DeltaFosB indirectly regulates Cck promoter activity (2010)

Brain Res. 2010 May 6; 1329: 10–20.

Published online 2010 March 11. doi:  10.1016/j.brainres.2010.02.081

PMCID: PMC2876727

John F. Enwright, III,1 Megan Wald,1 Madison Paddock,1 Elizabeth Hoffman,1 Rachel Arey,2 Scott Edwards,2 Sade Spencer,2 Eric J. Nestler,3 and Colleen A. McClung2,*

Author information ► Copyright and License information ►

The publisher’s final edited version of this article is available at Brain Res

See other articles in PMC that cite the published article.

Go to:

Abstract

Some of the important biochemical, structural, and behavioral changes induced by chronic exposure to drugs of abuse appear to be mediated by the highly stable transcription factor ΔFosB. Previous work has shown that ΔFosB overexpression in mice for 2 weeks leads to an increase in the expression of numerous genes in striatum, most of which are later downregulated following 8 weeks of ΔFosB expression. Interestingly, a large number of these genes were also upregulated in mice overexpressing the transcription factor CREB. It was unclear from this study, however, whether short-term ΔFosB regulates these genes via CREB. Here we find that 2 weeks of ΔFosB overexpression increases CREB expression in striatum, an effect that dissipates by 8 weeks. The early induction is associated with increased CREB binding to certain target gene promoters in this brain region. Surprisingly, one gene that was a suspected CREB target based on previous reports, cholecystokinin (Cck), was not controlled by CREB in striatum. To further investigate the regulation of Cck following ΔFosB overexpression, we confirmed that short-term ΔFosB overexpression increases both Cck promoter activity and gene expression. It also increases binding activity at a putative CREB binding site (CRE) in the Cck promoter. However, while the CRE site is necessary for normal basal expression of Cck, it is not required for ΔFosB induction of Cck. Taken together, these results suggest that while short-term ΔFosB induction increases CREB expression and activity at certain gene promoters, this is not the only mechanism by which genes are upregulated under these conditions.

Keywords: nucleus accumbens, transcription, addiction

Go to:

INTRODUCTION

Chronic exposure to drugs of abuse causes biochemical and structural changes in several brain regions. These changes are thought to involve alterations in gene expression profiles in the mesolimbic system. This system is composed of dopaminergic neurons that project from the ventral tegmental area (VTA) in the midbrain to medium spiny neurons in the nucleus accumbens (NAc) (ventral striatum) as well as a number of other brain regions. Alterations in the activity of two transcription factors, cAMP response element binding protein (CREB) and ΔFosB (a Fos family protein), have been proposed to mediate many of the biochemical, structural, and behavioral changes seen with chronic exposure to drugs of abuse (reviewed by Nestler, 2005).

CREB is a ubiquitously expressed transcription factor that is a member of the CREB/ATF family. CREB homodimers bind to variations of a CRE sequence (consensus: TGACGTCA) found in the promoters of many genes. Phosphorylation of CREB (predominately at serine 133, although other sites have been identified) can be stimulated by several signaling cascades including those downstream of dopamine receptors (Cole et al., 1995). Upon phosphorylation at serine 133, CREB recruits the co-activator CREB binding protein (CBP) or related proteins leading to increased gene expression (reviewed by Johannessen et al., 2004). Chronic exposure to opiate or psychostimulant drugs of abuse induces transient increases in CREB activity in the nucleus accumbens (Barrot et al., 2002; Shaw-Lutchman et al., 2002, 2003), an adaptation thought to decrease the rewarding properties of these drugs and to contribute to the negative emotional state of drug withdrawal (Nestler, 2005).

Longer-lasting adaptations to drugs of abuse are thought to be mediated in part by ΔFosB, a highly stable splice variant of FosB (Nestler et al., 1999; McClung et al., 2004; Nestler, 2008). Fos family members dimerize with members of the Jun family to form an activator protein 1 (AP-1) complex. AP-1 transcription complexes bind to variations of the AP-1 response element (consensus: TGACTCA) to regulate transcription (reviewed by Chinenov and Kerppola, 2001). While acute exposure to drugs of abuse leads to the short-lived induction (hrs) of Fos-family members (as well as increased CREB activity), repeated drug exposure leads to the accumulation of the highly stable ΔFosB (Hope et al., 1994; Perrotti et al., 2008), the expression of which persists for weeks.

Bi-transgenic mice inducibly overexpressing either ΔFosB or CREB in the adult striatum display many of the biochemical and behavioral phenotypes seen in animals exposed repeatedly to psychostimulants or other drugs of abuse. Analysis of gene expression changes in these transgenic animals identified numerous genes upregulated by short-term (2 weeks) overexpression of ΔFosB, changes associated with a concomitant decrease in drug reward. The changes in gene expression and behavioral response with short-term ΔFosB were remarkably similar to those seen in animals overexpressing CREB for 2 or 8 weeks (McClung and Nestler, 2003). In striking contrast, long-term overexpression (8 weeks) of ΔFosB decreased expression of many of these same genes and lead to an increase in drug reward (Kelz et al., 1999; McClung and Nestler, 2003).

One gene identified in these studies is cholecystokinin (Cck), a neuropeptide produced in several brain regions, including the striatum (Hokfelt et al., 1980). CCK can modulate dopaminergic transmission (Vaccarino, 1992), is involved in drug reward and reinforcement (Josselyn et al., 1996; Josselyn et al., 1997; Hamilton, et al., 2000; Beinfeld et al., 2002; Rotzinger et al., 2002), and is induced in the striatum by chronic cocaine (Ding and Mocchetti, 1992). Additionally the Cck promoter has been shown to be responsive to both CREB and AP-1 complexes (Haun and Dixon, 1990; Deavall, et al., 2000; Hansen, 2001). Since many of the genes (including Cck) that showed increased expression following both CREB and short-term ΔFosB expression were known or suspected CREB target genes (McClung and Nestler, 2003), we wanted to determine if short-term ΔFosB expression leads to regulation of these genes (with a focus on Cck) through the regulation of CREB or through more complex mechanisms of gene regulation.

Go to:

RESULTS

ΔFosB overexpression transiently increases CREB levels

We used Western blotting to investigate whether ΔFosB overexpression increases CREB protein levels in the striatum of mice. For this study, we utilized bi-transgenic mice (line 11A) which carry both an NSE-tTA transgene and a TetOp-ΔFosB transgene. In the absence of doxycycline, these mice show a robust increase in ΔFosB expression in the dynorphin positive neurons in striatum (Kelz et al., 1999). This method of overexpressing ΔFosB has been extensively documented and allows for region-specific overexpression, which parallels the ΔFosB induction seen in animals exposed to chronic cocaine (Hope et al., 1994; Kelz et al., 1999). We found that in 11A mice overexpressing ΔFosB, CREB protein levels were significantly upregulated after 2 weeks of expression and these levels returned to baseline after 8 weeks of expression (Figure 1A, n=8). To determine if the changes in CREB levels with short-term ΔFosB overexpression could be replicated in another system, we transiently overexpressed ΔFosB in PC12 cells and found that CREB levels increased significantly (p<0.05) when compared to controls (Figure 1B, n=4). These results demonstrate that short-term ΔFosB expression increases CREB protein levels.

Figure 1

Figure 1

CREB levels increase with ΔFosB overexpression. Western blot analysis of lysates from (A) mouse striata from 11A mice off dox for 2 or 8 weeks or (B) PC12 cells overexpressing ΔFosB. Data in A are shown as percent change in off dox compared …

Both ΔFosB and CREB bind to promoters of specific target genes in the striatum following short-term ΔFosB overexpression

We used ChIP (chromatin immunoprecipitation) assays of striatal tissue to determine if ΔFosB or CREB binding occurred at certain target gene promoters and if this binding was increased following short-term ΔFosB overexpression. We analyzed binding at the BDNF and Cck promoters, since both genes are highly upregulated following short-term ΔFosB overexpression, CREB overexpression, or chronic cocaine treatment (McClung and Nestler, 2003). We also analyzed binding at the CDK5 promoter, since it is a known direct target of ΔFosB (Chen et al., 2000; Bibb et al., 2001; Kumar et al., 2005). Finally, we measured binding at the prodynorphin promoter, since previous studies have found that it can be bound by both ΔFosB and CREB under different conditions (Andersson et al., 2001; Zachariou et al., 2006).

ChIP analysis was performed on striata from 11A mice overexpressing ΔFosB for 2 weeks using antibodies that recognize CREB or ΔFosB. Under normal conditions, we found that ΔFosB binds to the CDK5 and prodynorphin promoters, while there is no detectable binding at the BDNF or Cck promoters (Table 1). Furthermore, ΔFosB overexpression increased the binding of ΔFosB at the CDK5 promoter, but not at the prodynorphin promoter. We next measured CREB binding at these promoters and found that CREB binds to the CDK5, BDNF and prodynorphin promoters, but not to the Cck promoter, in normal striatum, and that ΔFosB overexpression for 2 weeks increases CREB binding at the BDNF and prodynorphin promoters, but not the CDK5 promoter. Taken together, these results show that ΔFosB and CREB can both bind to certain gene promoters such as prodynorphin and CDK5, however, CREB binding is specific to other promoters such as BDNF. Furthermore, ΔFosB overexpression leads to increases in ΔFosB binding at certain promoters, as would be expected, but also to CREB binding to specific promoters, consistent with the ΔFosB-mediated CREB induction observed at this time point.

Table 1

Table 1

Binding of putative regulatory proteins to various promoters in mice overexpressing ΔFosB for two weeks.

Previous work has shown that changes in gene expression induced by long-term ΔFosB overexpression are associated with chromatin modifications, in particular, acetylation of histone H3, at specific gene promoters (Kumar et al., 2005). To determine if this could account for changes in gene expression upon shorter-term ΔFosB overexpression, we measured binding of acetylated histone H3 (a histone modification associated with transcriptionally active chromatin), or a methylated histone H3 (Lys9, a histone modification associated with transcriptionally inactive chromatin). We found that overexpression of ΔFosB for 2 weeks resulted in no changes in binding of acetylated H3 at any of the gene promoters studied (Table 1). We did find a significant decrease in the binding of methylated histone H3 at the prodynorphin promoter, but no binding at the Cck promoter and no change in binding at the CDK5 and BDNF promoters, suggesting that this is not a general mechanism by which ΔFosB, in the short-term, regulates gene expression. We were surprised and interested in the fact that we found no differences in our ChIP assays that could account for the increase in Cck mRNA expression in the 11A mice following 2 weeks of ΔFosB expression and decided to investigate this mechanism further.

Short-termΔFosB increases Cck expression in multiple systems

Microarray characterization of bi-transgenic 11A mice overexpressing ΔFosB in the striatum found that Cck expression levels increase following 2 weeks of overexpression and then gradually decrease with longer periods of ΔFosB expression (Figure 2A, n=3). We validated this effect for Cck using real time PCR on a separate group of animals at 2 and 8 weeks and found results at the two time points to be similar to the microarray analysis (data not shown).

Figure 2

Figure 2

Short-term overexpression of ΔFosB increases Cck gene expression. (A) Cck mRNA expression in striatum following ΔFosB overexpression in 11A mice for 1, 2, 4, or 8 weeks. Microarray analysis was performed on striatal samples and Cck levels …

To further investigate the ability of ΔFosB to regulate Cck expression, we used PC12 cells transiently transfected with a Cck-luciferase reporter plasmid and either a ΔFosB expression plasmid or an equal amount of pCDNA. Both two (n=5-9) and three (n=11-13) days of ΔFosB overexpression resulted in a significant increase in Cck-luciferase expression. Additionally, three days of ΔFosB overexpression resulted in significantly more Cck-luciferase induction when compared to two days of overexpression (Figure 2B). Overexpression of ΔFosB did not induce expression of a promoterless luciferase construct (data not shown). Under no treatment conditions was a reduction in Cck-luciferase activity apparent. These results show that short-term ΔFosB expression increases activity of the Cck promoter, and leaves unanswered the mechanism by which long-term ΔFosB overexpression suppresses Cck expression.

ΔFosB overexpression increases binding at a putative CREB binding site in the Cck promoter

Our analyses found that Cck expression is increased following short-term ΔFosB expression, however, our ChIP assays found that neither CREB nor ΔFosB bind to the Cck promoter. To determine whether there are any changes in protein binding at the Cck promoter following ΔFosB overexpression, we used electrophoretic mobility shift assays (EMSA) with a probe containing the putative CRE-like site present within the Cck promoter. Using nuclear extracts from striata of 11A mice overexpressing ΔFosB for 2 weeks, we found an increase in binding to the putative CRE site in the Cck promoter (Figure 3 A,C, n=4). Interestingly, 11A mice overexpressing ΔFosB for 8 weeks, which show a decrease in Cck expression, also showed increased binding at this site (Figure 3B,C, n=4). As a comparison, we examined binding to a consensus CRE site in mice overexpressing ΔFosB for 2 weeks and found robust CRE binding in striatal extracts, but no increase in binding following ΔFosB induction (Figure 3F, n=4). Thus, despite a ΔFosB-induced increase in total CREB levels seen at this time point, these results are in line with our ChIP assays which find that increased CREB binding at promoters following ΔFosB overexpression is specific to only certain genes and is not a global phenomenon. To determine if CREB is bound to the Cck promoter in our EMSA analysis, we performed supershift assays with a CREB specific antibody. In agreement with our ChIP assays, we did not find any binding of CREB to a Cck probe containing the putative CRE site in EMSA assays, while CREB did significantly bind and supershift a consensus CRE site (Figure 3D,E, n=4). The DNA binding activity at the Cck promoter was also not affected by an antibody to ΔFosB (data not shown), under conditions shown in several prior studies to block ΔFosB binding to bona fide AP-1 sites (Hope et al., 1994a, 1994b; Chen et al., 1995, Hiroi et al., 1998). We also performed ChIP assays on striata of 11A animals following 8 weeks of ΔFosB expression and still find no binding of CREB or ΔFosB at the Cck promoter (data not shown). Thus, ΔFosB expression does lead to an increase in protein binding at the Cck promoter after both 2 and 8 weeks of expression; however, the identity of these factors remains unknown.

Figure 3

Figure 3

Protein binding at the Cck promoter. (A, B) Electrophoretic mobility shift assay using the Cck CRE-like site with striatal tissue from animals overexpressing ΔFosB for 2 weeks (A) or 8 weeks (B). In (A), competition with excess unlabeled competitor …

The putative CRE site in the Cck promoter is not responsible for increased promoter activity

Since we did find an increase in protein binding using a fragment of the Cck promoter, which contains the putative CRE site, following ΔFosB overexpression, we wanted to determine if this site is necessary for increased Cck expression following ΔFosB overexpression. To test this possibility, we transfected PC12 cells with a Cck-luciferase plasmid containing its intact CRE-like site or one containing a mutation in the site that would abolish any interaction with CREB. Interestingly, mutation of the CRE-like site decreased basal Cck promoter activity by 32% (Figure 4A, n=9), but did not affect the Cck promoter’s induction by ΔFosB overexpression (Figure 4B, n=11-13). This suggests that, although the Cck promoter requires an intact CRE-like site for full basal activity, the increased promoter activity induced by ΔFosB overexpression does not require the CRE-like sequence.

Figure 4

Figure 4

The Cck-like CRE site is not necessary for Cck induction by ΔFosB. (A) Cck-luciferase activity was measured 2 days after transfection with either normal Cck-luciferase or one in which the CRE-like site was mutated. * p<0.05 (B) Cck-luciferase …

cFos binds to the Cck promoter

Previous studies have found that cFos mRNA increases with short-term ΔFosB expression, however, after prolonged ΔFosB expression, the ability of cocaine treatment to induce cFos in striatum is reduced (McClung and Nestler, 2003; Renthal et al., 2008). Therefore, it might be possible that cFos contributes to the increase in Cck expression following short-term ΔFosB expression. We performed ChIP assays with an antibody specific for cFos and measured cFos binding at the Cck promoter with and without short-term ΔFosB expression. While we found that cFos does bind to the Cck promoter, this binding did not significantly increase following ΔFosB overexpression (Figure 5, n=5). This suggests that since cFos binds the Cck promoter, it may contribute to the general regulation of Cck expression, but it is likely not involved in the regulation of the Cck promoter by ΔFosB.

Figure 5

Figure 5

cFos binds to the Cck promoter. Chromatin immunoprecipitation assays were performed with a specific antibody for cFos using striatal tissue from ΔFosB overexpressing mice either on dox, or after 2 weeks of dox removal. Real time PCR analysis was …

Go to:

DISCUSSION

This study confirms and expands upon previous findings showing that ΔFosB regulates gene expression in the striatum and we find that it does so through multiple mechanisms after short-term expression. We show that, after 2 weeks of overexpression, ΔFosB binds directly to the promoters in certain genes leading to changes in expression (i.e. CDK5). Furthermore, it increases CREB protein levels, an effect observed in cultured cells as well as in striatum, leading to increased CREB binding at other gene promoters (i.e. dynorphin and BDNF). In a previous study, we found that short-term overexpression of ΔFosB in striatum leads to many of the same gene expression changes that are found when CREB is overexpressed, and leads to similar behavioral responses in measures of cocaine preference (McClung and Nestler, 2003). Thus, the present finding that ΔFosB leads to an induction of CREB, as well as binding of CREB to certain gene promoters, helps to explain why so many of the gene expression changes were shared by these two transcription factors.

The induction of CREB by ΔFosB is interesting, since it has been shown that drugs of abuse induce changes in serine 133-phosphorylated CREB levels (Mattson et al., 2005) and increase CRE-mediated transcription (Barrot et al., 2002; Shaw-Lutchman et al., 2002, 2003), without altering overall levels of CREB. It is possible that changes in CREB levels may be transient, and, therefore, easily missed in other studies. In our hands, we have seen cocaine-induced increases in CREB mRNA in particular experiments, however, this effect is highly variable (unpublished observation). Since both the 11A transgenic mice and PC-12 cells show CREB induction following short-term ΔFosB overexpression, this suggests that CREB is indeed induced by ΔFosB (or a target of ΔFosB), providing yet another mechanism to explain drug-induced changes in gene expression.

Surprisingly, we found that neither CREB nor ΔFosB bind to the Cck promoter even though Cck expression is clearly upregulated following short-term ΔFosB expression. Cck is an abundant neuropeptide expressed in both the VTA and NAc (Hokfelt et al., 1980) and is likely involved in behavioral responses to drugs of abuse (Josselyn et al., 1996; Josselyn et al., 1997; Hamilton, et al., 2000; Beinfeld et al., 2002; Rotzinger et al., 2002). In cell culture assays, the Cck promoter has been extensively characterized and been shown to be responsive to CREB and AP-1 family members (reviewed by Hansen, 2001). Haun and Dixon (1990) showed that AP-1 complexes can bind to the Cck CRE-like site in vitro, and it was later shown, using SK-N-MC neuroblastoma cells, that mutation of the CRE-like site reduced promoter responsiveness to overexpressed cFos/cJun (Rourke et al., 1999). Indeed, we also find increased Cck promoter activity (Figure 2) and binding at or around the CRE-like element (Figure 3) upon overexpression of ΔFosB, another AP-1 family member, but we find no direct binding of ΔFosB to the Cck promoter in vivo or in vitro, even upon its overexpression.

Much work has demonstrated a role for CREB in the regulation of Cck promoter activity. The Cck CRE-like site is conserved across vertebrates (Hansen, 2001) and, in some cell culture assays, both CREB and AP-1 complexes bind to this site and are necessary for Cck promoter activity (Haun and Dixon, 1990; Deavall, et al., 2000; Hansen, 2001). Additionally, several known activators of Cck expression (including bFGF, PACAP, peptones, and depolarization) have been shown to act via CREB (Hansen, et al., 1999; Deavall, et al, 2000; Bernard, et al., 2001; Gevrey, et al., 2002; Hansen, et al., 2004). Our Cck-luciferase reporter gene data support an essential role for the CRE-like site in regulation of Cck promoter activity, since mutation of this site reduces basal Cck promoter activity and Cck-luciferase expression induced by VP16-CREB, a constitutively active form of CREB, is lost when this site is mutated (unpublished observation). Thus, we were surprised to find that CREB does not appear to bind to the Cck promoter in striatal extracts either at baseline or upon short-term ΔFosB overexpression when CREB levels are increased. This argues that levels of CREB per se are not the sole factor in determining the amount of binding at this site, and this is supported by the work of others (Cha-Molstad, et al., 2004). Since the promoters of other, previously identified CREB target genes, such as BDNF and prodynorphin, did bind CREB, we are confident in our finding that CREB is not binding to the Cck promoter in striatal nuclear extracts. Furthermore, the induction of Cck-luciferase activity by ΔFosB was not dependent on the intact CRE-like site, suggesting that ΔFosB does not regulate Cck expression by regulating the direct binding of CREB to the Cck promoter.

Our inability to detect CREB interacting with the Cck promoter is supported by Renthal et al. (2009), who used a ChIP-chip approach to look at global changes in phosphorylated CREB (pCREB) and ΔFosB binding in striatum after chronic cocaine exposure. In these experiments, DNA-protein complexes were immunoprecipitated with ΔFosB or pCREB antibodies and the precipitated DNA, after labeling, was hybridized to a promoter microarray. While many previously characterized CREB target genes were identified with this approach (e.g., BDNF, prodynorphin), Cck was not identified. In addition, it has been demonstrated that the binding of CREB to a consensus CRE site varies greatly between cultured cell lines (Cha-Molstad, et al., 2004). All of the previous studies that found CREB interactions with the Cck promoter were carried out in cell culture (not brain from which our EMSA and ChIP samples were derived) and used gel shift assays to investigate protein-DNA interactions. While an EMSA can assess the potential of a factor to bind to a DNA sequence, ChIP assays provide a novel look at these interactions in vivo. Furthermore, much of the data demonstrating either induction of Cck promoter activity or CREB binding to the Cck promoter were obtained from cells that had been stimulated by factors such as peptones (Bernard et al., 2001), depolarization (Hansen, et al., 2004), or a variety of activators of intracellular signaling cascades including cAMP and ERK (Hansen et al., 1999). In our experiments, the only “stimulus” used was the overexpression of ΔFosB, which is sufficient to induce Cck expression. Taken together, this suggests that the ability of CREB to bind to (and potentially regulate) the Cck promoter is highly dependent upon the cell type and activation of particular signaling pathways. Additionally, the Cck CRE-like promoter element (at least in uninduced PC12 cells and in mouse striatum) is not a direct target of either CREB or ΔFosB. Interestingly, the regulation of FosB expression by CREB is also specific to cell type and the type of stimulation. A study by Andersson et al. found that injection of CREB antisense oligonucleotides into mouse striatum partially inhibited the induction of FosB following cocaine administration (Andersson et al., 2001). However, they also found that the ability of L-Dopa to induce FosB expression in 6-OHDA-lesioned striatum was not influenced by the presence of CREB antisense oligonucleotides.

Since CREB and ΔFosB seem to indirectly regulate the Cck promoter, and changes in chromatin structure have been documented in response to a variety of stimuli that induce ΔFosB (Tsankova et al., 2004; Kumar et al., 2005; Renthal et al., 2008), we reasoned that ΔFosB might indirectly modulate promoter activity by altering chromatin structure. However, in mice overexpressing ΔFosB for 2 weeks, there was no change in histone H3 acetylation at the Cck promoter (Table 1). This is supported by the ChIP-chip data of Renthal et al. (2009), who reported no change in acetylated H3 binding at the Cck promoter in mice exposed to chronic cocaine. Since the Cck promoter is active in the striatum, no repressive methylated histone H3 binding was expected or observed. Interestingly, we also saw no change due to ΔFosB overexpression in acetylated H3 binding at the BDNF promoter (which did show increased CREB binding) or at the CDK5 and prodynorphin promoters (which showed increased ΔFosB binding). Since there are a myriad of histone modifications associated with changes in promoter activity (reviewed by Rando and Chang, 2009), there are likely other chromatin modifications that associate with induction of these genes. Any single chromatin modification, though often predictive of the level of promoter activity, may not change during the activation of a particular gene. In future work, it would be interesting to look at other potential changes in chromatin structure around the Cck promoter following ΔFosB overexpression. Interestingly, chronic cocaine (likely via ΔFosB induction) has been shown to induce expression of sirtuin 1 and 2, class III histone deacetylases which appear to alter neuronal physiology, ERK signaling, and behavioral responses to cocaine (Renthal et al., 2009). Induction of a histone deacetylase would have the ability to simultaneously regulate the expression of a large number of genes via global changes in chromatin structure.

One possible candidate involved in Cck regulation following ΔFosB overexpression was the AP-1 family member cFos. Expression of cFos is regulated by CREB (Sheng et al., 1990; Impey et al., 2004), and cFos overexpression (concordant with overexpression of its binding partner cJun) increases Cck promoter activity (Rourke et al., 1999). Therefore, increased CREB levels due to short-term ΔFosB overexpression could increase cFos levels and result in increased binding to the Cck CRE-like site. cfos mRNA is induced in mice following two weeks of ΔFosB overexpression (McClung and Nestler, 2003) and decreased in mice exposed to chronic cocaine or long-term ΔFosB overexpression (Renthal et al., 2008). Here we find that cFos binds directly to the Cck promoter in striatal tissue, however, ΔFosB overexpression does not significantly increase binding. This suggests that while cFos could be involved regulating Cck expression in general, a change in binding of cFos alone is not likely the mechanism by which ΔFosB regulates Cck expression. It is possible, however, that ΔFosB may induce either, post-translational changes in cFos (e.g. altered phosphorylation) or induce the expression of a binding partner (such as cJun) or co-activator protein. However, since the intact CRE-like site (which has previously been shown to be a binding site for AP-1 complexes, see Haun and Dixon, 1990) is not required for the increased Cck promoter activity seen with ΔFosB overexpression (as assessed in our reporter gene experiments), it stands to reason that other trans-acting factors are also regulated by ΔFosB.

The Cck promoter fragment used in our luciferase reporter gene experiments contains a conserved Sp1 binding site and an E-box (reviewed by Hansen, 2002). In particular, E-box sequences have been shown to bind numerous transcription factors (reviewed by Forrest and McNamara, 2004). Using PC12 cells, we have seen that mutation of the E-box decreases Cck promoter activity, but does not alter the response of the promoter to ΔFosB (data not shown). Interestingly, a Cck-luciferase reporter containing mutations in both the CRE site and E-box has no detectable basal activity and is unresponsive to ΔFosB overexpression (unpublished observation). Another potential mediator of ΔFosB action on the Cck promoter are ATFs, certain forms of which are known to be induced in striatum by chronic psychostimulant exposure (Green et al., 2008). However, we have found no evidence for ΔFosB induction of these ATFs (data not shown), and ATFs would not be expected to bind to the mutated CRE-like site on the Cck promoter.

One caveat of this study is that we are using a bi-transgenic system to overexpress ΔFosB and thus one must be conservative in drawing parallels between this paradigm and administration of chronic cocaine. However, the 11A transgenic mice do afford the unique opportunity to look at the specific effects of ΔFosB in the striatum, since overexpression is limited to this brain region (Chen et al., 1998), while administration of cocaine induces changes in a wide variety of other brain regions that may then indirectly affect the striatum. Furthermore, several studies have documented similar behavioral and molecular phenotypes in the 11A mice when compared to non-transgenic animals treated with chronic cocaine (Kelz et al., 1999; McClung and Nestler, 2003; Renthal et al., 2009). Additionally, Bibb et al. (2001) reported similar levels of striatal Cdk5 mRNA and protein induction in this same 11A strain when compared to cocaine-treated, non-transgenic littermates, as well as similar changes in the CDK5 targets, p35 and DARPP-32.

In conclusion, we find that short-term ΔFosB expression leads to the induction of genes in the striatum through multiple mechanisms. These include direct promoter binding, induction of CREB protein and activity, chromatin modification, in addition to pathways yet to be determined.

Go to:

EXPERIMENTAL PROCEDURES

Animals

Male bi-transgenic 11A animals (NSE-tTA x TetOP-ΔFosB) were used in this study and are characterized in Kelz et al., 1999. To overexpress ΔFosB, mice were removed from doxycycline between 3 and 6 weeks of age, while control mice were maintained on doxycycline. All mice were group housed and maintained on a 12:12 light/dark cycle, lights on at 7 am and lights off at 7 pm, with ad lib access to food and water. All mouse experiments were in compliance with protocols approved by the animal care and use committee of The University of Texas Southwestern Medical Center at Dallas.

Reporter and expression plasmids

The wildtype (WT) Cck promoter-luciferase reporter was prepared by inserting an approximately 200 bp PCR fragment into the pGL3-luc vector (Promega). This fragment was obtained from mouse genomic DNA (primers: 5’ TATCCTCATTCACTGGGACGC 3’ upstream, and 5’ TACCTTTGGATGGGGAAATCG 3’ downstream) and initially inserted into pGEM-T Easy vector (Promega, #A1360). The promoter fragment was then cloned into the Kpn1/Xho1 restriction enzyme sites of pGL3-luc.

To create the CRE point mutation in the Cck promoter, a mutagenic primer directed against a previously reported CRE-like site (sense primer: 5’CGTGTCCTGCTGGACTGAGCTCGCACTGGGTAAACA 3’, antisense primer: 5’CTGTTTACCCAGTGCGCGCTGAGTCCAGCAGGACACG 3’) was used in combination with the Stratagene Quik Change II mutagenesis kit (per manufacture’s instruction). This converts the reported CRE-like site (ACTGCGTCAGC) to ACTGAGCTCC. All reporter plasmids were confirmed by DNA sequencing. The ΔFosB expression plasmid contains a full-length ΔFosB sequence inserted into the multiple cloning site of pCDNA 3.1 and has been described previously (Ulery and Nestler, 2007).

Cell culture and DNA transfections

Rat pheochromocytoma (PC12) cells were maintained in Dulbecco’s modified Eagle’s medium F-12, supplemented with 10% horse serum, 5% fetal bovine serum, and 1% penicillin/streptomycin at 37°C and 5% CO2. Cells were transfected by electroporation using a BTX 360 electroporator (350V, 0 ohms, and 850 μF) in 800 μL Dulbecco’s phosphate buffered saline in 4 mm gap cuvettes with 10 μg of the reporter and 5 μg of the expression construct. Empty vector plasmid (pCDNA) was used to normalize total amounts of DNA. After transfection, the cells were grown on 35 mm collagen-coated dishes for the indicated amounts of time.

Luciferase assays

Two or three days after transfection, cells were washed 3 times in Dulbecco’s phosphate buffered saline, lysed (using 25 mM glycylglycine, 15 mM MgSO4, 4 mM EGTA, 1% Triton X-100, pH 7.8, 1 mM DTT), collected, and cleared via centrifugation. 30 μL of lysate was combined with 140 μL luciferase assay buffer (25 mM glycylglycine, 15 mM MgSO4, 4 mM EGTA, 1 mM DTT, 1 mM ATP, 1 mM potassium phosphate, 1 mM coenzyme A, pH 7.8). Luminescence activity was measured using an FLx-800 microplate fluorescence reader after an automated injection of 40 μL 1 mM luciferin per well. Luciferase activity was normalized to total protein content as determined by a BioRad protein assay.

Electrophoretic mobility shift assay

Nuclear extracts from bilateral slices of striatum from bi-transgenic 11A mice (that where maintained on or off doxycycline for 2 or 8 weeks) (McClung and Nestler, 2003) were prepared according to Huang and Walters (1996). 32P-labeled double-stranded oligonucleotide probes were prepared using the Promega Gel Shift Assay system protocol (#E3300) and probes were purified using Roche Quick Spin Columns. The consensus CRE and AP-1 probe sequences were from Promega (#E328A and E320B, respectively) and the Cck CRE sequences were (Cck-CRE sense: CTAGCGAGCTCTGGACTGCGTCAGCACTGGGTGCA; Cck-CRE antisense: CCCAGTGCTGACGCAGTCCAGAGCTCGCTAGCTTT).

Binding reactions and electrophoresis were performed using modifications of the Promega Gel Shift Assay system procedure (#E3300). 50,000 CPM of labeled probe was combined with 10 μg striatal nuclear extract. Cold competitor DNA or antibodies were added prior to introduction of the radiolabeled probes. For supershift experiments, 2 μg of CREB antibody (Upstate Biotechnology #06-083) was used. Reactions were electrophoresed on 4% polyacrylamide gels, dried, and exposed to film (using intensifying screens for 1 hour to 2 days).

Immunoblotting

For PC12 cells, 35 mm plates of transfected cells were washed in ice cold Dulbecco’s phosphate-buffered saline and lysates were prepared in ice cold RIPA lysis buffer (50 mM Tris pH 7.4, 5 mM NaCl, 5 mM EDTA, 1% deoxycholate, 1% Triton X-100, 0.1% sodium dodecyl sulfate) containing protease inhibitors. After sonication, clearing, and Bradford protein assay, lysates were fully denatured and 50 μg of each sample was electrophoresed on 10% SDS polyacrylamide gels. Proteins were transferred to PVDF membrane, blocked for 1 hour in 3% non-fat dry milk in Tris-buffered saline containing 0.1% Tween-20 (TBS-T milk), and probed overnight at 4°C with primary antibodies (CREB-Upstate Biotechnology #06-083, used at 1:1,000; GAPDH- Sigma #G8795, used at 1:80,000) diluted in TBS-T milk. After multiple washes in TBS-T, blots were probed for one hour at room temperature using alkaline phosphatase-conjugated secondary antibodies (Sigma) diluted 1:5,000 in TBS-T milk. After multiple washes in Tris-buffered saline, the color reaction was performed according the BioRad (#170-6432) instructions. Membranes were dried overnight, scanned on a flatbed scanner and densitometry performed using ImageJ (see below).

For striatal extracts, Western blot assays were carried out as published previously (Hope et al., 1994). Tissue was removed from decapitated mice, placed on ice and sectioned on a brain matrix at a thickness of 1 mm. Tissue punches were then taken and frozen at -80°C until used. Tissue was sonicated on ice in a modified detergent based buffer containing both phosphatase and protease inhibitors (Roche, Sigma). After sonication, samples were denatured in boiling water and centrifuged at 15,000xg for 15 minutes; supernatant was subsequently collected and processed; protein concentration amounts were then quantified using a Bradford assay (Bio-Rad). Samples were run on a 10% acrylamide/bisacrylamide gel, transferred to a PVDF membrane, blocked in 5% milk and incubated with primary antibodies (Anti-CREB, Upstate, Lake Placid, NY). Blots were subsequently visualized using a chemiluminescence system (Pierce). All samples were normalized to GAPDH (Fitzgerald, Concord, MA). Standard curves were run to ensure that we are in the linear range of the assay.

Densitometry analysis

For PC12 immunoblots, densitometry analysis was performed using ImageJ with rodbard calibration. Average background signal was subtracted from each measurement and the ratio of CREB to GAPDH signal was calculated for each sample. For striatal immunoblots and EMSA analysis, Scion Image 1.62c was used with background subtraction.

Chromatin immunoprecipitation (ChIP)

ChIP assays were performed according to the methods of Tsankova et al. (2004) and Kumar et al. (2005). Briefly, bilateral striatal samples from 11A mice maintained on or off doxycycline were crosslinked with 1% formaldehyde and crosslinking was quenched with glycine (final concentration of 0.125 M). These samples were from entire brain slices taken at the level of the nucleus accumbens with the cortex removed. Chromatin was sheared to approximately 0.2 to 1 kb fragments via sonication, cleared with Protein G beads (Thermo Scientific #22852), and input samples frozen at -80°C. Between 60 and 100 μg of chromatin was used for each precipitation. 5-10 μg of each primary antibody was used (CREB: Upstate Biotechnology #06-863, ΔFosB: Santa Cruz Biotechnology #SC-48x, acetylated H3: Upstate Biotechnology #06-599, methylated H3 (LYS9): Cell Signaling Technology, cFos: Santa Cruz Biotechnology #SC-7202x). Antibody-chromatin complexes were immunoprecipitated with Protein G plus beads according to manufacture’s instructions (Thermo Scientific #22852). Following reverse crosslinking of input and precipitated samples, each sample was subjected to quantitative PCR (qPCR). The use of all of these antibodies for ChIP has been extensively validated (Tsankova et al., 2004; Kumar et al., 2005; Renthal et al., 2009).

Levels of protein binding at each gene promoter of interest were determined by measuring the amount of associated DNA by qPCR (Applied Biosystems (ABI) Prism 7700, Foster City, CA). Input or total DNA (nonimmunoprecipitated) and immunoprecipitated DNA were amplified in triplicate in the presence of SYBR Green (Applied Biosystems, CA). Ct values from each sample were obtained using the Sequence Detector 1.1 software. Relative quantification of template DNA was performed using the ΔΔCt method (Tsankova et al., 2004). Primers used: BDNF promoter 4: CTTCTGTGTGCGTGAATTTGCT; AGTCCACGAGAGGGCTCCA CDK5 promoter: GCTGAAGCTGTCAGGAGGTC; GTGCCCCGCTCTTGTTATTA Cck promoter: CTTGGGCTAGCCTCATTCACTG; TTAAATAGCTCCTCCCGGTTCG Prodynorphin promoter: GGCTTCCTTGTGCTTCAGAC; GCGCTGTTTGTCACTTTCAA.

Statistical analysis

All data are presented as means ± standard error of the mean. Statistical difference was determined by Student’s two tailed t-test (p<0.05). When multiple comparisons were made, p-values were adjusted using Bonferroni correction.

Go to:

Acknowledgements

We would like to thank Will Renthal and Arvind Kumar for helpful discussions. We would also like to thank NIDA for funding these experiments.

Go to:

Footnotes

Publisher’s Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Classification terms:

Section: #1 Cellular and Molecular Biology of Nervous systems

Go to:

References

  1. Andersson M, Konradi C, Cenci MA. cAMP response element-binding protein is required for dopamine-dependent gene expression in the intact but not the dopamine-denervated striatum. J Neurosci. 2001;21:9930–43. [PubMed]
  2. Barrot M, Olivier JD, Perrotti LI, DiLeone RJ, Berton O, Eisch AJ, Impey S, Storm DR, Neve RL, Yin JC, Zachariou V, Nestler EJ. CREB activity in the nucleus accumbens shell controls gating of behavioral responses to emotional stimuli. Proc Natl Acad Sci U S A. 2002;99:11435–40. [PMC free article] [PubMed]
  3. Beinfeld MC, Connolly KJ, Pierce RC. Cocaine treatment increases extracellular cholecystokinin (CCK) in the nucleus accumbens shell of awake, freely moving rats, an effect that is enhanced in rats that are behaviorally sensitized to cocaine. J Neurochem. 2002;81:1021–7. [PubMed]
  4. Bernard C, Sutter A, Vinson C, Ratineau C, Chayvialle J, Cordier-Bussat M. Peptones stimulate intestinal cholecystokinin gene transcription via cyclic adenosine monophosphate response element-binding factors. Endocrinology. 2001;142:721–9. [PubMed]
  5. Bibb JA, Chen J, Taylor JR, Svenningsson P, Nishi A, Snyder GL, Yan Z, Sagawa ZK, Ouimet CC, Nairn AC, Nestler EJ, Greengard P. Effects of chronic exposure to cocaine are regulated by the neuronal protein Cdk5. Nature. 2001;410:376–80. [PubMed]
  6. Cha-Molstad H, Keller DM, Yochum GS, Impey S, Goodman RH. Cell-type-specific binding of the transcription factor CREB to the cAMP-response element. Proc Natl Acad Sci U S A. 2004;101:13572–7. [PMC free article] [PubMed]
  7. Chen J, Nye HE, Kelz MB, Hiroi N, Nakabeppu Y, Hope BT, Nestler EJ. Regulation of delta FosB and FosB-like proteins by electroconvulsive seizure and cocaine treatments. Mol Pharmacol. 1995;48:880–9. [PubMed]
  8. Chen J, Kelz MB, Zeng G, Sakai N, Steffen C, Shockett PE, Picciotto MR, Duman RS, Nestler EJ. Transgenic animals with inducible, targeted gene expression in brain. Mol Pharmacol. 1998;54:495–503. [PubMed]
  9. Chen J, Zhang Y, Kelz MB, Steffen C, Ang ES, Zeng L, Nestler EJ. Induction of cyclin-dependent kinase 5 in the hippocampus by chronic electroconvulsive seizures: role of ΔFosB. J Neurosci. 2000;20:8965–71. [PubMed]
  10. Chinenov Y, Kerppola TK. Close encounters of many kinds: Fos-Jun interactions that mediate transcription regulatory specificity. Oncogene. 2001;20:2438–52. [PubMed]
  11. Cole RL, Konradi C, Douglass J, Hyman SE. Neuronal adaptation to amphetamine and dopamine: molecular mechanisms of prodynorphin gene regulation in rat striatum. Neuron. 1995;14:813–23. [PubMed]
  12. Deavall DG, Raychowdhury R, Dockray GJ, Dimaline R. Control of CCK gene transcription by PACAP in STC-1 cells. Am J Physiol Gastrointest Liver Physiol. 2000;279:G605–12. [PubMed]
  13. Ding XZ, Mocchetti I. Dopaminergic regulation of cholecystokinin mRNA content in rat striatum. Brain Res Mol Brain Res. 1992;12:77–83. [PubMed]
  14. Forrest S, McNamara C. Id family of transcription factors and vascular lesion formation. Arterioscler Thromb Vasc Biol. 2004;24:2014–20. [PubMed]
  15. Gevrey JC, Cordier-Bussat M, Némoz-Gaillard E, Chayvialle JA, Abello J. Co-requirement of cyclic AMP- and calcium-dependent protein kinases for transcriptional activation of cholecystokinin gene by protein hydrolysates. J Biol Chem. 2002;277:22407–13. [PubMed]
  16. Green TA, Alibhai IN, Unterberg S, Neve RL, Ghose S, Tamminga CA, Nestler EJ. Induction of activating transcription factors (ATFs) ATF2, ATF3, and ATF4 in the nucleus accumbens and their regulation of emotional behavior. J Neurosci. 2008;28:2025–32. [PubMed]
  17. Hamilton ME, Redondo JL, Freeman AS. Overflow of dopamine and cholecystokinin in rat nucleus accumbens in response to acute drug administration. Synapse. 2000;38:238–42. [PubMed]
  18. Hansen TV, Rehfeld JF, Nielsen FC. Mitogen-activated protein kinase and protein kinase A signaling pathways stimulate cholecystokinin transcription via activation of cyclic adenosine 3′,5′-monophosphate response element-binding protein. Mol Endocrinol. 1999;13:466–75. [PubMed]
  19. Hansen TV, Nielsen FC. Regulation of neuronal cholecystokinin gene transcription. Scand J Clin Lab Invest Suppl. 2001;234:61–7. [PubMed]
  20. Hansen TV. Cholecystokinin gene transcription: promoter elements, transcription factors and signaling pathways. Peptides. 2001;22:1201–11. [PubMed]
  21. Hansen TV, Rehfeld JF, Nielsen FC. KCl and forskolin synergistically up-regulate cholecystokinin gene expression via coordinate activation of CREB and the co-activator CBP. J Neurochem. 2004;89:15–23. [PubMed]
  22. Haun RS, Dixon JE. A transcriptional enhancer essential for the expression of the rat cholecystokinin gene contains a sequence identical to the -296 element of the human c-fos gene. J Biol Chem. 1990;265:15455–63. [PubMed]
  23. Hiroi N, Marek GJ, Brown JR, Ye H, Saudou F, Vaidya VA, Duman RS, Greenberg ME, Nestler EJ. Essential role of the fosB gene in molecular, cellular, and behavioral actions of chronic electroconvulsive seizures. J Neurosci 1998. 1998;18:6952–62. [PubMed]
  24. Hokfelt T, Rehfeld JF, Skirboll L, Ivemark B, Goldstein M, Markey K. Evidence for coexistence of dopamine and CCK in meso-limbic neurones. Nature. 1980;285:476–8. [PubMed]
  25. Hope BT, Kelz MB, Duman RS, Nestler EJ. Chronic electroconvulsive seizure (ECS) treatment results in expression of a long-lasting AP-1 complex in brain with altered composition and characteristics. J Neurosci. 1994;14:4318–28. [PubMed]
  26. Hope BT, Nye HE, Kelz MB, Self DW, Iadarola MJ, Nakabeppu Y, Duman RS, Nestler EJ. Induction of a long-lasting AP-1 complex composed of altered Fos-like proteins in brain by chronic cocaine and other chronic treatments. Neuron. 1994;13:1235–44. [PubMed]
  27. Huang KX, Walters JR. Dopaminergic regulation of AP-1 transcription factor DNA binding activity in rat striatum. Neuroscience. 1996;75:757–75. [PubMed]
  28. Impey S, McCorkle SR, Cha-Molstad H, Dwyer JM, Yochum GS, Boss JM, McWeeney S, Dunn JJ, Mandel G, Goodman RH. Defining the CREB regulon: a genome-wide analysis of transcription factor regulatory regions. Cell. 2004;119:1041–54. [PubMed]
  29. Johannessen M, Delghandi MP, Moens U. What turns CREB on? Cell Signal. 2004;16:1211–27. [PubMed]
  30. Josselyn SA, Vaccarino FJ. Opposing effects of CCK(A) and CCK(B) antagonists on the development of conditioned activity in rats. Behav Pharmacol. 1996;7:505–512. [PubMed]
  31. Josselyn SA, De Cristofaro A, Vaccarino FJ. Evidence for CCK(A) receptor involvement in the acquisition of conditioned activity produced by cocaine in rats. Brain Res. 1997;763:93–102. [PubMed]
  32. Kelz MB, Chen J, Carlezon WA, Jr., Whisler K, Gilden L, Beckmann AM, Steffen C, Zhang YJ, Marotti L, Self DW, Tkatch T, Baranauskas G, Surmeier DJ, Neve RL, Duman RS, Picciotto MR, Nestler EJ. Expression of the transcription factor deltaFosB in the brain controls sensitivity to cocaine. Nature. 1999;401:272–6. [PubMed]
  33. Kumar A, Choi KH, Renthal W, Tsankova NM, Theobald DE, Truong HT, Russo SJ, Laplant Q, Sasaki TS, Whistler KN, Neve RL, Self DW, Nestler EJ. Chromatin remodeling is a key mechanism underlying cocaine-induced plasticity in striatum. Neuron. 2005;48:303–14. [PubMed]
  34. Mattson BJ, Bossert JM, Simmons DE, Nozaki N, Nagarkar D, Kreuter JD, Hope BT. Cocaine-induced CREB phosphorylation in nucleus accumbens of cocaine-sensitized rats is enabled by enhanced activation of extracellular signal-related kinase, but not protein kinase A. J Neurochem. 2005;95:1481–94. [PubMed]
  35. McClung CA, Nestler EJ. Regulation of gene expression and cocaine reward by CREB and DeltaFosB. Nat Neurosci. 2003;6:1208–15. [PubMed]
  36. McClung CA, Ulery PG, Perrotti LI, Zachariou V, Berton O, Nestler EJ. DeltaFosB: a molecular switch for long-term adaptation in the brain. Brain Res Mol Brain Res. 2004;132:146–54. [PubMed]
  37. Nestler EJ, Kelz MB, Chen JS. ΔFosB: A molecular mediator of long-term neural and behavioral plasticity. Brain Res. 1999;835:10–17. [PubMed]
  38. Nestler EJ. Is there a common molecular pathway for addiction? Nat Neurosci. 2005;8:1445–9. [PubMed]
  39. Nestler EJ. Transcriptional mechanisms of addiction: role of DeltaFosB. Philos Trans R Soc Lond B Biol Sci. 2008;363:3245–55. [PMC free article] [PubMed]
  40. Perrotti LI, Weaver RR, Robison B, Renthal W, Maze I, Yazdani S, Elmore RG, Knapp DJ, Selley DE, Martin BR, Sim-Selley L, Bachtell RK, Self DW, Nestler EJ. Distinct patterns of DeltaFosB induction in brain by drugs of abuse. Synapse. 2008;62:358–69. [PMC free article] [PubMed]
  41. Rando OJ, Chang HY. Genome-wide views of chromatin structure. Annu Rev Biochem. 2009;78:245–71. [PMC free article] [PubMed]
  42. Renthal W, Carle TL, Maze I, Covington HE, 3rd., Truong HT, Alibhai I, Kumar A, Montgomery RL, Olson EN, Nestler EJ. Delta FosB mediates epigenetic desensitization of the c-fos gene after chronic amphetamine exposure. J Neurosci. 2008;28:7344–9. [PMC free article] [PubMed]
  43. Renthal W, Kumar A, Xiao G, Wilkinson M, Covington HE, 3rd, Maze I, Sikder D, Robison AJ, LaPlant Q, Dietz DM, Russo SJ, Vialou V, Chakravarty S, Kodadek TJ, Stack A, Kabbaj M, Nestler EJ. Genome-wide analysis of chromatin regulation by cocaine reveals a role for sirtuins. Neuron. 2009;62:335–48. [PMC free article] [PubMed]
  44. Rotzinger S, Bush DE, Vaccarino FJ. Cholecystokinin modulation of mesolimbic dopamine function: regulation of motivated behaviour. Pharmacol Toxicol. 2002;91:404–13. [PubMed]
  45. Rourke IJ, Hansen TV, Nerlov C, Rehfeld JF, Nielsen FC. Negative cooperativity between juxtaposed E-box and cAMP/TPA responsive elements in the cholecystokinin gene promoter. FEBS Lett. 1999;448:15–8. [PubMed]
  46. Shaw-Lutchman TZ, Barrot M, Wallace T, Gilden L, Zachariou V, Impey S, Duman RS, Storm D, Nestler EJ. Regional and cellular mapping of CRE-mediated transcription during naltrexone-precipitated morphine withdrawal. J Neurosci. 2002;22:3663–3672. [PubMed]
  47. Shaw-Lutchman TZ, Impey S, Storm D, Nestler EJ. Regulation of CRE-mediated transcription in mouse brain by amphetamine. Synapse. 2003;48:10–7. [PubMed]
  48. Sheng M, McFadden G, Greenberg ME. Membrane depolarization and calcium induce c-fos transcription via phosphorylation of transcription factor CREB. Neuron. 1990;4:571–82. [PubMed]
  49. Tsankova NM, Kumar A, Nestler EJ. Histone modifications at gene promoter regions in rat hippocampus after acute and chronic electroconvulsive seizures. J Neurosci. 2004;24:5603–10. [PubMed]
  50. Ulery PG, Nestler EJ. Regulation of DeltaFosB transcriptional activity by Ser27 phosphorylation. Eur J Neurosci. 2007;25:224–30. [PubMed]
  51. Vaccarino FJ. Nucleus accumbens dopamine-CCK interactions in psychostimulant reward and related behaviors. Neurosci Biobehav Rev. 1992;18:207–14. [PubMed]
  52. Zachariou V, Bolanos CA, Selley DE, Theobald D, Cassidy MP, Kelz MB, Shaw-Lutchmann T, Berton O, Sim-Selley LJ, DiLeone RJ, Kumar A, Nestler EJ. ΔFosB: An essential role for ΔFosB in the nucleus accumbens in morphine action. Nature Neurosci. 2006;9:205–11. [PubMed]