Prefrontal Cortical Potoloho ea ho Tepella Maikutlong- le Lintho Tse Amanang le ho Tšoenyeha Tse Amanang le Cholecystokinin: Karolo ea ΔFosB (2014)

J Neurosci. 2014 Mar 12; 34 (11): 3878-3887.
doi: 10.1523 / JNEUROSCI.1787-13.2014

PMCID: PMC3951691

Vincent Vialou,^1,^6,^7,⁸ Rosemary C. Bagot,¹ Michael E. Cahill,¹ Deveroux Ferguson,¹ Alfred J. Robison,² David M. Dietz,³ Barbara Fallon,² Michelle Mazei-Robison,² Stacy M. Ku,¹ Eileen Harrigan,¹ Katherine A. Winstanley,⁴ Tej Joshi,¹ Jian Feng,¹ Olivier Berton,⁵ 'me Eric J. Nestler¹

Boitsebiso ba Mongoli ► Sehlooho sa Article ► Tlhahisoleseding ea Copyright le License ►

Sehlooho sena se bile teng e boletsoeng ke lihlooho tse ling ho PMC.

inahaneloang

Ts'ebetso ea neuronal ea prelineal cortex (mPFC) e theohileng ea medial e kopantsoe le khatello ea maikutlo e tlisoang ke khatello ea maikutlo le boits'oaro bo kang ho tšoenyeha. Leha ho le joalo, methapo ea limolek'hule e bakileng ts'ebetso ea MPFC e fokotsehileng le karolo ea eona ea protepressant e lula e sa tsejoe. Re bonts'a mona hore ho kenyelletsa ntho ea transcript factor ΔFosB ho mPFC, haholo sebakeng sa prelimbic (PrL), ho nka bohato ba khatello ho khatello. Ho kenella ha osFosB ho PrL ho etsahetse ka mokhoa o ikhethileng ka litloebelele tse senyehileng kamora khatello ea khatello ea mantlha ea khatello ea sechaba, le khatello e fetisisang ea ΔFosB sebakeng sena, empa eseng sebakeng se haufi sa infralimbic (IL), se ntlafatsang khatello ea maikutlo. ΔFosB e hlahisitse litla-morao tsena ka ho kenella ho cholecystokinin (CCK) -B receptor: CCKB blockade in mPFC induces phenthype, athe tsamaiso ea CCK ho mPFC e etsisa lits'oants'o tsa khatello ea maikutlo sechabeng. Pejana re fumane hore ts'usumetso ea optogenetic ea li-neuron tsa mPFC litoeba tse sa bonahaleng e khutlisetsa litlolo tse mpe tsa boits'oaro tse bonoang kamora khatello e matla ea khatello ea sechaba. Ka hona, re ile ra nahana hore ts'usumetso ea optogenetic ea likhakanyo tsa cortical e tla lopolla litla-morao tsa CCK ho mPFC. Kamora ho kenella ha CCK ho mPFC, re ile ra susumetsa likhakanyo tsa mPFC ho li-amygdala tsa basolateral kapa li-nucleus, mekhatlo e 'meli e ikemetseng e kentseng letsoho taolong ea maikutlo. Ho hlohlelletsa likhakanyo tsa corticoamygdala ho thibetse mokokotlo oa CCK, leha ho se na phello e ileng ea bonoa matšoao a mang a ho hloleha sechabeng. Ka lehlakoreng le leng, ho hlohlelletsa ha likhakanyo tsa corticoaccumbens ho khutlisitse qobello ea boiketlo ba sechaba ba CCK le bofokoli ba ho ikhetholla empa eseng litlamorao tse kang tsa ho tšoenyeha. Ka bobeli, liphetho tsena li bonts'a hore bofokoli ba boitšoaro bo susumetsoang ke boiketlo ba sechaba bo kopantsoe le likarolo tse ling ka liphetoho tsa limolek'hule tsa MPFC tse kenyelletsang ΔFosB le CCK ka lipakanyo tsa cortical ho khetholla sepheo sa subcortical.s.

Keywords: li-accumbens, amygdala, matšoenyeho, CCK, khatello ea maikutlo, mPFC

Selelekela

Likarolo tse 'maloa tsa boko le li-limbic li kopantsoeng ka bokhabane, ho kenyelletsa medial prefrontal cortex (mPFC), hippocampus, amygdala, le nucleus accumbens (NAc), li na le tšusumetso ho hanyetsang matšoao a bohlokoa a khatello ea maikutlo le matšoenyeho (Bremner, 1999; Drevets, 2001; Keedwell et al., 2005; Mayberg et al., 2005; Bremner, 2006, 2007; Krishnan le Nestler, 2008; Feder et al., 2009). Mohlala, ho ba sieo ha maikutlo a cortical ho amygdala ho amana le maikutlo a dysphoric mme o khutlela maemong a tloaelehileng holim'a kalafo e atlehileng. Litlamorao tsa khatello ea kelello e matlafatsang ea tlhaho e tebileng ea cingrate cortex, sebaka sa mPFC, li amahanngoa le ho khutlisetsoa hoa tšebetso ea boko ba cortical le subcortical maemong a tloaelehileng.Mayberg et al., 2005; Nahas et al., 2010). Ka mokhoa o ts'oanang, ts'usumetso e tebileng ea boko ba NAc ke antidepressant le anxiolytic mme e lumellana le metabolism e fetotsoeng ho NAc, amygdala, le mPFC (Schlaepfer et al., 2008; Bewernick et al., 2010; Grubert et al., 2011). Lintlha tsena li tšehetsa khokahano ea neural network ea mathata a ho feto-fetoha ha maikutlo moo kalafo ea meriana e thibelang khatello ea kelello, ho sa tsotelehe methati, e hlophisang tšebetso maemong ohle a ts'ebetso ea likonteraka tse sa sebetseng le tse sebetsang haholo (Kennedy et al., 2001; Mayberg et al., 2005; Kennedy le Giacobbe, 2007; Fales et al., 2008; Fales et al., 2009; Leistedt le Linkowski, 2013).

Mefuta ea liphoofolo e amanang le ho pepesetsoa khatello ea maikutlo kapa khatello ea maikutlo e sitisa sebopeho le tšebetso ea li-neuron ho mPFC (Radley et al., 2006), amygdala (Akirav le Maroun, 2007), hippocampus (Sebelisa et al., 2011), le NAc (Vialou et al., 2010; Christoffel et al., 2011). Matšoenyeho a sa feleng a khatello ea sechaba, mohlala o hlakileng oa khatello ea maikutlo (Berton et al., 2006), e fokotsa ts'ebetso ea methapo ea MPFC joalo ka ha e tsoa lenaneong le fokotsehileng la Zif268 le c-Fos (Covington et al., 2005; Covington et al., 2010). Ntle le moo, ts'usumetso ea optogenetic ea mPFC e khutlisetsa bofokoli bona mme e fana ka litlamorao tse kang antidepressant-like (Covington et al., 2010), e netefatsang bohlokoa ba mPFC ho liketsahalo tse amanang le maikutlo. The rodent mPFC, joalo ka mehleng ea khale, e laola boits'oaro ba maikutlo ka karolo ka ho qhanolla ho fihlela ho basolateral amygdala (BLA) le NAc (Vogt et al., 1992; Barbas le Blatt, 1995; Heidbreder le Groenewegen, 2003). Leha ho le joalo, mekhoa ea limolek'hule e etsang karolo ena ea mPFC e ntse e sa tsejoe.

Boithuto ba hona joale bo ne bo tsepamisitse maikutlo ho ΔFosB, ntho e tsitsitseng ea ho ngola e etsoang ho NAc ke khatello ea maikutlo ea khatello ea setjhaba moo e hananang le khatello ea maikutlo (Vialou et al., 2010). Re sebelisitse 'mapa o akaretsang oa ts'ebetso ea ΔFosB kamora khatello ea khatello mme re fumane, joalo ka lithuto tsa pejana (Perrotti et al., 2004; Nikulina et al., 2008; Lehmann le Herkenham, 2011), ho kenella ka matla ho mPFC. Ho makatsang ke hore re fumane hore ΔFosB e kenelletseng mPFC e khothalletsa khatello ea maikutlo. Re supile cholecystokinin (CCK) -B receptor e le sepheo sa limolek'hule sa ΔFosB ho mPFC, moo ts'ebetso ea methapo ea methapo ea methapo ea CCKerg e kentsoe ts'ebetsong ea khatello ea maikutlo le depressogenic ea khatello ea sechaba (Becker et al., 2001, 2008). Re fumane hore ts'ebetso ea CCK ho mPFC e bohlokoa ebile e lekane bakeng sa litlamorao tse kang khatello ea maikutlo le khatello ea maikutlo. Ho feta moo, ka ts'ebeliso ea mekhoa ea optogenetic, re bonts'a liketso tse ikhethang tsa CCK maemong a mPFC: CCK ho mPFC-BLA projeke e hokahanya matšoao a ho tšoenyeha, athe CCK ho mPFC-NAc merero e hokahanya matšoao a khatello ea maikutlo.

Lisebelisoa le mekhoa

Teko ea 1: 'Mapa o pharalletseng oa ΔFosB o hlahisang khatello ea kelello ea khatello ea kelello ea khatello ea kelello.

Limpho tse tona tsa libeke tse robeli tsa C57BL / 6J li ile tsa ba le khatello ea maikutlo e sa feleng ea khatello ea kelello bakeng sa matsatsi a 10 a latellanang joalokaha ho hlalositsoe pele (Berton et al., 2006; Krishnan et al., 2007; Vialou et al., 2010) (bona Lethathamo 1; Feie. 1A). Ka bokhutšoanyane, mouse e 'ngoe le e' ngoe e ile ea pepesetsoa phoofolo ea mohoebi e sa sebetseng e mabifi ea CD1 ka 5 min ka letsatsi. Kamora ho sebelisana ka kotloloho le CD1 aggressor (5 min), liphoofolo li ile tsa beoa kamoreng e haufi le terata e le 'ngoe bakeng sa 24 h e latelang ka maqhubu a maikutlo, empa eseng ka' mele. Liphoofolo tse laoloang li ne li bolokiloe makaleng a lekanang empa li ne li fuoa litho tsa mofuta o le mong. Liteko tsa tšebelisano ea sechaba li ile tsa etsoa 24 h kamora letsatsi la ho qetela la ho hloloa. Thibelo ea boiketlo ba sechaba ho panya ea monna ea CD1 e sa tsejoeng e ile ea hlahlojoa ho latela protocol e phatlalalitsoeng. Nako e sebelisitsoeng "sebakeng sa tšebelisano" (phapang e bolelele ba 8-cm e pota-potileng kh'harale) e lekantsoe. Ho arohana ha litoeba tse hlotsoeng hore e be liphofu tse ka qhekelloang le tse khutsitseng ho entsoe joalo ka ha ho hlalositsoe peleKrishnan et al., 2007; Vialou et al., 2010). Hobane bongata ba litoeba tsa taolo li qeta nako e ngata li sebelisana le sepheo sa sechaba ho fapana le sebaka se se nang letho, karolelano ea tšebelisano ea 100 (nako e lekanang e sebelisitsoeng sebakeng sa tšebelisano boteng le ho ba sieo ha sepheo sa sechaba) e sebelisoa e le cutoff: Litoeba tse nang le lintlha tse <100 li ngotsoe e le "tse hlaselehang habonolo", 'me tse nang le lintlha tse ngata ≥100 li "mamella." Litlhahlobo tse pharalletseng tsa boits'oaro, biochemical le electrophysiological li tšehetsa bonnete ba likaroloana tsena tse bonolo tse ka hlaseloang habonolo.Krishnan et al., 2007; Wilkinson et al., 2009; Vialou et al., 2010).

Palo ea bolele (± SEM) ea vaerase ea FosB-immunoreactive ka limilimithara² libakeng tsa bokong tsa taolo, tse ling habonolo le litoeba tsa 24 h tse sa feleng (10 d) khatello ea maikutlo ea setjhaba

Setšoantšo sa 1.

Setšoantšo sa 1.

Induction ea ΔFosB ho mPFC e thusa ho hatella khatello ea maikutlo. A, Li-photomicrographs tsa moemeli oa osFosB immunohistochemistry ho mPFC 24 h kamora ho qetela la li-episode tsa 10 tsa ho hlola sechaba. B, Tlhahiso ea ΔFosB ha e hlahe GABAergic ...

Hang kamora tlhahlobo ea tšebelisano ea sechaba, litoeba li ne li sa sebetsoa li bile li entsoe ka mokhoa o ikhethileng ka 4% paraformaldehyde / PBS. Palo ea sele ka ΔFosB⁺ li-neurons tsa NAc li ne li etsoa joalokaha ho hlalositsoe pele (Vialou et al., 2010). Li-brains li ile tsa hlakoloa ka 30% sucrose le likaroloana tsa coronone (30 )m) li ile tsa roaloa microtome e sa tsitsang 'me ea sebetsoa bakeng sa immunohistochemistry. Likarolo tse phaphametseng tsa mahala li ne li entsoe ka pele ho buffer e thibelang e nang le 0.3% Triton le 3% serum ea poli e tloaelehileng. ΔFosB e fumanoe e sebelisa li-antibodies tsa mmutla tsa polyclonal tse phahamisitsoeng khahlanong le karolo ea N-terminal ea protheine (1 / 1000 Santa Cruz Biotechnology, lethathamo la # sc-48) ka buffer e le 'ngoe, ebe e sebetsoa ka li-antibodies tsa poli ea Igot le li-avidin-biotin Mokhoa o rarahaneng oa peroxidase le DAB e le substrate (Vector Laboratories). Linako tsa incubation tsa Diaminobenzidine li ne li bolokoa khafetsa bakeng sa maemo ohle (100 s). Likhechana li ne li ts'oaroa, ho angoa le ho koaheloa ka metsi. Lisele tsa ΔFosB-immunopositive li bonts'itse boemo bo itseng ba sootho kahar'a mothapo mme bo ile ba hlalosoa ke bashebelli ba sa boneng maemo a kalafo ba sebelisa microscope (kholo ea 20 ×). Likarolo tse tharo tse khethiloeng tsa boko tse nkiloeng sebakeng se seng le se seng sa boko li ile tsa khethoa ka ho panya bakeng sa quanifying. Khethollo ea anatomical ea karolo e 'ngoe le e' ngoe ea boko e entsoe ka ho bapisa karolo eo le "atxinos mouse brain atlas". Maemo a immunohistochemistry a ile a ntlafatsoa ho fokotsa maemo a ka morao ho ea tlase ho lumella tlhaiso e nepahetseng ea lisele tse ntle tsa ΔFosB. Bohlokoa ba boleng bo ne bo baloa phoofolo ka 'ngoe' me bo nkuoa e le tlhaiso ea motho ka mong bakeng sa tlhahlobo ea lipalo. Le ha antibody e sebelisitsoeng e amohela ΔFosB ka bobeli le bolelele bo felletseng, re tseba ka ho hlakola hore ke ΔFosB feela e ka bonoang tlasa maemo a ithutoang (Perrotti et al., 2004; Vialou et al., 2010).

Teko ea 2: tlhahlobo ea khatello ea maikutlo ea khatello ea maikutlo ea ΔFosB ea neuronal phenotype ho MPFC.

Ho hlahloba polelo ea ΔFosB ka li-neuron tsa cortical GABAergic, re sebelisitse litoeba tse tsoang GAD2-tdTomato lithunya tse pepesitsoeng khatello ea maikutlo ea khatello ea maikutlo ea sechaba le ho ainedFosB joalo ka ha ho hlalositsoe ka holimo (bona Feie. 1B). Lice li hlahisitsoe ke mofuta o mong oa tlhahiso ea "GAD2-Cre mice" (Gad2tm2 (cre) Zjh / J; JAX nomoro ea 010802) (Taniguchi et al., 2011) le (B6.Cg-Gt (ROSA) 26Sortm9 (CAG-tdTomato) Hze / J; JAX nomoro ea setoko sa 007908) e nang le li-tdTomato tse laoloang ka mokhoa o sa tsitsitseng (RFP).

Teko ea 3: litlamorao tsa boits'oaro ba ΔFosB overexpression ho prelimbic (PrL) le infralimbic (IL) cortex.

Ho buuoa ka Stereotaxic ho etsoa ho litoeba tsa banna ba baholo (libeke tsa 8) ho kenya HSV-ΔFosB-GFP kapa HSV-GFP libakeng tsa PrL kapa IL tsa mPFC. Ka bokhutšoanyane, litoeba li ne li sa sebetse li sebelisa motsoako oa ketamine (10 mg / kg) le xylazine (1 mg / kg), 'me ho ile ha sebelisoa li-link tsa li-stereotaxic tse latelang bakeng sa ho tsamaisa vaerase bakeng sa PrL: 1.8 mm (anterior / posterior), 0.65 mm (lateral ), −2.2 mm (dorsal / ventral); le bakeng sa IL: 1.9 mm (anterior / posterior), 0.75 mm (lateral), −2.8 mm (dorsal / ventral) ka angle ea 10 ° ho tloha bohareng (amanang le bregma). Kakaretso ea 0.5 μl ea vaerase e hloekisitsoeng e ile ea tlisoa habeli ka nako ea 5 min X (0.1 μl / min) e lateloa ke 5 min ea phomolo. Litsi tsa ente ea vaerase li netefalitsoe li sebelisa mekhoa e tloaelehileng ea histological (bona Feie. 1C). Le ha ho khonehe ho khetholla PrL e bapisoa le IL ka litoeba ka ho nepahala ho phethahetseng, datha ho Setšoantšo sa 1C etsa mohlala oa hore ho ka khoneha haholo ho shebisa sebaka se le seng kapa ho e ngoe. Haele hantle, litlamorao tse ikhethang tsa boitšoaro bo fumanoeng mabapi le ho lebisa libaka tse peli (bona liphetho) li tiisa mokhoa ona. Sehlopha sa litoeba tsa pele se ne se sebelisoa molemong oa teko ea maemo a phahameng sechabeng (bona Feie. 1D). Matsatsi a mararo ka mor'a ho buuoa, litoeba li ile tsa hloloa ka makhetlo a mabeli ka tatellano ka letsatsi le le leng 'me tsa hlahlojoa hore na ho na le tšebelisano ea sechaba 24 h hamorao. Ts'ebetso ena ea ho hlola ka mokhoa o pharalletseng e netefalitsoe pejana ho senola prosusceptibility phenotypes tse latelang liphatsa tsa lefutso (Krishnan et al., 2007; Vialou et al., 2010).

Sehlopha sa bobeli sa litoeba se ile sa sebelisetsoa ho lekola matšoenyeho a mantlha- le boits'oaro bo sithabetsang (bona Feie. 1J - J). Letsatsi kamora ho buoa, litoeba li ile tsa lula ka tharollo ea sucrose ea 1% (w / v). Letsatsing le hlahlamang, litoeba li ne li ka khetha pakeng tsa botlolo ea metsi le botlolo ea 1% sucrose solution, tse fetotsoang letsatsi le letsatsi. Tšebeliso ea tharollo ea Sucrose bakeng sa 24 h e lekantsoe ka letsatsi la bone le la bohlano kamora ho buuoa mme ea hlahisoa joalo ka karolo ea kakaretso ea mokelikeli o kentsoeng. Litsuonyana li ile tsa lekoa lebaleng le bulehileng (ka letsatsi 3), li-plus maze (letsatsi la 4), tšebelisano ea sechaba (letsatsi la 5 hoseng), le liteko tse qobelloang tsa ho sesa (letsatsi la 5 thapama) ho latela liprotheine tse phatlalalitsoeng (Vialou et al., 2010). Re fumane hore, ka taelo ena ea liteko, liphetho tsa liteko tse latelang ha li amehe ke tse fetileng (Krishnan et al., 2007). Ts'ebetso ea litoeba lebaleng le bulehileng e tlalehiloe bakeng sa 5 min e sebelisa sistimi ea videotracking (Ethovision) tlasa maemo a khanya e khubelu. Maze o phahamisitsoeng o ne o e-na le litselana tse peli tse otlolohileng tse pakeng tsa 60 cm kaholimo 'me e arotsoe ka matsoho a mabeli a bulehileng le a mabeli a koetsoeng. Linta li ne li behiloe bohareng ba maze mme li lumelloa ho phenya letsoho le leng le le leng ka bolokolohi bakeng sa 5 min. Boemong bo bulehileng le liteko tse phahameng tsa maze, nako e sebelisitsoeng setsing le matsoho a bulehileng, ka ho latellana, e ne e sebelisoa e le index e fapaneng ea likarabo tse amanang le matšoenyeho. Teko ea letsatsi le le leng e qobelloang ea ho sesa e entsoe nakoana ea 5 min. Ho eketsa nako ea ho se sebetse hantle nakong ea liteko tsa ho sesa tse qobelloang ho hlalosoa e le mokhoa o ts'oanang le oa ho susumetsa maikutlo. Teko ena ea letsatsi la 1 e sebelisitsoe haholo ho litoeba mme e netefalitsoe e le mokhoa oa ho nepahala esale pele, ka hore lithethefatsi tsa antidepressant li fokotsa linako tsa ho se sebetse hantle.

Qetellong, sehlopha sa litoeba tse arohaneng se ile sa kenngoa intra-mOFC le HSV-ΔFosB mme sa hlahlojoa hore se sebelisane le sechaba kamora ho hloloa ho hoholo (bona Feie. 1K).

Li-veins tsa HSV li fumanoe ho Rachael Neve (Massachusetts Institute of Technology). Mefuta ea mofuta oa litakatso (BFosB le GFP) e tlas'a mofani oa CMV. Lierekisi tsena li netefalitsoe haholo likhatisong tsa pele (mohlala, Maze et al., 2010).

Teko ea 4: litlamorao tsa khatello ea maikutlo e sa foleng ea maemo a CCKB receptor ho mPFC.

Ho 24 h kamora tlhahlobo ea puisano ea sechaba, likelello li ile tsa tlosoa kapele mme tsa ngolisoa ka bo-mong, mme mPFC e ile ea qhaloa kapele ea ba ea hoama leqhoa le omileng (bona Feie. 2A,B). Boikhethollo ba RNA, qPCR, le tlhahlobo ea data li entsoe joalo ka ha ho hlalositsoe pele (Maze et al., 2010; Vialou et al., 2010). RNA e ne e arotsoe le TriZol reagent (Invitrogen) mme e ile ea hloekisoa le ho feta ka RNAeasy micro kits tse tsoang QIAGEN. Mehlala eohle ea RNA e ne e ikemiselitse ho ba le 260 / 280 le 260 / 230 boleng values1.8. Mongolo o fetoletsoeng o ne o etsoa ho sebelisoa iScript (Bio-Rad). QPCR e sebelisang SYBR Green (Quanta) e entsoe ka Sistimi ea Applied Biosystems 7900HT RT PCR e nang le likarolo tse latelang tsa potoloho: 2 min ho 95 ° C; Li-circuits tsa 40 tsa 95 ° C tsa 15 s, 59 ° C bakeng sa 30 s, le 72 ° C bakeng sa 33 s; le ho futhumatsa maemo ho ea 95 ° C ho hlahisa li-curve tsa ho itlhatsoa bakeng sa netefatso ea lihlahisoa tse le 'ngoe tsa PCR. Lintlha li ile tsa hlahlojoa ka ho bapisa C_t Bohlokoa ba boemo ba kalafo (litoeba tse senyehang kapa tse laoloang ke litoeba, kapa HSV-ΔFosB vs HSV-GFP) le ΔΔC_t mokhoa (Tsankova et al., 2006). Li-primers tsa qPCR li latelang: ΔFosB, pele, AGGCAGAGCTGGAGTCGGAGAT le ho khutlisa, GCCGAGGACTTGAACTTCACTCG; CCKB, pele, ACCCTTTATGCGGTGATCTTTC le ho khutlisa, ATGAGCACGTTTCCGCCAA; CCK, pele, AGCGCGATACATCCAGCAG le ho khutlisetsa morao, ACGATGGGTTTCGTAGTCCTC; GAPDH, pele, AGGTCGGTGTGAACGGATTTG le ho khutlisa, TGTAGACCATGTAGTTGAGGTCA.

Setšoantšo sa 2.

Setšoantšo sa 2.

Blockade ea CCKB receptor e na le ts'ebetso e tšoanang le ea antisepressant-like. A, Ho hloloa ha sechaba ho fokotsa maemo a "CCKB receptor" ho mPFC feela ho litoeba tse tiileng (n = 8-10). *p <0.05, ha e bapisoa le taolo (ANOVA ea tsela e le 'ngoe). **p <0.05 ...

Teko 5: litlamorao tsa ΔFosB ho li-receptor tsa CCKB le li-cFos.

Linta li ile tsa kenngoa ka har'a intra-PrL le HSV-ΔFosB. Ho 72 h kamora ho buuoa, ka tlhaselo ea vaerase e fetang tekano, libaka tsa ente li ile tsa qhaloa tlasa microscope (fluorescent microscope) Feie. 2C). Boikhethollo ba RNA, qPCR, le tlhaiso ea data li entsoe joalo ka ha ho hlalositsoe kaholimo. Li-primers tsa qPCR li latelang: c-fos, pele, AATCCGAAGGGAACGGAATAAGA le ho khutlisa, TGCAACGCAGACTTCTCATCT.

Teko ea 6: litlamorao tsa ΔFosB blockade maemong a CCKB a amohelang khatello le ho imeloa.

Malinyane a batho ba baholo a ne a kenngoa ka ente e kopaneng le HSV-GFP kapa HSV-ΔJunD ho PrL (bona Feie. 2D-F). ΔJunD ke setla-morao sa N-terminal se kopantsoeng le JunD se sebetsang joaloka mohanyetsi ea seng molaong oa ΔFosB. Lice li ne li hlotsoe habeli ka letsatsi bakeng sa 5 d. Protocol ena e potlakileng ea ho hlola maemo sechabeng, e khutsufalitsoeng ho hokahana le nako ea polelo e fetisisang ea HSV, e kile ea sebelisoa pele mme ea bontšoa ho susumetsa maemo a phahameng haholo a thibelo ea sechaba (Covington et al., 2011). Ho 24 h kamora ketsahalo ea ho qetela ea khatello ea maikutlo, litoeba li ile tsa khaoloa hlooho ntle le thethebatso ho qoba litlamorao tsa moriana o thethefatsang maemong a protheine ea neuronal. Lisele tse nang le tšoaetso li ile tsa tlosoa ka PBS e nang le protease (Roche) le phosphatase (Sigma-Aldrich) inhibitors e sebelisang punch ea 15 gauge mme hang hang ea hoamisoa leqhoeng le ommeng. Mehlala e ile ea ntlafatsoa ka leseli la sonication ho RIPA buffer e fetotsoeng: 10 mm Tris base, 150 mm sodium chloride, 1 mm EDTA, 0.1% SDS, 1% Triton X-100, 1% sodium deoxycholate, pH 7.4, le protease le phosphatase inhibitors joalo ka kaholimo. Kamora ho eketsoa ha buffer ea Laemmli, liprotheine li ile tsa aroloa ho 4-15% polyacrylamaide gradient gels (Criterion System; Bio-Rad), mme blotting ea Bophirimela e ile ea etsoa ho sebelisoa sistimi ea Odyssey (Li-Cor) ho latela liprothokho tsa moetsi. Lera le ne le hlakotsoe ka lesole la mmele la CCKB (1/1000, Acris, catalog # AP01421PU-N). Sehlopha se seng sa litoeba se ile sa entoa ka AAV-ΔJunD kapa AAV-GFP ho PrL mme, kamora libeke tsa 5 kamora ho buuoa ho lumella polelo e kholo ea transgene, litoeba li ile tsa romelloa ho protocol e nyane ea ho hloloa. Ba ile ba lekoa bakeng sa tšebelisano ea sechaba 24 h kamora ho hloloa hoa ho qetela.

Teko ea 7: litlamorao tsa intra-mPFC CI-988, mohanyetsi oa CCKB, mabapi le khatello ea maikutlo le ts'usumetso ea sechaba.

Bilateral cannula (1.0 mm cannula ho cannula hole, 1.8 mm anterior, injector −2.2 mm dorsal / ventral) tse tsejoang mPFC li kentsoe ka litoeba tse ka kenang habonolo (bona Feie. 2G,H). Beke kamora ho buuoa, 10 ng ea CI-988 e ile ea kenngoa ka kotloloho ho mPFC, e lebisitsoe haholo ho PrL. Litoeba li ile tsa lekoa molemong oa ho sebelisana le batho ba bang sechabeng. Khetho ea Sucrose e lekantsoe bakeng sa 24 e setseng. CI-988 (Tocris Bioscience) e ile ea qhibiliha ka saline, aliquited le serame. Ho ne ho hlophisitsoe lethopo la ho qetela ka letsatsi la liteko. Teko e 'ngoe e entsoe ka litoeba tse ka hlaselloang ka CI-988 e laoloang ka hloko (2 mg / kg) 30 min pele ho liteko tsa likamano tsa sechaba.

Teko ea 8: litlamorao tsa CCKB agonist ho ts'oenyehong ea khatello ea sechaba le ho khutlisoa ke ts'usumetso ea optogenetic ea mPFC e lebisitsoeng ho BLA kapa NAc.

AAV-CaMKII-ChR2-EYFP kapa AAV-CaMKII-EYFP e kentsoe ka har'a mPFC e nepahetseng, hape e lebisitse haholo ho PrL (bona Feie. 3A-G). Libeke tse hlano hamorao, likhoele tsa optic li ile tsa kenngoa ka ho le letona NAc (1.4 anterior / posterior, 2.6 lateral, −4.7 dorsal / ventral ka angle ea 25 ° ho tloha bohareng) kapa BLA (−1.6 anterior / posterior, 3.1 lateral, −4.7 dorsal / ventral ntle le sekhutlo ho tloha bohareng). Nakong ea ts'ebetso e ts'oanang ea ts'ebetso ea bongaka tse peli li ile tsa kenngoa kahare ho mPFC (bona ka holimo). Cannulae le likhoele li ne li sirelelitsoe ka lehata ka samente ea meno. Litoeba li ile tsa lumelloa beke ea 1 hore e fole pele ho qala liteko tsa boitšoaro. Litsuonyana li ile tsa hloloa ka mokhoa o fetisisang, tsa ntan'o lekoa 24 h kamora nako ea ts'ebelisano 'moho, tsa lateloa ka kotlolloho ke maze e phahameng le khetho ea sucrose bakeng sa 24 h. Ka 30 min pele ho liteko tsa tšebelisano ea sechaba, halofo ea litoeba e ile ea kenngoa le CCK-8 (10 ng) ka mPFC ha halofo e 'ngoe e fumana koloi (saline). Litsuonyana li ile tsa lekoa ka bobeli (koloi le koloi e hapiloeng ke CCK-8, e nang le AAV-GFP kapa AAV-ChR2). CCK-8 (Sigma) e ile ea qhibiliha ka letsoai, ea hloloa le ho bata. Ho ne ho hlophisitsoe lethathamo la ho qetela ka letsatsi la liteko.

Setšoantšo sa 3.

Setšoantšo sa 3.

CCK-8 e bakang khatello ea maikutlo ea khatello ea maikutlo e ipapisitse le lipakanyo tse ikhethang tsa cortical. A, Ho 24 h ka mor'a ho hlaseloa ka tlase sechabeng le 30 min kamora ho kenngoa ha CCK-8, libaka tsa projeke ea mPFC li ile tsa hlasimoloha nakong ea teko ea tšebelisano ea sechaba. Tlatsetso ea CCK-8 ...

Likeletso tse matlafatsang li entsoe ho latela protocol e phatlalalitsoeng (Covington et al., 2010). Fiber Optical (Thor Laboratories) e ne e kengoe hantle ebile e hokahantsoe ka adapta ea FC / PC ho 473 nm blue laser diode (Crystal Lasers, BCL-473-050-M). Motlatsi (Agilent, #33220A) e ne e sebelisoa ho hlahisa li-pulses tse bobebe tsa botala. Nakong ea litlolo tsohle, 40 ms burding of 100 Hz (9.9 ms spike wide) mabone a khanya a maputsoa a ile a isoa sebakeng se seng le se seng sa 3 s libakeng tsa terminal ho BLA kapa NAc nakong ea tlhahlobo ea tšebelisano ea sechaba feela, ho etsisa mohlala o phatlohileng oa cortical ts'ebetso. Botebo ba khanya ea khanya ea optic bo ile ba netefatsoa pele ho ts'ebeliso e 'ngoe le e' ngoe, ho sebelisoa sensor ea khanya (Thor Laboratories, S130A), le matla a khanya e ne e le ∼15 mW. Protocol ena ea tšusumetso, e neng e netefalitsoe ka motlakase pele (Covington et al., 2010), ha ea ka ea hohola ho ipapisitsoe le boits'oaro bo botle le ho se be teng ha polelo ea c-Fos kantle ho libaka tse susumetsoang ke optogenetically (Covington et al., 2010).

Teko ea 9: litla-morao tsa CCKB agonist holima tšebetso ea methapo ea MPFC joalo ka ha e lekantsoe ke maemo a c-Fos mRNA.

Li-cannulae tse nang le moea o mong li ne li kentsoe litoeba tsa batho ba baholo tse shebileng mPFC (bona Feie. 3H). Kamora beke ea ho phomola, litoeba li ile tsa hloloa ka tlase mme tsa kenngoa CCK-8 24 h hamorao. li-punch tsa mPFC li ile tsa nkuoa 30 min kamora ho kenngoa ha lithethefatsi, le mehlala e lokiselitsoeng tlhahlobo ea mRNA joalo ka ha ho hlalositsoe kaholimo.

Matlo a liphoofolo.

Ho ne ho sebelisitsoe litoeba tse mashome a robeli tsa C57BL / 6J (The Jackson Laborator). Limpha tsohle li ne li lula sebakeng sa liphoofolo bonyane 1 bekeng pele ho liteko tsa liteko 'me li ne li bolokiloe 23 ° C-25 ° C ho potoloho ea khanya ea 12 h / lefifi (mabone ho 7: 00 AM) le ad libitum phihlello ea lijo le metsi. Liteko li entsoe ho latela tataiso ea Mokhatlo oa Neuroscience le Komiti ea Tlhokomelo ea Liphoofolo le Ts'ebeliso ea Setheo Sekolong sa Bongaka sa Icahn Mount Mount.

Tlhahlobo ea lipalopalo.

Lintlha tse bonts'itsoeng li hlahisoa e le tsa bohlokoa ± SEM (e emeloang joaloka mekoallo ea liphoso). Li-ANOVA tsa tsela e le 'ngoe li ne li sebelisoa ho bapisa mokhoa lipakeng tsa taolo, tšenyo e bakoang habonolo, le litheko tse ling tsa tlhahlobo ea immunohistochemical, biochemical, le boitšoaro. Li-ANOVA tsa tsela e le 'ngoe li ne li sebelisoa ho bapisa mekhoa lipakeng tsa taolo ea GFP le ΔFosB overexpression ho PrL kapa IL lebaleng le bulehileng, litlolo tse phahamisitsoeng, le liteko tse ratoang tsa boikhethelo. Li-ANOVA tse peli tsa tsela li ile tsa sebelisoa ho bapisa mekhoa lipakeng tsa taolo ea GFP, ΔFosB-PrL, le ΔFosB-IL tekong ea likamano tsa sechaba. Li-ANOVA tse peli tsa tsela li ile tsa sebelisoa ho bapisa litlamorao tsa CCK-8 kapa ntle le ts'usumetso ea optogenetic litekong tsohle tsa boits'oaro, hammoho le phello ea BFosB overexpression kapa CI-988 ts'usumetso ho qoba boiketlo ba sechaba. Ha ho loketse, post hoc bohlahlobi bo entsoe ka Bonferroni post hoc teko. Seithuti t Liteko li sebelisitsoe ho bapisa mekhoa bakeng sa phello ea ts'oaetso ea CI-988 ho khethoeng ha sucrose le liteko tsa ho sesa tse qobelloang, le tsa CCK-8 ho c-Fos maemo a mRNA. Phapang lipakeng tsa maemo a liteko e ne e nkuoa e le ea bohlokoa lipalo ha p ≤ 0.05.

Results

'Mapa o pharalletseng oa ts'ebetso ea osFosB ka khatello ea maikutlo ea khatello ea kelello ea khatello ea kelello

Re qalile ka ho etsa patlisiso ea ΔFosB ka litoeba tse laolang, tse senyehang habonolo, le ho ba le boikemisetso, kamora nako ea khatello ea maikutlo ea 10 d, e shebaneng le maemo a forebrain le a midbrain a neng a entsoe pele maemong a khatello. Liphoofolo li ile tsa hlahlojoa 24 h ka mor'a karolo ea ho qetela e hlōtsoeng. Matšoenyeho a sa feleng a moruo a etsa hore ΔFosB e lule libakeng tse ngata tsa boko tse nang le litoeba tse hlakileng pakeng tsa litoeba tse tsofetseng. Joalokaha ho bontšitsoe Lethathamo 1 'me Setšoantšo sa 1A, IL, BLA, meno a meno a hippocampus, dorsal striatum, le NAc mantlha e bonts'itse ts'ebetso e khethehileng ea litheko ho litoeba tse sebetsang; Liphetho tse joalo ho NAc li tsamaellana le liphetho tse phatlalalitsoeng (Vialou et al., 2010). Ka lehlakoreng le leng le leholo, litoeba tse ka hlaselitsoeng li bontšitse ho kenella haholo ho PrL, septum ea morao-rao le mokokotlo oa bethe ea stria terminalis. Likarolo tse 'maloa tsa boko li bontšitse ΔFosB e ka bapisoang le litoeba tse qhekellang; Tsena li kenyellelitse cortex ea orbitof Pambal (OFC, sebaka se seng sa PFC), khetla ea NAc, raphes ea dorsal, le 'mala oa bohloeki ba' mele (PAG).

Ho khetholla li-subtype tsa neuronal tse bonts'ang ho kenella ha ΔFosB libakeng tsa cortical, litoeba tsa GAD2-tdTomato li ile tsa ba le khatello ea maikutlo ea khatello ea khatello ea sechaba. ImmFosB immunoreactivity ho litoeba tse kotsing ea ho senyeha e ne e sa bonahale ho li-neurons tsa GABAergic (Feie. 1B), e netefatsang liphetho tsa pejana tsa ho kenngoa ka ho khetheha ha ΔFosB ho li-neuron tsa cortical pyramidal ka mor'a mefuta e meng ea khatello ea maikutlo (Perrotti et al., 2004). Ho litoeba tsa taolo e sa laoleheng, basotho ΔFosB maemo a ho potoloha likarolo tsa boko a ne a tšoana le a tlalehiloeng lithutong tse fetileng (Perrotti et al., 2004, 2008) e nang le maemo a phahameng haholo a NAc le dorsal striatum ha a bapisoa le sebaka leha e le sefe se seng, ntle le mofuta o le mong oa meno ea meno, e bonts'ang maemo a ka bapisoang le a libaka tse haufi. (Lethathamo 1).

ΔFosB ho mPFC e khothalletsa ho imeloa kelellong

Ho latela liphumano tsena, re ile ra tsepamisa maikutlo ho PrL hobane pele re ne re bonts'a ts'ebetso ea optogenetic ea sebaka sena e bile le litlamorao tse kang li-antidepressant ho paradigm ea sechaba.Covington et al., 2010). Ho lekola litlamorao tse sebetsang tsa ho kenella ha ΔFosB sebakeng sena sa boko, re qoelitse ΔFosB ka bongata ho PrL ea litoeba tsa taolo (Feie. 1C) 'me a ba beha khosong ea khatello e tlisoang ke khatello ea khatello ea sechaba, e sa qobelle ho qoba ho phoofolo e tloaelehileng. ΔFosB e sebelisang khatello e fetelletsang ea kelello ho PrL e ne e kotsing ea ho hloloa sechabeng ho feta litoeba tse laoloang ke GFP ka hore e bonts'itse boitšoaro ba boiketlo kamora ho hloloa ho hoholo sechabeng (lipuisano, F_(2,38) = 2.847, p > 0.05, litlamorao tse kholo tsa vaerase, F_(2,38) = 6.013, p <0.05; Teko ea poso ea Bonferroni t = 2.447, p <0.05) (Feie. 1D). Litoeba tsena li boetse li bonts'itse ho se sebetse hantle ha liteko tsa letsatsi la 1 tse qobelloang ho sesa (F_(2,31) = 6.448, p <0.05; Teko ea poso ea Bonferroni t = 3.518, p <0.05) (Feie. 1E), phello e khahlano le e hlahisoang ke lithethefatsi tsa antidepressant. Ka lehlakoreng le leng, ΔFosB overexpression ho PrL ha e a fetola mehato e mengata ea motheo ea boits'oaro bo kang ho tšoenyeha, khetho ea sucrose, tšebelisano ea sechaba, kapa ketsahalo ea phenomotor (Feie. 1F-J). Ka kopanelo, liphuputso tsena li tšehetsa khopolo-taba ea hore ΔFosB e ikhethileng mabapi le PrL ea litoeba tse sa bonahaleng e kenya letsoho tlokotsing ea khatello ea maikutlo le litlamorao tsa eona. Ka lehlakoreng le leng, ΔFosB overexpression sebakeng se seng sa mPFC, IL, e ne e sena tšusumetso ho boits'oarong ba maikutlo bo hlakileng kapa karabong ea khatello ea khatello ea sechaba (Feie. 1D-J), athe ΔFosB e tebisa maikutlo litabeng tsa medical OFC e tloaetse ho khothaletsa ho ts'oaroa hoa tlhaselo e sa feleng ea sechaba, leha phello e sa fihlelle bohlokoa ba lipalo (lipuisano, F_(1,31) = 1.741, p > 0.05, phello ea mantlha ea nako ea tšebelisano, F_(1,31) = 14.170, p <0.05; Teko ea poso ea Bonferroni t = 3.860, p <0.05 ka har'a sehlopha sa GFP; t = 1.960, p <0.05 kahare ho sehlopha sa osBFosB; phello ea vaerase, t = 2.447, p <0.05) (Feie. 1K).

ΔFosB e khothaletsa induction ea CCKB ho mPFC

Ho na le bopaki bo bongata bo tšehetsang taba ea hore CCK, e leng neuropeptide e ngata bokong, e bapala karolo ea bohlokoa mananeng a khatello ea maikutlo le matšoenyeho (Rotzinger le Vaccarino, 2003). Haholo-holo, ho lokolloa ha CCK ho mPFC nakong ea khatello ea sechaba literekeng ho amana le boits'oaro bo amanang le ho tšoenyeha (Becker et al., 2001). Le ha ho kenyeletsoa ha CCK mahlomoleng a batho ho lula ho sa hlaka, bopaki ba morao-rao bo supa karolo ea bona ea boits'oaro bo tlisoang ke khatello ea maikutlo e kang ea khatello ea maikutlo sechabeng literekeng (Becker et al., 2008). Ka hona re ile ra kholoa hore liphetoho tse maemong a CCK kapa CCKB (e tsejoang hape e le CCK2) receptor ho mPFC li ka kenya letsoho phapusing lipakeng tsa litoeba tse qalang le tse sa sebetseng hantle. Ho 48 h ka mor'a karolo ea ho qetela e hlōtsoeng, maemo a CCKB mRNA a fokotsehile ho mPFC ea litoeba tse mamellang feela (F_(2,18) = 8.084, p <0.01; Teko ea poso ea Bonferroni, t = 3.104, p <0.05 khahlanong le taolo; t = 5.113, p <0.01 khahlanong le ts'oaetso) (Feie. 2A). Ha ho phapang e ileng ea bonoa maemong a CCK mRNA ka litoeba tse ka qhekelloang kapa tse fumanehang (ya data e sa bontsitsoeng). Re bone keketseho ea ΔFosB maemo a mRNA feela a litoeba tse ka qhekelloang tse lumellanang le data ea protheine e boletsoeng ka holimo (F_(2,18) = 5.246, p <0.01; Teko ea poso ea Bonferroni t = 3.336, p <0.05 khahlanong le ts'oaetso; t mamella teko t₍₁₂₎ = 2.138, p <0.05 vs taolo) (Feie. 2B). Hobane ΔFosB e laola phetisetso ea mefuta ea mefuta e mengata (McClung le Nestler, 2003; Winstanley et al., 2007), re nkile monyetla oa hore e ka tsamaisa polelo ea CCKB mRNA. Ho araba potso ena, re qalile ho hlahloba ΔFosB ho feta ho PrL mme re fumane hore thetso ena e nyolla maemo a CCKB mRNA sebakeng sena (t₍₁₂₎ = 2.012, p <0.05 vs GFP) (Feie. 2C). Ho khahlisang, re boetse re fumane ho fokotseha ho c-Fos maemo a MRNA kamora ΔFosB overexpression (t₍₁₁₎ = 3.382, p <0.01) (Feie. 2C). Tliphumano tsa hese li fana ka maikutlo a hore indFosB e kenella ho PrL ea litoeba tse ka hlaselang habonolo ke mokhoa o sebetsang oa ho rarolla mathata ka ho thibela khatello ea CCKB e bonoang ho litoeba tse tiileng.

Ho matlafatsa lipatlisiso tsena ho feta, re qobelletse ΔJunD, setho se kopanyang sa osFosB se se nang sebaka sa ho fetisetsa litaba mme ka tsela eo se sebetsa joaloka mohanyetsi ea matla, 'me re bone sephetho sa sona liphatlalatsong tse susumetsang maikutlo tsa CCKB. Re netefalitse hore khatello ea maikutlo e sa feleng ea khatello ea sechaba e ile ea eketsa maemo a liprotheine tsa CCKB ho PrL ea litoeba tse hlasetsoeng (t mamella teko t₍₁₂₎ = 2.289, p <0.05 vs taolo) (Feie. 2D,E). Ho feta moo, ho kenella ka mokhoa o joalo ho ne ho koetsoe ka botlalo ke ΔJunD overexpression seterekeng sena (F_(2,20) = 6.306, p <0.01, tlhahlobo ea poso ea Bonferroni t = 3.615_, p <0.01) (Feie. 2D,E), e tšehetsa khopolo-taba ea hore ΔFosB e buella polelo ea CCKB e susumetsang khatello ea maikutlo. Ntle le moo, thibelo ea ts'ebetso ea ΔFosB ho PrL, ka polelo ea lehae ea ΔJunD, le eona e khothalelitse boikemelo ho hlola khatello ea maikutlo (t mamella teko t₍₁₆₎ = 2.114, p = Taolo ea 0.05 vs) (Feie. 2F). Mokhoa o ikhethileng oa ho fokotsoa ha CCKB litheteneng tse ikemetseng o sa ntse o tla hlakisoa.

Karolo ea CCKB boitlamong le ho itšireng ha khatello ea maikutlo

Ho leka ka kotloloho karolo ea taolo ea CCKB ho PrL ho loants'eng ts'oaetso le boikemelo, re kentse CCKB receptor antagonist CI-988 (10 ng) ka kotloloho sebakeng sena sa boko sa litoeba tse kotsing. CI-988 e sebetsana hantle le li-receptor tsa CCKB Ka vivo hobane e bonts'a tumellano ea nanomolar le khethollo e phahameng bakeng sa CCKB receptor subtype (Noble et al., 1999). Ho thibela tšebetso ea CCKB ho matlafalitse tšebelisano ea sechaba ka matla (Feie. 2G) (tšebelisano, F_(1,20) = 7.795, p <0.05; sethethefatsi F_(1,20) = 5.38, p <0.05, tlhahlobo ea poso ea Bonferroni t = 3.615_, p <0.01). Ts'oaetso ea CI-988 e boetse e khutlisitse sekhahla sa khetho ea sucrose e bonoang litoeba tse ka hlaseloang habonolo (t₍₈₎ = 2.681, p <0.05) (Feie. 2H). Liphetho ka bobeli li bontša hore blockade ea khato ea CCK ho PrL e fana ka litlamorao tse kang tsa antidepressant-like. Ho khahlisang, ha e ne e sebetsoa ka masene, CI-988 e ne e sa sebetse hantle ho khutlisetseng phephetso ea sechaba (data e sa bonts'itsoeng).

Ho lekola mokhelo, ts'ebetso ea CCKB ho PrL e ka kopanya thibelo ea sechaba mme ea fokotsa boikhethelo bo hlahisitsoeng ke khatello ea maikutlo ea taolo e sa feleng, ra hlahloba phello ea infusion ea lehae ea CCK-8 (10 ng), mofuta o ka sehloohong oa CCK bokong , mabapi le khatello ea maikutlo le boits'oaro bo amanang le ho tšoenyeha. Tekanyo ea lithethefatsi e ile ea khethoa ho latela liphetho tse fetileng ho lingoliloeng (De Witte le al., 1987; Rotzinger le Vaccarino, 2003; Zanoveli et al., 2004). Litsuonyana li ile tsa pepesetsoa khatello ea maikutlo ea khatello ea maemo a tlase ea 24 h pele ho liteko tsa boitšoaro (Feie. 3A). CCK-8, e kentsoeng metsotso ea 30 pele ho liteko, e ne e lekane ho kenya ts'ireletso ea sechaba litekong tsa ts'ebelisano ea sechaba le ho fokotseha ha nako e sebelisitsoeng matsohong a bulehileng ka har'a maze a phahameng (SI: BLA, tšebelisano, F_(1,22) = 0.79, p > 0.05; phello e kholo ea lithethefatsi, F_(1,22) = 11.75, p <0.05; Teko ea poso ea Bonferroni t = 2.957_, p <0.05; NAc: tšebelisano, F_(1,26) = 6.688, p <0.05, tlhahlobo ea poso ea Bonferroni t = 2.816_, p <0.05; EPM: BLA, tšebelisano, F_(1,22) = 8.0, p <0.01; Teko ea poso ea Bonferroni t = 2.509_, p <0.05 phello ea lithethefatsi; t = 2.528, p <Phello ea vaerase ea 0.05; NAC, t mamella teko t₍₁₇₎ = 1.961; p <Phello ea lithethefatsi ea 0.05 sehlopheng sa eYFP) (Feie. 3B-E, letšehali). Ha ho na phapang e ileng ea bonoa ho khethoeng ha sucrose (Feie. 3F,G, letšehali). Kamora nako, ts'ebetso ea CCK-8 ha ea ka ea ama boitšoaro (tšebelisano ea sechaba le litlatsetso tse phahameng) tsa litoeba tse se nang thuso mefuteng ena (ya data e sa bontsitsoeng). TLiphetho tsa hese li bonts'a hore keketseho ea ΔFosB-e kopantsoeng le tšebetso ea CCKB ho PrL ea litoeba tse ka qhekelloang, ha e bapisoa le litoeba tse tiiselitsoeng, e kenya letsoho ho etseng bofokoli bo sisimosang ba boits'oaro bo bontšitsoeng ke liphoofolo tsena.

Blockade of CCK e hlohlelletsa khatello ea maikutlo ka ts'ebetso ea likhakanyo tsa cortical ho BLA bapisoa le NAc

Ts'ebetso ea morao-rao ea mPFC e fokotsehileng e lumellana le boits'oaro bo tšoanang le khatello ea litoeba, ka ts'usumetso ea optogenetic ea li-neuron tsa mPFC tsa litoeba tse sa bonahaleng li hlahisa litlamorao tse kang li-antidepressant-like (Covington et al., 2010). Ka hona, re ne re nahana hore CCK e ka sebetsa ho PrL ka ho sitisa tšebetso ea methapo 'me ka tsela eo ra baka boits'oaro bo kang khatello ea maikutlo. Tumellanong le khopolo ena, re bone ho fokotseha ha c-Fos maemo a MRNA ho PrL ha a arabela ts'oaetso ea CCK sebakeng sena sa boko (t₍₁₃₎ = 2.235, p <0.05) (Feie. 3H).

Ka mor'a moo re ile ra kholoa hore ts'usumetso ea optogenetic ea mPFC e fana ka liketso tsa eona tse khahlanong le khatello ka ho hanyetsa litlamorao tsa CCK mesebetsing ea neuronal. Ha re leka tlhahiso-leseling ena, re ile ra etsa lipatlisiso tsa sebopeho sa subcortical se pakeng tsa litlamorao tsa ho ts'oenyeha le ho ts'oaroa ha maikutlo ke CCK. Li-neuron tsa "pyramidal" tsa projeke ea mPFC haholo ho NAc le BLA, mekhahlelo e 'meli ea li-legion e bohlokoa ho arabello ea boitšoaro ho khatello ea maikutlo. Ketsahalo e fetotsoeng ea likarolo ka bobeli tsa boko e bontšitsoe e bapala karolo ea bohlokoa ponahalong ea boits'oaro ba boits'oaro le khatello ea maikutlo joalo ka (Vialou et al., 2010; Tye et al., 2011). Ka hona re ile ra leka hore na ho ts'oaroa ha likhakanyo tsa glutamatergic ho tloha PrL ho ea ho NAc kapa ho BLA ho hana ho felisa litlamorao tsa CCK microinfusion ho PrL (Feie. 3A). Re kentse AAV-CaMKII-ChR2-EYFP, kapa AAV-CaMKII-EYFP e le taolo, ho kena PrL. Morekisi oa CaMKII o tsejoa ho tobisa polelo ea vaerase ho li-neuron tsa glutamatergic pyramidal libakeng tsa cortical. Ka mor'a moo re ile ra lumella nako e lekaneng (libeke tsa 6) hore transuter e isoe litsing tsa methapo ea methapo ena ea kutlo ea "pyramidal" ho NAc le BLA (Feie. 3I). Linta li ile tsa hlola maemo a phahameng sechabeng; 24 h hamorao, re kentse CCK-8 ho PrL mme, 30 min kamora moo, ts'ebelisano ea sechaba e ile ea lekanngoa nakong ea ts'usumetso ea optogenetic ea li-terminals tsa glutamatergic ho NAc kapa BLA. Hang ka mor'a tlhahlobo ea puisano ea sechaba, litoeba li ile tsa hlahlojoa moahong o moholo oa boemo bo holimo ho lekola boitšoaro bo amanang le ho tšoenyeha ebe ho khethoa ho ikemela ho lekola anhedonia.

Ts'usumetso ea Optogenetic ea PrL glutamatergic projeke ho NAc e khutlisitse ka botlalo boiketlo ba sechaba bo hlahisitsoeng ke intra-PrL CCK-8 (tšebelisano, F_(1,26) = 6.688, p <0.05, ha ho na tšusumetso ea lithethefatsi sehlopheng sa ChR2) (Feie. 3C). Ho fapana le hoo, PrL e joalo ea NAc e hlohlelletsang e ne e se na phello mokhoeng oa ho tšoenyeha joalo ka ha o lekantsoe ho maze e phahameng (Feie. 3E); leha ho le joalo, ho hlohlelletsa ho joalo ho ile ha eketsa khetho ea sucrose ha e bapisoa le litoeba tse sa susumetsoang (tšebelisano, F_(1,20) = 5.77, p <0.05; Teko ea poso ea Bonferroni t = 2.998_, p <Phello ea ts'usumetso ea liphoofolo tse tšoaroang ke CCK-0.05) (Feie. 3G).

Mokhoa o fapaneng haholo oa boits'oaro o ile oa bonoa ka ts'usumetso ea optogenetic ea PrL glutamatergic projeke ho BLA. Ho hlohlelletsa joalo ha hoa ka ha thibela tšireletso ea sechaba e hlahisoang ke ts'ebetso ea intra-PrL CCK-8 (tšebelisano, F_(1,22) = 0.79, p > 0.05; phello e kholo ea lithethefatsi, F_(1,22) = 11.75, p <0.05; ha ho na phello sehlopheng se tsositsoeng, t mamella teko t₍₁₂₎ = 2.054, p <0.05) (Feie. 3B). Leha ho le joalo, ho hlohlelletsoa ha barekisi ba BLA ho bile le tšusumetso e ts'oenyehileng joalo ka ha ho bonts'oa ke nako e eketsehileng e sebelisitsoeng matsohong a bulehileng a maze e phahameng (tšebelisano, F_(1,22) = 8.0, p <0.01; Teko ea poso ea Bonferroni t = 2.528, p <Phello ea vaerase ea 0.05 ka har'a lihlopha tse tšoaroang tsa CCK-8) (Feie. 3D). Ho hlohlelletsa likhakanyo tsa glutamatergic ho BLA ha ho na phello e kholo ho khethollo ea sucrose (tšebelisano, F_(1,22) = 2.08, p > 0.05) (Feie. 3F).

Puisano

Liphetho tsa boithuto ba hona joale li fana ka bopaki ba liphetoho tsa limolek'hule tse hlahelang PrL tse tlisoang ke khatello ea maikutlo sechabeng. Re bonts'a ho kenella hoa osFosB moqotong ona oa mPFC kamora khatello ea maikutlo ea khatello ea sechaba, moo ΔFosB ho tlatselletsa kelello ho khothaletsa khatello ea maikutlo. Re khethile receptor ea CCKB e le mofuta o le mong oa sepheo o laoloang ke ΔFosB ho PrL, ka mokhoa o hlakileng o kenyelletsa protheine ea CCKB ka litoeba tse senyehang mme re thibele ho nyenyefatsoa ha polelo ea CCKB e etsahalang ka mokhoa o ikhethileng ho litoeba tse sebetsang. Re bontšitse hape hore ho kenella ha agonist ea CCK ho PrL ho khothaletsa khatello ea maikutlo le boits'oaro bo ts'oanang le boits'oaro ho arabela khatello ea sechaba, athe lithibelo tsa mesebetsi ea CCKB receptor sebakeng sena sa litoeba tse senyehileng li thibela litlamorao tsena. Ka mor'a moo re ile ra sebelisa lisebelisoa tsa optogenetic ho khetholla li-microcircuitry tse kenyellelitsoeng liketsong tsa proanxcare- vs tsa protepression-like tsa CCK ho PrL. Leha li-cortico-NAc glutamatergic li-processor defence liphoso li bonahatsoa ke ho qoba sechaba le ho fokotsa khetho ea sucrose, microcircuit ena ha e susumetse litlamorao tsa CCK tse kentsoeng PrL. Ka lehlakoreng le leng, ho hakana ha BLA ho buella ponahatso ea boits'oaro bo amanang le ho tšoenyeha empa ha ho na phello likhatellong tsa boiketlo ba sechaba tse bakang khatello ea maikutlo kapa bofokoli ba khethollo. Ka bobeli, tlhaiso-leseling ena e bonts'a liphetoho tse teng tšebetsong ea PrL kamora ho hlola khatello e sa feleng ea setjhaba ho loants'a liphoso tse ngata ka boits'oaro bo ikhethileng.

ΔFosB: Ho etsa 'mapa oa khatello ea kelello le karolo ho mPFC

ΔFosB immunohistochemistry e supa li-neuron tse anngoeng ke khatello ea maikutlo e sa feleng ka tharollo ea sele e le 'ngoe ebile e sebelisitsoe ho etsa' mapa oa tsamaiso ea khatello ea maikutlo ("neuronal circry")Perrotti et al., 2004; Nikulina et al., 2008; Lehmann le Herkenham, 2011). Re sebelisitse mokhoa ona ho bonts'a khatello ea khatello ea maikutlo ea khatello ea kelello e hlolang ΔFosB libakeng tse fapaneng tsa boko tse nang le lipapatso tse arohaneng pakeng tsa lihlopha tse ikemiselitseng ho hlaseloa habonolo, tse ling li bonts'a litoeba ho litoeba tse mamellehang feela, tse ling li le litokollong tse ka bang teng feela, 'me tse ling li le ka tlasa maemo ana ka bobeli.Lethathamo 1). Mosebetsi oa nakong e fetileng o bonts'itse hore ΔFosB induction ho NAc kapa PAG ea hare-hare e ntlafatsa boikokobetso ho khatello ea maikutlo mme e kenya letsoho karabong ea antidepressant (Berton et al., 2007; Vialou et al., 2010).

Ho hlahisoa ha ΔFosB ho PrL ea litoeba tse amehang habonolo, hammoho le liphumano tse fetileng tse susumetsang optogenetic ea sebaka sena e ba le litlamorao tsa khatello ea maikutlo (Covington et al., 2010), e re khothalelitse hore re ithute ka tšusumetso ea ΔFosB sebakeng sena sa cortical. Khahlano le liphumano ho NAc le ventr PAG, re fumane hore ΔFosB ho PrL e khothalletsa ho ts'oaroa ha khatello ea maikutlo ea khatello ea khatello ea sechaba mme e hlahisa sephetho se tšoanang litekong tse ts'oaroang tsa ho sesa, ntle le ho ama boits'oaro bo kang boits'oaro kapa khetho ea sucrose. Ho fapana le PrL, ha re fumane phello ea ΔFosB overexpression ho IL e haufi. Phuputso ea morao-rao e fumane maemo a phahameng a ΔFosB ho IL ka litoeba tse tiileng mme e hatelletse subregion ena ho inehela khatellong ea sechaba (Lehmann le Herkenham, 2011). Ka hona lithuto tse ling li hlokahala ho sebetsana le likarolo tse fapaneng tsa likarolo tsena tse peli tsa mPFC, tse bonts'itsoeng ho hlahisa litlamorao tse fapaneng libakeng tsa boitšoaro tse ling (Sierra-Mercado et al., 2011; Burgos-Robles et al., 2013; Richard le Berridge, 2013). Re kile ra tlaleha hore batho ba tepelletseng maikutlo ba bonts'a maemo a tlase a ΔFosB ho NAc a hlahlobe postmortem (Vialou et al., 2010), wmona maemo a phahameng a ΔFosB a bontšitsoe ho dorsolateral PFC (sebaka sa Brodmann 46) sa batho ba tepeletseng maikutlo (Teyssier et al., 2011). Libaka tse ling tsa cortical ha lia ka tsa hlahlojoa thutong ea morao-rao. Ketsahalong efe kapa efe, liphumano tsena li tšehetsa tlhekefetso e ikhethang sebakeng sa polelo ea ΔFosB maemong a sithabetsang a batho, moo sengoloa se hlahisang litlamorao tse fapaneng haholo le ho ba le khatello ea maikutlo. E ka ba ho khahlisang lithutong tsa nakong e tlang ho hlahloba tšusumetso ea ΔFosB libakeng tse ling tse ngata tsa boko moo e hlahisoang teng (Lethathamo 1) mabapi le likarabo tsa khatello ea maikutlo.

Mochine o mong oo ΔFosB e ka kenang ho PrL e ka eketsang boitšoaro bo joalo ka khatello ea maikutlo ke ka ho hatella ketsahalo ea PrL. ΔFosB e bontšitsoe ho hatella likarabo tsa AMPA glutamate, 'me c-Fos expression, in NAc EH Kati spiny neurons (Renthal et al., 2008; Vialou et al., 2010; Grueter et al., 2013). Ka mokhoa o ts'oanang, re fumane ho fokotseha ho c-Fos polelo kamora ΔFosB overexpression ho PrL. Kahoo, ho kenella ka ΔFosB ho PrL ho ka ikarabella bakeng sa ts'ebetso ea neuronal e fokotsoeng e bonoang sebakeng sena kamora khatello ea khatello ea maikutlo ea khatello ea maikutlo sechabeng. Molumo o joalo o fokotsehileng oa PrL holim'a sepheo sa eona sa subcortical, joalo ka BLA le NAc, ho ka lebelloa ho ntlafatsa polelo ea tšabo le ho se khone ho tima likarabo tsa maikutlo ho khatello ea maikutlo (Fales et al., 2008, 2009). Ntle le moo, marang-rang a mPFC a hlohlelletsa likarabo tsa maikutlo a sithabetsang le bofokoli ka tšabo ea ho timela (Holson, 1986; Silva et al., 1986; Diorio et al., 1993; Milad le Quirk, 2002), ho fana ka maikutlo a hore ho fokotsoa ke khatello ea mPFC, ka karolo e itseng ho tsoa ho ΔFosB, ho ka baka khatello ea maikutlo le mafu a mang a amanang le khatello ea maikutlo (Choi et al., 2012).

Karolo ea CCK maemong a tlokotsing ea khatello ea maikutlo

Re fana ka bopaki ba hore li-receptor tsa CCKB ke sepheo sa ΔFosB, hore ΔFosB induction ho PrL ea litoeba tse amehang ke mochine o le mong feela oo ΔFosB e hlahisang litlamorao tse kang tsa protepression sebakeng sena. Le ha liketso tse khethehileng tsa CCK ho mPFC circry li lula li sa hlaka, ka mekotla CCK e fumaneha kahare ho GABAergic interneurons (Somogyi et al., 1984). Ho nahanoa hore e hatella tšebetso ea li-neuron tsa "cortical pyramidal" ka ho ntlafatsa tokollo ea GABA ea lehae le ho sebetsa ka kotloloho ho li-receptors tsa CCKB tse hlahisitsoeng ke li-neuron tsa pyramidal (Yaksh et al., 1987; Benoliel et al., 1992; Pérez de la Mora et al., 1993; Gallopin et al., 2006). Ka hona, li-neurotransication tsa CCKergic li ka kenya letsoho mosebetsing o fokolisitsoeng oa PrL o boletsoeng ka holimo.

CCK ke moemeli oa matšoenyeho, 'me taolo e hlophisehileng ea li-agonists tsa CCKB e hlohlelletsa litlhaselo tsa ts'abo ho baithaopi ba phetseng hantle. Bakuli ba ikemiselitseng ho hlaseloa ke tšabo ba fetoha hypersensitised kamora ho pepesetsoa CCK (de Montigny, 1989; Bradwejn et al., 1991). Liphuputso tse 'maloa li netefalitse litlamorao tsa CCK tsa matšoenyeho litoeba (Rotzinger le Vaccarino, 2003). Ho lokolloa ha CCK ho mPFC nakong ea khatello ea maikutlo ho litoeba ho amana le boits'oaro bo amanang le ho tšoenyeha (Becker et al., 2001); Likarolo tsa PrL le IL li ne li sa khetholloe thutong ena. Haufinyane tjena, systemic, blockade e sa foleng ea CCKB e nang le CI-988 e kenyelitseng litlamorao tse kang li-antidepressant liketsong tsa likhoto (Becker et al., 2008). CI-988 e tloaelehileng ea nako ea ho se sebetse litekong tse qobelloang tsa ho sesa. E boetse e thibela hypothalamic-pituitary-adrenal axis hyperactivity, e fokotsitse molumo oa hippocampal le ho eketseha ha sele, hape ea fokotsa khetho ea sucrose eo hangata e tsosoang ke ho hloloa hoa sechaba. Mona, re netefatsa liphetho tsena ka ho bonts'a phello ea antidepressant-CI-988 e kentsoeng ho PrL ea litoeba tse senyehang, leha e le hore ente e le 'ngoe ea systemic ha e etsise phello ena.

Ntle le ts'ebetso e mpe ea CCK ho PrL, re bontsitse maemo a fokotsehileng a CCKB mRNA ho litoeba tse ikemiselitseng, e ka bang phetoho ea molek'hule ka lebaka la ho tiea. Ka sebele, liphetoho lipokellong tsa molumo oa CCKergic, haholo mekhahlelo ea CCKB, li etsa mochini oa bohlokoa bakeng sa ho hlahisa letsoalo. Transgenic mice overexpressing CCKB e phatleng e bonts'a ho tšoenyeha ho hoholo le likarabo tsa ho tšaba (Chen le al., 2006). Ho fumana ha rona maemo a fetotsoeng a CCKB lipakeng tsa litoeba tse tiileng le tse ka hlaseloang habonolo ho ka tlatsetsa phapang ea phenotypic ho ts'oenyeheng le boits'oaro bo ts'oanang le bo sithabetsang. Mona, re bonts'a PrL e le karolo ea bohlokoa ea anatomical bakeng sa litlamorao tsa khatello ea maikutlo le tsa prodepressant tsa CCK maemong a khatello ea maikutlo sechabeng. Leha ho le joalo, libaka tse ling tse 'maloa tsa boko li kentse letsoho liketsong tsa CCK tsa boits'oaro, ho kenyeletsoa BLA, hippocampus, NAc le PAG (De Witte le al., 1987; Belcheva et al., 1994; Noble le Roices, 1999; Zanoveli et al., 2004; Rezayat et al., 2005). Hape, re fumane keketseho ea liprotheine tsa CCKB, empa eseng maemo a mRNA, ho mPFC ea liphoofolo tse kotsing. Liphumano tsena li tiisa hore, le ha maemo a mRNA a atisa ho lumellana le maemo a protheine, ha ho hlile ha ho joalo (Gygi et al., 1999).

Liteko tsa rona tsa optogenetic li bonts'a tšebetso e ntseng e eketseha ea likhakanyo tsa glutamatergic ho tloha PrL ho ea NAc kapa BLA e hanyetsa litlamorao tsa CCK ho PrL. Ho hlokahala lithuto tse ling ho netefatsa hore phello ea ts'usumetso ea optogenetic e tsamaisoa ke li-neuron tse tšoanang tsa PrL tse laoloang ke CCK. Ho khahlisang, tlhaiso-leseling ea rona e senola likarolo tse ikhethileng tsa li-microcircuits tsena tse peli ho hokahanya libaka tse fapaneng tsa boits'oaro bo bobe. Morero oa cortico-NAc o laola anhedonia le moputso; taba ea hore e laola ho qoba ho ba le sechaba e tiisa hore letšoao lena le bonts'a maikutlo a fokotsehileng a khothatso le moputso bakeng sa boits'oaro ba sechaba mme e seng la ho tšoenyeha ho eketsehileng sechabeng. Qeto ena e lumellana le ho se khonehe ha li-benzodiazepines ho lokisa tšibollo ena (Berton et al., 2006), hape le pontšo ea morao-rao ea hore mPFC e susumetsa NAc e eketsa moputso le khothatso ea lithethefatsi tsa tlhekefetso (Britt et al., 2012). Ho fapana le seo, mohopolo oa cortico-BLA o laola matšoao a amanang le ho tšoenyeha, a tsamaellanang le lingoliloeng tse kholo ka litoeba le batho (bona ka holimo).

Ha re phethela, Liphetho tsa boithuto ba hona joale li supa sebopeho sa libaka tse nang le bokhoni ba litho tsa bokong tse kenelletseng liphoofolong tse ka tsubang habonolo le tse matla, 'me li bonts'a liphetoho ho PrL e khothalletsang ho hlaseloa habonolo. Liphetoho tsena li kenyelletsa tlhahiso ea ΔFosB le ho kenella ha eona CCKB receptor. Ka lehlakoreng le leng, blockade ea liketso tsa CCK ho PrL e khothaletsa litlamorao tse joalo ka litlamorao. Re boetse re theha lipheo tsa subcortical tsa li-neuron tsa cortical pyramidal tse potileng liketso tsena, ka potoloho ea cortico-NAc ea bohlokoa boits'oaro bo amanang le khatello ea maikutlo, le potoloho ea cortico-BLA e bohlokoa bakeng sa boits'oaro bo amanang le ho tšoenyeha. Le ha lithuto tsa tlhabollo tsa lingaka tsa bahanyetsi ba CCKB ho bakuli ba tepelletseng maikutlong a 1990 li sa hlahise litholoana tse ntle, liphetho tsa hona joale li fana ka maikutlo a boleng ba ho hlahloba menyetla ea kalafo ea basebeletsi ba joalo maemong a tlase a bakuli ba pepesitsoeng maemo a phahameng a khatello ea maikutlo.

Mongolo o botlaaseng ba leqephe

Mosebetsi ona o ne o tšehelitsoe ke Setsi sa Naha sa Bophelo bo Botle ba Kelello (EJN) le Brain & Behavior Research Foundation Alliance ea Naha ea Patlisiso mabapi le Khau ea Schizophrenia le Depression Young Investigator ho VV.

Bangoli ha ba phatlalatse lithahasello tsa lichelete.

References

Akirav I, Maroun M. Karolo ea potoloho ea medial prefrontal cortex-amygdala maemong a khatello ea maikutlo ho felisoa hoa tšabo. Plastiki ea Neural. 2007; 2007: 30873. Doi: 10.1155 / 2007 / 30873. [Tlhahiso ea mahala ea PMC] [E fetotsoe] [Ref Ref Cross]
Barbas H, Blatt GJ. Merero e ikhethang ea hippocampal e tsepamisitse likarolo tse ikhethileng pele ho monkey ea rhesus. Hippocampus. 1995; 5: 511-533. Doi: 10.1002 / hipo.450050604. [E fetotsoe] [Ref Ref Cross]
Becker C, Thièbot MH, Touitou Y, Hamon M, Cesselin F, Benoliel JJ. Maemo a ntlafalitsoeng a cortical extracellular a thepa ea cholecystokinin joalo ka mohlala oa tebello ea ho hlola sechaba sechabeng. J Neurosci. 2001; 21: 262-269. [E fetotsoe]
Becker C, Zeau B, Rivat C, Blugeot A, Hamon M, Benoliel JJ. Liphetoho tse phetoang khafetsa tsa sechabeng tse bakang khatello ea maikutlo le boits'oaro lithutong: ho kenya letsoho cholecystokinin. Khoele ea kelello. 2008; 13: 1079-1092. Doi: 10.1038 / sj.mp.4002097. [E fetotsoe] [Ref Ref Cross]
Belcheva I, Belcheva S, Petkov VV, Petkov VD. Asymmetry ho likarabo tsa boits'oaro ho cholecystokinin microinjected into rat nucleus accumbens le amygdala. Neuropharmacology. 1994; 33: 995-1002. doi: 10.1016 / 0028-3908 (94) 90158-9. [E fetotsoe] [Ref Ref Cross]
Benoliel JJ, Bourgoin S, Mauborgne A, Pohl M, Legrand JC, Hamon M, Cesselin F. GABA, ea sebetsang ho li-receptor tsa GABAA le GABAB, o thibela ho hlahisoa ha lisebelisoa tsa cholecystokinin tse tsoang mokokotlong oa lesapo la mokokotlo ho vitro. Brain Res. 1992; 590: 255-262. doi: 10.1016 / 0006-8993 (92) 91103-L. [E fetotsoe] [Ref Ref Cross]
Berton O, McClung CA, Dileone RJ, Krishnan V, Renthal W, Russo SJ, Graham D, Tsankova NM, Bolanos CA, Rios M, Monteggia LM, Self DW, Nestler EJ. Karolo ea bohlokoa ea BDNF ka tsela e hlollang ea dopamine tseleng ea ho hlōla khatello ea sechaba. Saense. 2006; 311: 864-868. doi: 10.1126 / science.1120972. [E fetotsoe] [Ref Ref Cross]
Berton O, Covington HE, 3rd, Ebner K, Tsankova NM, Carle TL, Ulery P, Bhonsle A, Barrot M, Krishnan V, Singewald GM, Singewald N, Birnbaum S, Neve RL, Nestler EJ. Ho hlahisoa ha δFosB ka boteng ba perraqueductal ka khatello ea maikutlo ho khothaletsa likarabo tse sebetsang. Neuron. 2007; 55: 289-300. Doi: 10.1016 / j.neuron.2007.06.033. [E fetotsoe] [Ref Ref Cross]
Bewernick BH, Hurlemann R, Matusch A, Kayser S, Grubert C, Hadrysiewicz B, Axmacher N, Lemke M, Cooper-Mahkorn D, Cohen MX, Brockmann H, Lenartz D, Sturm V, Schlaepfer TE. Nyutlelie e bokellana ho ho tsosa ha kelello ho fokotseha litekanyetso tsa khatello ea maikutlo le ho tšoenyeha ka khatello ea maikutlo e hananang le kalafo. Psychology ea Biol. 2010; 67: 110-116. Doi: 10.1016 / j.biopsych.2009.09.013. [E fetotsoe] [Ref Ref Cross]
Bradwejn J, Koszycki D, Shriqui C. Matlafatso ea kutlo ea cholecystokinin tetrapeptide ho ts'oenyeha ha ts'abo: lipatlisiso tsa kliniki le boits'oaro. Psychology ea Arch Gen. 1991; 48: 603-610. Doi: 10.1001 / archpsyc.1991.01810310021005. [E fetotsoe] [Ref Ref Cross]
Bremner JD. Na khatello ea maikutlo e senya boko? Psychology ea Biol. 1999; 45: 797-805. doi: 10.1016 / S0006-3223 (99) 00009-8. [E fetotsoe] [Ref Ref Cross]
Bremner JD. Matšoenyeho a sithabetsang: litlamorao ho bokong. Dialogues Clin Neurosci. 2006; 8: 445-461. [Tlhahiso ea mahala ea PMC] [E fetotsoe]
Bremner JD. Neuroimaging a posttraumatic khatello ea kelello le mathata a mang a amanang le khatello ea maikutlo. Neuroimaging Clin North Am. 2007; 17: 523-538. Doi: 10.1016 / j.nic.2007.07.003. [Tlhahiso ea mahala ea PMC] [E fetotsoe] [Ref Ref Cross]
Britt JP, Benaliouad F, McDevitt RA, Stuber GD, RA ea Bohlale, Bonci A. Synaptic le boitsoaro ba mekhoa e mengata ea glutamatergic ho nucleus accumbens. Neuron. 2012; 76: 790-803. doi: 10.1016 / j.neuron.2012.09.040. [Tlhahiso ea mahala ea PMC] [E fetotsoe] [Ref Ref Cross]
Burgos-Robles A, Bravo-Rivera H, Quirk GJ. Li-neurons tsa prelimbic le infralimbic li bontša likarolo tse ikhethileng tsa boits'oaro ba sesebelisoa se matla. PloS One. 2013; 8: e57575. Doi: 10.1371 / journal.pone.0057575. [Tlhahiso ea mahala ea PMC] [E fetotsoe] [Ref Ref Cross]
Chen Q, Nakajima A, Meacham C, Tang YP. Molumo o phahamisitsoeng oa cholecystokininergic o etsa mokhoa oa bohlokoa oa molek'hule / neuronal bakeng sa ho hlahisa letsoalo la panya. Proc Natl Acad Sci US A. 2006; 103: 3881-3886. Doi: 10.1073 / pnas.0505407103. [Tlhahiso ea mahala ea PMC] [E fetotsoe] [Ref Ref Cross]
Choi DC, Gourley SL, Ressler KJ. Prelimbic BDNF le TrkB ho saena li laola ho kopanya ha monate oa takatso ea boithuto le boithuto ba maikutlo. Fetolela Psychiatry. 2012; 2: e205. Doi: 10.1038 / tp.2012.128. [Tlhahiso ea mahala ea PMC] [E fetotsoe] [Ref Ref Cross]
Christoffel DJ, Golden SA, Dumitriu D, Robison AJ, Janssen WG, Ahn HF, Krishnan V, Reyes CM, Han MH, Ables JL, Eisch AJ, Dietz DM, Ferguson D, Neve RL, Greengard P, Kim Y, Morrison JH , Russo SJ. IvanoB kinase e laola khatello ea maikutlo ea khatello ea maikutlo e hlahisoang ke batho ba nang le khatello ea kelello le boits'oaro. J Neurosci. 2011; 31: 314-321. Doi: 10.1523 / JNEUROSCI.4763-10.2011. [Tlhahiso ea mahala ea PMC] [E fetotsoe] [Ref Ref Cross]
Covington HE, 3rd, Kikusui T, Goodhue J, Nikulina EM, Hammer RP, Jr, Miczek KA. Khatello e khutšoane ea khatello ea sechaba: litlamorao tsa nako e telele tsa ho ts'oara koae ka nako ea polelo ea ho itlopa lijo le maf268 mRNA ho amygdala le preortalal cortex. Neuropsychopharmacology. 2005; 30: 310-321. Doi: 10.1038 / sj.npp.1300587. [E fetotsoe] [Ref Ref Cross]
Covington HE, 3rd, Lobo MK, Maze I, Vialou V, Hyman JM, Zaman S, LaPlant Q, Mouzon E, Ghose S, Tamminga CA, Neve RL, Deisseroth K, Nestler EJ. Phello e sithabetsang ea ts'ebetso ea optogenetic ea correx e ka hare-hare. J Neurosci. 2010; 30: 16082-16090. doi: 10.1523 / JNEUROSCI.1731-10.2010. [Tlhahiso ea mahala ea PMC] [E fetotsoe] [Ref Ref Cross]
Covington HE, 3rd, Maze I, Sun H, Bomze HM, DeMaio KD, Wu EY, Dietz DM, Lobo MK, Ghose S, Mouzon E, Neve RL, Tamminga CA, Nestler EJ. Karolo ea khatello ea khatello ea methapo ea methapo ho batho ba kotsing ea ho koahela khatello ea koae. Neuron. 2011; 71: 656-670. Doi: 10.1016 / j.neuron.2011.06.007. [Tlhahiso ea mahala ea PMC] [E fetotsoe] [Ref Ref Cross]
de Montigny C. Cholecystokinin tetrapeptide e tsosa litlhaselo tse joalo tsa tšabo ho baithaopi ba phetseng hantle: liphetho tsa pele. Psychology ea Arch Gen. 1989; 46: 511-517. Doi: 10.1001 / archpsyc.1989.01810060031006. [E fetotsoe] [Ref Ref Cross]
De Witte P, Heidbreder C, Roices B, Vanderhaeghen JJ. Litlamorao tse hanyetsanang tsa cholecystokinin octapeptide (CCK-8) le tetrapeptide (CCK-4) kamora ho kenngoa kahare karolong ea caudal ea li-nucleus bokellwang kapa karolong ea eona ea rostral le li-ventricle tsa mokokotlo. Neurochem Int. 1987; 10: 473-479. doi: 10.1016 / 0197-0186 (87) 90074-X. [E fetotsoe] [Ref Ref Cross]
Diorio D, Viau V, Meaney MJ. Karolo ea medial prefrontal cortex (cingrate gyrus) taolong ea likarabo tsa hypothalamic-pituitary-adrenal ho imeloa kelellong. J Neurosci. 1993; 13: 3839-3847. [E fetotsoe]
Drevets WC. Lithuto tse amanang le khatello ea maikutlo le tsa neuropathological: litlamorao bakeng sa likarolo tsa kelello le maikutlo tsa mathata a maikutlo. Curr Opin Neurobiol. 2001; 11: 240-249. doi: 10.1016 / S0959-4388 (00) 00203-8. [E fetotsoe] [Ref Ref Cross]
Fales CL, Barch DM, Rundle MM, Mintun MA, Snyder AZ, Cohen JD, Mathews J, Sheline YI. Ho kena-kenana le maikutlo ho fetotsoeng ha maikutlo ho potileng le ho laola kelello ha motho kelellong e kholo ea khatello ea maikutlo. Psychology ea Biol. 2008; 63: 377-384. Doi: 10.1016 / j.biopsych.2007.06.012. [Tlhahiso ea mahala ea PMC] [E fetotsoe] [Ref Ref Cross]
Fales CL, Barch DM, Rundle MM, Mintun MA, Mathews J, Snyder AZ, Sheline YI. Phekolo ea antidepressant e tloaetse hypoactivity ho corsex ea dorsolateral pele ho nako ha ho kenella maikutlong ho sebetsana le khatello ea maikutlo. J Mathata a Khahlano. 2009; 112: 206-211. Doi: 10.1016 / j.jad.2008.04.027. [Tlhahiso ea mahala ea PMC] [E fetotsoe] [Ref Ref Cross]
Feder A, Nestler EJ, Charney DS. Psychobiology le genetics ea limolek'hule tsa ho mamella. Nat Rev Neurosci. 2009; 10: 446-457. Doi: 10.1038 / nrn2649. [Tlhahiso ea mahala ea PMC] [E fetotsoe] [Ref Ref Cross]
Gallopin T, Geoffroy H, Rossier J, Lambolez B. Mehloli ea cortical ea CRF, NKB, le CCK le litlamorao ho lisele tsa pyramidal ho neocortex. Cereb Cortex. 2006; 16: 1440-1452. Doi: 10.1093 / cercor / bhj081. [E fetotsoe] [Ref Ref Cross]
Grubert C, Hurlemann R, Bewernick BH, Kayser S, Hadrysiewicz B, Axmacher N, Sturm V, Schlaepfer TE. Tšireletso ea Neuropsychological ea li-nucleus e bokellla ho tsitsisa ha kelello bakeng sa khatello e kholo ea maikutlo: litlamorao tsa ho hlohlelletsa khoeli ea 12. World J Biol Psychiatry. 2011; 12: 516-527. Doi: 10.3109 / 15622975.2011.583940. [E fetotsoe] [Ref Ref Cross]
Grueter BA, Robison AJ, Neve RL, Nestler EJ, Malenka RC. DFFB e fapana ka tsela e fapaneng ea motlakase e kenyang tsela e tobileng le e sa tobang. Proc Natl Acad Sci US A. 2013; 110: 1923-1928. doi: 10.1073 / pnas.1221742110. [Tlhahiso ea mahala ea PMC] [E fetotsoe] [Ref Ref Cross]
Gygi SP, Rochon Y, Franza BR, Aebersold R. Correlation lipakeng tsa protheine le mRNA e ngata ho tomoso. Mol Cell Biol. 1999; 19: 1720-1730. [Tlhahiso ea mahala ea PMC] [E fetotsoe]
Heidbreder CA, Groenewegen HJ. Cortex ea medial e tlang pele ho litekanyetso: bopaki ba karohano ea dorso-ventral e thehiloeng holim'a litšobotsi tsa ts'ebetso le li-anatomical. Neurosci Biobehav Rev. 2003; 27: 555-579. Doi: 10.1016 / j.neubiorev.2003.09.003. [E fetotsoe] [Ref Ref Cross]
Holson RR. Mesial preortal cortical lesions le ho hlatsoa lihlong lithutong: I. Reacisation to aversive stimuli. Physiol Behav. 1986; 37: 221-230. doi: 10.1016 / 0031-9384 (86) 90224-6. [E fetotsoe] [Ref Ref Cross]
Keedwell PA, Andrew C, Williams SC, Brammer MJ, Phillips ML. Mekhabiso ea neuralonia ea anhedonia bothateng bo boholo ba khatello ea maikutlo. Psychology ea Biol. 2005; 58: 843-853. Doi: 10.1016 / j.biopsych.2005.05.019. [E fetotsoe] [Ref Ref Cross]
Kennedy SH, Giacobbe P. Ho phekola khatello ea maikutlo e sa khaotseng: khatelo-pele lithutong tsa bongaka tse itseng. Ann Clin Psychiatry. 2007; 19: 279-287. Doi: 10.1080 / 10401230701675222. [E fetotsoe] [Ref Ref Cross]
Kennedy SH, Evans KR, Krüger S, Mayberg HS, Meyer JH, McCann S, Arifuzzman AI, Houle S, Vaccarino FJ. Liphetoho ho metabolism ea "glucose" ea tikoloho e lekantsoeng le positron emission tomography ka mor'a kalafo ea paroxetine ea khatello ea maikutlo e kholo. Ke J Psychiatry. 2001; 158: 899-905. Doi: 10.1176 / appi.ajp.158.6.899. [E fetotsoe] [Ref Ref Cross]
Renthal W, Rusia SJ, Lapland Q, Graham A, Lutter M, Lagace DC, Ghose S, Reister R, Tannous P, Green A , Eisch AJ, Eena DW, Lee FS, et al. Liphetoho tsa limolek'hule li thehiloeng ts'ebetsong le ho hanyetsa ho hlōloa ha sechaba sechabeng sa moputso oa libaka. Cell. 2007; 131: 391-404. doi: 10.1016 / j.cell.2007.09.018. [E fetotsoe] [Ref Ref Cross]
Krishnan V, Nestler EJ. Neurobiology ea molek'hule ea khatello ea maikutlo. Tlhaho. 2008; 455: 894-902. Doi: 10.1038 / nature07455. [Tlhahiso ea mahala ea PMC] [E fetotsoe] [Ref Ref Cross]
Lehmann ML, Herkenham M. Tlhokomelo ea tikoloho e tiisa khatello ea maikutlo ho ho hlōloa ha sechaba ka tsela ea phekolo ea methapo ea pelo ea corralx. J Neurosci. 2011; 31: 6159-6173. doi: 10.1523 / JNEUROSCI.0577-11.2011. [Tlhahiso ea mahala ea PMC] [E fetotsoe] [Ref Ref Cross]
Leistedt SJ, Linkowski P. Brain, marang-rang, khatello ea maikutlo le tse ling. Eur Neuropsychopharmacol. 2013; 23: 55-62. Doi: 10.1016 / j.euroneuro.2012.10.011. [E fetotsoe] [Ref Ref Cross]
Mayberg HS, Lozano AM, Voon V, McNeely HE, Seminowicz D, Hamani C, Schwalb JM, Kennedy SH. Ts'usumetso e tebileng ea kelello bakeng sa khatello ea maikutlo e hananang le kalafo. Neuron. 2005; 45: 651-660. Doi: 10.1016 / j.neuron.2005.02.014. [E fetotsoe] [Ref Ref Cross]
Hona ke, Covington HE, 3rd, Dietz DM, LaPlant Q, Renthal W, Russo SJ, Mechanic M, Mouzon E, Neve RL, Haggarty SJ, Ren Y, Sampath SC, Hurd YL, Greengard P, Tarakhovsky A, Schaefer A, Nestler EJ. Karolo ea bohlokoa ea histone methyltrferferase G9a ka polasetiki e entsoeng ka cocaine. Saense. 2010; 327: 213-216. doi: 10.1126 / science.1179438. [Tlhahiso ea mahala ea PMC] [E fetotsoe] [Ref Ref Cross]
McClung CA, Nestler EJ. Taolo ea polelo ea gene le moputso oa koae ka CREB le DeltaFosB. Nat Neurosci. 2003; 6: 1208-1215. Doi: 10.1038 / nn1143. [E fetotsoe] [Ref Ref Cross]
Milad MR, Quirk GJ. Li-Neurons tse memelo ea pontso ea cortex ea medial prefrontal cortex bakeng sa ho timela. Tlhaho. 2002; 420: 70-74. Doi: 10.1038 / nature01138. [E fetotsoe] [Ref Ref Cross]
Nahas Z, Anderson BS, Borckardt J, Arana AB, George MS, Reeves ST, Takacs I. Bilateral prelocal cortical cortical cortical cortical femal khatello ea maikutlo e sa phekoleng khatello ea maikutlo. Psychology ea Biol. 2010; 67: 101-109. Doi: 10.1016 / j.biopsych.2009.08.021. [Tlhahiso ea mahala ea PMC] [E fetotsoe] [Ref Ref Cross]
Nikulina EM, Arrillaga-Romany I, Miczek KA, Hammer RP., Jr Liphetoho tsa nako e telele meaho ea mesocorticolimbic kamora ho pheta-pheta khatello ea maikutlo sechabeng ka litoeba: nako ea mo-opioid receptor mRNA le FosB / DeltaFosB. Eur J Neurosci. 2008; 27: 2272-2284. Doi: 10.1111 / j.1460-9568.2008.06176.x. [Tlhahiso ea mahala ea PMC] [E fetotsoe] [Ref Ref Cross]
Noble F, Roques BP. CCK-B receptor: chemistry, biology ea molek'hule, biochemistry le pharmacology. Prog Neurobiol. 1999; 58: 349-379. doi: 10.1016 / S0301-0082 (98) 00090-2. [E fetotsoe] [Ref Ref Cross]
Noble F, Wank SA, Crawley JN, Bradwejn J, Seroogy KB, Hamon M, Roques BP. International Union of Pharmacology: XXI. Sebopeho, ho ajoa le mesebetsi ea li-cholecystokinin receptors. Pharmacol Rev. 1999; 51: 745-781. [E fetotsoe]
Pérez de la Mora M, Hernandez-Gómez AM, Méndez-Franco J, Fuxe K. Cholecystokinin-8 e eketsa K (+) - evoche [³H] gamma-aminobutyric acid e lokolloe ka lisakha tse tsoang libakeng tse fapaneng tsa boko. Eur J Pharmacol. 1993; 250: 423-430. doi: 10.1016 / 0014-2999 (93) 90029-H. [E fetotsoe] [Ref Ref Cross]
Perrotti LI, Hadeishi Y, Ulery PG, Barrot M, Monteggia L, Duman RS, Nestler EJ. Ho qhekella ha δFosB ka mekhoa ea boko bo amanang le moputso ka mor'a khatello ea maikutlo. J Neurosci. 2004; 24: 10594-10602. doi: 10.1523 / JNEUROSCI.2542-04.2004. [E fetotsoe] [Ref Ref Cross]
Rowland RI, Rowland RI, Rowland R Row, Rowland Row, Rowland RI, Rowland RI, Rowland RI, Rowland RJ, Rowland RJ, Rowland EJ. Mekhoa e fapaneng ea DeltaFosB ho kenngoa ka bokooa bokong ka lithethefatsi tsa tlhekefetso. Synapse. 2008; 62: 358-369. doi: 10.1002 / syn.20500. [Tlhahiso ea mahala ea PMC] [E fetotsoe] [Ref Ref Cross]
Radley JJ, Rocher AB, Miller M, Janssen WG, Liston C, Hof PR, McEwen BS, Morrison JH. Khatello ea maikutlo khafetsa e etsa hore ho lahleheloe ke lesapo la dendritic mokokotlong oa "rat medial" pele ho "cortex". Cereb Cortex. 2006; 16: 313-320. Doi: 10.1093 / cercor / bhi104. [E fetotsoe] [Ref Ref Cross]
Renthal W, Carle TL, Maze I, Covington HE, 3rd, Truong HT, Alibhai I, Kumar A, Montgomery RL, Olson EN, Nestler EJ. Delta FosB e buisana le 'mele oa ecpiitetic ka ho fetoloa hoa mofuta oa c-fos kamora ho pepeseha ho sa feleng hoa amphetamine. J Neurosci. 2008; 28: 7344-7349. Doi: 10.1523 / JNEUROSCI.1043-08.2008. [Tlhahiso ea mahala ea PMC] [E fetotsoe] [Ref Ref Cross]
Rezayat M, Roohbakhsh A, Zarrindast MR, Massoudi R, Djahanguiri B. Cholecystokinin le tšebelisano-'moho le GABA tekanyetsong ea dorsal hippocampus ea litoeba tlhahlobong e phahameng ea' mele-ea maze. Physiol Behav. 2005; 84: 775-782. Doi: 10.1016 / j.physbeh.2005.03.002. [E fetotsoe] [Ref Ref Cross]
Richard JM, Berridge KC. Pele ho cortex modulates takatso le tšabo e hlahisoang ke nyutlelie ea bokellana glutamate. Psychology ea Biol. 2013; 73: 360-370. Doi: 10.1016 / j.biopsych.2012.08.009. [Tlhahiso ea mahala ea PMC] [E fetotsoe] [Ref Ref Cross]
Rotzinger S, Vaccarino FJ. Cholecystokinin receptor subtypes: karolo ea phetolo ea boits'oaro bo amanang le ho tšoenyeha le moputso mefuteng ea liphoofolo. J Psychiatry Neurosci. 2003; 28: 171-181. [Tlhahiso ea mahala ea PMC] [E fetotsoe]
Schlaepfer TE, Cohen MX, Frick C, Kosel M, Brodesser D, Axmacher N, Joe AY, Kreft M, Lenartz D, Sturm V. Ho ts'oaroa ha kelello ho fana ka moputso oa potoloho ho fokotsa ts'ebetso ea "" "" circry ". Neuropsychopharmacology. 2008; 33: 368-377. Doi: 10.1038 / sj.npp.1301408. [E fetotsoe] [Ref Ref Cross]
Sierra-Mercado D, Padilla-Coreano N, Quirk GJ. Likarolo tse sa amaneng le li-cortices tsa prelimbic le infralimbic, ventral hippocampus, le basolateral amygdala polelong le pheletsong ea tšabo e nang le maemo. Neuropsychopharmacology. 2011; 36: 529-538. Doi: 10.1038 / npp.2010.184. [Tlhahiso ea mahala ea PMC] [E fetotsoe] [Ref Ref Cross]
Silva MG, Boyle MA, Finger S, Numan B, Bouzrara AA, Almli CR. Litlamorao tsa boits'oaro ba liso tse kholo le tse nyane tsa rat medial frontal cortex. Brain Res. 1986; 65: 176-181. [E fetotsoe]
Somogyi P, Hodgson AJ, Smith AD, Nunzi MG, Gorio A, Wu JY. Baahi ba mefuta e fapaneng ea li-neurons tsa GABAergic ka har'a cortex ea pono le hippocampus ea katse li na le somatostatin- kapa cholecystokinin-immunoreactive thepa. J Neurosci. 1984; 4: 2590-2603. [E fetotsoe]
Lekola A, Tanti A, Leonardo ED, Laugeray A, Pula ea Q, Touma C, Palme R, Griebel G, Ibarguen-Vargas Y, Hen R, Belzung C. Lingaka tsa kelello li hira li-neurons tse ncha ho ntlafatsa taolo ea karabelo ea khatello. Khoele ea kelello. 2011; 16: 1177-1188. Doi: 10.1038 / mp.2011.48. [Tlhahiso ea mahala ea PMC] [E fetotsoe] [Ref Ref Cross]
Taniguchi H, He M, Wu P, Kim S, Paik R, Sugino K, Kvitsiani D, Fu Y, Lu J, Lin Y, Miyoshi G, Shima Y, Fishell G, Nelson SB, Huang ZJ. Mohloli oa mela ea likhoele tsa Cre bakeng sa liphatsa tsa lefutso tsa "neuron" ea GABAergic ho cortex ea "cerebral". Neuron. 2011; 71: 995-1013. Doi: 10.1016 / j.neuron.2011.07.026. [Tlhahiso ea mahala ea PMC] [E fetotsoe] [Ref Ref Cross]
Teyssier JR, Ragot S, Chauvet-Gélinier JC, Trojak B, Bonin B. Ts'ebetso ea mofuta oa polelo ea mofuta oa DeltaFOSB ho dorsolateral prefrontal cortex ea bakuli ba nang le bothata bo boholo ba khatello ea maikutlo. J Mathata a Khahlano. 2011; 133: 174-178. Doi: 10.1016 / j.jad.2011.04.021. [E fetotsoe] [Ref Ref Cross]
Tsankova NM, Berton O, Renthal W, Kumar A, Neve RL, Nestler EJ. Ts'ebetso ea hippocampal chromatin e tsitsitseng ka mokhoa oa panya ea khatello ea maikutlo le ts'ebetso ea antidepressant. Nat Neurosci. 2006; 9: 519-525. Doi: 10.1038 / nn1659. [E fetotsoe] [Ref Ref Cross]
Tye KM, Prakash R, Kim SY, Fenno LE, Grosenick L, Zarabi H, Thompson KR, Gradinaru V, Ramakrishnan C, Deisseroth K. Amygdala circuitry mediating reversible and control bidatectional of control. Tlhaho. 2011; 471: 358-362. Doi: 10.1038 / nature09820. [Tlhahiso ea mahala ea PMC] [E fetotsoe] [Ref Ref Cross]
Vialou V, Robison AJ, Laplant QC, Covington HE, 3rd, Dietz DM, Ohnishi YN, Mouzon E, Rush AJ, 3rd, Watts EL, Wallace DL, Iñiguez SD, Ahnishi YH, Steiner MA, Warren BL, Krishnan V, Bolaños CA, Neve RL, Ghose S, Berton O, Tamminga CA, et al. DeltaFosB ho li-circuits tsa moputso oa boko li thusa ho sebetsana le khatello ea maikutlo le likarabo tse khahlanong le khatello ea maikutlo. Nat Neurosci. 2010; 13: 745-752. Doi: 10.1038 / nn.2551. [Tlhahiso ea mahala ea PMC] [E fetotsoe] [Ref Ref Cross]
Vogt BA, Finch DM, Olson CR. Mokhoa o sebetsang oa heterogeneity ho cingate cortex: sebaka se ka sehloohong sa bolaoli le libaka tsa tlhahlobo tsa kamora nako. Cereb Cortex. 1992; 2: 435-443. Doi: 10.1093 / cercor / 2.6.435-a. [E fetotsoe] [Ref Ref Cross]
Wilkinson MB, Xiao G, Kumar A, LaPlant Q, Renthal W, Sikder D, Kodadek TJ, Nestler EJ. Phekolo ea imipramine le boikemisetso li bonts'a molao o tšoanang oa chromatin ho li-nucleus tsa mouse ho mefuta ea khatello ea maikutlo. J Neurosci. 2009; 29: 7820-7832. Doi: 10.1523 / JNEUROSCI.0932-09.2009. [Tlhahiso ea mahala ea PMC] [E fetotsoe] [Ref Ref Cross]
Winstanley CA, LaPlant Q, Theobald DE, Green TA, Bachtell RK, Perrotti LI, DiLeone RJ, Russo SJ, Garth WJ, Self DW, Nestler EJ. DeltaFosB induction ea orbitofrontal cortex e mamellana mamellong ea ho se sebetse hantle ha koae ka koae. J Neurosci. 2007; 27: 10497-10507. Doi: 10.1523 / JNEUROSCI.2566-07.2007. [E fetotsoe] [Ref Ref Cross]
Yaksh TL, Furui T, Kanawati IS, E ea VL. Ho lokolloa ha cholecystokinin ho "cortex" ea "cerebral" cortex ho karolo ea "GABA" le "glutamate receptor system". Brain Res. 1987; 406: 207-214. doi: 10.1016 / 0006-8993 (87) 90784-0. [E fetotsoe] [Ref Ref Cross]
Zanoveli JM, Netto CF, Guimarães FS, Zangrossi H., Jr Systemic le intra-dorsal periaqueductal grey ente ea cholecystokinin sulfated octapeptide (CCK-8s) e hlahisa karabelo e ts'oanang le ea boikhabi literekeng tse isitsoeng ho T-maze e phahameng. Li-peptide. 2004; 25: 1935-1941. Doi: 10.1016 / j.peptides.2004.06.016. [E fetotsoe] [Ref Ref Cross]