtimal olunan təfsirini dəstəklədi.

ΔFosB dövriyyəsində CK2 rolunu daha da möhkəmləndirmək üçün biz siRNA vasitəsilə CK2-ni yıxmaq nəticələrini araşdırdıq. Daha sonra ΔFosB ilə transfekte olan sıçan CK12 (CK2α) və 2 h katalitik subunitinin mRNA-nı hədəfləyən (nontargeting) siRNA və ya siRNA ilə ilk dəfə transfekte edilmiş PC24 hüceyrələri istifadə edərək, bu təcrübələri icra etdik. Göstərildiyi kimi Şəkil 4F, CK2α siRNA ilə transfection effektiv və xüsusən ΔFosB səviyyələrinə (üst panel) təsir etmədən CK2α protein səviyyələrini aşağı saldı. Pulse-kəşf analizi CK2-nun yıxılmasının, ΔFosB dövriyyə dövriyyəsinin əhəmiyyətli dərəcədə artmasına gətirib çıxardığını göstərdi ki, bu da proteinin daha sürətli parçalanması ilə sübutdur. CK2 aktivliyinin inhibe edilməsi faktı (DRB müalicəsi və ya siRNA vasitəsilə) ΔFosB dövriyyəsini artırır və bifazik əyrisin yavaş dərəcə komponentinin itməsinə gətirib çıxarır, halbuki CK2 aktivasiyası əyri yavaş mərhələini artırır, CK2'un ΔFosB sabitliyini tənzimləyən bir rol oynadığı fikri.

SerxNUMX-də CK2 fosforli ΔFosB

CK2 tərəfindən fosforla ΔFosB-də sahələri müəyyən etməyə başlayaq, biz CK2 tərəfindən fosfatlanmış rekombinant ΔFosB fosfo-amin turşusu analizini aparmışdır vitro və ΔFosB'nin PC12 hüceyrələrində fosforilatlaşdırılmışdır. Bu təcrübələr göstərir ki, hər iki halda aşkar edilən yeganə fosfo-amin turşusu fosfo-Ser (Əncir 5A). CK2 üçün əldə edilən stokiometriya ilə birlikdə bu tapıntı vitro fosforlaşma reaksiya (~ 50%) (Əncir 3B) və CK2 fosfopeptid xəritəsində yalnız bir əhəmiyyətli nöqtənin olması (Əncir 4A), ΔFosB'nin CK2 fosforilasyonu ehtimal ki, tək bir serin qalıqları ilə məhdudlaşdığını göstərir. Bu nəticə fosforilyasiya konsensus sahəsinin təhlili ilə uyğun gəlir (Əncir 2B), CK27 üçün yalnız bir namizəd serin, yəni Ser2 proqnozlaşdırdı. Taxonomik analiz SerxNUMX-in Fos ailə üzvləri arasında təkamül yolu ilə yüksək səviyyədə saxlanıldığını (Əncir 5B) əhəmiyyətli bir fizioloji funksiyaya sahib ola biləcəyini irəli sürdü.

Şəkil 5.

Daha böyük versiyanı bax:

Şəkil 5.

SerxNUMX-də CK2 fosforli ΔFosB. A, CK2-fosforilatlı fosforamino turşusu analizi (vitro) və PC12 hüceyrə fosforlu ΔFosB hər iki halda fosforilatın əsas qalıqları serin olduğunu göstərərək göstərir. BFosB / ΔFosB amino asit sekansının cross-species analizi, Fos ailə üzvləri arasında insandan zebra balığı (qaranlıq vurğulamaq) arasında Ser27-nun yüksək qorunmasını aşkar etdi. Bununla belə, CK3 konsensus ərazisi üçün tələb olunan + 2 mövqeyində olan asidik qalıq, mühafizə olunmur (yüngül işıq). C, HeLa hüceyrələri transsently ya vahşi tipli ΔFosB (WT) və ya Ser27 əleyhinə Ala (S27A) əvəz etmək üçün bir nöqtə mutasiya olan ΔFosB ilə transfekte edilmişdir. Hücrelər metabolik olaraq etiketli idi 32PH3PO4 və CK2 aktivləşdirmək üçün vasitə ilə və ya sperma (SP) ilə müalicə olunur. Əldə edilən ΔFosB immunoprecipitatların nümayəndəsi autoradiogram (üst panel) və immünoblot (alt panel) göstərilir. Mock-transfected hüceyrələrin (vektor) immunoprecipitatasiyası göstərilir.

Ser27'un ΔFosB-də fosforilatlandığını müəyyənləşdirmək üçün bu qalıqları Ala'ya dəyişdik və proteinlərin fosforilyasiya vəziyyətinə dair nəticələri təhlil etdik. Bu məqsədlə, WT və ya S27A mutantı ΔFosB-ni müvəqqəti şəkildə ifadə etmək üçün HeLa hüceyrələrini (daha yüksək effektivliyə malikdir) istifadə etdik. Transfeksiyondan təxminən 24 h, hüceyrələr metabolik olaraq etiketli idi 32P-ortofosfat və bütün hüceyrə lizatları hazırlanmışdır. Immunoprecipitation və SDS-PAGE-dən sonra, 32P-ΔFosB, autoradioqrafiya və immunoblotinq tərəfindən ΔFosB tərəfindən aşkar edilmişdir. Göstərildiyi kimi Şəkil 5C (alt panel), ΔFosB, vektor transfekte edilmiş hüceyrələrdə aşkarlanmadı, ya da WT ya da S27A mutantı ΔFosB ilə transfekte edilmiş hüceyrələr proteini müvəffəqiyyətlə ifadə edirdi. S27A mutasyonunun əhəmiyyətli (~ 30%) bir azalmaya səbəb olduğunu təsbit etdik 32P-ΔFosB səviyyəsi (Əncir 5C, üst panel və qraf) yaşayan hüceyrələrdə, ΔFosB SerxNUMX-da fosforilatlandığını bildirir. SerxNUMX hüceyrələrində həqiqətən CK27 tərəfindən fosforilatlandığını müəyyənləşdirmək məqsədilə CK27 aktivatorunun sperminin WT və S2A ΔFosB fosforiliyasını modullaşdırma qabiliyyətini müqayisə etdik. Daha əvvəl PC2 hüceyrələrindəƏncir 4B) HeLa hüceyrələrinin sperma ilə müalicəsi WT proteinin fosforiliyasını əhəmiyyətli dərəcədə artırdı. Bu təsir S27A mutasiyası tərəfindən əhəmiyyətli dərəcədə azalıb (Əncir 5C) ΔFosB Ser27-in CK2 üçün fizioloji substrat olduğunu şərhini dəstəkləyir.

SerxNUMX-in fosforlaşması ΔFosB-nin sabitliyini tənzimləyir

CK2 aktivləşdirildikdə CK2 inhibe edildikdə və inkişaf etdikdə ΔFosB sabitliyinin azaldığını müəyyənləşdirərək (Əncir 4) və SerxNUMX-də ΔFosB CK2 fosforilatlarınınƏncir 5), bu sitenin fosforlaşmasının qarşısının alınması proteinin istikrarsızlığı olmalıdır. HeLa hüceyrələri ilə aparılan pulse-kəşf təcrübələri və ya WT və ya S27A mutantı ΔFosB ifadə edən S27A mutasiyası, ΔFosB-nin degradasiyasının dərəcəsinin əhəmiyyətli dərəcədə artmasına gətirib çıxardığını və proteinin yarım ömrünün (Əncir 6A). Daha sonra bu tənzimləmə mexanizminin daha çox nöron kimi PC12 hüceyrə xəttində olub-olmadığını araşdırdıq. Bu təcrübələr, HeLa hüceyrələrində müşahidə etdiyimiz kimi, S27A nöqtəsi mutasiya PC12 hüceyrələrində ΔFosB yarım ömrünün dramatik azalmasına səbəb olur (~ 11-dən ~ 4 h) (Əncir 6B). Bu istikrarsızlığın CK2 inhibisyonu və ya yıxılması səbəbindən bənzər olması (Əncir 4SerxNUMX-in CK2 vasitəsi ilə fosforlaşmasının ΔFosB-nin sabitliyini tənzimləyən ideyası üçün daha çox dəstək verir. SerxNUMX fosforilasyonunun ΔFosB protein dövriyyəsi üzərində tənzimləyici rolu üçün əlavə sübut fosfomimetik SerxNUMX istifadə edərək Asp mutasyonuna (S27D) yol verildi. S27D mutasiya fosfomimetik hesab olunur, çünki bu, 27 amino asidində böyük bir mənfi yüklü (karboksil) qrup yerləşdirir və bununla da SerxNUMX-in fosforiliyasını qismən təqlid edir. Göstərildiyi kimi Şəkil 6C, S27D mutasiya S27A mutasyonunun əks təsirinə səbəb oldu və WT proteinindən daha əhəmiyyətli dərəcədə sabit olan bir protein gətirdi. CK2 aktivasiyasından sonra əldə edilən təsirə eyni şəkildə (Əncir 4D), S27D mutasiya əmələ gəlməsi ilə nəticələndi və beləliklə ilk təqvim zamanı ΔFosB səviyyələrini artırdı.

Şəkil 6.

Daha böyük versiyanı bax:

Şəkil 6.

SerxNUMX-in fosforlaşması ΔFosB-nin sabitliyini tənzimləyir. A, CSerxNUMX fosforilasiyasının ΔFosB dövran hövzəsinə təsirini göstərən Pulse-kovalamaq təhlili. Vahid tipli ΔFosB (WT), SerxNUMX-in Ala mutantına (S27A) və Fosfomimetik SerxNUMX-in Asp mutantına (S27D) təxmin edilən yarım ömrü göstərilir. Eyni nəticələr HeLa hüceyrələrindəA) və PC12 hüceyrələri (B, C).

SerxNUMX fosforiliyi proteazomal deqradasiyanın qarşısını alaraq ΔFosB stabilləşdirir

SerxNUMX-in fosforilyasiyasını ΔFosB stabilləşdirən mexanizmi aydınlaşdırmağa başlamaq üçün proteazom inhibitorlarının MG27 (Palombella et al., 1994; Tsubuki və digərləri, 1996) və epoksomisinin (Hanada və digərləri, 1992; Kim və digərləri, 1999) WT və S27A mutantının ΔFosB deqradasiya dərəcəsini modullaşdırmaq üçün. Pulse-təqib təcrübələri WT və ya S12A ΔFosB ifadə edən rekombinant HSV ilə yoluxan PC27 hüceyrələri və ya DMSO ya da iki proteazome inhibitorlarından biri ilə müalicə edilərək aparılmışdır. Bu təcrübələr göstərir ki, WT proteininin degradasiya dərəcəsi iki proteazome inhibitorlarının ya birinin varlığına nisbətən laqeyddir (baxmayaraq ki,Əncir 7A), S27A mutantının bu dərmanlara həssas olması (Əncir 7B). Bu, WT proteinindən fərqli olaraq, S27A mutantının proteazomal degradasiyanın bir hədəfi olduğunu göstərir. Həqiqətən, MG132 ya da epoksomisin olan hüceyrələrin müalicəsi S27A mutasyonunun ΔFosB'nin degradasiya dərəcəsinə təsirini tamamilə geri çevirdi və S27A mutantının 4 dan MG9 üçün ~ 132 h-ə qədər olan yarım ömrünün artması və " Epoxomicin üçün 12 h (Əncir 7B). Birlikdə bu nəticələr göstərir ki, ΔFosB'nin Ser27-ə fosforilasiyası proteini proteazomal degradasiyadan qoruyur və buna görə qeyri-adi stabillik üçün vacibdir.

Şəkil 7.

Daha böyük versiyanı bax:

Şəkil 7.

SerxNUMX-in fosforlaşması onun proteasomal deqradasiyasının qarşısını alaraq ΔFosB-ni sabitləşdirir. A, B, HSV-yoluxmuş PC12 hüceyrələri ilə zülal-kovuşma təhlili və yabanı tipli ΔFosB (təxminən yarım ömrünü göstərən)A) və ya S27A ΔFosB (B) iki proteazom inhibitorlarından biri yoxluğunda və ya mövcudluğunda [MG132 və epoxomicin (Epoxo)]. Nə dərmanın vahid tipli ΔFosB dövranına əhəmiyyətli dərəcədə təsiri olmadığını nəzərə alsaq, ya proteazome inhibitoru olan hüceyrələrin müalicəsi S27A ΔFosB-nin sabitləşməsinə gətirib çıxardı. C, ΔFosB'nin uzunmüddətli beyin plastisiyasına vasitəçilik etmək qabiliyyətində SerxNUMX fosforiliyinin rolu üçün bir model. İndüklədikdən sonra, ΔFosB'nin bir hissəsi S27-in CK2-vasitəçiliyi ilə fosforlaşması ilə beynə sabitləşir. Bu da öz növbəsində gen ifadəsində uzunmüddətli dəyişikliklərə səbəb olur. Gen ifadəsində bu sabit dəyişikliklər sabit davranış uyğunlaşmalarına kömək edir. Bunun əvəzində Ser / Thr fosfatazlar PP27 və / və ya PP27A tərəfindən S1-in deposforilyasiyasını proteazın tərkibində istifadəsi və proteazomal maşın tərəfindən emal edilməsi ilə nəticələnir.

Əvvəlki BölməSonrakı Bölmə

Müzakirə

Bu işdə, ΔFosB'nin hüceyrə mədəniyyətində 10 h-in yarım ömrünü göstərdiyini göstərir və bu, tam uzunluğu olan FosB və digər hüceyrə hüceyrəsindəki yarım ömrünü qısa müddətdə keçə bilən transkripsiyası faktorlar ilə müqayisədə sabit təşkil edir. bir neçə dəqiqə kimi və nadir hallarda 3 h-dən çoxdur (Hann və Eisenman, 1984; Dobrazanski və digərləri, 1991; Roberts və Whitelaw, 1999; Ferrara və digərləri, 2003; Hirata və digərləri, 2004). Bundan əlavə, ΔFosB'nin beyində fosforilat olduğu və onun fosforiliyinin PP1 / PP2A inhibitoru okadaik turşuna həssas olduğunu tapırıq. Bizim hüceyrə mədəniyyətinə dair araşdırmalar göstərir ki, ΔFosB-nin sabitliyi CK2 tərəfindən modulyasiya edilir, daha yüksək CK2 aktivliyi stabilləşdirir. Nəhayət, bizim tapıntılar CK2 fosforilatlarının ΔFosB yüksək konservləşdirilmiş N terminus serin (S27) üzərində olduğunu göstərir və S27'un fosforiliyasını proteazomal degradasiyadan ΔFosB qoruyur. Buna görə də, ΔFosB nin S27 üzrə CK2-lə fosforlaşması ΔFosB dövriyyəsinin kritik tənzimləyici mexanizmidirƏncir 7C). ΔFosB'nin fosforiliya vasitəsi ilə sabitləşməsi funksional əhəmiyyət kəsb edir, çünki ΔFosB xüsusilə beyin bölgələrində artan səviyyələr bir çox nöronal genləri vivo ilə və bəzi nöropsikiyatrik xəstəliklərin heyvan modellərində potensial davranış təsiri göstərməkdir (Girişə bax).

Fosforilasyon, CREB (cAMP cavab elementi bağlayıcı protein) kimi müəyyən transkripsiya faktorlarının transkripsiya fəaliyyətini tənzimləyən sürətli və bərpaedici bir yol olsa daBohmann, 1990), transkripsiyanın əmələ gəlməsinin tənzimlənməsini tənzimləmənin daha güclü (daha az asanlıqla bərpaedici) formasını təmin edirDesterro və digərləri, 2000). Funksional fəaliyyətinin tənəzzül səviyyəsində tənzimləndiyi transkripsiyaya aid faktorlar NFKB (Desterro və digərləri, 2000), c-Myc (Sears və digərləri, 1999) və c-Fos (Ferrara və digərləri, 2003), başqaları arasında. Bir çox hallarda, fosforilasiya trans-faktorun sabitliyinin əsas tənzimləyicidir, çünki c-Fos (Okazaki və Sagata, 1995; Tsurumi et al., 1995), Fos ilə əlaqəli antigen-1 (Fra-1) (Vial və Marshall, 2003), Fra-2 (Manabe və digərləri, 2001), c-Jun (Fuchs et al., 1996), JunB (Fuchs et al., 1997), ATF2 (Fuchs et al., 2000) və p53 (Buschmann et al., 2001). Bizim işlərimiz ΔFosB funksiyasını fosforli addımlı stabillik vasitəsilə tənzimləyən transkripsiyaya aid faktorlar siyahısına əlavə edir.

CK2, hər yerdə yayılmış və qurucu olaraq aktiv bir Ser / Thr kinazdır və bu vaxta qədər 300 substratı müəyyən edilmiş və hüceyrələrin ölümü və sağ qalması da daxil olmaqla bir çox bioloji proseslərdə iştirak etmişdir (Litchfield, 2003; Unger və digərləri, 2004), hücresel stress reaksiyaları (Yanagawa et al., 1997; Kato et al., 2003), DNT təmiri və kromatin remodeling (Barz və digərləri, 2003; Krohn et al., 2003). CK2-in ehtimal olunan substratlarının üçdə birindən çoxu gen ifadəsinin tənzimlənməsində iştirak edən zülallardır (Meggio və Pinna, 2003). Əslində, CK2'in görkəmli bir nüvə kinaz (Krek et al., 1992) (nəzərdən keçirmək üçün bax Yu və al., 2001) və bir neçə transkripsiya amillərinin bZIP domainləri ilə qarşılıqlı əlaqə yaratmaqYamaguchi et al., 1998). CK2-mediatlı fosforilasyonun bir çox proteinlərin degenerasiyasını (artırma və ya azaltma)Schwarz və digərləri, 1996), PTEN (Torres və Pulido, 2001), lens connexin (Yin və digərləri, 2000), kromatinlə əlaqəli protein HMG1 (Wisniewski və digərləri, 1999) və HMGB kimi bir neçə transkripsiyanınStemmer və s., 2002), Myf-5 (Winter və digərləri, 1997) və c-Myc (Channavajhala və Seldin, 2002). CK2 beyində ən çoxAlcazar et al., 1988; Girault və digərləri, 1990) və onun fəaliyyəti nöronal sağalma da daxil olmaqla beyin funksiyasının bir çox aspektindəBoehning et al., 2003), fərqləndirmə (Nuthall və digərləri, 2004), ion kanal funksiyası (Jones və Yakel, 2003; Bildl və digərləri, 2004), uzunmüddətli potensiasiya və nöronal plastisiyanıDiaz-Nido və digərləri, 1992; Lieberman və Mody, 1999; Reikhardt və digərləri, 2003).

Neyron funksiyasının tənzimlənməsində CK2 rolunun artması üçün bu artan sübuta baxmayaraq, onun fəaliyyətini nəzarət edənlər haqqında çox az məlumatlar var. CK2 əsasən intraselüler lokalizasiyada dəyişikliklərə (məsələn, sitosol vs nüvəsə) istinadən xüsusi substratları fosforlatmaq qabiliyyətinin tənzimlənməsi ilə qurucu aktiv hesab olunurAhmed və Tawfic, 1994; Yu və al., 1999). Bu məlumat xroniki stimullaşdırmadan sonra beyində ΔFOSB əmələ gətirmək üçün hansı siqnalların tələb olunduğuna dair mühüm bir sual doğurur (Əncir 7C). Bir şərt tələb olunur fosB genin və ΔFosB mRNA indüksiyasını (Chen et al., 1995). Bizim məlumatlar ΔFosB'nin CK2 fosforlaşmasının sabitliyinə görə vacibdir və ΔFosB'nin gen ifadəsinə uzun müddətli təsiri üçün ikinci bir siqnalın tələb oluna biləcəyini göstərir, yəni CK2 tərəfindən proteinin fosforiliyasını stimul edən bir siqnaldır. Bu, CK2-nun bəzi tanınmamış mexanizmlərdən və ya nüvəyə translokasiyadan aktivləşməsini ehtiva edə bilər. Alternativ olaraq, ΔFosB'nin CK2 fosforilasyonu, ΔFosB proteininin hər stimuluna cavab olaraq tərcümə edildiyi kimi, bir hissəsi fosforilatlı olur və bununla da sabitləşir, belə ki təkrarlanan stimullaşdırma ilə təsirlənmiş nöronlarda yüksək səviyyədə yığılır.

Bizim tapıntılar CK2 və S27-nun ΔFosB fosforilyasiyasından məsul olan yeganə kinaza və sahə deyildir, çünki CK2 və S27A mutasiyalarının inhibisyonu ΔFosB fosforiliyasını tamamilə qarşısını ala bilməmişdir. Eyni zamanda, S27A mutasyonunun fosfo-ΔFosB'de bir 30% azalma ilə nəticələnməsi S27 proteinin əsas fosforiliya sahəsidir. Buna baxmayaraq, ΔFosB üzərindəki digər pozitiv kinazları və fosforilyasiya sahələrini araşdırırıq. Nəticədə S27 və beyində ΔFosB-də olan digər fosforilyasiya sahələrinin fosforilyasiyasını təhlil etmək də vacibdir. vivo ilə məsələn, kütlə spektrometriyası və ya fosfospesifik antikorların istifadəsi ilə müxtəlif növ kronik stimullaşmalardan sonra.

Yuxarıda qeyd etdiyimiz kimi, ΔFosB-də S27 təkamül boyunca və digər Fos ailə zülalları arasında mühafizə olunur. Bununla belə, CK2 üçün konsensus saytı deyil: göstərildiyi kimi Şəkil 5B, yalnız FosB / ΔFosB (və Zebrafish xenoloq), lakin c-Fos və ya Fra-2 deyil, CX3 fosforilyasiyasının əsas göstəricisi olan + 2-da asidik bir qalıq varMarin və digərləri, 1986; Meggio və ark., 1994). Beləliklə, S2 üzrə CK27 fosforilyasiyasının olmaması digər Fos ailə zülallarının ΔFosB kimi sabit olmadığını izah edə bilər. Bununla belə, bu, ΔFosB kimi eyni CK2 konsensus saytına malik olan tam uzunluqlu FosB-nin nə üçün eyni dərəcədə stabilləşdirilmədiyini açıqlamır. Tam uzunluqlu FosB'nin bu qorunmuş qalıqda CK2 tərəfindən fosforilatlandığını bilmirik. Yalnız FosB (Skinner və digərləri, 1997) və c-Fos (Okazaki və Sagata, 1995; Chen et al., 1996fosforiliya bu ΔFosB-də olmayan bu zülalların C-terminal bölgəsində təsvir edir. CK2 tərəfindən tam uzunluqlu FosB və digər Fos ailə proteinlərinin potensial fosforlaşması birbaşa istintaq tələb edir. Lakin, fosforilatlı olsa da, digər Fos ailənin zülalları, C dövründə onların sürətli təriflənməsi üçün zülalları hədəf alan motiflər olduğu bilinir (Papavassiliou et al., 1992; Jariel-Encontre və digərləri, 1997; Acquaviva və digərləri, 2002). Məsələn, bütün Fos ailə zülallarının C terminusunda mövcud olan, lakin ΔFosB-də olmayan bir cədvəlin c-Fos üçün pozğunluq təşkil edən bir sahə kimi fəaliyyət göstərdiyi göstərilmişdirAcquaviva və digərləri, 2001). Bu ardıcıllıq eyni uzunluqlu FosB (Carle və ark., 2004), bu domenin ΔFosB-də olmaması onun sabitliyini tam hesablamır. Əksinə, bu C termus domeni və SerxNUMX fosforiliyinin olmaması birləşməsi ΔFosB və FosB arasındakı sabitliyin təxminən beş qat fərqini əks etdirir.

Fos ailənin zülallarının parçalanması kompleks və tam başa düşülməməsinə baxmayaraq, proteazomal degradasiya əsas yol kimi görünür (Salvat et al., 1999; Acquaviva və digərləri, 2002; Ferrara və digərləri, 2003). Burada təqdim olunan məlumatlarda proteasomal inhibitorların ΔFosB degradasiyasının dərəcəsini əhəmiyyətli dərəcədə dəyişməməsi, digər Fos ailənin zülallarından fərqli olaraq, ΔFosB 26S proteasomundan yayındırır və bu onun sabitləşməsində əsas rol oynayır. Buna görə, ΔFosB'nin inkişaf etmiş sabitliyi iki əsas amilin birləşməsinə aiddir: (1) C-terminal istikrarsızlaşdırıcı domenin olmaması və (2) S27'in CK2 tərəfindən fosforiliyi.

Xülasə olaraq, hazırkı tədqiqat dərhal erkən genin ΔFosB məhsuludur, nə üçün mexanik fikir verir fosB, digər Fos ailə üzvlərindən fərqli olaraq, nisbətən uzun ömürlü bir proteindir. Digər Fos ailə zülallarının sürətli, lakin müvəqqəti stimul-transkripsiya əlaqələndirməsinəMorgan və Curran, 1995), ΔFosB'nin nisbi sabitliyi ona kronik stimullaşdıran uzunmüddətli transkripsiyalı dəyişikliklərin vasitəçiliyinə imkan verir. Bu, ΔFosB'nin beyində davamlı bir molekulyar keçid kimi fəaliyyət göstərdiyini, tədricən kəskin cavabları kronik uyğunlaşmalara çevirməsini təmin edir. ΔFosB'nin stabilitesinin mərkəzi bir mexanizm olaraq SerxNUMX fosforilasyonunun tanımlanması, ΔFosB'nin işlevini düzenlemek için araçların geliştirilmesi için yeni yollar açar ve böylece uzun vadeli etkilerini nöral ve davranışsal plastisite üzerine modüle eder.

Əvvəlki BölməSonrakı Bölmə

Dəyişikliklər

  • Noyabr 21, 2005 qəbul edildi.
  • Revizyon Fevral 21, 2006 aldı.
  • Aprel 2 qəbul edildi, 2006.
  • Bu iş PGU üçün Şizofreniya və Depressiya Gənc Tədqiqatçılar Mükafatı üzrə Milli Alliance, NGUA Narkotik Tədqiqatlar üzrə Milli İnstitutu (PİV) üzrə Milli Tədqiqat Xidməti Mükafatı və Milli Ruh Sağlamlığı İnstitutu və NİDA tərəfindən EJN Dr. James Bibb ilə kömək etdiyi üçün təşəkkür edirəm vitro metabolik etiketləmə üçün istifadə edilmiş beyin dilimlərinin hazırlanmasında kömək üçün Dr. Ming-Hu Xan və onun rekombinant HSV'lerin qablaşdırma ilə bağlı köməkçisi Dr. Rachael Neve.
  • G. Rudenkonun indiki ünvanı: Həyat Elmləri İnstitutu və Farmakologiya şöbəsi, Michigan Universiteti, 210 Washtenaw prospekti # 3163A, Ann Arbor, MI 48109-2216.
  • Yazışmalar Eric J. Nestler, 5323 Harry Hines Bulvarı, Dallas, TX 75390-9070 ünvanına göndərilməlidir. E-poçt: [e-poçt qorunur]

Əvvəlki Bölmə

 

References

  1. â † μ

Acquaviva C, Brockly F, Ferrara P, Bossis G, Salvat C, Jariel-Encontre I, Piechaczyk M (2001) C-Fos proto-onkoproteinin sürətli (0) -ə-S mərhələsi keçid dövründə sürətli proteasomal deqradasiyasına nəzarətdə iştirak edən C-terminal tripeptid motivinin müəyyən edilməsi. oncogene 20:7563-7572.

CrossRefMedline

  1. â † μ

Acquaviva C, Bossis G, Ferrara P, Brockly F, Jariel-Encontre I, Piechaczyk M (2002) Fos ailə zülalları üçün bir çox degradasiya yolları. Ann NY Acad Sci 973:426-434.

Medline

  1. â † μ

Ahmed K, Tawfic S (1994) Protein kinazının intraselluler tənzimlənməsi mexanizmi CK2: stimul vasitəsi ilə yaranan nüvə birləşməsinin rolu. Cell Mol Biol Res 40:539-545.

Medline

  1. â † μ

Alcazar A, Martin E, Lopez-Fando J, Salinas M (1988) Beynindən kazein kinaz II'nin təkmilləşdirilmiş təmizlənməsi proseduru və xüsusiyyətləri. Neurochem Res 13:829-836.

CrossRefMedline

  1. â † μ

Andersson M, Westin JE, Cenci MA (2003) Kronik dopaminomimetik müalicənin dayandırılmasından sonra striatal DeltaFosB kimi immunoreaktivlik və prodinorfin mRNA səviyyəsinin vaxt kursu. Eur J Neurosci 17:661-666.

CrossRefMedline

  1. â † μ

Barz T, Ackermann K, Dubois G, Eils R, Pyerin W. (2003) Genom genişliyi ifadə ekranları, kromatin remodelində protein kinase CK2 üçün qlobal rol göstərir. J Cell Sci 116:1563-1577.

Abstract / FREE Tam Mətn

  1. â † μ

Beh I, Schmidt R, Hecker E (1989) HL-60 hüceyrələrində olan PKC'nin iki isozymları phorbol ester TPA tərəfindən aktivləşdirmədə fərqlilik göstərir. FEBS Lett 249:264-266.

Medline

  1. â † μ

Bildl W, Strassmaier T, Thurm H, Andersen J, Eble S, Oliver D, Knipper M, Mann M, Schulte U, Adelman JP, Fakler B (2004) Protein kinaz CK2 kiçik keçiricilik Ca (2 +) ilə birgədir - aktivləşdirilmiş K + kanalları və kanal qapılarını tənzimləyir. Neyron 43:847-858.

CrossRefMedline

  1. â † μ

Bing G, Wang W, Qi Q, Feng Z, Hudson P, Jin L, Zhang W, Bing R, Hong JS (1997) Fos ilə əlaqəli antigenin uzun müddətli ifadəsi və sıçan hipokampusu və striatumdakı nöbetlərlə əlaqəli delta FosB-nin keçid ifadəsi. J Neurochem 68:272-279.

Medline

  1. â † μ

Blom N, Sicheritz-Ponten T, Gupta R, Gammeltoft S, Brunak S (2004) Əməliyyat sonrası glikozilinin və zülalların amin turşu diziliyindən fosforiliyinin proqnozlaşdırılması. proteomics 4:1633-1649.

CrossRefMedline

  1. â † μ

Boehning D, Moon C, Sharma S, Hurt KJ, Hester LD, Ronnett GV, Shugar D, Snyder SH (2003) Gem oksigenaz-2-in CK2 fosforilasyonu ilə aktivləşdirilən karbon monoksid nörotransmission. Neyron 40:129-137.

CrossRefMedline

  1. â † μ

Bohmann D (1990) Transkripsiya faktorunun fosforlaşması: siqnal ötürülməsi və gen ifadəsinin tənzimlənməsi arasında bir əlaqə. Xərçəng Hüceyrələri 2:337-344.

Medline

  1. â † μ

Buschmann T, Potapova O, Bar-Shira A, Ivanov VN, Fuchs SY, Henderson S, Fried V, Minamoto T, Alarcon-Vargas D, Pincus MR, Gaarde WA, Holbrook NJ, Shiloh Y, Ronai Z (2001) P2'in Thr-53 üzrə Jun NH81-terminal kinaz fosforilasiyası stressə cavab olaraq p53 stabilizasiyası və transkripsiya fəaliyyəti üçün vacibdir. Mol Cell Biol 21:2743-2754.

Abstract / FREE Tam Mətn

  1. â † μ

Carle TL, Ulery PG, Nestler EJ (2004) Konservləşdirilmiş bir Fos ailəsi C-terminal domeninin olmaması deltaFosB-nin özünəməxsus sabitliyinə kömək edir. Soc Neurosci Abstr 30: 692.2.

  1. â † μ

Channavajhala P, Seldin DC (2002) Lenfomagenezdə protein kinaz CK2 və c-Myc funksional qarşılıqlı. oncogene 21:5280-5288.

CrossRefMedline

  1. â † μ

Chen J, Nye HE, Kelz MB, Hiroi N, Nakabeppu Y, Hope BT, Nestler EJ (1995) Elektrokonvulsif nöbet və kokain müalicəsi ilə delta FosB və FosB kimi zülalların tənzimlənməsi. Mol Pharmacol 48:880-889.

mücərrəd

  1. â † μ

Chen J, Kelz MB, Hope BT, Nakabeppu Y, Nestler EJ (1997) Xroniki Fos ilə əlaqəli antijenlər: xroniki müalicələrlə beyindəki ΔFosB'nin sabit variantları. J Neurosci 17:4933-4941.

Abstract / FREE Tam Mətn

  1. â † μ

Chen RH, Juo PC, Curran T, Blenis J. (1996) C-Fosdakı C-Fosun fosforlaşması onun transformasiya fəaliyyətini artırır. oncogene 12:1493-1502.

Medline

  1. â † μ

Choe ES, Parelkar NK, Kim JY, Cho HW, Kang HS, Mao L, Wang JQ (2004) Protein fosfataz 1 / 2A inhibitoru okadaik turşu CREB və Elk-1 fosforilasyonunu və c-fos ifadəsini in vivo sıçan striatumunda artırır. J Neurochem 89:383-390.

CrossRefMedline

  1. â † μ

Cochet C, Chambaz EM (1983) Polyamin vasitəçiliyi olan protein fosforilləri: intraselluler poliamin hərəkətləri üçün mümkün bir hədəf. Mol Cell Endocrinol 30:247-266.

CrossRefMedline

  1. â † μ

Cochet C, Feige JJ, Chambaz EM (1983) Bovine ağciyər toxumasından yüksək təmizlənmiş G tipli kazein kinazın katalitik və molekulyar xüsusiyyətləri. Biochim Biophys Acta 743:1-12.

Medline

  1. â † μ

Colby CR, Whisler K, Steffen C, Nestler EJ, Self DW (2003) DeltaFosB'nin striatal hüceyrə tipli xüsusi ov ekspresyonu kokain üçün təşviq artırır. J Neurosci 23:2488-2493.

Abstract / FREE Tam Mətn

  1. â † μ

Daunais JB, Roberts DC, McGinty JF (1993) Kokain özünü idarəsi preprodinorfini artırır, lakin c-fos deyil, rat striatumda mRNA. NeuroReport 4:543-546.

Medline

  1. â † μ

Desterro JM, Rodriguez MS, Hay RT (2000) Zülalın parçalanması ilə transkripsiyanın tənzimlənməsi. Cell Mol Həyat Sci 57:1207-1219.

CrossRefMedline

  1. â † μ

Diaz-Nido J, Armas-Portela R, Avila J. (1992) NİA-103 nöroblastoma hüceyrələrindəki DNT sintezinin inhibisyonundan sonra sitoplazmik kalium kinaz II-tipli aktivliyin artması nöritin inkişafı ilə müşayiət olunur. J Neurochem 58:1820-1828.

Medline

  1. â † μ

Di Maira G, Salvi M, Arrigoni G, Marin O, Sarno S, Brustolon F, Pinna LA, Ruzzene M (2005) Protein kinaz CK2 fosforilatlar və Akt / PKB-ni dəyişir. Cell Death fərqli 12:668-677.

CrossRefMedline

  1. â † μ

Dobrazanski P, Noguchi T, Kovary K, Rizzo CA, Lazo PS, Bravo R (1991) FosB geninin hər iki məhsulu, FosB və qısa forması, FosB / SF, fibroblastlarda transkripsiya aktivatorlardır. Mol Cell Biol 11:5470-5478.

Abstract / FREE Tam Mətn

  1. â † μ

Ferrara P, Andermarcher E, Bossis G, Acquaviva C, Brockly F, Jariel-Encontre I, Piechaczyk M (2003) C-Fos protein proteasomal deqradasiyasından məsul olan struktur determinantlar ifadə şərtlərinə görə fərqlənir. oncogene 22:1461-1474.

CrossRefMedline

  1. â † μ

Fuchs SY, Dolan L, Davis RJ, Ronai Z (1996) Jun N-kinaz tərəfindən c-Jun ubiquitinasyonuna fosforiliyaya bağlı olaraq hədəflənmə. oncogene 13:1531-1535.

Medline

  1. â † μ

Fuchs SY, Xie B, Adler V, Fried VA, Davis RJ, Ronai Z. (1997) c-Jun NH2-terminal kinazları, onların əlaqəli transkripsiyanın faktorlarını müşahidə etməyi hədəfləyir. J Biol Chem 272:32163-32168.

Abstract / FREE Tam Mətn

  1. â † μ

Fuchs SY, Tappin I, Ronai Z (2000) ATF2 transkripsiyası amilinin stabilliyi fosforiliya və fosforiliya ilə tənzimlənir. J Biol Chem 275:12560-12564.

Abstract / FREE Tam Mətn

  1. â † μ

Girault JA, Hemmings HC Jr, Williams KR, Nairn AC, Greengard P. (1989) Dozin kinaz II tərəfindən DARPP-32, bir dopamin və cAMP-tənzimlənən fosfoproteinin fosforlaşması. J Biol Chem 264:21748-21759.

Abstract / FREE Tam Mətn

  1. â † μ

Girault JA, Hemmings HC Jr, Zorn SH, Gustafson EL, Greengard P. (1990) Xərçəngin beyində xarakterizə edilən bir DARPP-32 serin kinaza, kazein kinaza II ilə eynidır. J Neurochem 55:1772-1783.

Medline

  1. â † μ

Hanada M, Sugawara K, Kaneta K, Toda S, Nishiyama Y, Tomita K, Yamamoto H, Konishi M, Oki T (1992) Epoksomicin, mikrob mənşəli yeni bir antitümör vasitədir. J Antibiot (Tokio) 45:1746-1752.

Medline

  1. â † μ

Hann SR, Eisenman RN (1984) İnsan c-myc onkogen tərəfindən kodlanan proteinlər: neoplastik hüceyrələrdə diferensial ifadə. Mol Cell Biol 4:2486-2497.

Abstract / FREE Tam Mətn

  1. â † μ

Hemmings HC Jr, Girault JA, Williams KR, LoPresti MB, Greengard P. (1989) ARPP-21, dopamin-innervasiya olunmuş beyin bölgələrində zənginləşdirilmiş bir siklik AMP-tənzimlənən fosfoprotein (Mr = 21,000). Sitenin aminokisit sekansı intact hüceyrələrdə siklik AMP ilə fosforlanmış və in vitro fosforilinin kinetik tədqiqatları. J Biol Chem 264:7726-7733.

  1. â † μ

Hidaka H, ​​Kobayashi R. (1992) Protein kinaz inhibitorlarının farmakologiyası. Annu Rev Pharmacol Toksikol 32:377-397.

CrossRefMedline

  1. â † μ

Hirata H, Bessho Y, Kokubu H, Masamizu Y, Yamada S, Lewis J, Kageyama R (2004) Hes7 proteininin qeyri-sabitliyi sadə seqment saatı üçün vacibdir. Nat Genet 36:750-754.

CrossRefMedline

  1. â † μ

Hiroi N, Graybiel AM (1996) Atipik və tipik nöroleptik müalicələr striatumda transkripsiya faktoru ifadəsinin ayrı-ayrı proqramlarına səbəb olur. J Comp Neurol 374:70-83.

CrossRefMedline

  1. â † μ

Ümid B, Kosofsky B, Hyman SE, Nestler EJ (1992) Xroniki kokain tərəfindən sıçan nüvəsindəki accumbenslərdə dərhal erkən gen ifadə və AP-1 bağlanmasının tənzimlənməsi. Proc Natl Acad Sci ABŞ 89:5764-5768.

Abstract / FREE Tam Mətn

  1. â † μ

Ümid BT, Kelz MB, Duman RS, Nestler EJ (1994a) Xroniki elektrokonvulsif nöbet (ECS) tedavisi değişen kompozisyon ve özelliklere sahip beyinde uzun süreli bir AP-1 kompleksinin ifadesini vermektedir. J Neurosci 14:4318-4328.

mücərrəd

  1. â † μ

Ümid BT, Nye HE, Kelz MB, Self DW, Iadarola MJ, Nakabeppu Y, Duman RS, Nestler EJ (1994b) Xroniki kokain və digər xroniki müalicələrlə beyindəki dəyişmiş Fos kimi zülallardan ibarət uzunmüddətli AP-1 kompleksinin indeksasiyası. Neyron 13:1235-1244.

CrossRefMedline

  1. â † μ

Ishida A, Fujisawa H. (1995) Avtomatik tənzimləyici domain vasitəsilə calmodulin-asılı protein kinaz II sabitləşdirilməsi. J Biol Chem 270:2163-2170.

Abstract / FREE Tam Mətn

  1. â † μ

Jariel-Encontre I, Salvat C, Steff AM, Pariat M, Acquaviva C, Furstoss O, Piechaczyk M (1997) C-fos və c-jun deqradasiyası üçün kompleks mexanizmlər. Mol Biol Rep 24:51-56.

CrossRefMedline

  1. â † μ

Jones S, Yakel JL (2003) Kasein kinaz ii (protein kinaz ck2) ng5-3 hüceyrələrində serotonin 108-ht (15) reseptor kanalı funksiyasını tənzimləyir. Nevrologiyada 119:629-634.

CrossRefMedline

  1. â † μ

Kato T Jr, Delhase M, Hoffman A, Karin M (2003) CK2 UV müdaxiləsi zamanı NF-kappaB aktivasiyasından məsul olan C-terminal IkappaB kinazdır. Mol Cell 12:829-839.

CrossRefMedline

  1. â † μ

Kelz MB, Chen J, Carlezon WA Jr, Whisler K, Gilden L, Beckmann AM, Steffen C, Zhang YJ, Marotti L, Self DW, Tkatch T, Baranauskas G, Surmeier DJ, Neve RL, Duman RS, Picciotto MR, Nestler EJ (1999) Beşte deltaFosB transkripsiyon faktorunun ifadəsi kokain həssaslığını nəzarət edir. təbiət 401:272-276.

CrossRefMedline

  1. â † μ

Kim KB, Myung J, Sin N, Yarımçıq CM (1999) Epoksomicin və dihidroeponemisin təbii məhsullar tərəfindən proteazome inhibisyonu: spesifiklik və potensiala nəzər yetirir. Bioorg Med Chem Lett 9:3335-3340.

CrossRefMedline

  1. â † μ

Kobayashi E, Nakano H, Morimoto M, Tamaoki T. (1989) Bir yeni mikrobik tərkibli Calphostin C (UCN-1028C), yüksək səviyyəli və spesifik protein kinaz C inhibitorudur. Biochem Biophys Res Commun 159:548-553.

CrossRefMedline

  1. â † μ

Krek W, Maridor G, Nigg EA (1992) Kasein kinaz II əsasən nüvə bir fermentdir. J Hüceyrə Biol 116:43-55.

Abstract / FREE Tam Mətn

  1. â † μ

Krohn NM, Stemmer C, Fojan P, Grimm R, Grasser KD (2003) Protein kinaz CK2 yüksək hərəkətlilik qrupu olan SSRP1 proteinini fosforlaşdırır və UV zədələnmiş DNT-nin tanınması ilə nəticələnir. J Biol Chem 278:12710-12715.

Abstract / FREE Tam Mətn

  1. â † μ

Qumar A, Choi KH, Renthal W, Tsankova NM, Theobald DEH, Truong HT, Russo SJ, LaPlant Q, Whistler K, Neve RL, Self DW, Nestler EJ (2005) Kromatin remodeling, striatumda kokainə səbəb olan plastisitənin əsas mexanizmidir. Neyron 48:303-314.

CrossRefMedline

  1. â † μ

Liberman DN, Mody I (1999) Həzi kinaz-II hipokampal nöronlarda NMDA kanalı funksiyasını tənzimləyir. Nat Neurosci 2:125-132.

CrossRefMedline

  1. â † μ

Şirkət Adı Litchfield DW (2003) Protein kinaz CK2: həyatın və ölümün hüceyrə qərarlarının strukturu, tənzimlənməsi və rolu. Biochem J 369:1-15.

CrossRefMedline

  1. â † μ

Manabe T, Kuramoto N, Nakamichi N, Aramachi K, Baba K, Hirai T, Yoneyama M, Yoneda Y (2001) C-Fos proteininin N-metil-dsəpin hipokampusunun nüvə hissələrində spartik turşusu. Brain Res 905:34-43.

Medline

  1. â † μ

Mandelzys A, Gruda MA, Bravo R, Morgan JI (1997) Kainik asitlə işlənmiş fosB null siçanların beyinlərində davamlı yüksəlmiş 37 kDa fos ilə əlaqəli antigen və AP-1 kimi DNA-bağlanma fəaliyyətinin olmaması. J Neurosci 17:5407-5415.

Abstract / FREE Tam Mətn

  1. â † μ

Marin O, Meggio F, Marchiori F, Borin G, Pinna LA (1986) Sıçan karaciğinden sitozoldan kazein kinaz-2 (TS) sitenin spesifikliyi. Model peptid substratları ilə bir iş. Eur J Biochem 160:239-244.

  1. â † μ

McClung CA, Nestler EJ (2003) CREB və DeltaFosB tərəfindən gen ifadə və kokain mükafatının tənzimlənməsi. Nat Neurosci 6:1208-1215.

CrossRefMedline

  1. â † μ

McClung CA, Ulery PG, Perrotti LI, Zachariou V, Berton O, Nestler EJ (2004) DeltaFosB: beyində uzun müddətli adaptasiya üçün molekulyar bir keçid. Brain Res Mol Brain Res 132:146-154.

Medline

  1. â † μ

Meggio F, Pinna LA (2003) Protein kinaz CK2 bir min və bir substratlar? FASEB J 17:349-368.

Abstract / FREE Tam Mətn

  1. â † μ

Meggio F, Donella-Deana A, Pinna LA, Moret V (1977) Siçovul qaraciyəri tərəfindən kazein fraksiyalarının fosforillənməsi 'fosvitin kinaz.'. FEBS Lett 75:192-196.

Medline

  1. â † μ

Meggio F, Brunati AM, Pinna LA (1983) Alfa və beta-alt birləşmələrində tip 2 kazein kinaz TS-in autofosforilasiyası. Müxtəlif effektivlərin təsiri. FEBS Lett 160:203-208.

CrossRefMedline

  1. â † μ

Meggio F, Shugar D, Pinna LA (1990) Rinofuranosil-benzimidazol türevləri, kasein kinaz-2 inhibitorları və kalium kinaz-1. Eur J Biochem 187:89-94.

Medline

  1. â † μ

Meggio F, Marin O, Pinna LA (1994) Protein kinazının subkrat spesifikliyi CK2. Cell Mol Biol Res 40:401-409.

Medline

  1. â † μ

Miller C, Zhang M, He Y, Zhao J, Pelletier JP, Martel-Pelletier J, Di Battista JA (1998) İnsan kondrositlərində fosfataza aktivliyinin okadaik asit inhibisyonu ilə siklooksijenaz-2 geninin transkripsiya indüksiyası: AP-1 və CRE nüvə bağlayıcı proteinlərin birgə stimullaşdırılması. J Cell Biochem 69:392-413.

CrossRefMedline

  1. â † μ

Moratalla R, Elibol B, Vallejo M, Graybiel AM (1996) Xroniki kokain müalicəsi və çəkilmə zamanı striatumda induksiyalı Fos-Jun proteinlərinin ifadəsində şəbəkə səviyyəsində dəyişikliklər. Neyron 17:147-156.

CrossRefMedline

  1. â † μ

Morgan JI, Curran T (1995) Dərhal erkən genlər: on ildir. Trends Neurosci 18:66-67.

CrossRefMedline

  1. â † μ

Nakabeppu Y, Nathans D (1991) Fos / Jun transkripsiyası fəaliyyətini inhibe edən FosB təbii şəkildə kəsilmiş forma. Cell 64:751-759.

CrossRefMedline

  1. â † μ

Nestler EJ, Barrot M, Self DW (2001) Delta FosB: asılılıq üçün davamlı bir molekulyar keçid. Proc Natl Acad Sci ABŞ 98:11042-11046.

Abstract / FREE Tam Mətn

  1. â † μ

Neve RL, Howe JR, Hong S, Kalb RG (1997) Qlutamat reseptor alt nüsri 1-in in vitro və in vivo bir rekombinant herpes simplex virusu istifadə edərək motor neyronlarına daxil edilməsi. Nevrologiyada 79:435-447.

CrossRefMedline

  1. â † μ

Nuthall HN, Joachim K, Stifani S. (2004) Protein kinaz CK239 tərəfindən Groucho / TLE1 serin 2-in fosforlanması nöronal diferensiyasiyanın inhibe edilməsi üçün vacibdir. Mol Cell Biol 24:8395-8407.

Abstract / FREE Tam Mətn

  1. â † μ

Okazaki K, Sagata N (1995) Mos / MAP kinaz yolları f-fosforla c-Fos'u stabilləşdirir və NIH 3T3 hüceyrələrində transformasiya fəaliyyətini artırır. EMBO J 14:5048-5059.

Medline

  1. â † μ

Palombella VJ, Rando OJ, Goldberg AL, Maniatis T (1994) Ubikuitin-proteasom yolu NF-kappa B1 prekursor proteini və NF-kappa B aktivliyinin işlənməsi üçün tələb olunur. Cell 78:773-785.

CrossRefMedline

  1. â † μ

Papavassiliou AG, Treier M, Chavrier C, Bohmann D (1992) C-Fos-un hədəflənmiş degradasiyası, f-fos deyil, c-Jun-da bir fosforilə bağlı siqnaldır. Elm 258:1941-1944.

Abstract / FREE Tam Mətn

  1. â † μ

Peakman MC, Colby C, Perrotti LI, Tekumalla P, Carle T, Ulery P, Chao J, Duman C, Steffen C, Monteggia L, Allen MR, Fond JL, Duman RS, McNeish JD, Barrot M, Self DW, Nestler EJ , Schaeffer E (2003) Transgenik siçanlarda C-Jun üstün dominant bir mutantın beyin sahəsinə özgü ifadəsidir, kokainə qarşı həssaslığı azaldır. Brain Res 970:73-86.

CrossRefMedline

  1. â † μ

Perrotti LI, Hadeishi Y, Ulery PG, Barrot M, Monteggia L, Duman RS, Nestler EJ (2004) Xroniki stressdən sonra mükafatla əlaqəli beyin strukturlarında DeltaFosB induksiyası. J Neurosci 24:10594-10602.

Abstract / FREE Tam Mətn

  1. â † μ

Persico AM, Schindler CW, O'Hara BF, Brannock MT, Uhl GR (1993) Beyin transkripsiyası faktoru ifadəsi: akut və kronik amfetamin və injection stressin təsiri. Brain Res Mol Brain Res 20:91-100.

Medline

  1. â † μ

Ploegh HL, Dunn BM (2000) Post-translational modifikasiya: fosforilasyon və fosfatazlar. In: Protein elminin hazırkı protokolları (Dunn BM, ed.) S. 13.01-13.02. New York: Wiley və Sons.

  1. â † μ

Pyerin W, Burow E, Michaely K, Kubler D, Kinzel V (1987) Yüksək təmizlənmiş fosvitin / kasein kinaz növü II-də insan epiteliya hüceyrələrindən (HeLa) olan və ekto protein kinaza qarşı olan katalitik və molekulyar xassələri. Biol Chem Hoppe Seyler 368:215-227.

Medline

  1. â † μ

Reikhardt BA, Kulikova OG, Borisova GY, Aleksandrova İY, Sapronov NS (2003) Sıçanda yaşa bağlı amneziyada "protein kinaz CK2-HMG14" sisteminin vəziyyəti. Neurosci Behav Physiol 33:799-804.

Medline

  1. â † μ

Roberts BJ, Whitelaw ML (1999) Ubiquitin / proteasome yolu ilə əsas helix-loop-helix / Per-ARNT-Sim homoloji domain dioksin reseptorunun parçalanması. J Biol Chem 274:36351-36356.

Abstract / FREE Tam Mətn

  1. â † μ

Rost B, Yachdav G, Liu J. (2004) PredictProtein server. Nüvə turşuları Res 32:W321-W326.

Abstract / FREE Tam Mətn

  1. â † μ

Rylski M, Kaczmarek L. (2004) Ap-1 beynində hədəflər. Ön Biosci 9:8-23.

CrossRefMedline

  1. â † μ

Şahin B, Kansy JW, Nairn AC, Spychala J, Ealick SE, Fienberg AA, Greene RW, Bibb JA (2004) Rekombinant siçan adenozin kinazının molekulyar xarakterizə edilməsi və protein fosforilasiyasının hədəfi kimi qiymətləndirilməsi. Eur J Biochem 271:3547-3555.

Medline

  1. â † μ

Salvat C, Aquaviva C, Jariel-Encontre I, Ferrara P, Pariat M, Steff AM, Carillo S, Piechaczyk M (1999) İn vivo c-Fos, c-Jun və p53 protein qidalanmasına kömək edən bir neçə proteolitik yol varmı? Mol Biol Rep 26:45-51.

CrossRefMedline

  1. â † μ

Schmidt R, Hecker E (1975) Normal saxlama şəraitində phorbol esterlərin avtomatik olaraq oksidləşməsi. Xərçəng Res 35:1375-1377.

PULSUZ Tam Mətn

  1. â † μ

Schwarz EM, Van Antwerp D, Verma IM (1996) İkappaBalphanın təsnifatlı fosforiliyi kazein kinaz II ilə üstünlük təşkil edir, serin 293-da: pulsuz IkappaBalpha-nın pozulması üçün tələbdir. Mol Cell Biol 16:3554-3559.

Abstract / FREE Tam Mətn

  1. â † μ

Sears R, Leone G, DeGregori J, Nevins JR (1999) Ras, Myc protein sabitliyini artırır. Mol Cell 3:169-179.

CrossRefMedline

  1. â † μ

Silva-Neto MA, Fialho E, Paes MC, Oliveira PL, Masuda H. (2002) Rhodnius prolixus oositlərindən təmizlənmiş kalium kinaz II tərəfindən vitellinin cikli nükleotiddən müstəqil fosforlaşması. Böcək Biochem Mol Biol 32:847-857.

CrossRefMedline

  1. â † μ

Skinner M, Qu S, Moore C, Wisdom R. (1997) FosB proteininin transkripsiya aktivləşdirilməsi və transformasiyası karboksil terminal aktivasiya domaininin fosforiliyasını tələb edir. Mol Cell Biol 17:2372-2380.

Abstract / FREE Tam Mətn

  1. â † μ

Stemmer C, Schwander A, Bauw G, Fojan P, Grasser KD (2002) Protein kinaz CK2, stabilliyini və DNT qarşılıqlı təsirini modifikasiya edən mısır xromosomlu yüksək hərəkətlilik qrupu B (HMGB) proteinlərini fosforilatlandırır. J Biol Chem 277:1092-1098.

Abstract / FREE Tam Mətn

  1. â † μ

Stevens I, Derua R, Rondelez E, Waelkens E, Merlevede W, Qoris J (1999) Yeni bir kalsium / calmodulin qarışıq protein kinaz II və Xenopus laevis oocyte yetişmə zamanı rolu kimi cyk, siklin B2 kinazın müəyyən edilməsi. Exp Cell Res 252:303-318.

CrossRefMedline

  1. â † μ

Suh HW, Choi SS, Lee JK, Lee HK, Han EJ, Lee J. (2004) Birincil mədəniyyətli astrositlərdə lipopolisakkarid və sitokinlər tərəfindən c-fos və c-jun gen ifadəsinin tənzimlənməsi: PKA və PKC yollarının təsiri. Arch Pharm Res 27:396-401.

Medline

  1. â † μ

Szyszka R, Boguszewska A, Grankowski N, Ballesta JP (1995) Ribozomal asidik proteinlərin maya hüceyrəsindəki iki endojen protein kinazdan diferensial fosforilasyonu: kazein kinaz-2 və 60S kinaz. Acta Biochim Pol 42:357-362.

Medline

  1. â † μ

Tamaoki T, Takahashi I, Kobayashi E, Nakano H, Akinaga S, Suzuki K (1990) Calphostin (UCN1028) və calphostin ilə əlaqəli birləşmələr, protein kinaz C xüsusi və potensial inhibitorları yeni bir sinif. Əvvəli İkinci Peyğəmbər Phosphoprotein Res 24:497-501.

Medline

  1. â † μ

Torres J, Pulido R. (2001) PTEN-in şiş təzyiqçisi C terminusunda protein kinaz CK2 tərəfindən fosforlaşdırılır. PTEN stabilitesinin proteazomla əlaqəli degradasiyaya təsirləri. J Biol Chem 276:993-998.

Abstract / FREE Tam Mətn

  1. â † μ

Tsubuki S, Saito Y, Tomioka M, Ito H, Kawashima S (1996) Di-lösin və tri-lösin peptidil aldehidləri tərəfindən calpain və proteasom fəaliyyətlərinin diferensial inhibisyonu. J Biochem (Tokio) 119:572-576.

Abstract / FREE Tam Mətn

  1. â † μ

Tsurumi C, Ishida N, Tamura T, Kakizuka A, Nishida E, Okumura E, Kishimoto T, Inagaki M, Okazaki K, Sagata N (1995) C-Fosun 26S proteazomu ilə parçalanması c-Jun və çoxlu protein kinazları ilə sürətlənir. Mol Cell Biol 15:5682-5687.

Abstract / FREE Tam Mətn

  1. â † μ

Unger GM, Davis AT, Slaton JW, Əhməd K. (2004) Protein kinaz CK2 hüceyrə sağkalım tənzimləyicisi olaraq: xərçəng terapiyası üçün təsirlər. Curr Xərçəng Drug hədəfləri 4:77-84.

CrossRefMedline

  1. â † μ

Vial E, Marshall CJ (2003) Yüksək ERK-MAP kinaz fəaliyyəti FOS ailəsinin üzvü FRA-1'i kolon karsinoma hüceyrələrində proteazomal degradasiyaya qarşı qoruyur. J Cell Sci 116:4957-4963.

Abstract / FREE Tam Mətn

  1. â † μ

Werme M, Messer C, Olson L, Gilden L, Thoren P, Nestler EJ, Brene S (2002) ΔFosB təkər qaçışını tənzimləyir. J Neurosci 22:8133-8138.

Abstract / FREE Tam Mətn

  1. â † μ

Whitmarsh AJ, Devis RJ (2000) Fosforilasiyaya görə transkripsiya faktoru funksiyasının tənzimlənməsi. Cell Mol Həyat Sci 57:1172-1183.

CrossRefMedline

  1. â † μ

Qış B, Kautzner I, Issinger OG, Arnold HH (1997) İki potensial protein kinaz CK2 fosforilyasiya sahələri Myf-5 aktivliyi üçün vacibdir. Biol Chem 378:1445-1456.

Medline

  1. â † μ

Wisniewski JR, Szewczuk Z, Petry I, Schwanbeck R, Renner U (1999) Xasum kinaz II-nin yüksək hərəkətlilik qrupu 1 proteinlərinin asidik quyruğunun quruluş fosforiliyi onların konformasiyası, stabilliyi və DNT-nin spesifikliyini dəyişir. J Biol Chem 274:20116-20122.

Abstract / FREE Tam Mətn

  1. â † μ

Yamaguchi Y, Wada T, Suzuki F, Takagi T, Hasegawa J, Handa H. (1998) Kasein kinaz II bir neçə transkripsiyanın faktorlarının bZIP domainləri ilə qarşılıqlı əlaqədə olur. Nüvə turşuları Res 26:3854-3861.

Abstract / FREE Tam Mətn

  1. â † μ

Yanagawa T, Yuki K, Yoshida H, Bannai S, Ishii T (1997) A170 stress proteininin makrofaglarda kasein kinaz II-tipli aktivliyi ilə fosforiliyi. Biochem Biophys Res Commun 241:157-163.

CrossRefMedline

  1. â † μ

Yankulov K, Yamaşita K, Roy R, Egly JM, Bentley DL (1995) Transkripsiyanın uzadılması inhibitoru 5,6-dichloro-1-beta-d-ribofuranosilbenzimidazol transkripsiya faktor IIH-əlaqəli protein kinazını inhibe edir. J Biol Chem 270:23922-23925.

Abstract / FREE Tam Mətn

  1. â † μ

Yen J, Hikmət RM, Tratner I, Verma IM (1991) FosB-in alternativ birləşdiyi forması Fos proteinləri tərəfindən transkripsiya aktivləşdirmə və transformasiyanın tənzimləyici mexanizmidir. Proc Natl Acad Sci ABŞ 88:5077-5081.

Abstract / FREE Tam Mətn

  1. â † μ

Yin X, Jedrzejewski PT, Jiang JX (2000) Casein kinase II fosforli lens əlaqəli 45.6 və onun deqradasiyasına iştirak edir. J Biol Chem 275:6850-6856.

Abstract / FREE Tam Mətn

  1. â † μ

Yoza BK, Brooks JW, Mizel SB (1992) Interleukin 1 və phorbol esterləri tərəfindən T-hüceyrəsinin aktivləşdirilməsi zamanı AP-1 transkripsiyası faktoru komponentlərinin indüksiyası. Hüceyrə böyüməsi fərqlidir 3:677-684.

mücərrəd

  1. â † μ

Yu S, Wang H, Davis A, Əhməd K. (2001) CX2 nüvə matrisi üçün siqnalın nəticələri. Mol Hüceyrə Biokim 227:67-71.

CrossRefMedline

  1. â † μ

Yu S, Davis AT, Guo C, Yaşıl JE, Əhməd K. (1999) Protein kinazının CK2-nun nüvə matriyasındakı alt birimlərinin keçdiyi zaman aşırı ekspresyonu ilə fərqli hədəflənməsi. J Cell Biochem 74:127-134.

CrossRefMedline

  1. â † μ

Zachariou V, Bolanos CA, Selley DE, Theobald D, Cassidy MP, Kelz MB, Shaw-Lutchmann T, Berton O, Sim-Selley LJ, DiLeone RJ, Kumar A, Nestler EJ (2006) ΔFosB: morfin hərəkətində nüvəli akumbensdə ΔFosB üçün mühüm rol. Nat Neurosci 9:205-211.

CrossRefMedline

Bu məqaləyə istinadən məqalələr

  • Xroniki Kokainə Davranış və Struktur Cavablar Nucleus Accumbens Shell-də {Delta} FosB və Kalsium / Calmodulin-Bağlı Protein Kinaz II iştirak edən bir Feedforward Loop tələb etməli Nevrologiyada jurnalı, 6 Mart 2013, 33(10):4295-4307
  • {Delta} FosB'nin Striatal Üstünlükü Kronik Levodopa İndüktörlü Sülh hərəkətləri Nevrologiyada jurnalı, 26 May 2010, 30(21):7335-7343
  • mücərrəd
  • Tam Mətn
  • Tam Mətn (PDF)
  • mücərrəd
  • Tam Mətn
  • Tam Mətn (PDF)
  • mücərrəd
  • Tam Mətn
  • Tam Mətn (PDF)
  • mücərrəd
  • Tam Mətn
  • Tam Mətn (PDF)
  • Bağımlılığın transkripsiyon mexanizmləri: {Delta} FosB rolu Biologiya elmləri: The Royal Society B fəlsəfi əməliyyatlar, 12 Oktyabr 2008, 363(1507):3245-3255
  • Glial hüceyrə xəttindən yaranan neyrotrofik faktor mutant siçanlarda metamfetamin axtarış davranışının bərpasına davamlı həssaslıq FASEB Journal, 1 iyul 2007, 21(9):1994-2004
  • Respirator Epiteliya Kanserogenezində Aktivator Protein-1 Transkripsiyası Faktorları Molekulyar Xərçəng Araşdırma, 1 Fevral 2007, 5(2):109-120