Front Behav Neurosci. 2014; 8: 297.
E phatlalalitsoe marang-rang Aug 29, 2014. Doi: 10.3389 / fnbeh.2014.00297
PMCID: PMC4148937
Yafang Zhang,1 Elisabeth J. Crofton,1 Dingge Li,1 Mary Kay Lobo,2 Xiuzhen Fan,1 Eric J. Nestler,3 'me Thomas A. Green1,*
inahaneloang
Keketso ea tikoloho e hlahisa litheko tse sireletsang le khatello ea maikutlo maemong a litoeba. ΔFosB ke ntho e hatisang e laolang moputso bokong 'me e susumetsoa ke khatello ea maikutlo le lithethefatsi tsa tlhekefetso. Leha ho le joalo, karolo e phethoang ke ΔFosB ho phenotypes ea ts'ireletso ea tikoloho ha e so ithutoe hantle. Mona, re bonts'a hore ΔFosB e laoloa ka mokhoa o fapaneng ho likhoto tse holisitsoeng boemong bo ikhethileng (IC) ha bo bapisoa le ba maemong a ruileng (EC) ho arabela khatello ea khatello kapa cocaine.
Matšoenyeho a sa foleng kapa kalafo ea koae e sa foleng e mong le e mong o phahamisa maemo a protheine ea ΔFosB ho li-ligus tsa nucleus (NAc) ea likhoto tsa IC, empa eseng ea likhoto tsa EC ka lebaka la ho bokelloa ha basele ea ΔFosB e seng e ntse e le tlasa maemo a EC.
Ho fetella ka bongata ha qoeliso ea inFosB mokokotlong oa NAc oa likhoto tse nang le matlo a mabeli (ke hore, ka boikemelo ba ho khothaletsa tikoloho / ho itšehla thajana) ho eketsa mohiruoa oa ho ikarabela ha a susumetsoa ke tlala, empa o fokotseha ho arabela ka liphoofolo tse khothatsang. Ho feta moo, ΔFosB e tebisa khatello ea kelello ea cocaine, e ntlafatsa ho fokotseha ha ho tsoma koae, hape e fokotsa ho khutlisetsoa ha k'hok'heine; liphumano tsohle tsa boits'oaro li tsamaisana le mofuta oa tlhahiso ea ntlafatso.
Ho fapana le hoo, ΔFosB overexpression ha e fetole likarabo tsa likhoto tse nang le ntlo e 'meli litekong tse' maloa tsa boits'oaro bo amanang le khatello ea maikutlo le khatello ea maikutlo.
Kahoo, ΔFosB ka har'a NAc shell mimics mofuta oa tšireletso o lematsang, empa eseng mokhoa o sireletsang maikutlo oa ho khothaletsa tikoloho.
Selelekela
Boiphihlelo ba bophelo, haholo-holo matsatsing a pele a bophelo, bo na le tšusumetso e matla boits'oarong ba liphoofolo bophelong bohle. Tikoloho e bapala karolo ea bohlokoa tlokotsing le ho hanyetsanong le mafu a kelello ho batho (Elisei et al., 2013; Akdeniz et al., 2014; Kato le Iwamoto, 2014; van Winkel et al., 2014). Litšoantšong tse majabajaba, ho phela tikolohong e ruileng ho tloha ho lema ho ba motho e moholo ho tlalehiloe hore ho hlahisa litheko tse sireletsang le khatello ea maikutlo (Green et al., 2002, 2003, 2010; Laviola et al., 2008; Solinas et al., 2008, 2009; El Rawas et al., 2009; Thiel et al., 2009, 2010). Paparong ena, liphoofolo li abeloa ho ba maemong a ruileng (EC) ao ho ona liphoofolo li arotsoeng ka sehlopha 'me li khona ho fumana lintho tsa morao-rao, kapa boemo bo ikhethileng ba hore liphoofolo li be le ntlo e le' ngoe ntle le ho ba bocha kapa ho ba le kamano e haufi le batho. Liphoofolo tse holisitsoeng boemong bo matlafalitsoeng, bo kenyelletsang ho ikamahanya le sechaba, ho ikoetlisa le ho ngola lintho tse ncha, li bonts'a ho matlafatsa le ho batla koae kapa amphetamine mokhatlong o ikemetseng oa taolo ea lithethefatsi (Green et al., 2002, 2010). Ntle le tšebeliso ea bokhoba ba ho lemalla, ho pepesetsoa leruo ho hlahisa litholoana tse ka felisang mefuta ea liphoofolo tsa khatello ea maikutlo. (Green et al., 2010; Jha et al., 2011). Ka ho khetheha, liphoofolo tse ruisitsoeng li bonts'a boitšoaro bo kang anhedonia tekong ea ho khetha ea sucrose, ho ikarola ha setjhaba tekong ea ts'ebelisano 'moho le ho se sebetse hantle litekong tse qobelloang tsa ho sesa (FST). Leha ho na le litlamorao tse khahlanong le bokhoba le litheko tse tšoanang le tlhabollo, methati e kenyang ts'usumetso ea ts'ireletso ea tikoloho e lula e sa utloisisehe, leha lipatlisiso tsa rona tsa pejana li hatelletse karolo ea mosebetsi o fokotsehileng oa sengoloa, CREB, ka har'a li-nucleus accumbens (NAc ) ho hanana le tse ling tsa litlamorao tsa ho ruisa tikoloho (Green et al., 2010; Larson et al., 2011). Kahoo, sepheo sa lithuto tsena tse fapaneng tsa ho holisa ke ho sebelisa mokhoa oa motheo oa mahlale ho tseba mekhoa ea limolek'hule eo hamorao e ka fetoleloang tleliniking. Mokhoa ona o lekana le tikoloho le maano a liphatsa tsa lefutso a hlophisitsoeng hantle joalo ka khetho e ikhethileng (McBride et al., 2014).
Mona re shebisisa ntlha e 'ngoe ea ho ngoloa, ΔFosB, e hlahisoang ka mokhoa o hlakileng ho NAc ka mefuta e meng ea khatello ea maikutlo kapa hoo e batlang e le lithethefatsi tsohle tsa tlhekefetso, ho kenyelletsa cocaine, morphine, joala, nicotine le amphetamine (Hope et al., 1992; Kelz le Nestler, 2000; Perrotti et al., 2004, 2008). Ha e le taba ea ho ngoloa, ΔFosB e nyamela le liprotheine tsa lelapa tsa Jun, ka ho rata JunD, ho theha mofuta o sebetsang oa AP-1 o tlamellang nthong ea karabelo ea AP-1 ho ntlafatsa kapa ho hatisa mongolo oa mefuta ea eona eo a e rerileng (Nestler, 2001), leha lipatlisiso tse ncha li fana ka maikutlo a hore ΔFosB e ka sebetsa hape joaloka homeodimer (Wang et al., 2012). Protheine ea ΔFosB ke phapang e kholo ea "splice" FosB gene, e etsang hore protheine ea ΔFosB e haelloe ke libaka tse peli tsa bofokoli ba C, e thibelang protheine ea ΔFosB ho tsoa lesikeng le bonts'a FosB le liprotheine tsohle tsa lelapa la Fos. Hobane ΔFosB e tsitsitse ka tsela e makatsang ho NAc, ΔFosB e sebetsa ka tsela e fapaneng haholo ho arabela ka ts'usumetso e mpe ea nako e telele ha e bapisoa le liprotheine tse ling tsa Fos. Ka ho pepesetsoa khafetsa lithethefatsi tsa tlhekefetso kapa khatello ea maikutlo ΔFosB butle-butle e bokella le ho phehella matsatsi ho isa libekeng, ha liprotheine tsa FosB le liprotheine tse ling tsa Fos li kenyellelitsoe nako e khuts'oane feela (lihora tse ngata) mme li theha mokhoa o kenyellelitsoeng tlhaisong e tlang (Nestler et al., 2001; Nestler, 2008).
Bohlokoa ba ΔFosB ha se feela hore e susumetsoa haholo ke lithethefatsi tsa tlhekefetso le khatello ea maikutlo, empa manonyeletso a ΔFosB bokong a bontšitsoe a ama boitšoaro ba liphoofolo. Ka mokhoa o ikhethileng oa ΔFosB mokokotlong oa "dynorphin" oa "" "" "litone tse kholo" "o eketsa kutloisiso ea" cocaine "e lemetseng le e pheta-phetoang, hammoho le karabelo e khahlisang ea koae sebakeng se ikhethileng sa paradigm. (Kelz et al., 1999; Kelz le Nestler, 2000; Colby et al., 2003).
Leha litla-morao tsa tšireletso le khatello ea maikutlo li hlalositsoe ka botlalo bakeng sa likhoto tse ruisitsoeng tikolohong, karolo e ka khonehang bakeng sa ΔFosB ho kenella lipakeng tsa phenotypes tsena tsa ts'ireletso ha e so hlahlojoe ka botlalo. Boithuto ba pejana ba ntlafatso ea tikoloho bo bonts'itse, ha ho bapisoa le tikoloho e tloaelehileng (SE), tikoloho e ntlafalitsoeng e eketsa maemo a basal ΔFosB maemong ka bobeli a D1 le D2 a bohareng ba li-spiny neurons tsa litereke tsa striatal ho litoeba. (Solinas et al., 2009; Lobo et al., 2013). Ntle le moo, likhoto tsa Wistar tse ruisitsoeng li bonts'itse lisele tse ntle tsa ΔFosB ho NAc le cortex ea pele ha li bapisoa le litoeba tsa SE, li fana ka maikutlo a karolo e ka bang teng ea ΔFosB ho ts'ireletso ea ts'ebeliso ea ts'ebeliso ea ts'ebeliso ea kelello ho nicotine (Venebra-Muñoz et al., 2014). Ntle le moo, ΔFosB e hatelletsang nako eohle ea litoeba e eketsa lebelo letsatsi le leng le le leng, e leng ntho e ka khahlisang tšebetso e eketsehileng ea likhoto sebakeng se ruileng. (Werme et al., 2002).
Thutong ea hajoale, re khothalelitse hore: (1) ntlafatso ea tikoloho e tla eketsa ho bokella maemo a basal ΔFosB ho NAc; le (2) ho bokella hona ha ΔFosB ho tla kenya letsoho ho litlamorao tsa ho ruisa tikoloho.
Lisebelisoa le mekhoa
Animals
Bakeng sa ntlafatso ea tikoloho, likhoto tsa banna tsa Sprague-Dawley (Harlan, Houston, TX, USA) li ile tsa abeloa ka tšohanyetso ho aha matlo a EC kapa IC ho tloha matsatsing a morao a 21 ho fihlela kajeno 51. Likhoto tsa EC li ne li tsamaisoa ka sehlopha (20 ka k'holeseterareng e ngoe) e kholo ka har'a teropo e kholo ea tšepe (70 × 70 × 70 cm) e nang le lintho tse 'maloa tse thata tsa polasetiki (libapalisoa tsa bana, lijana tsa polasetiki, li-tub tsa PVC, jj.). Lintho tsena li ile tsa nkeloa sebaka ke lintho tse ncha ebe li hlophisoa bocha sebopeho sa buka letsatsi le letsatsi. Likhoto tsa IC li ne li lula li kentsoe ka har'a mekotla e tloaelehileng ea polycarbonate. Likhoto li ile tsa lula maemong ana ho pholletsa le liteko le liteko tsohle tsa boitšoaro le liteko tsa biochemical li qalile kamora matsatsi a 51 a lilemo (ke hore, bonyane matsatsi a 30 a ho ruisa / ho khetholla). Bakeng sa overexpression ea ΔFosB, likhoto tsa banna tsa Sprague-Dawley (Harlan, Houston, TX, USA) li ile tsa fumanoa ka boholo ba 225-250 g 'me tsa kenngoa ka makhethe ka mekotleng e tloaelehileng ea polycarbonate pele li kenngoa ka phoso ka vector e amanang le vaerase (AAV2) vereFosB e nang le protheine e tala ea fluorescent (GFP) kapa GFP feela joalo ka taolo (bona ka tlase). Litekanyetso tse tloaelehileng tsa rat le metsi li ne li fumaneha ka bolokolohi ho likhoto tsohle ntle le nakong ea liteko tsa boitšoaro le taolo ea lijo. Lirosa tsohle li ne li bolokiloe sebakeng se laoloang (mocheso, 22 ° C; mongobo o lekanang, 50%; le 12 h lebone / potoloho e lefifi, mabone ho 600 h) Mokhatlong oa Tlhatlhobo le Kamohelo ea Mosebetsi oa Tlhokomelo ea Liphoofolo (AAALAC) . Liteko tsohle li tsamaisana le Tataiso ea NIH bakeng sa Tlhokomelo le Ts'ebeliso ea Liphoofolo tsa Laboraro le Komiti ea Tlhokomelo ea Liphoofolo le Thupelo ea Univesithi ea Texas.
Phaello ea tikoloho ke boqhekanyetsi bo akaretsang bo iqapetsoeng, likamano tsa sechaba le boikoetliso. Bolulo ba matlo ka marang-rang bo fana ka ho ikamahanya le batho 'me kahoo e emela EC (bona tataiso ea NIH). Kahoo, sehlopha se laolehileng se loketseng boemo ba ho hlanya, ho ikamahanya le sechaba le boikoetliso e ne e tla ba sehlopha ntle le ho ba le bocha, ho ikamahanya le batho kapa ho ikoetlisa, boemo ba IC. Likhoto tsa IC li bonts'a matšoao a fokolang a khatello ea maikutlo e telele ho feta likhoto tsa EC. Ka ho khetheha, likhoto tsa EC li holisitse li-adrenals (Mlynarik et al., 2004), likarabo tse tlotsitsoeng tsa CORT (Litepisi et al., 2011), e hlahisoang ka mokhoa o potlakileng oa tlhaho ea liphatsa tsa lefutso (Zhang et al., phetolelo e ngotsoeng ka letsoho) le ho bokella ha osFosB (Solinas et al., 2009; Lobo et al., 2013), matšoao ohle a khatello ea maikutlo (Crofton et al., ka tlhahlobo).
Matšoenyeho a kelello
Likhoto tse matlafalitsoeng le tse ikhethileng li ile tsa kenngoa ka har'a li-restry tse bobebe tsa polasetiki tse lahloang (DecapiCone®, Braintree Science Science Inc., MA, USA) bakeng sa 60 min bakeng sa matsatsi a 1 (a hlobaetsang kapa a 9 (a phetoa). Bakeng sa tlhahlobo ea mRNA e senang nako e khutšoane, litoeba tsa 30 (likhoto tsa 5 ka sehlopha) li ile tsa qaptjoa metsotso ea 30 kamora ho qaleha ha nako ea hoqetela ea khatello ea maikutlo, ho ile ha ntšoa likotsi tsa rat 'me NAc e qhalakanngoa tlhahlobo ea mRNA. Bakeng sa immunohistochemistry, likhoto tsa 12 li ile tsa tšeloa ka letsoai le 4% paraformaldehyde, likelello li nts'itsoe, tsa ngolisoa ka 4% paraformaldehyde 'me tsa bolokoa ka 20% glycerol ho 1xPBS ho 4 ° C. Mekokotlo ea litoeba e ne e qhekelloa ho 40 μm e nang le microtome ea serame. Li-brine li ile tsa kotuloa 24 h kamora khatello ea ho qetela ho lumella protheine ea FosB e bolelele bo felletseng e nyenyefatsa (Perrotti et al., 2008).
Intravenous cocaine e itlhommeng pele ka ho ruisa tikoloho
Ho kenella kahare ho catheter
Likhoto li ne li sebelisoa ka kotlolloho li sebelisa ketamine (100 mg / kg IP) le xylazine (10 mg / kg IP) mme silathe catheter e ile ea kenngoa 'me ea sirelloa mothapong oa jugular, e tlosa letlalo mokokotlong oa phoofolo. Letsatsi le leng le le leng li-catheters li ne li kenngoa ka 0.1 ml ea tharollo ea letsoai e nang le heparin (30.0 U / ml), penicillin G potasium (250,000 U / ml) le streptokinase (8000 IU / ml) ho thibela ts'oaetso le ho boloka patency ea catheter ho pholletsa le nako eohle tsa liteko.
Ts'ebetso ea cocoaine ka ho ruisa tikoloho
Likhoto tse mashome a mabeli tse ruileng le 20 li arotsoe likamoreng tse sebetsang tsa 30 × 24 × 21 cm (Med-Associates, St. Albans, VT) mme ea lumelloa ho hatella lever bakeng sa infusions ea koae (0.5 mg / kg / infusion, phepelo ea lithethefatsi tsa NIDA, Research Triangle Institute, NC, USA) kapa saline tlasa kemiso e tsitsitseng ea 1 (FR1) ea 2 h ka letsatsi bakeng sa matsatsi a 14 kaofela. Ho boloka tšebeliso e tšoanang ea cocaine pakeng tsa lihlopha tsa EC le IC ho ne ho e-na le palo e kholo ea infusions ea 30 ka nako e le ngoe. Bokhoni ba ho sebetsana le litšepe bo ne bo lekanyelitsoe ho mehlala ea 30, ka hona litoeba tse arabelang ka tlase ho sehlopha ka seng ha lia ka tsa sebetsoa, tsa siea Ns ea 8 bakeng sa koae le 7 bakeng sa lihlopha tsa saline. Ka hona, ho ne ho se na phapang pakeng tsa EC / IC ka ho ja lijo tsa koae ka botlalo kapa nako ea litlatsetso pakeng tsa likhoto tsa EC le IC. Litlolo tsa makenete li ile tsa ntšoa 3 h kamora ho qaleha ha seboka sa ho qetela sa boitaolo 'me NAc ea qhaloa bakeng sa tlhahlobo ea mRNA le protheine. Lehlakore le leng la NAc le ne le sebelisetsoa blot Bophirimela, lehlakoreng le leng le sebelisoa QPCR.
Tsamaiso ea koae e se nang phehisano e matlafatsang molemong oa tikoloho
Bakeng sa papiso e tobileng ho lingoliloeng tse neng li hatisitsoe pele (Hope et al., 1994; Chen et al., 1995), EC (N = 12) le likhoto tsa IC (N = 12) e ne e kenngoa ka har'a letsoai kapa 20 mg / kg cocaine intraperitoneally (IP) bakeng sa matsatsi a 1 (a acute) kapa matsatsi a 9 (a phetoa). Mohlala o le mong oa EC o ile oa lahleha nakong ea ts'ebetso. Sehlopha se matla haholo se fumane liente tsa saline bakeng sa matsatsi a 8 le jekete e le 'ngoe ea koae ka letsatsi 9 e le hore likhoto tsohle li fumane palo e lekanang ea liente. Li-brains li ile tsa ntšoa 30 min ka mor'a ho kenngoa ka ente ea ho qetela le NAc e arotsoe tlhahlobo ea mRNA.
Quanifying ea mRNA e sebelisang qPCR
RNA e ntšoa ka homogenizing ho RNA STAT-60 (Teltest, Friendwood, TX), e arola RNA ho tsoa ho DNA le protheine e sebelisa chloroform, mme e fana ka RNA eohle ka isopropanol. DNA e silafatsang e tlositsoe (TURBO DNA-Free, Life Technologies, CA, USA) le 5 ug ea RNA e hloekisitsoeng e ile ea fetisoa ho fetoleloa ho cDNA (SuperScript III First Strand Synthesis: lethathamo la Invitrogen # 18080051). ΔFosB mRNA ile quantified sebelisa ditirisanommogo sebele nako PCR (SYBR Green: sebelisoa Biosystems, Foster City, CA) ka sebelisoa Biosystems 7500 itima lijo thermocycler le primers etselitsoe ho khona ho utloa feela ΔFosB (pele: AGGCAGAGCTGGAGTCGGAGAT; etsolla: GCCGAGGACTTGAACTTCACTCG) le boetse maemong ho primers etselitsoeng ho bona rat GAPDH (pele: AACGACCCCTTCATTGAC; reverse: TCCACGACATACTCAGCAC). Li-primers tsohle li ile tsa netefatsoa mme tsa hlahlojoa bakeng sa tlhaiso le tatellano pele ho liteko (Alibhai et al., 2007).
Botlaela ba Bophirimela
Lehlakore le letona la NAc ho tloha ho koae kapa ho sebelisa likhoto tsa saline tse tsamaisoang ke EC le IC li ile tsa homogenized ka buffer e nang le sucrose, Hepes buffer, sodium fluoride, 10% SDS, le proteinase le phosphatase inhibitors (Sigma-Aldrich: P-8340, P -2850, P-5726). Ts'ebetso ea liprotheine e ile ea hlahlojoa ho sebelisoa Pierce BCA Protein Assay Kit (Thermo Science, IL, USA). Hobane protheine e ntšitsoeng lenaneng le le leng e ne e sa lekana ho hlahlobisisoa, disampole tsa 2 sehlopheng se le seng li ile tsa kengoa hammoho, tsa hlahisa sampole ea 4 bakeng sa sehlopha ka seng. Mefuta ea liprotheine e ne e emisitsoe ho 95 ° bakeng sa 5 min mme e tsamaisoa ka 10-20% polyacrylamide gradient gel (Criterion TGX, Bio-Rad Laboratories, CA, USA) ebe e fetisetsoa membrane ea polyvinylidene fluoride (PVDF) (Millipore, MA, USA) ). Membrane e ne e koetsoe ka blotting-grade blocker (lebese le sa omelletseng), le entsoe ka ΔFosB anti anti (rabi, 1: 1000, #2251, Cell Signaling Technology, MA, USA) le antiβrinin antibody (mouse, 1: 1000 , Cell Signaling Technology, MA, USA), e hlatsoitsoe ka TBST ebe e kenella ka li-antibodies tsa morao-rao tse amanang le rabara (780 nm), anti-mouse (680 nm), 1: 15000, Li-Cor Bioscience, NE, USA). Mefuta ea Bophirimela e ile ea etsoa setšoantšo (Odyssey, Li-Cor Biosciences, NE, USA) mme maemo a liprotheine a arotsoe ka software ea Odyssey.
Immunohistochemistry
Bakeng sa Setšoantšo Figure11 (N = 3), lisele tse nang le ΔFosB li ile tsa bonoa tsa ba tsa baloa ka ho ngola melaetsa ea immunohistochemical ea ΔFosB ka lipampiri tsa NAc tse nang le DAB (DAB peroxidase substrate kit, Vector Laboratories, CA, USA). Mekokotlo e ne e ntšoa, e entsoe kamora nako e telele, e kenyelletsoa ebe e aroloa likarolo tsa 40 μm tse nang le NAc ka li-microtome tse sa tsitsang tsa Leica (Leica Biosystems, IL, USA). Litlhaka li ile tsa lula li phaphametse mme li tlatsitsoe ka 1xPBS pele li-endoxidases tsa endo asili li felisoa, pele ho thibela ka 3% serum ea poli e tloaelehileng (Jackson ImmunoResearch, PA, USA) ka 0.3% triton le avidin D (Vector Laboratories, CA, USA). Methapo ea NAc e ne e kentsoe anti-mantlha ea FosB bosiu (1: 1000, Santa Cruz Biotechnology, Dallas, TX, USA) ka serum ea poli ea 3%, 0.3% triton, 1xPBS, le tharollo ea biotin (Vector Laboratories, CA, USA). Le ha antiwel ena e amohela bobeli ba FosB le ΔFosB, lithuto tsa pele tsa Bophirima tsa Bophirimela li bontšitse hore ho 24 h post stimulation, bongata ba letšoao la immunohistochemical le bopiloe ke ofFosB hobane FosB e nyenyefatsa hantle pele ho 24 h (Perrotti et al., 2008). Kamora ho hlatsoa, likhechana li ile tsa kenngoa ka poli ea li-antibi tsa mmutla tse loants'itsoeng tsa mmutla IgG (Vector Laboratories, CA, USA), serum ea poli, le 1xPBS. Ka mor'a moo, likhechana li ile tsa kenngoa ka lehare la "avidin-biotin" (ABC) peroxidase bakeng sa 15 min (Thermo Science science, IL, USA). Qetellong, ho ile ha hloekisoa linama, tsa haelloa ke metsi ka ho sebelisa ethanol le CitriSolv (Saense ea Fischer, MA, USA) 'me tsa koaheloa ka DPX (Saense ea Fisher). Bakeng sa ho bala lisele, likarolo li ne li nkuoa sampole ho tloha Bregma + 1.80 ho ea + 1.44 ho tsoa phoofolo ka 'ngoe. Palo eohle ea lisele tsa immunopositive ea ΔFosB e baliloe ho tsoa likarolong tse 'ne tsa NAc ho tloha mantlha le khetla ea rat e ngoe le e ngoe.
Motsoako o amanang le vaerase o amanang le tšoaetso FosB
Vector e thehiloeng ho AAV2 e hlalosang ΔFosB le humanilla renilla GFP (hrGFP; Winstanley et al., 2007, 2009a,b) kapa "veter control" ea hrGFP (N = 10 e ngoe le e ngoe) e ile ea kenngoa ka kotloloho ho ratoa NAc. Hobane ha ho na batho ba IC, likhoto tse nang le matlo a mabeli li sebelisitsoe ho fapana le likhoto tsa IC thutong ena ho eketsa bohlokoa sechabeng ka ho bonts'a litlamorao tsa ΔFosB E ikemetseng ea EC / IC paradigm. AAV e hlalosang hrGFP empa e sa sebeliseng oteFress wasFosB e sebelisitsoe e le taolo. Polelo ea ΔFosB Ka vivo e netefalitsoe ke immunofluorescence staining le FosB antibody ea mantlha (1: 200, Rabbit, Cell Signaling Technology, MA, USA). Li-vector tsa AAV li ile tsa kenngoa ka har'a polasetiki ea NAc ka mahlakore a mabeli (1 μl / lehlakoreng le fetang 10 min) li sebelisa li-coordinates (AP = 1.7, L = 2.0, D = −6.5). Liteko tsa boits'oaro li qalile libeke tsa 3 kamora ts'ebetso ea bongaka e buoang. Ho beoa ka nepo ho ile ha khethoa immunohistochemically kamora ho phethoa ha liteko tsa boits'oaro.
Suprose neophobia
AtsFosB likotlo tse utloisang bohloko (N = 10) le likhoto tse laolang (N = 8) li ile tsa tšoaroa ka beke ea 1 beke pele ho liteko tsa boitšoaro. Ho etsa liteko bakeng sa boitšoaro bo kang ba ho tšoenyeha, likhoto li ile tsa hlahlojoa bakeng sa neophobia ho tatso e ncha (sucrose). Likhoto li ile tsa aroloa mekotleng e le 'ngoe' me metsi a tlosoa ho 1600 h. Li-botlolo tse tloaelehileng tsa "rat" tsa metsi li ne li tlatsitsoe ka 1% w / v sucrose tharollo metsing a "litompo" a tloaelehileng a "pompo" le ho imeloa pele li kenngoa koung e 'ngoe le e' ngoe ho 1800 h. Kamora ho qeta metsotso ea 30, libotlolo li ile tsa tlosoa 'me tsa lekanngoa bocha, le phapang ea boima ba libotlolo tsa sucrose pele le kamora tlhahlobo e baliloe. Ka mor'a moo, sucrose e ile ea nkeloa mabokoseng bakeng sa matsatsi a 2 a eketsehileng ho tlohella litoeba li tloaelane le tatso ea sucrose pele ho tlhahlobo ea khetho ea sucrose.
Motsoako o phahamisitsoeng
Teko e 'ngoe ea boits'oaro bo ts'oanang le ho tšoenyeha, mofuta o phahameng oa maze (EPM), e ile ea lekoa matsatsi a 2 kamora ho ts'oaroa ke neophobia. EPM e lekola boits'oaro bo fetotsoeng bo hlophisitsoeng ba vector ka mokhoa o makatsang le tikoloho e bakang matšoenyeho (Green et al., 2008). Matsoho a mabeli a koetsoeng le matsoho a mabeli a bulehileng (Med Associates Inc., VT, USA) e neng e lekanya 12 × 50 cm e ne e le 75 cm kaholimo ho lefatše 'me e ne e e-na le li-photobeams monyako oa letsoho le leng. Nako e sebelisitsoeng matsohong a bulehileng e ile ea beoa leihlo bakeng sa 5 min ka likhefu tsa photobeam sebelisa software ea Med-PC.
Ho theoha ho fokolisang khatello ea maikutlo
Letsatsing le hlahlamang la EPM, ho ile ha sebelisoa teko ea boraro ea ho tšoenyeha: defecation ha ho qoqoa ka tikoloho e hatellang e bonolo (e batang). Li-cage tsa panya ea polycarbonate (33 × 17 × 13 cm) li ne li entsoe ka pele ho leqhoa bakeng sa metsotso ea 10. Likhoto li kentsoe ka har'a mekotla ea leqhoa bakeng sa 30 min mme palo ea fecal boli e tlalehiloe metsotso e meng le e meng ea 5.
Khokahano sechabeng
Letsatsing le latelang, boitšoaro bo kang ba khatello ea maikutlo bo ile ba lekanngoa ho sebelisoa tlhahlobo ea ho sebelisana le sechaba. Likhoto li ile tsa aroloa bakeng sa 24 h pele ho tlhahlobo. Ka letsatsi la liteko litoeba li ne li kentsoe tikolohong ea lipalesa (sets'oants'o sa polasetiki, 45 × 40 × 45 cm) le molekane oa bona oa cage mme boitšoaro bo ile ba tlaleheloa video bakeng sa 30 min. Nako ea likhoto tse sebelisitsoeng ho itlhoekisa e lekantsoe ke mohlahlobisisi ea sa boneng boemo ba likhoto.
Ho rata khetho
Kamora ho ikamahanya le sechaba, teko ea ho khetha ea sucrose e sebelisitsoe e le mohlala oa anhedonia. Likhoto tse nang le matlo a mabeli li ile tsa aroloa 1600 h ka lijo empa li sa lumelloe ho fihlella metsi a 2 h. Ho 1800 h libotlolo tse peli tsa metsi tse boima esale pele li ile tsa beoa holima e ngoe le e ngoe, e ngoe e na le metsi, e 'ngoe e le 1% sucrose solution ka metsing. Libotlolo tsa metsi li ile tsa beoa maemong a tloaelehileng ha sucrose e ne e beoa haufi le 10 cm. Libotlolo li ile tsa tlosoa 'me tsa imeloa hape kamora metsotso ea 15.
Ts'ebetso ea locomotor
Matsatsi a mararo kamora ho ratoa ke sucrose, ts'ebetso ea locomotor e ile ea hlahlojoa tlas'a maemo a tloaelehileng a khanya ka ho beha litoeba likamoreng tse hlakileng tsa Plexiglas (40 × 40 × 40 cm) e nang le moalo o mosesane oa bethe, o pota-potiloe ke matrices a mabeli a 4 x 4 cmbebe fatše le 4 cm e le 'ngoe ka holim'a lefats'e ho tlaleha ho ts'oaroa ho ts'oarellang le ts'ebetso e emeng (ho holisa). Likhefu tsa Photobeam li behiloe leihlo bakeng sa 16 h ke sistimi e hlophisitsoeng e bulehileng ea ts'ebetso ea masimo (San Diego Instruments, CA, USA).
Teko ea ho sesa e qobelloang
Teko ea ho qetela ea boits'oaro e ne e le FST, mohlala o anngoeng haholo ke litlhare tsa litlhare. Lirosa li ile tsa kenngoa ka har'a moqomo oa Plexiglas o tlatsitsoeng ke 14 L ea mocheso oa kamore (24 ± 0.5 °) mochini oa 15 min ka Session 1, le 5 min ka Session 2 ka letsatsi le hlahlamang. Likhoto li ile tsa omisoa 'me tsa khutlisoa ka mekotleng ea tsona. Ts'ebetso ea ho sesa e ne e rekotiloe ka video mme ho lateloa nako ea pele ea ho se sebetse hantle (1 s) le nako eohle ea koloing e reriloeng bakeng sa Karolo ea 2 ke mofuputsi ea foufalitseng maemo.
Sesebelisoa sa oprose se arabang
Likhoto tsa AAV tsa taolo le likhoto tsa ΔFosB-overexpressing li ne li laoloa ho 85% ea boima ba 'mele bo fepang mahala matsatsing a 7. Likhoto tsohle li ile tsa koetlisetsoa ho hatella mochini oa khatiso oa li-sucrose pellets (Bio-serv, NJ, USA) lenaneong la FR1 la ho matlafatsa mananeo a 15 min ka matsatsi a latellanang a 5. Likhoto li ile tsa fuoa monyetla oa ho fumana lijo mahala bakeng sa matsatsi a 3 hape li lumelloa ho hatella li-pellets tsa sucrose lenaneong la FR1 bakeng sa 15 min, ka nako ena ho 100% mahala-feed.
Ts'ebetso ea cocoaine
fumana
Bekeng e le 'ngoe ka mor'a ho buuoa ka catheter (joalo ka ha ho hlalositsoe kaholimo), likhoto tsohle (likhoto tsa taolo ea 7 le likhoto tsa 10 ΔFosB tse fetang tekano, litekanyetso tse le' ngoe tsa taolo li ile tsa lahleha ho tsoa ho ts'ebetso ea catheter) li ile tsa beoa likamoreng tsa basebetsi tsa 30 x 24 x 21 cm (Med-Associates, St. Albans, VT) mme ea lumelloa ho itaola ka boeona 0.2 mg / kg / infusion yuniti ea cocaine bakeng sa 2 h ka karolo e ngoe bakeng sa matsatsi a 4; ebe 0.5 mg / kg / infusion bakeng sa matsatsi a 3 lenaneong la FR1. Tlatsetso e 'ngoe le e' ngoe e ne e fanoa kahare ka bongata ka bongata ba 0.01 ml ka holim'a 5.8 s. Ts'oaetso e ne e tšoaetsoa ke khanya ea mabone a mabeli a 20 s, a neng a tšoaea nako ea ho tima eo ho neng ho sa fumanehe infusions e 'ngoe hape.
Fela
Hobane ho pepesetsoa ha koae e sa foleng ho ka kenyelletsa ho bokella ΔFosB maemong a taolo ea litoeba, e leng ho ka etsang hore likhoto maemong ohle a vector li be le maemo a phahameng a ΔFosB bokong, likhoto li ne li ts'oareloa malapeng a bona bakeng sa matsatsi a 4 ntle le ho itaola Maemo a liprotheine tsa ΔFosB a fokotseha ho likhoto tsa taolo ea vector. Kamora ho qeta matsatsi a 4, likhoto li ile tsa beoa ka phapusing ea basebetsi 'me tsa lumelloa ho itaola ka letsoai sebakeng sa cocaine tlasa kemiso ea FR1 ea 1 h bakeng sa matsatsi a 3 a latellanang.
Karabelo ea tekanyetso e lekantsoeng
Rate e ngoe le e ngoe (taolo le ΔFosB overexpressing) e ne e lumelloa ho itaola 0.00325, 0.0075, 0.015, 0.03, 0.06, 0.125, 0.25, 0.5 mg / kg / infusion cocaine ka letsatsi le letsatsi ka matsatsi a latellanang a 1. Liroto tse ikentseng tekanyetso e 'ngoe le e' ngoe ea koae ka 5 min.
Phetetso e nchafalitsoeng ke Cocaine
Likhoto li ile tsa sebelisa mokhoa o kahare oa ho khutlisetsa hare-hare. Likhoto li amohetse 0.5 mg / kg / infusion lenaneong la FR1 bakeng sa 60 min e lateloang ke 3 h ea ho timela (e nang le likhakanyo tsa cocaine cingeine). Kamora moo ba amohela ente ea IP (Green et al., 2010) ea k'hok'heine ea e 'ngoe ea litekanyetso tse hlano (0, 2.5, 5, 10, kapa 20 mg / kg) ka tatellano ea tlhaiso e ngoe le e ngoe ho pholletsa le linako tsa 5 tsa ho khutlisetsoa. Karolo ea ho qetela ea 3 h ea thuto e ne e khutlisetsoa ka karabo, hape ka li-cocaine tsa cocaine empa li ntse li se na infusions ea koae. Kamora seboka se seng le se seng sa ho ts'oaroa ke koae, litoeba li ile tsa fumana matsatsi a kenang a 2 a lethal dose e phahameng (0.5 mg / kg / infusion) cocaine lenaneong la FR1 la 2 h Nakong ea ts'ebetso ea ho iphekola ka koae, ka linako tse ling li-catheter tsa likhoto tse ling li ile tsa lahleha habonolo; ka hona, lintlha tsa likhoto tsa taolo ea 6 le likhoto tsa 7 ΔFosB-overexpressing li sebelisitsoe tlhahlobisong ena.
Tlhahlobo ea statistical
Litlhatlhobo tsa mefuta e 'meli tsa li-fapana (ANOVA) le likhato tse peli tse phetoang habeli li-ANOVA li entsoe ho bapisa lihlopha tse' ne tsa kalafo mme lipapiso tse reriloeng li sebelisitsoe ho bapisa phapang lipakeng tsa maemo. Bohlokoa lipakeng tsa maemo a mabeli feela bo ile ba hlahlojoa ho sebelisoa baithuti ba Moithuti t-etona. Tsohle tLintlha tsa tlhaiso-leseling li fetisitse tlhahlobo ea Shapiro-Wilk ea maemo a tloaelehileng. Lintlha tsohle li hlahisoa e le tsa bohlokoa ± SEM. Bohlokoa ba lipalo bo thehiloe ho p <0.05. Likhoto tsohle tse ruileng bakeng sa teko e le 'ngoe li ne li lula ka hokong e le' ngoe empa li nkuoa joalo ka lihlooho tse arohaneng, li fana ka se amehang mabapi le taba ea pseudoreplication.
Results
Liroto tsa EC li bonts'a maemo a holimo a basal a FosB ho NAc ho feta likhoto tsa IC
Ha ho bapisoa le likhoto tsa IC, likhoto tsa EC li na le palo e phahameng haholo ea lisele tse ntle tsa ΔFosB maemong a mabeli a NAc (t(4) = -3.31, p <0.05) le khetla (t(4) = -6.84, p <0.05) (Lipalo 1A, C, E, F), e fana ka maikutlo a hore molumo oa basal oa ΔFosB o phahame ho likhoto tsa EC ha li bapisoa le likhoto tsa IC. Ntle le moo, liphetho tsa blot tsa Bophirimela li bonts'itse mokhoa o matla bakeng sa likhoto tsa saline tsa EC tse nang le protheine e phahameng ea "protein" ea ΔFosB ho NAc ha e bapisoa le likhoto tsa IC tsa saline (t(6) = -2.03, p = 0.089; Setšoantšo Figure2A) 2A) sebelisa teko e nang le mehala e 'meli. Leha ho le joalo, ha ho fanoa ka polelo e eketsehang ho Litšoantšo 1A-F le keketseho e bonoang lipampiring tse ling (Solinas et al., 2009), re na le ts'epo mabapi le phello ena. Se fumanoeng ka Bophirimela se boetse se netefatsa hore hoo e batlang e le lits'oaetso tsohle tsa FosB tse bonoeng ke immunohistochemistry e ne e le ΔFosB eseng FosB, e neng e sa bonoe ho 24 h.
FosB e kenella ka mokhoa o fapaneng ho likhoto tsa EC le IC ka khatello ea maikutlo
Ho bile le phello e kholo ea khatello ea khatello ea maikutlo khafetsa likhutlong ka bobeli (F(1, 8) = 16.6, P <0.005) le mantlha (F(1, 8) = 7.9, P <0.05) ea NAc le phello e kholo ea ntlafatso ea tikoloho ka khetla (F(1, 8) = 22.3, P <0.005; Litšoantšo 1A-F). Habohlokoa le ho feta, tšebelisano pakeng tsa khatello ea maikutlo le moruo oa tikoloho e ne e le bohlokoa hape le ka har'a likhetla (F(1, 8) = 25.6, P <0.01) le mantlha (F(1, 8) = 6.7, P <0.05). Tšebelisano e ne e le hore, kamora khatello ea maikutlo e phetoang, palo ea lisele tse ntle tsa ΔFosB e eketsehile haholo likhoto tsa IC, ha palo ena e sa fetohe likhoto tsa EC kamora khatello ea maikutlo khafetsa.
Ho etsa lipatlisiso tse ling tsa hore na ΔFosB e laoloa ka matla joang ke khatello e matla ea khatello ea maikutlo le ho lumella ho bapisoa le lipatlisiso tsa pele (Alibhai et al., 2007), tlhahiso ea ofFosB mRNA o ne a ithutoa ka khatello ea maikutlo le ka makhetlo-khetlo ea ho ithiba (Setšoantšo (Figure1G) .1G). Ho bile le phello e kholo ea khatello ea maikutlo (F(2, 24) = 31.9, P <0.001) le ntlafatso ea tikoloho (F(1, 24) = 5.1, P <0.05). Likhoto tsa IC, ΔFosB mRNA e ile ea susumetsoa ka matla kamora khatello ea maikutlo e matla. Leha ho le joalo, ka khatello ea maikutlo e phetoang, ho qalisoa ha ΔFosB mRNA ho ile ha fokotsoa haholo ha ho bapisoa le ho kenella hampe. Ho ne ho boetse ho na le tšebelisano ea bohlokoa (F(2, 24) = 4.6, P <0.05), ho bonts'a hore ho qhekelloa ho matla ha ΔFosB mRNA ho ne ho le tlase ho likhoto tsa EC ha ho bapisoa le likhoto tsa IC. Kahoo, litoeba tsa EC li na le maemo a phahameng a basotho a ΔFosB protheine ho NAc, empa lessFosB e fokolang mRNA ho itšireletsa ha o sebetsana le khatello ea maikutlo e matla.
FosB e susumetsoa ka mokhoa o fapaneng ke cocaine ho NAc ea EC le likhoto tsa IC
Ho fumana hore na likhoto tsa EC le IC li arabela ka tsela e fapaneng ho koae, re ithutile taolo ea "protein" ea proteinFosB le mRNA ho RNAc kamora ho itaola 2A, B ka ho latellana). Leqhubu la Bophirimela le ile la senola phello e kholo ea cocaine (F(1, 12) = 24.9, P <0.001) le tšebelisano e bohlokoa (F(1,12) = 5.5, P <0.05). Tšebelisano e ne e le hore ΔFosB e eketsehile ho feta likhoto tsa IC ho feta likhoto tsa EC (Setšoantšo (Figure2A) .2A). Ebile, kamora maemo a protheine ea cocaine ea boithatelo ΔFosB e ile ea phahamisoa haholo feela likotong tsa IC. Mabapi le maemo a mRNA, liphetho tsa qPCR li boetse li senotse phello e kholo ea cocaine (F(1, 26) = 47.1, P <0.001) le litlamorao tse kholo tsa ntlafatso ea tikoloho (F(1, 26) = 13.8, P <0.005). Leha maemo ka kakaretso a ne a le tlase ho likhoto tsa EC, lihlopha ka bobeli li eketsehile ΔFosB mRNA (Setšoantšo (Figure2B2B).
Le ha data ea protheine e ts'ehetsa hypothesis ea mantlha, e ne e tšelisitsoe ho tsoa ho setšoantšo Figure1G1G hore likhoto tsa EC li tla bonts'a hanyane mRNA ho kenella ho feta likhoto tse ikhethileng tekong ea koae e kaholimo, e sa kang ea etsahala, mohlomong hobane ke setšoantšo Figure1G1G o sebelisitse timepoint ea 30 min mme liteko tsa cocaine li sebelisitse 3 h timepoint. Ho tsoela pele ho hlongoa lipotso ka mRNA hypothesis, ho sebelisitsoe nako ea metsotso ea 30 ho hlahloba kalafo ea cocaine e boima le e phetoang ho bapisoa hantle le setšoantšo. Figure1G.1G. Hobane ho itaola ka lehare la cocaine ho na le mathata ka tlhaho (ke hore, ho ithuta ka thepa), likhoto tsa EC le IC li fuoe matsatsi a hlobaetsang a cocaine IP (9 mg / kg) a morao-rao. Ha e le hypothesized, ho bile le phello ea bohlokoa ea ho ruisa tikoloho (F(1, 17) = 14.3, P <0.005), empa kalafo e ka sehloohong ea kalafo ea cocaine (F(2, 17) = 3.4, P = 0.057) le tšebelisano (F(2, 17) = 3.4, P = 0.055) e bonts'itse ts'ebetso e matla feela ka tlhahlobo e nang le mabili a mabeli. Leha ho le joalo, ha re fuoa hore re ne re na le li-hypotheses tsa tataiso ho tsoa ho Setšoantšo Setšoantšo1G, 1G, re phutholohile haholo ka maikutlo a rona hore litoeba tsa EC li bonts'a ho kenella ho feta likhoto tsa IC (Setšoantšo (Figure2C2C).
Tlhakiso ea FosB ea khetla ea NAc e etsisa morusu oa tšireletso o khothatsang
Ho etsa lipatlisiso ka phello ea ΔFosB mabapi le boitšoaro ba rat ntle le ho ruisa / ho khetholla tikoloho (ke hore, ho etsa hore liphetho tsena li lumellane le lithuto tse seng tsa EC / IC). likhoto tse senang matlo. Ho latela lithuto tsa rona tse fetileng, khetla ea NAc e tsotella haholo ho laola boitšoaro bo amanang le khatello ea maikutlo le ho ts'oara lithethefatsi kahoo litsebi tsa AAV li ile tsa kenngoa khetla ea NAc thutong ena (Green et al., 2006, 2008, 2010). Lipalo 3A, B bonts'a moemeli immunohistofluorescence ea ΔFosB ka sethala sa taolo (phanele ea A; ke hore, polelo ea semelo sa expressionFosB) le veter ea ΔFosB-overexpressing (paneli ea B) khetla ea NAc.
Ha re netefalitse titer, Ka vivo polelo le ho beoa ka kakaretso ha vaerase ea vaerase, re ithutile pele ka phello ea ho tebella hoa ofFosB ka mefuta ea matšoenyeho. Ho hlohlona ho fetelletseng ha osFosB khetla ea NAc ho ne ho sa lekana ho hlahisa matla a ho natefeloa ke tikoloho ho neophobia ea ho chesa le ho sithabetsoa ke khatello ea maikutlo. (ya data ha e bontšoe). Ntle le moo, ha ho na phello ho EPM (ya data e sa bonts'itsoeng). Hobane ntlafatso ea tikoloho e hlahisa litla-morao tse khahlanong le litoeba, ka mor'a moo re ile ra etsa liteko tse amanang le khatello ea maikutlo ho likhoto tsa ΔFosB tse hatisang. Hoa tšoana le mehlala ea matšoenyeho, liphetho li bonts'a hore ΔFosB e tlotsitsoeng ho NAc khetla e ne e sa lekana ho fokotsa boits'oaro bo kang khatello ea maikutlo tlhahlobong ea likhetho tsa sucrose, tlhahlobo ea tšebelisano ea sechaba, kapa FST (ya data ha e bontšoe).
Paradigmeng ea ntlafatso ea tikoloho, likhoto tsa EC li bonts'a ts'ebetso ea boemo bo tlase ba basal ho feta likhoto tsa IC (Bowling et al., 1993; Bowling le Bardo, 1994; Smith et al., 1997; Green et al., 2003, 2010). Ho etsa lipatlisiso ka phello ea vereFosB ea ho feta ha motho a le ka hara khetla ea NAc, ts'ebetso ea tšohanyetso e ile ea lekoa bakeng sa 120 min. Ho sebelisa liteko tse nang le mehatla e 'meli sephetho se bontšitse hore oFosB e hatisang boima khetla ea NAc e hlahisitse mokhoa o matla bakeng sa ts'ebetso ea basal ea metal e fokotsehileng litsing (Setšoantšo. (Figure3C; 3C; t(16) = 1.84, p = 0.084). Leha e se ea bohlokoa lipalo-palo ka tlhahlobo e nang le mehala e 'meli, datha tsena li ntse li tsoteha ha li fuoa hore li lumellana le tataiso ea rona e hlakileng ea tataiso e thehiloeng ho Green et al. (2010), e lumellanang le phello ea ntlafatso ea tikoloho.
Ise fapaneng le khatello ea maikutlo le matšoenyeho, overexpression ea ΔFosB ka hara poloko ea NAc e khonne ho hlahisa mofuta oa EC-phenotype maemong a mangata a ho lemalla / ho matlafatsa. In teko ea boithatelo ea ho ikemela, ho bile le tšebelisano ea bohlokoa lipakeng tsa ΔFosB oxpxpression le tlhotlheletso ea tlala ea likhoto (F(1, 16) = 7.4, P <0.01). Likhoto tse hatisang haholo ΔFosB ka har'a khetla ea NAc li nkile haholo Hape li-pellets tsa sucrose tlasa maemo a susumetsoang ke tlala (ke hore, ho 85% mahala feed feed bodyweight), empa li-pellets tse fokolang tlasa maemo a tlase a khothalletsoang (ke hore, 100% boima ba phepelo ea mahala; Figure3D), 3D), e etsisang EC phenotype ka mokhoa o phethahetseng (Green et al., 2010).
Karolong e ntlafatsang ea tikoloho, likhoto tsa EC li bonts'itse boitšoaro bo fokotsehileng ba ho batla koae ka ho felisoa le ho khutlisetsoa hoa koae ka koae. (Green et al., 2010). Kahoo, boitšoaro ba ho ts'oara koae le ho bo ts'oara bo ile ba lekanngoa ho likhoto tsa ΔFosB tse sebelisang mokhoa o ikemetseng oa taolo ea koae. Ha e le mohlala oa ho lakatsa, paracigm ea cocaine e felisitsoeng e senotse hore xpFosB ho tebela ha mokokotlo oa NAc e fokotsehile boits'oaro ba ho batla lithethefatsir (F(1, 15) = 6.7, P <0.05; Setšoantšo Figure3E) .3E). Ho bile le phello ea bohlokoa ea thuto (F(2, 30) = 74.0, P <0.001). Bakeng sa karabelo ea tlhokomelo tlasa kemiso ea FR1, ho bile le phello e kholo ea tekanyetso (F(7, 105) = 222.6, P <0.001) le tšebelisano e bohlokoa (F(7, 105) = 2.3, P <0.05) ka tšebeliso ea k'hok'heine e bokellanang. Sebopeho sa tšebelisano e ne e le hore liphapang li ne li bonahala feela litekanyetsong tse phahameng tsa cocaine (Setšoantšo (Figure3F) .3F). Kamora nako ea hore cococaine e hlohlelletsoe hape ho bile le phello e kholo ea lethal dose (F(4, 44) = 15.5, P <0.001) le tšekamelo ea sephetho se seholo sa ΔFosB overexpression e sebelisa teko ea mehatla e 'meli (F(1, 11) = 4.1, P = 0.067). Leha ho le joalo, ha u fuoa tataiso ea tataiso e tsoang ho Green et al. (2010) le liphetho tsa bohlokoa le tse lumellanang tsa lipalo 3D, E, F, ho ka etsahala hore ΔFosB e fokotsehe ho khutlisetsoa (Setšoantšo (Figure3G) .3G). Ho arabela ho 10 mg / kg tekanyetso e ne e le tlase haholo bakeng sa likhoto tse hlalosang ΔFosB. Liphetho ka kakaretso li bonts'a hore ΔFosB e matlafatsang ka khetla ea NAc e fokotsa boitšoaro ba cocaine le bo batlang, bo tsamaisanang le litlamorao tsa boits'oaro ba tikoloho.
Puisano
Ho ba kotsing ea batho ba bang ba ho lemalla le ho tepella maikutlo ho angoa haholo ke maemo a tikoloho. Mohlodi wa tikoloho ke paradigm e sebelisang tikoloho ea liphoofolo e phelang, e hlahisang litlamorao khahlano le maemo a mangata a kelello. ΔFosB e bapala karolo ea bohlokoa ho laola ts'ebetso ea moputso libakeng tse ngata tsa boko, ho kenyeletsa le NAc le dorsal striatum (Koob et al., 1998; Bohlale, 1998; Wallace et al., 2008; Grueter et al., 2013; Pitchers et al., 2013). Morerong ona, re ithutile molao o matla oa ofFosB ka ho fokotsa khatello ea kelello le koae ka likhoto tse ruileng le tse ikhethileng. Liphetho tse kholo tsa morero ona ke:
(1) Likhoto tsa EC li phahamisitse maemo a ΔFosB ho NAc maemong a tlase ha a bapisoa le likhoto tsa IC;
(2) ke likhoto tsa IC feela tse bokellang protheine e eketsehileng ea osFosB ka khatello ea maikutlo khafetsa;
(3) Likhoto tsa EC li bonts'a ho kenella ha ΔFosB mRNA ka morao ho khatello ea kelello kapa cocaine; le
(4) xpFosB e fetang tekano ho NAc ea likhoto tse nang le matlo a mabeli li etsisa mokhoa oa ts'ireletso o lemalloang, empa eseng mokhoa o sireletsang oa khatello ea maikutlo.
Motho a ka lebella ho tsoa ho lingoliloeng tse phatlalalitsoeng, tse bonts'ang hore litoeba tsa transgenic ΔFosB tse fetang tekano li bonts'a kutloisiso e kholo ea moputso oa koae le ho itaola ka tekanyetso e tlase ea lithethefatsi (Kelz et al., 1999; Colby et al., 2003; Vialou et al., 2010; Robison et al., 2013), hore ΔFosB-overexpressing rats in the liteko tsa hona joale e tla bonts'a tekanyo e eketsehileng ea ho itaola le ho ts'oara koae. In Liteko tsa hajoale, leha ho le joalo, ΔFosB e matlafatsang ka khetla ea NAc e fokotse tšebeliso ea koae le ho ts'oara koae nakong ea ha e felisoa le ho khutlisetsoa ka botlalo, e bonts'ang sepheo se fokolisitsoeng sa koae. Phapang e ka bakoa ke taba ea hore litoeba tsa transgenic li hlalositse ΔFosB hohle striatum, empa ke liseleng tsa dynorphin + feela (Colby et al., 2003). Litekong tsa hajoale ΔFosB e ile ea hatisoa ka ho hlaka ka vector ea AAV e tšoaeang dynorphin + le enkephalin + neurons. Taba ea bobeli, boithuto ba hajoale bo ne bo shebane haholo le khetla ea NAc ho fapana le sebaka sohle sa litoro.
Ntle le tšebeliso ea bokhoba ba ho lemalla, ho ruisa tikoloho ho hlahisa lintlha tse bolaeang likhathatso le likhakanyo tse joalo ka litšoelesa literekeng (Green et al., 2010; Vialou et al., 2010). Phuputsong ea hona joale, oxpxpression ea ΔFosB ho NAc e hlolehile ho hlahisa litlamorao ho tse ling tsa liteko tse tharo tsa khatello ea maikutlo kapa tse tharo tsa ho tšoenyeha. Leha ho na le mabaka a mangata a ka 'nang a kenya letsoho ho ΔFosB ho etsisa ts'ebetso ea tšebeliso empa eseng semelo sa khatello ea maikutlo, ho ka etsahala hore khetla ea NAc e atile haholo bakeng sa boits'oaro bo amanang le bokhoba ha litloaelo tse amanang le khatello ea maikutlo li ka tsamaisoa ka matla le libaka tse ling. Se fumanoeng hajoale se hanana le lithuto tsa Litoeba moo ΔFosB e tebelitsoeng ho NAc (moo motho a ke keng a khona ho khetholla ka karolelano ea khetla ho tloha mantlha) e hlahisitse litlamorao tse ts'oanang le litlatsetso litekong tse 'maloa tsa boits'oaro (Vialou et al., 2010). Lebaka le leng le ka 'nang la etsahala ke hore ho ka ba bonolo ho bona phello ea ΔFosB ho mefuta e matla ea khatello ea maikutlo joalo ka khatello ea khatello ea sechaba. Phuputso ea hona joale ea overexpression e fuputse boits'oaro bo ts'oanang le khatello ea maikutlo ha ho se na khatello ea maikutlo e matla.
Nako le nako thutong ena kaofela, maemo a phahameng a ΔFosB (mohlala, ho tsoang moriring, khatello ea maikutlo kapa cocaine) e kopantsoeng le ΔFosB e fokolang. Sena se ka emela ts'ebetso ea siling, ntle le ho kenella ho eketsehileng ka holim'a maemo a phahameng a protheine. Ho ka etsahala hore maemo a bokelletsoeng a ΔFosB a ka iphelisa ho khutlisa ho kenella ha ΔFosB mRNA kamora khatello ea maikutlo kapa koae e le karabelo e mpe ea karabo. Ka mohlala, ELikhoto tsa C li ne li na le ΔFosB e phahameng ebile li bonts'a induction ea ΔFosB kamora khatello ea maikutlo le cocaine. Sena se hatisa khokahano e mpe pakeng tsa maemo a liprotheine tsa ΔFosB le tlhahiso ea eona ea mRNA. Maikutlo a mabe a ΔFosB e bokelletsoeng e boetse e ikarabella bakeng sa ho kenella ha ΔFosB ka khatello ea maikutlo khafetsa ho likhoto tsa IC.
Ho hlakisa, ha re hlahise liqoso tsa hore paradigm ea ntlafatso ea tikoloho e na le bohlokoa bo fetoletsoeng bo fetohileng, joalo ka ha ho na le bana ba fokolang haholo ba holisitsoeng tlhahisong ea 'nete (ho lokela ho hlokomeloa hore ho nyahlatsoa ha sechaba le moruo ha ho tšoane le tlholeho ea tikoloho). Sesebelisoa sa paradigm ena ke hore ke tšebeliso e seng ea lithethefatsi, e seng ea ho buoa, e seng ea liphatsa tsa lefutso e hlahisang tšireletso ea boits'ireletso bokhobeng le khatello ea maikutlo tse ka sebelisoang tikolohong e laoloang ke laboratori e le sesebelisoa sa saense sa ho tsebahatsa methapo ea limolek'hule. ho tiisetsa maemong a kelello. Pele patlisiso e hlalositse litekanyetso tsa boits'oaro ka botlalo (Bowling et al., 1993; Bowling le Bardo, 1994; Bardo et al., 1995; Green et al., 2002, 2003; El Rawas et al., 2009) le lithuto tsa morao-rao (Solinas et al., 2009; Green et al., 2010; Lobo et al., 2013), hammoho le thuto ea hajoale, li fana ka leseli mabapi le mekhoa e ngotsoeng e tlatselletsang tšebetsong tsena tsa boitšoaro. Mefuta / liprotheine tse thellisang tse tlase tse tlase li ntse li ntse li etsoa lipatlisiso (Fan et al., 2013a,b; Lichti et al., 2014).
Khopolo ea rona ea ho ruisa tikoloho ke hore moruo ke tšitiso ea ho ikarola qetellong le ho ruisa ka botlalo qetellong e phahameng. “Katleho e felletseng ”ntlheng ena e hlalosoa e le tikoloho eo ho eona baithuti ba nang le tšibollo ea litaba tse sa tloaelehang, tse se nang tšokelo sechabeng, mme ba lumelloa sebaka le lintho tsa ho ikoetlisa. Tmabaka a mararo kaofela a supa maemo a kopantsoeng a "ho ruisa" hobane a na le moputso o mong le o mong o hlahisang dopamine ho NAc, 'me ka lebaka leo, o kenya ts'ebetso ea potoloho e tloaelehileng ea methapo (Louilot et al., 1986; Kalanah Schechter, 1992; Crowder and Hutto, 1992; Rebec et al., 1997; Bevins et al., 2002). Khopolo-taba ena, ho ikhetholla ho nkoa e le sehlopha sa taolo hobane e emela ho ba sieo ha moano (ke hore, ho ruisa; Crofton et al., Ka tlhahlobo). Leha ho le joalo, conceptualizations tse ling lia khoneha. Khethollong e le 'ngoe e ts'oanang, e ts'oanang e tsoana, empa sehlopha se ikhethileng ke sehlopha sa liteko mme sehlopha se ruisitsoeng ke sona se laolang. In Moetso ona, o hlokisa lihlooho tsa ntlafatso e tloaelehileng is thetso. In nyeoe ena, ho ena le ho re ho ruisa ke tšireletso, motho a ka re ho itšehla thajana ho fana ka pherekano. Khakanyo ea boraro e tiisa hore ha ho na tsoelopele le hore ho ntlafatsa le ho itšehla thajana ke mananeo a mabeli a fapaneng a fapaneng. Ponong ena, ho ruisa le ho itšehla thajana li lokela ho arohana 'me ka bobeli li bapisoe le taolo e tsamaisang ntlo e' ngoe. Ho haella ha tumellano ea bokahohleng mabapi le mofuta oa ho ruisa ho emela moeli oa paradigm, leha ho le joalo e fana ka tataiso bakeng sa lithuto tsa nako e tlang. Ho sa tsotelehe, liphetho tsa liteko tsena li eme li tiile ho sa tsotellehe tlhaloso e latelang.
Tikoloho le liphihlelo tsa bophelo li na le tšusumetso e matla ntlafatsong le ponts'ong ea maemo a mangata a kelello. Ho utloisisa mokhoa oa ts'ebetso ea ts'ireletso le khatello ea maikutlo ho atiseng tikoloho ho araba potso ea bohlokoa phuputsong ea mathata a kelello-e leng tlatsetso ea tikoloho ho tsitsinyeheng kapa ho tiisetsa maemong a kelello. Boithuto bona bo totobatsa bohlokoa ba ΔFosB taolong boits'oaro bo amanang le bokhoba ba taolo. Lithutong tsa nako e tlang, ts'ebetso ea ΔFosB le ts'ebetso ea eona ea ts'ebetso le tse sitisang mefuta e meng ea sepheo li lokela ho hlahlojoa ho feta molemong oa ntlafatso ea tikoloho.
Lithuso le ho tsebahatsa
Yafang Zhang, ha a eo; Elizabeth J. Crofton, ha ho; Dingge Li, ha ho eo; Mary Kay Lobo, ha ho; Xiuzhen Fan, ha ho motho; Eric J. Nestler, R37DA007359; Thomas A. Green, DA029091.
Khohlano ea polelo ea thahasello
Bangoli ba bolela hore lipatlisiso li ne li etsoa ka ho se be le likamano leha e le life tsa khoebo kapa tsa lichelete tse ka nkoang e le khohlano e ka 'nang ea e-ba le thahasello.
lumela hore baa fokola
Liteko tsena li tšehelitsoe ka chelete e tsoang ho Setsi sa Naha sa Tlhekefetso ea Lithethefatsi, DA029091 le R37DA007359. Kokonate e fanoeng ke Setheo sa Naha sa Tlhekefetso ea Lithethefatsi.
References
- Akdeniz C., Tost H., Meyer-Lindenberg A. (2014). The neurobiology ea kotsi ea tikoloho ea tikoloho bakeng sa schizophrenia: lefapha le hlahisang lipatlisiso. Motsoalle Psychiatry Psychiatr. Epidemiol. 49, 507-517 10.1007 / s00127-014-0858-4 [E fetotsoe] [Ref Ref Cross]
- Alibhai IN, Green TA, Potashkin JA, Nestler EJ (2007). Taolo ea fosB le polelo ea DeltafosB mRNA: lithutong tsa vivo le tsa vitro. Brain Res. 1143, 22-33 10.1016 / j.brainres.2007.01.069 [Tlhahiso ea mahala ea PMC] [E fetotsoe] [Ref Ref Cross]
- Bardo MT, Bowling SL, Rowlett JK, Manderscheid P., Buxton ST, Dwoskin LP (1995). Khothaletso ea tikoloho e bonts'a sensitization ea locomotor, empa eseng ho tsoa ho vitro dopamine, e hlahisoang ke amphetamine. Pharmacol. Biochem. Behav. 51, 397-405 10.1016 / 0091-3057 (94) 00413-d [E fetotsoe] [Ref Ref Cross]
- Bevins RA, Besheer J., Palmatier MI, Jensen HC, Pickett KS, Eurek S. (2002). Boemo ba sebaka sa Novel: litloaelo tsa boitshwaro le dopaminergic ho hlahisa moputso o mocha. Behav. Brain Res. 129, 41-50 10.1016 / s0166-4328 (01) 00326-6 [E fetotsoe] [Ref Ref Cross]
- Bowling SL, Bardo MT (1994). Liphello tse matlafatsang le tse khotsofatsang tsa amphetamine ho ruileng, sechabeng le ho khetholla likhoto. Pharmacol. Biochem. Behav. 48, 459-464 10.1016 / 0091-3057 (94) 90553-3 [E fetotsoe] [Ref Ref Cross]
- Bowling SL, Rowlett JK, Bardo MT (1993). Kameho ea ho ruisa tikoloho mosebetsing oa amphetamine o susumetsang, dopamine synthesis le dopamine. Neuropharmacology 32, 885-893 10.1016 / 0028-3908 (93) 90144-r [E fetotsoe] [Ref Ref Cross]
- Calcagnetti DJ, Schechter MD (1992). Sebaka sa maemo a sebaka se senola karolo e khotsofatsang ea tšebelisano ea batho litabeng tsa bana. Physiol. Behav. 51, 667-672 10.1016 / 0031-9384 (92) 90101-7 [E fetotsoe] [Ref Ref Cross]
- Chen J., Nye HE, Kelz MB, Hiroi N., Nakabeppu Y., Hope BT, et al. (1995). Taolo ea li-protein tsa delta FosB le tsa FosB ka ho ts'oaroa ke motlakase le kalafo ea koae. Mol. Pharmacol. 48, 880-889 [E fetotsoe]
- Colby CR, Whisler K., Steffen C., Nestler EJ, Self DW (2003). Striatal cell Type overexpression e khethehileng ea DeltaFosB e ntlafatsa ts'usumetso ea koae. J. Neurosci. 23, 2488-2493 [E fetotsoe]
- Crowder WF, Hutto CW (1992). Mehato ea boemo ba ts'ebetso e hlahlojoang e sebelisa li-reinforcers tse peli tsa nondrug. Pharmacol. Biochem. Behav. 41, 817-824 10.1016 / 0091-3057 (92) 90233-6 [E fetotsoe] [Ref Ref Cross]
- Elisei S., Sciarma T., Verdolini N., Anastasi S. (2013). Ho tsitsipana le mathata a sithabetsang. Psychiatr. Danub. 25 (Suppl. 2), S263-S267 [E fetotsoe]
- El Rawas R., Thiriet N., Lardeux V., Jaber M., Solinas M. (2009). Katoloso ea tikoloho e fokotsa moputso empa e seng litlamorao tse sebetsang tsa heroin. Psychopharmacology (Berl) 203, 561-570 10.1007 / s00213-008-1402-6 [E fetotsoe] [Ref Ref Cross]
- Fan X., Li D., Lichti CF, Green TA (2013a). Liprotheine tse matla tsa li-nucleus li bokellana ka lebaka la khatello ea maikutlo e matla ho likhoto tse ruileng le tse ikhethileng tikolohong. PloS One 8: e73689 10.1371 / journal.pone.0073689 [Tlhahiso ea mahala ea PMC] [E fetotsoe] [Ref Ref Cross]
- Fan X., Li D., Zhang Y., Green TA (2013b). Phapang e fapaneng ea phosphoproteome ea li-nucleus tse bokellanang tikolohong e ruileng le e itšehlang thajana ho arabela khatello ea maikutlo. PloS One 8: e79893 10.1371 / journal.pone.0079893 [Tlhahiso ea mahala ea PMC] [E fetotsoe] [Ref Ref Cross]
- Green TA, Alibhai IN, Hommel JD, Dileone RJ, Kumar A., Theobald DE, et al. (2006). Tlhahiso ea polelo e sa sebetseng ea cAMP ea pele ea khatello ea methapo e bokellanang ka khatello ea maikutlo kapa amphetamine e eketsa karabelo ea boitšoaro ho susumetso ea maikutlo. J. Neurosci. 26, 8235-8242 10.1523 / jneurosci.0880-06.2006 [E fetotsoe] [Ref Ref Cross]
- Green TA, Alibhai IN, Roybal CN, Winstanley CA, Theobald DE, Birnbaum SG, et al. (2010). Kholiso ea tikoloho e hlahisa mofuta oa boitšoaro oa phenotype o kopantsoeng le ts'ebetso e tlase ea cyclic adenosine monophosphate reaction element (CREB) ho li-nucleus accumbens. Biol. Psychiatry 67, 28-35 10.1016 / j.biopsych.2009.06.022 [Tlhahiso ea mahala ea PMC] [E fetotsoe] [Ref Ref Cross]
- Green TA, Alibhai IN, Unterberg S., Neve RL, Ghose S., Tamminga CA, et al. (2008). Tlhahiso ea lintlha tse qalang tsa ho ngola (ATFs) ATF2, ATF3 le ATF4 ho li-nucleus accumbens le taolo ea bona ea boitšoaro ba maikutlo. J. Neurosci. 28, 2025-2032 10.1523 / jneurosci.5273-07.2008 [E fetotsoe] [Ref Ref Cross]
- Green TA, Kaine ME, Thompson M., Bardo MT (2003). Phumatso ea tikoloho e fokotseha khatello ea maikutlo e bakoang ke nicotine ho likhoto. Psychopharmacology (Berl) 170, 235-241 10.1007 / s00213-003-1538-3 [E fetotsoe] [Ref Ref Cross]
- Green TA, Gehrke BJ, Bardo MT (2002). Phumatso ea tikoloho e fokotsa taolo ea methapo ea methapo ho litheko: ts'ebetso ea karabelo ea tekanyetso bakeng sa litekanyetso tse tsitsitseng le tse tsoelang pele. Psychopharmacology (Berl) 162, 373-378 10.1007 / s00213-002-1134-y [E fetotsoe] [Ref Ref Cross]
- Grueter BA, Robison AJ, Neve RL, Nestler EJ, Malenka RC (2013). ΔFosB e fapaneng ka mokhoa o fapaneng e bokella tsela e tsamaeang ka kotloloho le e sa tobang. Proc. Natl. Acad. Saense USA 110, 1923-1928 10.1073 / pnas.1221742110 [Tlhahiso ea mahala ea PMC] [E fetotsoe] [Ref Ref Cross]
- Tšepo B., Kosofsky B., Hyman SE, Nestler EJ (1992). Taolo ea polelo ea pele ea liphatsa tsa lefutso le AP-1 e tlamang lenaneong la litekanyetso ke cocaine e sa foleng. Proc. Natl. Acad. Saense USA 89, 5764-5768 10.1073 / pnas.89.13.5764 [Tlhahiso ea mahala ea PMC] [E fetotsoe] [Ref Ref Cross]
- Tšepo BT, Nye HE, Kelz MB, Self DW, Iadarola MJ, Nakabeppu Y., et al. (1994). Tlhahiso ea motsoako oa AP-1 oa nako e telele o qapiloeng ke liprotheine tse kang Fos ka bokong ka cocaine e sa feleng le kalafo tse ling tse sa foleng. Neuron 13, 1235-1244 10.1016 / 0896-6273 (94) 90061-2 [E fetotsoe] [Ref Ref Cross]
- Jha S., Dong B., Sakata K. (2011). Phekolo ea tikoloho e ntlafalitsoeng e khutlisetsa boits'oaro bo ts'oanang le khatello ea maikutlo mme e khutlisetsa maemo a fokotsang a hippocampal neurogeneis le liprotheine tsa neurotrophic tse tsoang bokong ho litoeba tse haelloang ke polelo ea tsona ka papatso ea IV. Fetolela. Psychiatry 1: e40 10.1038 / tp.2011.33 [Tlhahiso ea mahala ea PMC] [E fetotsoe] [Ref Ref Cross]
- Kato T., Iwamoto K. (2014). Tlhahlobo e phethahetseng ea methapo ea DNA le hydroxymethylation bokong ba motho le seo e se bolelang likhatellong tsa kelello. Neuropharmacology 80, 133-139 10.1016 / j.neuropharm.2013.12.019 [E fetotsoe] [Ref Ref Cross]
- Kelz MB, Chen J., Carlezon WA, Whisler K., Gilden L., Beckmann AM, et al. (1999). Khopolo ea "transaction factor deltaFosB" bokong e laola maikutlo a cocaine. Tlhaho 401, 272-276 10.1038 / 45790 [E fetotsoe] [Ref Ref Cross]
- Kelz MB, Nestler EJ (2000). deltaFosB: phetoho ea limolek'hule tlas'a motheo oa neural oa nako e telele. Borr. Opin. Neurol. 13, 715-720 10.1097 / 00019052-200012000-00017 [E fetotsoe] [Ref Ref Cross]
- Koob GF, Sanna PP, Bloom FE (1998). Neuroscience ea ho lemalla. Neuron 21, 467-476 [E fetotsoe]
- Larson EB, Graham DL, Arzaga RR, Buzin N., Webb J., Green TA, et al. (2011). Ho pepeseha ha CREB ka har'a khetla ea nucleus e eketsa matlafatso ea koae ho litoeba tse iphelisang. J. Neurosci. 31, 16447-16457 10.1523 / JNEUROSCI.3070-11.2011 [Tlhahiso ea mahala ea PMC] [E fetotsoe] [Ref Ref Cross]
- Laviola G., Hannan AJ, Macrì S., Solinas M., Jaber M. (2008). Liphello tsa tikoloho e ntlafalitsoeng mefuteng ea liphoofolo ea mafu a neurodegenerative le mafu a kelello. Neurobiol. Dis. 31, 159-168 10.1016 / j.nbd.2008.05.001 [E fetotsoe] [Ref Ref Cross]
- Lichti CF, Fan X., English RD, Zhang Y., Li D., Kong F., et al. (2014). Polelo ea ntlafatso ea tikoloho e fetola polelo ea liprotheine hammoho le karabelo ea protheine ea koae ho li-ligator tsa rat. Ka pele. Behav. Neurosci. 8: 246 10.3389 / fnbeh.2014.00246 [Tlhahiso ea mahala ea PMC] [E fetotsoe] [Ref Ref Cross]
- Lobo MK, Zaman S., Damez-Werno DM, Koo JW, Bagot RC, Dinieri JA, et al. (2013). UctionFosB e kenyellelitsoeng ka har'a methapo ea methapo e bohareng ea "metso" e arabelang ka lebaka la khatello ea maikutlo e sa feleng ea tlhaho, maikutlo le maikutlo. J. Neurosci. 33, 18381-18395 10.1523 / JNEUROSCI.1875-13.2013 [Tlhahiso ea mahala ea PMC] [E fetotsoe] [Ref Ref Cross]
- Louilot A., Le Moal M., Simon H. (1986). Reacuction e fapaneng ea li-neuron tsa dopaminergic ho li-nucleus e bokellana ho arabela maemong a fapaneng a boitšoaro. Phuputso e entsoeng ka vivo voltammetric ho litheko tse tsamaeang mahala. Brain Res. 397, 395-400 10.1016 / 0006-8993 (86) 90646-3 [E fetotsoe] [Ref Ref Cross]
- McBride WJ, Kimpel MW, Mcclintick JN, Ding ZM, Edenberg HJ, Liang T., et al. (2014). Liphetoho lipuisanong tsa liphatsa tsa lefutso ka har'a li-amygdala tse atileng tse latelang ho itlopa joala-joalo ka ho noha joala ke likotlo tse khethang joala tsa bongoana. Pharmacol. Biochem. Behav. 117, 52-60 10.1016 / j.pbb.2013.12.009 [Tlhahiso ea mahala ea PMC] [E fetotsoe] [Ref Ref Cross]
- Mlynarik M., Johansson BB, Jezova D. (2004). Tikoloho e ntlafalitsoeng e susumetsa karabelo ea adrenocortical ho phephetso ea boits'ireletso le glutamate polelo ea liphatsa tsa lefutso ho rat hippocampus. Ann. NY Acad. Saense 1018, 273-280 10.1196 / annals.1296.032 [E fetotsoe] [Ref Ref Cross]
- Nestler EJ (2001). Molek'hule ea moea oa ho lemalla. Am. J. Addict. 10, 201-217 10.1080 / 105504901750532094 [E fetotsoe] [Ref Ref Cross]
- Nestler EJ (2008). Tlhahlobo. Mekhoa e meng ea ho lemalla: karolo ea DeltaFosB. Philos. Trans. R. Soc. Monyaluoa. B Biol. Saense 363, 3245-3255 10.1098 / rstb.2008.0067 [Tlhahiso ea mahala ea PMC] [E fetotsoe] [Ref Ref Cross]
- Nestler EJ, Barrot M., Self DW (2001). DeltaFosB: phetoho e tsitsitseng ea molek'hule bakeng sa ho lemalla. Proc. Natl. Acad. Saense USA 98, 11042-11046 10.1073 / pnas.191352698 [Tlhahiso ea mahala ea PMC] [E fetotsoe] [Ref Ref Cross]
- Perrotti LI, Hadeishi Y., Ulery PG, Barrot M., Monteggia L., Duman RS, et al. (2004). Ho hlahisoa ha deltaFosB ka likarolo tsa boko tse amanang le moputso kamora khatello ea maikutlo e sa foleng. J. Neurosci. 24, 10594-10602 10.1523 / jneurosci.2542-04.2004 [E fetotsoe] [Ref Ref Cross]
- Perrotti LI, Weaver RR, Robison B., Renthal W., Maze I., Yazdani S., et al. (2008). Mekhoa e fapaneng ea tlhahiso ea DeltaFosB bokong ka lithethefatsi tsa tlhekefetso. Synapse 62, 358-369 10.1002 / syn.20500 [Tlhahiso ea mahala ea PMC] [E fetotsoe] [Ref Ref Cross]
- Pitchers KK, Vialou V., Nestler EJ, Laviolette SR, Lehman MN, Coolen LM (2013). Meputso ea tlhaho le ea lithethefatsi e sebetsa ho mekhoa e tloaelehileng ea neural plasticity e nang le ΔFosB e le mokena-lipakeng oa bohlokoa. J. Neurosci. 33, 3434-3442 10.1523 / jneurosci.4881-12.2013 [Tlhahiso ea mahala ea PMC] [E fetotsoe] [Ref Ref Cross]
- Rebec GV, Christensen JR, Guerra C., Bardo MT (1997). Phapang ea tikoloho le ea nakoana nakong ea 'nete ea dopamine efflux bokong ba li-nucleus nakong ea khetho ea maiketsetso ea mahala. Brain Res. 776, 61-67 10.1016 / s0006-8993 (97) 01004-4 [E fetotsoe] [Ref Ref Cross]
- Robison AJ, Vialou V., Mazei-Robison M., Feng J., Kourrich S., Collins M., et al. (2013). Likarabo tsa boitšoaro le tsa sebopeho sa koae e sa foleng li hloka phepelo e kopanyang involvingFosB le calcium / proteinodulin e itšetlehileng ka protheine kinase II mokokotlong oa li-nucleus accumbens. J. Neurosci. 33, 4295-4307 10.1523 / jneurosci.5192-12.2013 [Tlhahiso ea mahala ea PMC] [E fetotsoe] [Ref Ref Cross]
- Smith JK, Neill JC, Costall B. (1997). Maemo a bolulo a kamora ho khoesoa kamora 'mele a susumetsa litlamorao tsa boitšoaro ba koae le c-amphetamine. Psychopharmacology (Berl) 131, 23-33 10.1007 / s002130050261 [E fetotsoe] [Ref Ref Cross]
- Solinas M., Chauvet C., Thiriet N., El Rawas R., Jaber M. (2008). Phetoho ea ho lemalla koae ka ho ruisa tikoloho. Proc. Natl. Acad. Saense USA 105, 17145-17150 10.1073 / pnas.0806889105 [Tlhahiso ea mahala ea PMC] [E fetotsoe] [Ref Ref Cross]
- Solinas M., Thiriet N., El Rawas R., Lardeux V., Jaber M. (2009). Ho ruisa tikoloho nakong ea methapo ea bophelo, ho fokotsa litla-morao tsa boitšoaro le methapo ea kutlo. Neuropsychopharmacology 34, 1102-1111 10.1038 / npp.2008.51 [E fetotsoe] [Ref Ref Cross]
- DJ oa Stairs, Prendergast MA, Bardo MT (2011). Phapang e bakiloeng ke tikoloho ho corticosterone le glucocorticoid receptor blockade ea amphetamine boits'elo ho likhoto. Psychopharmacology (Berl) 218, 293-301 10.1007 / s00213-011-2448-4 [Tlhahiso ea mahala ea PMC] [E fetotsoe] [Ref Ref Cross]
- Thiel KJ, Pentkowski NS, Peartree NA, Painter MR, Neisewander JL (2010). Maemo a bophelo a tikoloho a hlahisoang nakong ea ts'ebetso e qobelloang ea ho ila koae le mokhoa oa protheine oa Fos. Neuroscience 171, 1187-1196 10.1016 / j.neuroscience.2010.10.001 [Tlhahiso ea mahala ea PMC] [E fetotsoe] [Ref Ref Cross]
- Thiel KJ, Sanabria F., Pentkowski NS, Neisewander JL (2009). Litlamorao tse khahlano le ho ruisa tikoloho. Int. J. Neuropsychopharmacol. 12, 1151-1156 10.1017 / s1461145709990472 [Tlhahiso ea mahala ea PMC] [E fetotsoe] [Ref Ref Cross]
- van Winkel M., Peeters F., Van Winkel R., Kenis G., Collip D., Geschwind N., et al. (2014). Kameho ea phapano mohloling oa BDNF mabapi le khatello ea kelello ea sechaba le phello e mpefatsang ea maikutlo a nepahetseng: ho pheta-pheta le katoloso ea tšebelisano ea tikoloho ea gene. EUR. Neuropsychopharmacol. 24, 930-938 10.1016 / j.euroneuro.2014.02.005 [E fetotsoe] [Ref Ref Cross]
- Venebra-Muñoz A., Corona-Morales A., Santiago-García J., Melgarejo-Gutiérrez M., Caba M., García-García F. (2014). Tikoloho e ntlafalitsoeng e bonts'a ts'ebetso ea nicotine ebile e etsa hore ho be le liphetoho puong ea ΔFosB ho "preortalal cortex" le "nucleus" ea pele. Neuroreport 25, 694-698 10.1097 / wnr.0000000000000157 [E fetotsoe] [Ref Ref Cross]
- Vialou V., Robison AJ, Laplant QC, Covington HE, Dietz DM, Ohnishi YN, et al. (2010). DeltaFosB ho li-circuits tsa moputso oa boko li thusa ho sebetsana le khatello ea maikutlo le likarabo tse khahlanong le khatello ea maikutlo. Nat. Neurosci. 13, 745-752 10.1038 / nn.2551 [Tlhahiso ea mahala ea PMC] [E fetotsoe] [Ref Ref Cross]
- Wallace DL, Vialou V., Rios L., Carle-Florence TL, Chakravarty S., Kumar A., et al. (2008). Tšusumetso ea DeltaFosB bokong e bokellana holim'a boitšoaro bo amanang le moputso oa tlhaho. J. Neurosci. 28, 10272-10277 10.1523 / jneurosci.1531-08.2008 [Tlhahiso ea mahala ea PMC] [E fetotsoe] [Ref Ref Cross]
- Wang Y., Cesena TI, Ohnishi Y., Burger-Caplan R., Lam V., Kirchhoff PD, et al. (2012). Ho hlahlojoa ha molek'hule e nyane ho supa ba laolang karolo ea criptionFosB. ACS Chem. Neurosci. 3, 546-556 10.1021 / cn3000235 [Tlhahiso ea mahala ea PMC] [E fetotsoe] [Ref Ref Cross]
- Werme M., Messer C., Olson L., Gilden L., Thorén P., Nestler EJ, et al. (2002). Delta FosB e laola mabili a tsamaeang. J. Neurosci. 22, 8133-8138 [E fetotsoe]
- Winstanley CA, Bachtell RK, Theobald DE, Laali S., Green TA, Kumar A., et al. (2009a). Keketseho e kenelletseng nakong ea ho khaotsa ho itlhokomela ka koae: karolo ea DeltaFosB ho cortex ea orbitof Pambal. Cereb. Cortex 19, 435-444 10.1093 / cercor / bhn094 [Tlhahiso ea mahala ea PMC] [E fetotsoe] [Ref Ref Cross]
- Winstanley CA, Green TA, Theobald DE, Renthal W., LaPlant Q., DiLeone RJ, et al. (2009b). Ho kenella ka DeltaFosB ho orbitofrontal cortex sensentiization ea phenomotor leha ho le joalo ho fumana ho se sebetse hantle hoa kelello ho bakoang ke koae. Pharmacol. Biochem. Behav. 93, 278-284 10.1016 / j.pbb.2008.12.007 [Tlhahiso ea mahala ea PMC] [E fetotsoe] [Ref Ref Cross]
- Winstanley CA, LaPlant Q., Theobald DE, Green TA, Bachtell RK, Perrotti LI, et al. (2007). DeltaFosB induction ea orbitofrontal cortex e mamellana mamellong ea ho se sebetse hantle ha koae ka koae. J. Neurosci. 27, 10497-10507 10.1523 / jneurosci.2566-07.2007 [E fetotsoe] [Ref Ref Cross]
- RA ea bohlale (1998). Ts'ebeliso ea lithethefatsi ea lits'ebetso tsa moputso oa boko. Lithethefatsi. 51, 13-22 10.1016 / s0376-8716 (98) 00063-5 [E fetotsoe] [Ref Ref Cross]