(Human) Surunkali Qo'qonga nisbatan xulq-atvorli va strukturaviy javoblar Nucleus Accumbens Shell (2013) dagi FosB va Kaltsiy / Calmodulinga bog`langan Protein Kinaz II ni jalb qiladigan,

J Neurosci. 2013 Mar 6;33(10):4295-4307.

Robison AJ, Vialou V, Mazei-Robison M, Feng J., Kourrich S, Collins M, Wee S, Koob G, Turecki G, Neve R, Thomas M, Nestler EJ.

manba

Nyu-York, 10029, Nyu-York, Nyu-York, 55455, Nevrologiya va psixologiya bo'limi, Human Genetika instituti, MINNESOTA universiteti, Minneanapolis, MINNESOTA 92037, Addictive Bozuklukları Nörobiyolojisi qo'mitasi, Fishberg Nörobilim va Friedman Brain instituti, Sinay Tibbiyot maktabi , Scripps Tadqiqot Instituti, La Jolla, Kaliforniyada 4 Depressiv Bozukluklar dasturi, Duglas Ruh Sa ¤ L> ¤> Universiteti va McGill universiteti, Montréal, Quebec, Kanada, H1H 3R02139 va Miya va Kognitif Fanlar bo'limi, Massachusetts Texnologiya instituti, Kembrij, Massachusetts XNUMX .

mavhum

Transkriptsiya faktori DFB va miya bilan boyitilgan kaltsiy / kalmodulinga qaram protein kinaz II (CaMKIIa) kokain yoki boshqa psixostimulyar dorilarning surunkali ta'siriga duchor bo'lganda, bu proteynlar sezgirlangan dori javoblariga vositachilik qilgan yadro akkumbenlari (NAc) . DFOSB va CaMKIIa NAc ning AMPA glutamat retseptorlari ifodasi va funktsiyasini, NAc o'rta aylanma neuronlarda (MSN) dendritik orqa miya organizmini va kokainga lokomotor sezuvchanlikni tartibga solsa-da, bu molekulalar orasidagi to'g'ridan-to'g'ri bog'liqlik hozirgi kungacha o'rganilmagan. Bu erda DFOSB ning CaMKIIa tomonidan oqsil-stabillashadigan Ser27da fosforilatlanganligini va CaMKII ning NAc ning DFOSB ning kokain-vositachilik birikmasi uchun talab qilinadi.

Aksincha, DFOSB ning in Vivo jonli CaMKIIa gen ekspresyonunun giyoh indüksiyonu uchun kerak va etarli ekanligini ko'rsatamiz, D1NAc qobig'idagi pastki mintaqada MSN-lar.

Bundan tashqari, NAc MSN-larda dendritik spinlarning kiritilishi va NAF ning DFFning ortiqcha ifodasini topganidan keyin kokainga nisbatan ta'sirchanligini oshirishi CaMKIIga qaram bo'lgan.

Eng muhimi, biz NAc of DFF va CaMKII ni birinchi marotaba namoyish etmoqdamiz giyoh giyohvand moddalarga qaram shaxslarkelajakda terapevtik aralashuvlar uchun mumkin bo'lgan maqsadlarni taklif qiladi. Ushbu ma'lumotlarga ko'ra, DFOSB va CaMKII surunkali kokainga javoban miyaning mukofot tizimini tartibga solishning asosiy mexanizmi sifatida hujayra tipidagi va miya-mintaqaga xos bo'lgan ijobiy ovqatlarni yuborish uchun pastadir.

kirish

Dalillarni ko'paytirish gen ifoda- sidagi o'zgarishlarning giyohvandlikning mexanizmlariga yordam berishi haqidagi fikrni qo'llab-quvvatlaydi (Robison va Nestler, 2011). Ushbu o'zgarishlarning muhim vositachisi DFOSB, Fosning oila transkripsiyasi omilidir (Nestler, 2008). Deyarli har qanday suyuqlikning surunkali ma'muriyati, mukofotlash uchun zarur bo'lgan limbik mintaqa bo'lgan yadro akumbens (NAc) da DFOSBning uzoq muddatli birikmasini keltirib chiqaradi. Such indüksiyon, D1 dopamin reseptörlerini ifoda etgan NAc o'rta zararli nöron (MSN) sinfiga xosdir. Ushbu D1-turdagi NAc MSN-larda DFOSB ning indossable ortiqcha ekspressioni kokain va morfinga lokomotor va rewarding javoblarni oshiradi (Kelz va boshq., 1999; Zachariou va boshq., 2006), shu jumladan, giyohlarning o'z-o'zini boshqarishini oshirish (Colby va boshq., 2003). Bundan tashZari, DFOSB transkripsiyonuniy faoliyatining genetik yoki virusli blokadasi bu dorilarningZachariou va boshq., 2006), bu DFB ning doimiy ravishda indüksiyonunun, NAc'de surunkali dori tatbikatıyla indüklenen doimiy o'zgarishlarning muhim vositasi ekanligini ko'rsatib turibdi.

DFOSBning (Fosning boshqa barcha oqsillari bilan solishtiradigan) odatiy bo'lmagan barqarorligi, to'liq uzunlikdagi FosB (hozirgi FosB) da mavjud bo'lgan degronli domenlarning kesilishi sababli, molekulaning o'ziga xos xususiyatidirCarle va boshq., 2007) va tartibga solingan jarayon. DF fosforli bo'ladi in vitro va ning Vivo jonli Ser27 da va bu reaksiya, DFosB, ~ 10-marta, hujayra madaniyatida va NAc-da stabillashadi ning Vivo jonli (Uler-Reynolds va boshq., 2009). Ser27-AFosB ning kazein kinaz-2 uchun substrat ekanligi ko'rsatilgan bo'lsa-da in vitro (Ulery va boshq., 2006), uning mexanizmi ning Vivo jonli fosforillanish ma'lum emas.

Kaltsiy / kalmodulinga bog'liq protein kinaz II (CaMKII) yuqori aniqlikda serine / treonin kinazdir, ularning a va b izoformlari dodekamerik homo va hetero-holoenzimalarni hosil qiladi ning Vivo jonliva neyroplastikaning bir nechta shakllari uchun juda muhimdir (Lisman va boshq., 2002; Colbran va Brown, 2004). CaMKIIa surunkali amfetamin (NAC) qobig'ida selektiv ravishda indüklenir (Loweth va boshq., 2010) va NAc qobig'idagi CaMKII samaradorligini iqtisodiyot blokadasi amfetaminga nisbatan xulq-atvori sezuvchanligini pasaytiradi (Loweth va boshq., 2008) va kokain (Pirs va boshq., 1998), bu NAc subregionidagi CaMKIIa ning virusli haddan tashqari ekspresiyasi amfetaminning lokomotor sezuvchanligini va o'zini o'zi boshqarishini kuchaytiradi (Loweth va boshq., 2010). CaMKIIa AMPA glutamat retseptorlari bo'linmalari modulyatsiyasi orqali mukofotlash ishlariga ta'sir qilishi mumkin (Pirs va boshq., 1998CaMKIIa faoliyati AMPA retseptorlari funktsiyasi va sinaptik-nishonga olish bilan uzoq vaqt davomida turli xil neuroplastiklik (Malinow va Malenka, 2002).

Ushbu adabiyotda DF va CaMKII orasida bir nechta paralellar mavjud: ularning har ikkalasi ham giyohvand moddalarni iste'mol qilishning ko'plab yurish-turadigan ta'sirlari uchun zarur va etarli bo'lgan, hamda turli xil neyronal hujayralardagi dendritik pog'onalarni ning Vivo jonli (Jourdain va boshq., 2003; Maze va boshq., 2010) va har ikkisi ham AMPA retseptorlarini modulyatsiya qilish orqali ularning xatti-harakatlari ta'siriniKelz va boshq., 1999; Malinow va Malenka, 2002; Vialou va boshq., 2010). Ushbu parallellarga qaramasdan, DF va CaMKII o'rtasida hech qanday funktsional bog'lanish mavjud emas. Bu erda biz DFOSB va CaMKII o'rtasida o'zaro tartibni o'rnatdik va ikkala oqsilni NAX qobig'ida D1 tipidagi MSNga xos besleme ildizini tashkil etayotganligini ko'rsatib, kokain tomonidan uyg'unlashib, bir qator kokain javoblarini tartibga soladi ning Vivo jonli.

O'tish:

Materiallar va usullari

1 eksperimenti: NAc Shell va Core kokainni davolashdan keyin iTRAQ protektsion tahlillari (Fig 1A)

Erkaklar (8 haftalar) erkak sichqonchani kuniga bir marta etti kun davomida bir marta 20 mg / kg kokain yoki sho'r suvli vosita IP-ga kiritilgan. Oxirgi enjeksiyadan so'ng 24 soat keyin NAc qobiqi va yadrolari mikrodissed (Fig 1A) va muzlatilgan flesh. iTRAQ tahlillari ilgari tasvirlangan (Ross va boshq., 2004; Davalos va boshq., 2010).

Shakl 1

Shakl 1

NAQdagi CaMKII ning Shellga maxsus indeksatsiyasi kokain bilan

2 ning eksperimenti: kokainni davolashdan keyin natsistorada va qobiqda oqsil miqdori o'zgarishi (Fig 1B-D)

Erkaklar (8 haftalar) erkak sichqonlar sakkiz kun mobaynida kuniga bir marta 10 mg / kg kokain yoki sho'r suvli vosita IP-qo'zg'atuvchisi ro'yxatga olish kameralarida qo'llangan. Kokainle ("surunkali") ilgari davolangan hayvonlarga va "sho'r" deb nomlangan ("o'tkir" deb nomlangan) bir qismini va bitta eritrotsitlar uchun sho'r suvli reaktsiyalarga javoban bir kokainni (5 mg / kg IP) bir marta yuborish uchun lokomotor javoblar qayd etildi qolgan surunkali sho'rlangan davolangan hayvonlarga ("sho'rlangan" deb nomlangan) qo'shilgan. Lokomotor harakatlarni tahlil qilish,Xiroy va boshqalar, 1997). Qisqacha aytganda, 18 "24" PAS maydonida 30 min oraliq ro'yxatga olish qutilarida (San Diego Instruments) kattalar erkak sichqonchani joylashtirildi, bir IP ning sho'rlanishi berilgan va qo'shimcha 30 min uchun nazorat qilingan 5 mg / kg kokainning yagona IP-tizimlari va 30 min.

24 soatdan so'ng, ushbu anestezikani neyronal oqsil darajalari va fosfor holatlariga ta'sirini oldini olish uchun behushliksiz dekapitatsiya qilindi. Braunlar 1.2 mm matritsasida (Braintree Scientific) sintezlangan va maqsadli to'qimalar NAc yadrosi uchun 14 o'lchagich mesh yordamida fosfat tamponlu tuzli proteaz (Roche) va fosfataz (Sigma Aldrich) inhibitörleri va qolgan 12 gauge mesh NAc shell uchun to'qima (Qarang Fig 1A) va quruq muz ustida zudlik bilan muzlatilgan. O'zgartirilgan RIPA tamponida nurli sonikatsiya yordamida namunalar homogen qilingan: 10 mM Tris asos, 150 mM natriy xlor, 1 mM EDTA, 0.1% natriy dodesil sulfat, 1% Triton X-100, 1% natriy deoksikolat, pH 7.4, proteaz va fosfataz inhibitörleri yuqoridagi kabi. Laemmli tamponining qo'shilgandan so'ng oqsillar 4-15% poliakrillamid gradyanli jellarda (Kriteriya tizimi, BioRad) ajratildi va ishlab chiqaruvchi protokollar bo'yicha Odyssey tizimi (Li-Cor) yordamida Western blotting jarayoni amalga oshirildi.

3 eksperimenti: kokainni chiqarib tashlaganidan keyin natsistoksin va qobiqdagi oqsil miqdori o'zgarishi (Fig 1E)

Erkaklar (8 haftalar) erkak sichqonchani kuniga bir marta etti kun davomida bir marta 10 mg / kg kokain yoki sho'r suvli vosita IP-ga kiritilgan. Oxirgi in'ektsiyadan so'ng 14 kun o'tgach, sho'rlangan eritmalarga yana salin ekstrakti ("sho'r" deb ataladi) va kokain bilan davolash qilingan hayvonlarga yana bir sho'rlangan in'ektsiya (14 kun yoki "14d WD" deb ataladi) yoki bitta kokain "14d WD Chal" deb nomlangan). Oxirgi inyeksiyadan keyin bir soatdan keyin hayvonlarni dekapitatsiya qilish va g'arbiy blokirovkalash jarayoni boshlandi Sinov 2.

4 eksperimenti: Kokainning o'z-o'zini boshqarishidan so'ng, hujayradagi qorin bo'shlig'i va qobig'idagi protein miqdori o'zgaradi (Fig 2A-C)

Sichqoncha to'qqiz kun mobaynida 0.5 jadvali bo'yicha bir-soatlik sessiyalarda 1 mg / kg / kokain infuzionini o'z-o'zini boshqarish uchun o'qitildi. To'qqiz asosiy uchrashuvdan so'ng, kalamushlar so'nggi ikki sessiyada kokain iste'moli bilan taqqoslangan ikki guruhga bo'lingan. Sichqonlardan bir guruhi, bir soatli sessiyalarda (qisqa kirish, SSh) kokainni (0.5 mg / kg / infuzion) o'z-o'zini boshqarishiga ruxsat berilgan bo'lsa-da, boshqa kalamushlar guruhi olti soatlik sessiyalarda o'z-o'zini boshqaradigan kokainga (uzoq kirish, LgA ) o'n kunlik qo'shimcha muddat (eskalatsiya sessiyalari) uchun.

Brain qismlari, ta'rif etilganidek, immünhistokimyasal sifatida qayta ishlangan (Perrotti va boshq., 2004). Bemorlarga so'nggi maruziyetdan keyin 18-24 soatdan oshib ketdi, natijada FOSB ning qolgan barcha immunoreaktivligi aks ettirildi, shuning uchun har qanday qoldiq to'liq uzunlikdagi FosB oqsilining degradatsiyasiga olib keldi. Ushbu buzilish Western blotting tomonidan tasdiqlangan bo'lib, bu aniq FF ning C terminusiga qarshi antikor bilan boyitilmaganligini ko'rsatmadi, bu esa DFBni (ma'lumot ko'rsatilmagan) anglatmaydi. 35 ìm bo'limiga bo'linib bo'lgach, DFOSB immunopozitiv hujayralarining soni ikkita bo'lakda har bir ratning NAc orqali aniqlandi va o'rtacha har bir 40 × maydon har bir hayvon uchun mintaqada hisoblandi. Har bir hayvon statistik tahlil uchun individual kuzatuv hisoblangan. Faoliyat hududlari Paxinos va Watson (Paxinos va Watson, 2007).

CaMKIIa ning immunoreaktivligini kantifikatsiya qilish, yuqorida aytib o'tilganidek, Licor tizimi yordamida amalga oshirildiCovington va uning hamkorlari, 2009). CaMKII va GAPDH integratsiyalangan intensivligi Odyssey dasturiy ta'minotida aniqlandi. Natijalar mm bo'yicha integral zichlik qiymatlari sifatida taqdim etiladi2 va vositalar sifatida taqdim etiladi.n = Guruhda 4-10). GAPDH uchun qadriyatlar dilim qalinligi va sharoitlari uchun CaMKII intensivligini normalizatsiya qilish uchun ishlatilgan.

Shakl 2

Shakl 2

CaCKII ni o'z-o'zini boshqarish sichqonlari va inson giyohli giyohvand moddalarning NAc qobig'ida indüksiyasi

5 eksperimenti: kokainga bog'liq odamlarda miqdoriy miqdoriFig 2D)

tartib

Postmortem inson miya to'qimalari Quebec Suicide Brain Bankidan olingan (Duglas Mental Health University Institute, Montreal, Quebec, Kanada). To'qimalarning saqlanib qolishi asosan ta'rif etilganidek (Quirion va boshq., 1987). Qisqasi, bir marta chiqarilganidan so'ng, miya Styrofoam qutisidagi nam muzga tushiriladi va Quebec Suicide Brain Bank muassasalariga yuguradi. Hamisferlar miya, miya sopi va serebellum o'rtasida sagittal kesilgan holda darhol ajralib turadi. Qon tomirlari, pineal bez, choroid plexus, yarim serebellum va yarim miya sopi odatda chap yarim sharda ajratiladi va keyin muzlatishdan oldin koronali ravishda 1 santimetr qalinligida kesiladi. Ikkinchi yarmi serebellum, muzlatishdan oldin, sindromi bilan 1cm-qalin chiziqlarga kesiladi. To'qimalar 2-metilbutanda -40 ° C da ~ 60 soniya davomida muzlatiladi. Barcha muzlatilgan to'qimalar -80 ° C da uzoq muddatli saqlash uchun plastik qoplarga alohida saqlanadi. Muayyan miya hududlari muzlatilgan koronali bo'laklardan zanglamaydigan po'lat plitalar atrofida quruq muz bilan atrof muhitning haroratini nazorat qilish uchun ajratiladi. Western blotting, tasvirlanganidek, amalga oshirildi Sinov 2.

Kohort

Kohort 37-3 yil orasida o'zgargan 15 erkak va 66 ayol sub'ektlaridan tashkil topgan. Barcha sub'ektlar uzoq davom etadigan og'riqsiz yoki uzoq davom etadigan tibbiy kasalliksiz to'satdan vafot etgan. Har holda, o'lim sababi Quebec Coroner ofisi tomonidan aniqlandi va o'lim vaqtida dorilar va noqonuniy moddalarni ishlatish haqida ma'lumot olish uchun to'qimalar namunalari bilan toksikologik ekran o'tkazildi. Mavzu guruhi 20 kishilaridan tashkil topgan bo'lib, ular giyohvandlikka bog'liq bo'lgan SCID-I mezonlariga javob berishgan. Nazorat guruhi 20 sub'ektlaridan tashkil topgan bo'lib, giyohga qaramlik va hech qanday asosiy psixiatrik tashxis mavjud emas. Barcha sub'ektlar to'satdan miya to'qimalariga bevosita ta'sir qilmaydigan sabablar tufayli vafot etdi. Guruhlar, o'rtacha yosh, sovutish kechikish va pH qiymati bilan mos keladigan edi. Barcha masalalar bo'yicha psixologik autopsiya ilgari ta'riflanganidek amalga oshirildi (Dumais va boshq., 2005), shuningdek, psixiatrik va tibbiy xulosaga oid batafsil ma'lumotlarga, shuningdek, tegishli klinik va sosyodemografik ma'lumotlarni olish imkonini beradi. Qisqacha qilib, tarbiyalangan intervyuser buni o'tkazdi DSM-IV uchun tuzilgan klinik intervyu Psixiatrik kasalliklar (SCID-I) vafot etganlarning bir yoki bir nechta informantlari bilan. Klinik shifokorlar guruhi psixiatriya bo'yicha konsensus diagnostikasini olish uchun SCID-I mulohazalarini, amaliy hisobotlarini, korpusning yozuvlarini va tibbiy yozuvlarni ko'rib chiqdi.

6 eksperimenti: Rats NAc uchun xromatin immunoprecipitation (Fig 3A-C)

Erkaklar (8 haftalar) erkak sichqonchani kuniga bir marta etti kun davomida bir marta 10 mg / kg kokain yoki sho'r suvli vosita IP-ga kiritilgan. Oxirgi enjeksiyadan so'ng 24 soat keyin NAc qobig'i va yadrolari mikrodissse qilindi. 14 umumiy guruhlarida (98 hayvonlarning jami, 7 kokainli hovuzlar, 7 sho'rlangan hovuzlar) guruhda har bir guruhda etti ta kaltsiydan olingan qobiq yoki yadrolarning ikki tomonlama NAc punchesini chromatin immunoprecipitation (ChIP) amalga oshirildi. To'qimalar o'zaro bog'langan, yuvilgan va -80 ° Cda ultrafiltratsiya qilish orqali kromatin kesmagunga qadar saqlangan. Tarqalgan kromatin kecha ilgari magnitli boncuklara (Dynabeads M-280, Invitrogen) bog'langan antikorlar bilan inkübe qilindi. Immunitetga qarshi IgG nazorat sifatida ishlatilgan. Teskari o'zaro bog'lash va DNKni tozalashdan keyin CaMKIIa promoter DNKning darajalarini o'lchash uchun qPCR ishlatilgan. Primerlar transkripsiyadan foydalanish boshlanish joyi oldida (XT): APN-1 konsensus ketma-ketligini o'z ichiga olgan hududni kuchaytirish uchun mo'ljallangan (oldinga: ACTGACTCAGGAAGAGGGATA; teskari: TGTGCTCCTCAGAATCCACAA).

Shakl 3

Shakl 3

CaMKIIa ning hujayra turi va hududiga xos DFosB indüksiyasi ning Vivo jonli

7ni sinash: CaMKII transkriptini va hujayra-toifa-o'ziga xos bo'lgan DFOSB oshqozon-protezli protsedurani o'lchash (Fig 3D)

Erkak bitransgen sichqonlaridan olingan NSE-tTA (A liniyasi) × TetOp-DfosB (11 liniyasi) va NSE-tTA (B sathi) × TetOp-FLAG-DfosB (layn 11) sichqonchani (Chen va boshq., 1998; Kelz va boshq., 1999; Werme va boshq., 2002; Zachariou va boshq., 2006) ishlab chiqishda DFOSB ifodasini bostirish uchun 100 ig / ml doksisiklin ustida o'ylab topilgan va ko'tarilgan edi. Yo'qotilganlar sutdan ajratishga ajratildi: yarmi doksisiklinada qoldi, yarmi suvga o'tkazildi va hayvonlar 8dan 11 haftadan so'ng DFB ning transkripsiyadan ta'sirlari maksimal (Kelz va boshq., 1999; McClung va Nestler, 2003). Transkritriyal analizlar uchun sichqon tezda dekapitatsiya qilindi va miyalar chiqarildi va muzlarga joylashtirildi. NAc dispersiyasi 14 o'lchovli igna zarbasi bilan olingan va RNK chiqarilgunga qadar quruq muzda tezda muzlatilgan. RNK izolyatsiyasi, qPCR va ma'lumotlar tahlillari ilgari tasvirlangan (LaPlant va boshq., 2009). Qisqacha aytganda, RNK TriZol reaktifi (Invitrogen) bilan xavfsiz holatga qilingan, keyinchalik Qiagendan RNAeasy mikro to'plami bilan tozalanadi va Agilentning Bioanalyzer bilan sifatini tekshiradi. Teskari transkriptsiya iScript (BioRad) yordamida amalga oshirildi. qPCR Quyidagi sikl parametrlari bilan Applied Biosystems 7900HT RT PCR tizimi bilan bajarildi: 10 min 95 ° C da; 40 daqiqasi uchun 95 ° C, 1 santimetr uchun 60 ° C, 30 santimetr uchun 72 santimetr; yagona PCR mahsulotlarini tasdiqlash uchun ajralish chizig'ini hosil qilish uchun 30 ° C darajali isitish. DFOSB va CaMKIIa proteinlarini ifodalaydigan immunohistokimyoviy tahlillar, ta'rif etilganidek, amalga oshirildi Sinov 4.

8 eksperimenti: Intra-NAc D1 va D2 Dopamin retseptorlari antagonistlarining kokain orqali vositachilik qilgan proteinlardagi o'zgarishlarga ta'siriFig 3H)

Erkaklar (8 haftalar) erkak sichqonchani 10 mg / kg kokain yoki sho'r suvli vosita ("transport vositasi") IP-sidan etti kun davomida kuniga bir marta qo'llashdi. Har bir giyohni inyeksiyasidan oldin 30 min oldin, Sichqoncha IP yoki D1 retseptorlari antagonisti SCH 23390 (0.5 mg / kg, "D1 ant" guruhi) yoki D2 retseptorlari antagonisti etiklopridi (0.5 mg / kg, "D2 ant" guruhi) , yoki sho'rlangan nazorat in'ektsiyasi ("kokain" guruhi). Yakuniy inyeksiyadan keyin 24 soat keyin hayvonlarni dekapitatsiya qilindi va oqsillar Western blotting Sinov 2.

9 eksperimenti: AAV-mediatsiyalashgan FFB ekspresyonunun oqsillarga ta'siriFig 4 A-C)

AAV-GFP (yashil floresans oqsili) yoki AAV-GFP-DFOSB (AAP-GFP-AFosB)Maze va boshq., 2010). 33 o'lchovli igna (Hamilton) barcha jarrohlik operatsiyalarida qo'llanilgan bo'lib, uning davomida 0.5 mL tozalangan yuqori titrli virus 5 min oralig'ida ikki tomonlama infüzyonga uchragan, so'ngra qo'shimcha 5 min infuziondan keyin dam olish davriga to'g'ri keladi. Barcha masofalar Bregma bilan qiyoslanadi: 10 ° burchagi, AP = + 1.7 mm, Lat = 2.5 mm, DV = -6.7 mm. Operatsiyadan keyingi 14 kundan so'ng, DFF eksperksepsiyasining ta'sirchan ta'sirini baholash uchun hayvonlarga lokomotor kuzatuv xonalarida 10 mg / kg kokainni yagona IP-in'ektsiyasi berildi. 24 soat keyin bu so'nggi inyeksiyadan so'ng, kalamushlar boshiga tushgan Sinov 2va to'qimalarning mikrodisseksiyasi GFP-musbat NAc to'qimasini olish uchun floresan mikroskopik yo'l-yo'riq ostida bajarildi. Keyinchalik G'arb blokirovkalashi bo'yicha amalga oshirildi Sinov 2.

Shakl 4

Shakl 4

DFOSB kokain bilan boshqariladigan D1 retseptorlari bilan bog'liq CaMKIIa indekslarini NAc qobig'ida zarur va etarli

10 eksperimenti: AAV vositasida kokainga bog'liq oqsillarni ifodalashda ta'sirchanligiFig 4 D-F)

AAV-GFP yoki AAV-GFP-DJunD ning stereotaksik in'ektsiyasi Sinov 8. Operatsiyadan keyingi 14 kundan keyin hayvonlarga etti kun davomida kuniga bir marta 10 mg / kg kokain yoki sho'r suvli vosita IP-lokomotorlar ro'yxatga olinadigan kameralarda kiritildi. Kokainni (5 mg / kg IP) yoki sho'r suvni bir marta yuborish uchun lokomotor javoblar qayd etildi. 24 soatdan keyin bu oxirgi inyeksiyada sichqonlar sindirildi, to'qimalarni yig'ishdi va Western blotlari Sinov 9.

11ni sinash: In Vitro Protein kinaz tekshiruvlari (Fig 5A-D)

Recombinant CaMKIIa va DFOSB hasharotlar hujayralaridaBrickey va boshq., 1990; Jorissen va boshq., 2007) va protein kinaz tahlillari amalga oshirildi (Colbran, 1993), ilgari tasvirlanganidek. Qisqacha aytganda, CaMKII, DNFX, 2.5 mM Ca, 1 mM (yoki konsentratsiyasi) bilan muz ustida preinkullatsiyalangan edi2+, 40 mm Mg2+, 15 mM calmodulin va 200 mM HEPES pH 7.5. Fosforillanish 200 μM ATP qo'shib, [g-32R] ATP va xona haroratida 10 daqiqa davom etishiga ruxsat berilgan (Shakl 5A va B) yoki 2 min muz ustidaShakl 5C va D). Mahsulotlar Western blotting tomonidan hal qilindi (Shakl 5A va B) yoki autoradiogramma va sintillashni hisoblash yo'li bilan (B-D).

Shakl 5

Shakl 5

DFOSB CaMKIIa uchun kuchli substratdir

12ni sinash: Ser27 ning DFOSB fosforillanishini aniqlash (Fig 5E)

In vitro kinaz tajribalari asosida amalga oshirildi Sinov 11, oqsillar SDS-PAGE bilan ajralib chiqdi va DFBga to'g'ri keladigan bantlar kesildi va tandem massa spektrometrisasiga ta'sir qildi. Panelning barcha qismidagi tegishli ion qismlarining m / z belgilashlari ion cho'qqilarining yuqori qismida yoritilgan. Erdagi cheklovlar tufayli barcha fragmentlar ionlari etiketlanmagan. Umuman olganda, ionli yorliqlar uchun matn qora rangda ranglangan bo'lib, ular to'g'ridan-to'g'ri to'g'ridan-to'g'ri tasdiqlaydigan yoki fosforlanish joylari mavjudligiga dalillarni qo'shganda, ular qizil rang bilan belgilangan. Orqa miya parchalanishiga qarshi mahsulotlarga oid dalillar fosfopeptidning ketma-ket o'qilishi natijasida, bitta amino kislotalar belgisi bilan qizil rangda ko'rsatilgan fosforilin qoldig'ining aniqlangan erida ko'rsatiladi. Kuzatilgan parcha ionlarining soni tavsifi, shuningdek, b va y ionlari kabi peptidlar ketma-ketligida belgilanadi. M / z o'qining pastki zichlikli qismli ionlarini ko'rsatish uchun keskin omillar ommaviy massa spektrining yuqori qismida belgilanadi. H panelida ko'rsatilgan qismli ionlar SerxNUMX fosforli izoform mavjudligini tasdiqlaydi, ammo Ser27, Ser28, Ser31 va Thr34 saytlarida boshqa fosforli izoformlarning aralashmasi ichida. Pa37, pa5-P, pb5 va pb5-P ionlarining mavjudligi Ser5 qoldig'ining fosforillanishini noyob tarzda tasdiqlaydi.

13 eksperimenti: SerxNUMX fosforillanishining kantifikatsiyasi (Fig 5F)

Standart peptidlar Ser27 DFB ning fosforli va fosfatsiz shakllarini taqqoslash uchun ishlab chiqilgan. Sintez va tozalashdan so'ng, har bir "og'ir" idyotipik peptid bir 50 / 50 asetonitril / suv tamponunda eritildi va sintetik peptid stok eritmasida mutlaq kontsentratsiyani aniqlash uchun amino kislotalar tahliliga jo'natildi. Har bir "og'ir" peptid MS / MS parchalanish va ikki dan to'rt MRM o'tish uchun eng yaxshi to'qnashuv energiyasini aniqlash uchun to'g'ridan-to'g'ri 4000 QTRAP massa spektrometresine (milodiy) kiritildi. Keyinchalik, peptidlarni ajratish uchun, toza "og'ir" peptidlar 4000 QTRAP orqali LCMSga ta'sir ko'rsatdi. Qurilma uchta to'rtburchak rejimida ishga tushirildi, Q1 maxsus prekursor m / z qiymatida o'rnatildi (Q1 skanerdan o'tkazilmagan) va Q3 ushbu peptidning ma'lum bir qismiga mos keladigan muayyan m / z qiymatiga o'rnatiladi. MRM rejimida bir nechta reaktsiyalar (to'qnashuv energiyasi to'qnashuv energetikasi qiziqishning ionli ionlarining qizg'inligini optimallashtirish uchun sozlangan kashshof / qismli ionli o'tishlar) ketma-ket ravishda o'lchanadi va aylanma (odatda 1-2 soniya) HPLC ajratishning barcha vaqti. MRM o'tishlari mavjud peptidlarning MS / MS spektrlaridan aniqlandi. Keyinchalik, yuqori zichlikli fragment ionlariga mos keladigan peptid boshiga ikkita o'tish tanlandi va avtomatlashtirish dasturlarini ishlatib, MRM o'tishining signal kuchini maksimal darajada oshirish uchun to'qnashuv energiyasi optimallashtirildi. Keyinchalik reaksiya davomida har peptid shaklining mutlaq farovonligini aniqlash uchun standart peptidlar va CaMKII yoki nazoratga duch kelgan DFSB misollaridan hosil bo'lgan tepaliklar solishtirildi. LC-MRM ma'lumotlari bo'yicha ma'lumotlarni tahlil qilish AB Multiquant 1.1 dasturidan foydalangan holda amalga oshiriladi.

14 ning eksperimenti: CaMKII'yi ortiqcha ekspress sichqonlarida DFOSB indüksiyasini (Shakl 5G & H)

Transgenik sichqonlarga T286D CaMKII (Mayford va boshq., 1996; Kourrich va uning hamkorlari, 2012) va yovvoyi turdagi zaharli moddalar transgen ekspresatsiyasiga ruxsat berish uchun doksisiklin bo'lmasa ko'tarildi. Kattalar sichqonlariga 20 kun davomida kuniga bir marta 14 mg / kg kokain yoki sho'rlangan IP yuborildi. So'nggi inyeksiyadan so'ng 24 soat keyin hayvonlarni dekapitatsiya qilindi va immunohistokimyo va DFosB ekspresyonining miqdori Sinov 4.

15 eksperimenti: NAV-Dendritik spinlardagi HSV-mediatsiyalashgan DFOSB superspression va CaMKII inhibisyonining ta'siri (Fig 6A-E)

Voyaga yetgan erkak sichqon (8 haftalar) HSV-GFP, HSV-GFP-DFOSB (Olausson va boshq., 2006), HSV-GFPAC3I yoki HSV-GFPAC3I-AFosB. Ushbu konstruktsiyalarda CaMKII faoliyatining peptid asosidagi inhibitori bo'lgan AC3I GFP ning S-terminasiga birlashtiriladi. GFPAC3I quyidagi platalarga ega bo'lgan shablon sifatida pMM400-vektorini ishlatib, PCR yordamida klonlanadi: GFP-AC3I-F: 3 "CC GCTAGC GCCGCCACC ATGGTGAGCAAGGGCGAGGAGGTGT 5" (clampNheIKozakmet); GFP-AC3I-R: 3 «CC TCCGGA TTACAGGCAGTCCACGGCCT 5» (clampBspEIstop). Olingan PCR mahsuloti NhI va BspEI saytlarini ishlatadigan p3 + va p1005 + -D FosB vektorlariga kiritildi. Qurilish navbati bilan tasdiqlangan. Stereotaxik koordinatalar: 1005 ° burchagi, AP = + 10 mm, Lat = + 1.6 mm, DV = -1.5 mm (Barrot va boshq., 4.4). Perfüzyon va miya kesitimi bo'yicha amalga oshirildi Sinov 4.

Orqa miya tahlillari ta'rif etilganidek (Christoffel va boshq., 2011). Qisqacha aytganda, soma ichidagi 50-150 mm masofada bo'lgan dendritik segmentlar GFPni ifodalovchi HSV bilan kasallangan hujayralardan tasodifiy tanlangan. Rasmlar NeuronStudio-dan rayburst algoritmi bilan morfologik tahlil qilish uchun konfokal LSM 710 (Carl Zeiss) da olingan. NeuronStudio bellarni quyidagi qiymatlarga qarab nozik, qo'ziqorin yoki o'stiruvchi sifatida tasniflaydi: (1) eng boshliqlari nisbati, (2) boshdan bo'yin nisbati va (3) bosh diametri. Bo'yinli bo'g'inlar yupqa yoki qo'ziqorin sifatida tasniflanishi mumkin va muhim bo'yinbop bo'lmaganlar yumshoq qilib tasniflanadi. Bo'yinli belkuraklar bosh diametriga asoslangan nozik yoki qo'ziqorin sifatida etiketlanadi.

Shakl 6

Shakl 6

CaMKII faoliyatining blokadasi NAFda DFB ning morfologik va qiziqishlariga ta'sirini oldini oladi

16 eksperimenti: HSV-mediatsiyalashgan DFOSB Oversxpression va CaMKII inhibishini kokainlarga ta'sir qilishlari (Fig 6F)

Voyaga etmagan erkak sichqonlarga ko'ra, viruslar AOK qilingan Sinov 15, va bitta 5 mg / kg kokain inyeksiya uchun lokomotor javoblar aniqlandi Sinov 9. Lokomotiv ma'lumoti kokainni in'ektsiya qilishdan keyin 30 daqiqadan so'ng umumiy nurlanish tuslari sifatida ifodalanadi.

Qo'shimcha ma'lumot

Hayvon uylari

Erkaklar Sprague Dawley kalamushlari (250-275 g, Charlz River laboratoriyalari) juftlashgan. Sakkiz haftalik C57BL / 6J erkak sichqonchasi (Jekson laboratoriyasi) guruhga katak uchun maksimal beshta hayvon bilan joylashtirilgan. Barcha hayvonlarni hayvon vositasiga ≥ 1 hafta davomida eksperimental manipulyatsiya qilishdan oldin va 23 soatlik nurli / quyuq aylanishlarda (25: 12 AM) yorug'likda (iqlim nazoratidagi xonalarda (7-00 ° S) va suv ad libitum. Tajribalar Neuroscience jamiyatining ko'rsatmalariga va Sinay tog'idagi institutsional hayvonlarni parvarish qilish va foydalanish qo'mitasiga (IACUC) muvofiq o'tkazildi.

Preparatlar

Giyohvand moddalar IP orqali kiritilgan va kokain (kaltsiy uchun 5 mL uchun 20-10 mg / kg, kaltsiylarda 1 ml uchun NIDA) va SCH 23390 yoki etikloprid gidroxlorid (0.5 ml uchun 1 mg / kg, Tocris), shu jumladan steril sho'r suv eritiladi . Stereotaksik jarrohlik uchun sichqon steril sho'r suv bilan ketamin (xNUMX mg / kg) va xylazine (100 mg / kg) (Genri Schein) "mexnat" bilan behushlik bilan o'tdi.

Antikorlar

CaMKIIa (jami): Upstate 05-532, 1: 5,000

CaMKII fosfo-Thr286: Promega V111A, 1: 1,000

DFosB (jami): 5G4, 1: 250

DFosB fosfo-Ser27: Fosfozolmalar, 1: 500

GluA1 (jami): Abcam, Ab31232, 1: 1,000

GluA1 fosfo-Ser831: Millipore N453, 1: 1,000

GluA1 fosfo-Ser845: Chemicon Ab5849, 1: 2,000

GluA2: Millipore 07-598, 1: 2,000

NR2A: Sigma HPA004692, 1: 2,500

NR2B: Millipore Ab1557P, 1: 1,000

Statistik tahlil

Barcha statistik tahlillar Prizma 6 dasturiy ta'minot to'plami (GraphPad) yordamida amalga oshirildi. Talabalarning t-testlari barcha juftlikdagi taqqoslashlar uchun (t qiymati berilgan Natijada ko'rsatilgan) ishlatilgan va bir nechta ANOVA-lar barcha ko'plab taqqoslar uchun ishlatilgan (F qiymati berilgan natijalar bo'limida ko'rsatilgan).

O'tish:

natijalar

Surunkali Kokain NAc Shell-da CaMKII ni chiqaradi

Ko'pgina tadqiqotlar shuni ko'rsatadiki, NAc qobig'idagi va yadrodagi MSNlar surunkali dori-darmonlar tarqalishining turli xil biokimyoviy va fiziologik javoblariga (Kourrich va Tomas, 2009; Loweth va boshq., 2010) va ikkala sub-mintaqada giyohvand moddalarni qidirishni tartibga soluvchi xatti-harakatlar tartibga solinadi (Ito va boshqalar, 2004). NAc qobig'ining protein tarkibiy qismlarida kokainning differentsial ta'sirini aniqlash boshqalar Multiplexed Isobaric Tagging (iTRAQ) va tandem massa spektroskopiyasi (MS / MS) ishlatilgan. Kattalar erkak sichqonlarga 20 kuniga kuniga kokain (7 mg / kg) yoki sho'rlangan IP yuborildi; Oxirgi enjeksiyadan so'ng 24 soat keyin NAc qobiqi va yadrolari mikrodissed (Fig 1A) va muzlatilgan flesh. Ushbu namunadagi proteinlar iTRAQ yordamida aniqlangan. To'rt CaMKII izoformi kokainni davolashdan so'ng yadroga nisbatan NAc qobig'iga xos bo'lgan katta ekspozitsiyalarni namoyish etdi. Bundan oldin boshqa tizimlarda turli CaMKII substratlar bilan bog'langan PP1 katalitik va tartibga soluvchi subunits va PP2A kabi bir nechta protein fosfatazlar (Colbran, 2004), shunga o'xshash modelga amal qilgan. Ushbu topilmalar CaMKII signalizatsiya yo'lining NAc ning kokain tomonidan ma'lum bir shaklda tartibga solingan yangi, xolis dalillarni taqdim etdi.

Ushbu topilmani yanada kantitativ tarzda tasdiqlash uchun biz farmatsevtiklarni kokain (turli dozalarda) yoki sho'r suv bilan va kokain (5 mg / kg) yoki sho'r suyuqlik dozasini o'lchagan dozadagi lokomotor ta'sirlari bilan davolashdik. 10 mg / kg kokainga duch kelgan takroriy ta'sir qilish lokomotor sezuvchanlikning odatdagi modeliga olib keldi (Fig 1B). Ushbu dozalash rejimi bilan olib borilgan izlanishlarga ko'ra, Western blotting-dan foydalangan holda takrorlangan kokain CaMKII ni kokainni oxirgi in'ektsiyasidan so'ng (24 soat)Fig 1C va D.; p = 0.0019; F = 7.943; df = 29). Bundan tashqari, AMPA retseptorlari GluA831 subunitining SerxNUMX kanonik CaMKII substratining fosforillanishlari CaCKIIa Thr1 autofosforilatsiyasining kuchli, ammo emasligi bilan birga NAc qobig'ida emas, yadroda (p = 0.0261; F = 4.208; df = 28) faqatgina qobiqdagi indüksiyonga nisbatan sezilarli tendentsiya (Fig 1D). Bir necha boshqa glutamat retseptorlari befarq edi. Ushbu CaMKII choralaridan farqli o'laroq, bir xil to'qima namunalari NAc ning ikkala qobig'ida (p = 0.0260; F = 4.189; df = 29) va yadro (p = 0.0350; F = 3.807; df = 29) (Fig 1C va D.), oldingi ma'ruza bilan mos keladi (Perrotti va boshq., 2008).

AMPA retseptorlarining kokainni tartibga solish bo'yicha bir nechta avvalgi tadkikoti surunkali giyohdan chiqarilgan ~ 14 kundan so'ng hayvonlarni tahlil qildi (Qarang: Munozara), biz bu vaqtdagi biyokimyasal tahlillarni takrorladik. Biz kokainni so'nggi in'ektsiyasidan 14 kun o'tgach, DFosB ning NAc (p = 0.0288; F = 4.258; df = 22) ichida balandligi saqlanib qolayotganini aniqladik. Na CaMKII va na GluA1 SerxNUMXning fosforillanish darajasi oshmadiFig 1E). Shunga qaramay, 1 soatiga bitta 10 mg / kg dozada kokain dozasi, jami CaMKII (p = 0.0330; F = 3.947; df = 26) va GluA1 Ser831 (p = 0.0213; F = 4.509; df = 27) fosforilasyon, birinchi surunkali giyoh ta'siridan so'ng, shunga o'xshash darajaga qadar ko'tarilgan (Fig 1E). Ushbu ma'lumotlar NAc shell neyronlari CaMKII gen promoterining bevosita astarlanishi orqali uzoq davom etadigan abstinentlik davrida CaMKII induksiyasi uchun asta-sekin qo'llanilganligini ko'rsatadi (Qarang: Munozara). Bundan tashqari, DFOSB induktsiyasi CaMKII induksiyasiga qaraganda ancha qat'iy bo'lib, "Kromatin-asosli" yoki boshqa usulda, CaMKII reglamentida "tormoz" ko'rsatadigan qo'shimcha mexanizmlarning borligini ko'rsatadi.

Ushbu kuzatuvlarni yanada mustahkamlash uchun biz giyohvand moddalarni iste'mol qilishni o'z ichiga olgan o'zboshimchalik bilan giyohvandlik modellarini o'rganib oldik. Voyaga olib kelingan erkak kalamushlarga kokainga qisqa yoki uzoq kirish mumkin; kutilganidek (Ahmad va Koob, 1998), faqat uzoq muddatli erkin foydalanish shartlari giyohvand moddalarning o'z-o'zini boshqarishini kuchayishiga olib keldi (Fig 2A). DFF ko'p jihatdan indikatsiyaga uzoq vaqt davomida kiritildi boshqalar NAc qobig'ida (p = 0.0011; F = 11.12; df = 17) va yadroda (p = 0.0004; F = 13.86; df = 17) kokainga qisqa muddatli kirish. Aksincha CaMKIIa NAc kabuğunda faqat uzoq vaqt davomida kokaingaFig 2B va C; p = 0.0236; F = 4.957; df = 16). O'rtacha kundalik kokain iste'molini qisqa muddatli hayvonlarga (~ 12 mg / kg IV), uzoq muddat foydalaniladigan hayvonlarga (~ 70 mg / kg IV) va eksperimental boshqariladigan hayvonlarga (10 mg / kg) nisbatan taqqoslash qiziq. nima uchun oxirgisi DF va CaMKII ning kuchli indüksiyasini keltirib chiqarsa, qisqa muddatli kirish imkoni yo'q. Ushbu farqlar, ehtimol, kokainning eng yuqori darajasidagi farqlarga bog'liq bo'lishi mumkin (eksperiment markazida qo'llaniladigan kokain yagona bolus IP sifatida berilgan bo'lsa-da, o'zini o'zi boshqargan giyoh ko'p IV dozalarda yuboriladi) yoki dori ta'sir qilish uzunligi farqlari (eksperimentator uchun 7 kun) administratsiya, o'zini o'zi boshqarish uchun 19 kun).

DFF va CaMKII haqida katta adabiyotga qaramasdan, kokainda bu oqsillarni o'rganish bo'yicha hech qanday tadqiqotlar mavjud emas. Bu erda kokainga qaram bo'lgan odamlarning NAc-da DFOSB (p = 0.0316; t = 1.921; df = 34) va CaMKII (p = 0.0444; t = 1.755; df = 32)Fig 2D, 1 stol). Ushbu ma'lumotlarga ko'ra, kemoterapist NAc'teki FosB va CaMKII'nin kokain tomonidan indüklenmesinin, inson kokain bağımlılığına klinik sifatida tegishli ekanligini ko'rsatadi.

1 stol

1 stol

Inson kokainli giyohvand moddalar va mos keladigan nazorat guruhining namunalarini tavsiflash

DFOSB NAc Shell ning D1-turi MSN-larida CaMKII transkripsiyasini tanlash tartibini tartibga soladi.

CaMKII va DFosB ning kemiruvchi NAcdagi kokain tomonidan regulyatsiya qilinganligi bizni DFOSning CaMKII genining transkripsiyasini tartibga solib qo'yishi mumkinligini aniqlashga olib keldi. Bundan oldin CaMKIIa'yı DFOSB uchun mumkin bo'lgan bir maqsad sifatida NAc'nin xolis mikroarray tahlil qilish (McClung va Nestler, 2003), ammo ushbu topilma ushbu tadqiqotda yana tasdiqlanmagan. Biz oldin DFosB kattalar erkak jinsida NAcdagi CaMKIIa gen promoteriga bog'langanligini aniqlash uchun quantitative chip (qChIP-ChIP va undan keyin kantitativ PCR) ni qo'lladik va bu ulanishning surunkali kokainga administratsiyasi orqali, qobiqda ( p = 0.0133; t = 2.901; df = 12), lekin yadro, subregion (Fig 3A). CaMKIIa promoteriga DFS bog'lanishida ushbu subregionga xos farqning mexanizmlarini yanada yaxshiroq tushunish uchun ushbu genomik hududdagi histon modifikatsiyasini aniqlash uchun qChIP-ni qo'lladik. Oldingi tadqiqotlar CaMKIIa promoterida H3 asetilatsiyasining kokain indüksiyasini umumiy sichqonchadan NAc (Vang va boshq., 2010). Aksincha, kokain CaCKIIa promoterida NAc yadrosida selektiv ravishda H3 asetilasyonunuFig 3B; p = 0.0213; T = 2.726; df = 10), DFosB ulanishi orqasida subregionga xos kromatin o'zgarishlariga mos keladigan qobiqda o'zgarishsiz. repressiv belgilar uchun dimetilatlangan H3 lizin 9 (H3K9me2) uchun qChIP qobiq va yadro sub-mintaqalaridagi pasayish tendentsiyalarini aniqladiFig 3C).

DFOSB CaMKIIa transkripsiyasini tartibga solishini aniqlash uchun ning Vivo jonli, biz DFNBXda D1da, ayniqsa DFOSB ni indeksini ortiqcha bosim o'tkazadigan ikkita tugilgan sichqonchani chiziqlaridan foydalandik boshqalar D2 tipidagi MSNlar ichimlik suvida doksitsilin idorasi tomonidan nazorat qilinadigan usulda (Chen va boshq., 1998; Kelz va boshq., 1999; Werme va boshq., 2002). D1-tipidagi MSNda faqat D0.0337-tipli MSNda haddan tashqari eksperimental DFOSB eksperimsi DSSNUMX-tipidagi MSNlarda (D = FN, 1.996, T = 13, df = 2) CaMKIIa mRNA darajasini sezilarli darajada oshirdi.Fig 3D). D1 tipidagi MSNda DFOSB ekspresyoni bilan CaMKIIa mRNKning o'sishiga CaCKIIa proteinlarining har ikkala NAc qobig'ida (p = 0.0030; t = 3.578; df = 14) va yadroda (p = 0.0392; t = 2.275; df = 14; Anjirlar 3E va F). Ushbu ma'lumotlar DFOSB ning subkordiyalarda D1-tipidagi MSN-da CaMKIIa gen ekspiratsiyasini boshqarishga qodir ekanligini ko'rsatadi Shakl 3B CaMKIIa promoterida kokain orqali vositachilik qilgan kromatin o'zgarishlar (masalan, kamaytirilgan asetilizatsiya) DFOSB ni kokaindan so'ng yadro pastki mintaqasida CaMKII-ni tartibga solishini oldini oladi.

Bizning transgenik sichqoncha ma'lumotlari CaMKII gen ekspressionining DFosB induksiyasi NAc tarkibidagi D1 tipidagi MSNlarga xos ekanligini ko'rsatganligi sababli, biz CaMKII ning kokainga bog'liq regulyatsiyasi D1 dopamin retseptorining faollashuvini talab qiladimi yoki yo'qligini aniqlashga harakat qildik. Voyaga etgan erkak kalamushlarga avvalgidek surunkali kokain yoki fiziologik eritma yuborilgan, ammo har bir in'ektsiyadan 30 minut oldin kokain guruhidagi kalamushlarga IP fiziologik eritma, D1 antagonisti SCH 23390 (0.5 mg / kg) yoki D2 retseptorlari antagonisti etikloprid kiritilgan. (0.5 mg / kg). Kokainning so'nggi in'ektsiyasidan 24 soat o'tgach, hayvonlar tahlil qilindi. G'arbiy blotting D1 emas, balki D2 antagonisti DFosB (p <0.0001; F = 18.96; df = 18) ning kokain vositachiligidagi o'sishini butunlay to'sib qo'yganligini aniqladi,Nye va boshq., 1995), shuningdek, CaMKII (p = 0.0005; F = 10.99; df = 18; Fig 3G va H). Ushbu ma'lumotlar kokainin CaCKII gen ekspresyonunda, NAc qobig'ining D1-tipidagi MSN-larida DFosB vositachiligida o'sishini ta'minlaydigan gipotezasini qo'llab-quvvatlaydi. Kelajakdagi tadkikotlar bu miya mintaqasida CaMKII ifodasi bo'yicha bu hujayra tipidagi o'ziga xos ta'sirini to'g'ridan-to'g'ri namoyish qilish muhimdir.

DFOSB NAc Shellda CaMKII ning kokain indüksiyasiga kerakli va etarli

Bittsenjen sichqonlaridan foydalanishni to'ldirish uchun, biz keyinchalik kaltsiylarda virusli vositalar yordamida gen transferi orqali CaMKIIa ning kokain indüksiyasini vositachilashda DFOSB rolini o'rganib chiqdik. Adeno bilan bog'liq Virusli (AAV) zarralarini bir-biriga yaqinlashtirdik. Biz ATF va GFP yoki GFP-ni ortiqcha bosim qilish uchun kattalar erkak sichqonlarning NAc qobig'ida (qobiqni qay tarzda tanlab olishi mumkin). Keyin hayvonlarga 10 mg / kg kokainni bitta IP-infektsiyasi berilgan. DFOSB / GFP ni haddan tashqari ekspluatatsiya qiladigan hayvonlar, faqat GFPni haddan tashqari ekspluatatsiya qilgan hayvonlar bilan solishtirganda ko'tarilgan lokomotor javobFig 4A). 24 soatdan keyin yagona kokainga qarshi, GFP-musbat NAc to'qimasi bu hayvonlardan flüoresan nur manbai ostida disektsiya yo'li bilan chiqarildi. Ushbu to'qimalarni g'arbiyFig 4B va C) surunkali giyoh amaliyotida ko'rilgan indüksiyona o'xshash kuchli GFP hayvonlariga nisbatan (P = 0.0070; t = 2.894; df = 30) solishtirganda kuchli DFB ekspresyonini va shuningdek, jami CaMKIIa proteinining sezilarli o'sishini aniqladi. Bundan tashqari CaMKIIa Thr286 da otofosforilasyon (ferment faollashuvi ko'rsatkichi) CaMKII substratining fosforillanishi, GluA0.0330 ning serxNUMX (p = xNUMX; t = xNUMX; t = xNUMX; p = xNUMX; t = 2.243; df = 28), yana surunkali giyoh (Fig 1C va D.). Taken bilan birgalikda, bu ma'lumotlar NAc kabuğundaki DFosB ekspresyonunun, ushbu pastki mintaqada kokainle lokomotor sezgirlik va CaMKII indüksiyonu va aktivasyonu uchun etarli ekanligini dalolat beradi.

NAF qobig'ida CaMKIIa ning kokain orqali vositachilik qilishini ta'minlash uchun DFOS ning ham zarurligini aniqlash uchun biz shunga o'xshash yondashuvni qo'lladik. AAV, DFosB transkripsiyonel aktivatsiyasining salbiy regulyatori bo'lgan DJunD deb ataladigan kesilgan JunD proteini ortiqcha bosim qilish uchun ishlatilgan (Winstanley va boshq., 2007) va faqat GFP yoki GFP. Ikki hafta o'tgach, transgen ekspresyonu maksimal bo'lsa, hayvonlar kuniga 10 kun davomida kokain (7 mg / kg) yoki sho'r suv berildi va so'nggi surunkali inyeksiyadan (16 kundan keyin) 5 soatdan so'ng kokainga qarshi kurashda (24 mg / kg) lokomotor javoblarni tekshirdiFig 4D). DJunD haddan oshiqligi kokainga lokomotor sezgirlikni keltirib chiqarmadi va NAc qobig'ida CaMKIIa indüksiyonu va aktivatsiyasini oldini oldi (Fig 4E va F; p = 0.0437; F = 2.997; jami df = 38), ushbu subkordagi CaMKIIa ning kokain orqali vositachilik qilish uchun DFosB transkripsiyali faoliyati zarurligini ko'rsatmoqda. Qizig'i shundaki, biz DJunD ning DFosB darajasini salbiy va kokain bilan muomala qilingan sharoitlarda (p = 0.0004, F = 8.110; df = 35) kamaytirishini aniqladik. DFosB o'z fikr darajalari uchun AP-1 faolligiga bog'liq bo'lgan yangi imkoniyatni oshirdi.

CaMKII fosforillari DFOSB ni SerxNUMX da

foydalanish in vitro protein kinaz tajribalari, biz aniqlangan DFBning CaMKIIa uchun mustahkam substrat ekanligini aniqladik. Uning Inkubatsiyasi6CaMKIIa va ATP bilan DFOSB DFOSning elektroforetik harakatlanishida yuqoriroq siljishga olib keldiFig 5A); bir nechta yuzaga keladigan guruhlar fosforillanishning ko'plab joylarini taklif qilishdi. O'xshash in vitro kinaz tajribalari [g-32R] ATP radiolabelli fosfatning kaydırılmış DFB bantlarına (Fig 5B), oqsilning bevosita fosforillanishini namoyish etadi. Biz oldingi xarakterli Ser27 ning DFOSB ga fosfaga xos antikor hosil qildik (Ulery va boshq., 2006). Ushbu antikor Ser27-fosforillangan DFB (ma'lumotlar ko'rsatilmagan) o'z ichiga olgan miya ekstraktlariga qarshi signal bermasa-da, biz SerxNUMX fosforillanishni in vitro CaMKII foydalanib, kinaz tahlil qilish (Fig 5B). DFOSB ning CaMKII fosforilatsiyasining kinetik analizlari uning kinaz uchun kuchli substrat ekanligini ko'rsatadi (Fig 5C), aniq ko'rinib turgan K bilanM 5.7 ± 2.0m va K ga tengCAT 2.3 ± 0.3min-1. Bu natijalar juda yaxshi xususiyatlarga ega ning Vivo jonli CaMKII ning substratlari (Colbran va Brown, 2004). Bundan tashqari CaMKII ning DFosB ni fosforli xlorometriyali xNUMX ± 2.27 mol / mol (Fig 5D), uning ichida CaMKII fosforlanishining kamida uchta hududi mavjudligini ko'rsatib o'tish mumkin6-DFosB oqsili bilan kelishilgan holda Fig 5A.

Fosforillanishning alohida joylarini tadqiq qilish uchun biz misollardan MS tahlillarini qo'lladik in vitro kinaz tahlillari. Fig 5E oldingi xarakterli SerxNUMX da va bir nechta qo'shimcha saytlarda (ma'lumotlar ko'rsatilmagan) DFOSB fosforillanishini namoyish etadi. SerxNUMX ning oldingi funktsional xarakteristikasini hisobga olgan holda, biz SerxNUMX ning fosfo va nofosfo-holatini taqqoslagan etiketli sintetik peptidlarni ishlab chiqarib, ushbu saytga diqqat qildik, keyin bu peptidlarning ma'lum miqdori DFB ning MRM tahlillarida standart sifatida oldingi va keyingi in vitro CaMKII tomonidan fosforillanish. Keyingi kantitatsiya (Fig 5F) SerxNUMX CaMKII uchun kuchli substrat ekanligini tasdiqlaydi. Ushbu natijalar, DFOSB ichidagi ko'p fosforli qoldiqlar orasida, SerxNUMX CaMKII uchun ayniqsa samarali substrat hisoblanadi.

CaMKII Interfaks NAc Shell-da DFOSB ning kokainni to'plashi

CaMKII fosfatlashtirishi mumkin bo'lganligi uchun DFB mavjud in vitro uning barqarorligini sezilarli darajada oshiradigan sayt in vitro va ning Vivo jonli (Ulery va boshq., 2006; Uler-Reynolds va boshq., 2009), CaMKII faoliyatining NAcdagi DFB darajasini tekshirganligini aniqladik ning Vivo jonli. Ushbu savolga javob berish uchun birinchi marta CaCKIIa (T286D) ning kaltsiysiz mustaqil mutantini bir nechta miya hududlarida, jumladan NAc (Mayford va boshq., 1996; Kourrich va uning hamkorlari, 2012). Biz kuniga bir marta 20 kun davomida kuniga bir marta 14 mg / kg kokain yoki sho'r suv bilan yoshga mos keladigan kattalar erkak mutanti va yovvoyi tipdagi littermateslarni kiritdik, so'ngra oxirgi inyeksiyadan bir kun keyin hayvonlarni tahlil qildik. DFOSBning bazal darajalari mutatsiyaga uchragan hayvonlarda NAc qobig'ida (p = 0.0001; F = 9.207; df = 37) ortdi, lekin yadro emasFig 5G va H). Ajablanarlisi shundaki, DFOSB ning kokainga bog'liq bo'lgan induktsiyasi har ikki qobiq va yadrodagi mutatsion hayvonlarda bloklanadi, shuning uchun CaMKII NAc qobig'ida to'g'ridan-to'g'ri DFBB barqarorligini boshqarishi mumkin bo'lsa-da, u NAc pastki mintaqalarida kokain-faollashtirilgan yo'llarda DFOSB oqimining yuqorida joylashgan bo'lishi mumkin .

CaMKII Faoliyati DFF-Mediateli Strukturaviy va Xatti-xarakatlanadigan Plastlik uchun talab etiladi

NAc MSN-larda dendritik spinalarning kokain indüksiyasi bu miya hududida eng yaxshi tashkil etilgan dori vositalaridan foydalanadigan moslamalardan biridir va bunday o'murtqa indüksiya preparatga sezuvchan xatti-harakatlar bilan bog'liqRobinson va Kolb, 2004; Russo va boshq., 2010) va D1-tipidagi MSN-lar uchun tanlanganligini bildirgan (Lee va boshq., 2006). Biz so'nggi paytlarda NAc dendritik tayoqlarni kokain indüksiyonunun DFB'ye va uning quyi oqim transkripsiyonel dasturiga (Maze va boshq., 2010). CaMKII-ning dendritik o'murtqa morfologiyasida va boshqa miya hududlarida va eksperimental tizimlarda indüksiyasiga aloqador keng qamrovli adabiyotlar mavjud bo'lsa-daJourdain va boshq., 2003; Penzes va boshq., 2008; Okamoto va boshq., 2009), NAc MSN orqa miya tarkibida uning roli o'rganilmagan. Shuning uchun CaMKII faoliyatini DFF vositasida MSN dendritik kontsentratsiyasi uchun CaMKII inhibitori peptidi AC3I ning HSF orqali oshqozonli oshqozon orqali GFP bilan bog'langan, CaMKII aktivligini inhibe qilish uchun ilgari ko'rsatilgan konstruktsiyadan foydalanish zarurligini aniqladik ning Vivo jonli (Zhang va boshq., 2005; Klug va boshq., 2012). Voyaga etgan sichqonlarning NAc qobig'ida DFOSB ning virusli ortiqcha ekspressioni MSN dendritik o'murtqa zichligining sezilarli darajada oshishiga olib keldi (p <0.0001; F = 8.558; df = 59; Fig 6A va B) ilgari xabar qilinganidek (Maze va boshq., 2010) va bu o'sish birinchi navbatda ingichka (p = 0.0027; F = 5.319; df = 59) va pushti (p = 0.0378; F = 2.988; df = 59)Fig 6C-E). Keyinchalik etuk, qo'ziqorin shaklidagi mayda-burunlarga ta'sir ko'rilmadi. Ammo, GFP-AC3I birgalikda ishlaganda, DFOSB indikatsiyasi to'liq bekor qilindi (Fig 6A-E), CaCKII faoliyatining NAc qobig'idagi Dendritik o'murtmalarning DFOSB indüksiyasini talab qilish kerakligini ko'rsatib beradi.

Keyinchalik, Virusli vositalarni DFOSning ta'siriga qarshi CaMKII samaradorligini tekshirish uchun ishlatdik. NAc qobig'ida virusni yuborishdan keyin 72 soatdan keyin hayvonlarga 5 mg / kg kokainni bir marta yuborish va ularning lokomotor faolligi qayd etildi. Yuqorida ilgari ko'rsatilgandek, DFOSB (kengaytirilgan AAV)Fig 4A), DFF ning HSV orqali oshqozonida ortiqcha ekspressioni kokainga lokomotor sezuvchanlikni oshirdi (p = 0.0002; F = 8.823; df = 37; Fig 6F). Dendritik kontsentratsiyali indikatsiyalarda bo'lgani kabi CaMKII samaradorligini GFP-AC3I bilan birga namoyon qilish orqali inhibe qilish kokainning sezgirlikdagi DFSB vositachiligida o'sishini butunlay to'sib qo'ydi, bu CaKKII faoliyatining kokainning ta'siriga ta'sirida DFSning ta'sirini o'zgartirish uchun zarur bo'lganligini ko'rsatmoqda.

O'tish:

muhokama

Ushbu izlanish yangi giyohvandlik mexanizmini belgilaydi, bu erda kokain NAc ning DFosB ni chaqiradi va CaCKIIa genining transkripsiyasini NAc qobig'ida. Keyinroq CaMKIIa fosforilatlaydi va DFOSBni stabillashtiradi, natijada DFOSB to'plamini ko'paytiradi va CaMKIIa indüksiyasini (Fig 6G). Kokainning surunkali ta'siriga duchor bo'lgan ikkita oqsilning birgalikdagi kuchayishi keyin preparatga sezgirlangan xatti-harakatlarga yordam beradi. Bu, ayniqsa, o'ziga jalb etuvchi gipoteza bo'lib, har ikkala DFO va CaMKII ning har biri oldindan kokainning ortib boradigan xatti-harakatlarida (Pirs va boshq., 1998; Peakman va boshq., 2003), va biz bu topilmani DFOSB uchun NAc qobig'ida maxsus ravishda virusli yondoshuv (Anjir 4 va Va66).

D1-tipli MSN-larda transgenik DFOSB ortiqcha ekspressionlari CaMKII indekslarini ham NAc qobig'ida, ham kokain-naif hayvonlarning ichki qismida olib kelishi mumkin bo'lsa-da, kokain tarkibida CaMKII ning ikkala kichik qismida ham sodir bo'lgan endojen DFB birikmasini NAc qobig'ida . Ushbu farq bizning bitransgenik modelimizdagi indikatsiya qilingan DFBning yuqori darajalariga bog'liq bo'lishi mumkin, ammo u kokainning CaMKIIa promoterini qobiqda turli xil tarzda o'zgartirishi qobiliyatini aks ettirishi mumkin boshqalar yadro MSN-larni bir-biriga bog'lash uchun FOSBni bog'lashga yoki ikkinchi bo'limga qo'shishga majbur qiladi. Aslida, faqatgina NAc yadrosidagi CaMKIIa gen promoterida histonlarning kokain orqali vositachilik deaktillanishini ko'rsatadigan bizning ChIP ma'lumotlarimiz kromatin mexanizmining mumkin bo'lgan ishtirokini qo'llab-quvvatlaydi. Ushbu gipotezaga binoan, D1-tipidagi MSNda DFOSB eksperimenti CaCKIIa indeksini NAc yadrosida kokain yo'qligi bilanFig 3F), CaMKIIa promoterining surunkali giyoh ta'sirida ushbu indüksiyani to'xtatuvchi faol modifikatsiyalari mavjudligini ko'rsatmoqda. CaMKII promoteridagi kromatin peyzajini tartibga solish ham CaMKII ning surunkali kokain chiqarish sichqonlarining NAc qobig'ida kokainning qiyin dozasi bilan nima uchun sabab bo'lganini ham tushuntirishi mumkin (Fig 1E), ammo giyohvand moddalar emas (Fig 1D). Bu esa, DFosB'nin epigenetik «gen priming» ta'sirini ifodalaydi.Robison va Nestler, 2011) va shunday qilib, giyohning o'zlashtirilishining inkübasyonunun bir molekulyar mexanizmi bo'lishi mumkin (Pickens va boshq., 2011). Ammo, bu kromatin almashinuvi sababli najas bilan intilishning inkubatsiyasiga bog'liq bo'lishi uchun vaqt o'tishi bilan ko'payishi kerak edi. Bunday holatni aniqlash va boshqa genlarni kokain tomonidan DFFga qaram bo'lgan, pastki mintaqaga xos tartibni ko'rsatadimi yoki yo'qligini aniqlash qiziqarli bo'ladi. Shuni ta'kidlash kerakki, biz aytib o'tgan besleme oldingi loop CaMKII yoki DFOSB ningFig 1E); Buning uchun javobgar bo'lgan molekulyar "tormoz" ni ochish kelajakdagi ishlarning muhim maqsadidir.

DFOSB va CaMKII ning ma'lum funktsional tizimlarida va miya hududlarida ma'lum funktsiyalari ko'plab darajalarda birlashadi (Fig 6F). Ikkala molekulalar dendritik o'mush o'sishiga chambarchas bog'liq: CaMKII aktin tsitoskeleton bilanOkamoto va boshq., 2009), orqa miya boshining kattaligiMatsuzaki va boshq., 2004) va hipokampal organotipik tillardagi madaniyatlarda filopodiyada va sinaps soni sonida plastisiyadan kelib chiqqan o'sish uchun zarur va etarliJourdain va boshq., 2003), wDOS FosB ham NAc MSN-larda kokainga bog'liq dendritik orqa miya shakllanishi uchun zarur va etarliMaze va boshq., 2010). Bundan tashqari, ikkala molekulalar AMPA glutamat retseptorlari bilan tartibga solish bilan bog'liq. CaMKII AMPA retseptorlari bo'linmalarining umumiy darajasini tartibga solmaydi, ammo AMPA retseptorlarining sinapslarga kiritilishini boshqaradi va madaniyatdagi hipokampal piramidal neyronlarda SerxNUMX da GluA1ni fosforilat bilan AMPA kanali o'tkazuvchanligini oshiradi va ning Vivo jonli (Qarang:Malinow va Malenka, 2002; Colbran va Brown, 2004)). GluA1ning sinapsga shunday ko'payishi, surunkali giyoh ta'siriga ham taalluqli edi (Boudreau va Wolf, 2005). Bundan tashqari, NACdagi AMPA retseptorlari aktivatsiyasiga ta'sir qiluvchi javoblar D1 dopamin retseptorlari bilan bog'liq holda CaMKIIa oshqozon orqali oshib boradi (Singer va boshq., 2010). Uzoq muddatli D1ga xos DFF ning ortiqcha ekspressioni NAc (GluA2 transkripsiyasini NAcKelz va boshq., 1999), bu erda GLIA1 orqali vositachilik qilgan AMPA javoblarini kamaytiradi, biz bu erda qisqa muddatli DFB ekspresyoni va qisqa muddatli giyoh ta'sirini ko'rsatadigan bo'lsak, ushbu subunitda (Fig 1). Shunga qaramay, so'nggi paytlarda biz qisqa muddatli DFOSB ortiqcha ekspressioni NAX da D1 tipidagi MSN-larda AMPA javoblarini pasaytiradi (Grueter va boshq., 2013). Ushbu ma'lumotlar giyohvandlikka qarshi vaqtga bog'liq bo'lgan neyrokatalogiyani tashkil etadigan vaqtinchalik farqlovchi mexanizmlarni taklif qiladi. Behayo darajadagi CaMKII va DFOSB kokainga lokomotor sezgirlik uchun kerak (yuqorida) va ikkala kemiruvchilarda doimiy kokainga o'z-o'zini boshqarish uchun zarurColby va boshq., 2003; Vang va boshq., 2010), ikkala oqsil ham qisqa va uzoq muddatli giyohvandlik ta'siriga moslashishi uchun muhim ahamiyatga ega ekanligini ko'rsatmoqda, garchi qisman alohida mexanizmlar orqali. Taxminlarga ko'ra, FosB va CaMKII sinaginaviy hodisalarni bevosita bog'liqlik darajasiga bog'lash uchun juda ko'p ishlar qilish zarur bo'lsa-da, NAc sinaptik funktsiyasidagi o'zgarishlar orqali bunday murakkab xatti-harakatlarga moslashuvlarni tartibga soladi.

CaMKII holoenzimasi bir vaqtning o'zida turli xil sinaps aloqasi oqsillari bilanRobison va uning hamkorlari, 2005), postsinaptik zichlikka (PSD) yo'naltirilganligi aniqlandi, bu esa sinaptik plastisitiya uchun muhim ahamiyatga ega bo'lgan bir hodisa. Xususan, CaMKII ning NMDA turi glutamat retseptorlari GluN2B subuniti bilan o'zaro ta'siri yaqinda sinaptik plastisitivlik va o'rganishni (masalan,Halt va boshq., 2012). AC3I peptidi CaMKII ning avtotexnik ta'sirini taqqoslab, ferment katalitik faolligini inkor qiladi, ammo u ko'p protein-protein ta'sirini (shuningdek,Strack va uning hamkorlari, 2000; Robison va uning hamkorlari, 2005). Shunday qilib, bu erda qayd etilgan HSV-GFP-AC3I ning qiziqish va morfologik ta'siri CaMKII maqsadli oqsillarini fosforillanishdan, CaMKII maqsadidagi o'zgarishlar yoki CaMKII ning sinapslarda tizimli rolini o'zgartirishda (masalan,Lisman va boshq., 2002).

Tavsiya etilgan FF-B-CaMKII loopini NAc qobig'iga taqiqlash alohida e'tiborga loyiqdir, chunki yaqin vaqtlardagi ishda NAc qobig'i va yadro o'rtasida kokainga nisbatan javob beradigan bir necha fiziologik farqlar ko'rsatildi, bu bizning xolis iTRAQ (Table S1) ma'lumotlarimiz tomonidan tasdiqlangan. . NAc kabuksidagi MSNlar bir necha hafta davom etadigan surunkali kokaindan keyin o'chirilish hollarini ko'rsatmoqda, bir xil hayvonlardan olingan asosiy MSNlar esa 1 xaftada bazal darajaga qaytadigan o't o'chirish imkoniyatini (3-2 kunlik) oshib boradiKourrich va Tomas, 2009). Bundan tashqari, ko'p sonli sinaptik oqsillar NAc qobig'ida turli xil tartibga solinadi boshqalar surunkali giyohga ta'sir qolgan hayvonlarning yadrosi, shu jumladan GluA2 (Knackstedt va boshq., 2010). Surunkali amfetamin CaMKII'ani NAc qobig'ida (Loweth va boshq., 2010), shunisi bilan ajralib tursak, kokainga o'xshash ta'sirni topamiz. Shu bilan birga, DFOSB surunkali kokain (NAc) qobig'i va yadrosidaPerrotti va boshq., 2008) va biz CaMKIIa induktsiyasida DFBga qaram ekanligimizni ko'rsatganimizdan so'ng, bizning topilmalarimiz ushbu CaMKIIa organizatorida CaMKIIa promoterida qobiqdagi CaMKIIa ning selektiv indüksiyasidan mas'ul bo'lgan ikki subkordonning alohida transkripsiyonuniy mexanizmlari uchun yangi dalillar keltirib chiqaradi.

Yaqinda juda ko'p ishlar D1- va D2-turdagi NAc MSN-lari o'rtasidagi farqlarni aniqlashga qaratildi. Ikkala D1 va D2 retseptorlari ham giyohning foydali ta'siriga aloqador (O'zingiz, 2010), so'nggi ish D1 tipidagi MSNlarning optogenetik faollashuvini kokainga nisbatan qiziqish bilan bog'liq javoblarni kuchaytirayotganligini, D2-turdagi MSN aktivatsiyasining teskari ta'sirga ega ekanligini ko'rsatadi (Lobo va boshq., 2010). Ushbu topilmalarga muvofiq, D1-retseptorlari nokaut sichqonlari kokainning o'z-o'zini boshqarishiniCaine va boshq., 2007), D2 noqonuniylari yo'q (Caine va boshq., 2002). D1 agonistlarini bevosita NAcga kiritish administratsiyani tiklash paradigmalarida (masalan,O'zingiz, 2010). Qizig'i shundaki, bu ta'sir NAc qobig'idagi CaMKII faoliyatida D1-retseptorlari-ga bog'liq bo'ladi, lekin yadro emas (Anderson va boshq., 2008), bu erda taklif qilingan D1 va qobig'iga xos DFOSB-CaMKII loopi bilan yaxshi tanish bo'lgan natijalar.

Biz ilgari DFOSB dagi SerxNUMX ning kationin kinaz-27 (fosforilatlangan)Ulery va boshq., 2006), ammo shu erda biz CaMKII ning ushbu va boshqa saytlarda juda katta kinetikalar va stokiometriya bilan DFOSB ni fosforli qilganligini va yuqori aniqlikdagi Mr DFF uchunFig 5A) kokain ta'sirida ning Vivo jonli (Nestler, 2008). SerxNUMX fosforillanishining DFOSB barqarorligi va transkripsiyal faolligini (Ulery va boshq., 2006; Ulery va Nestler, 2007; Uler-Reynolds va boshq., 2009). Kelajakda olib borilayotgan ishlar ushbu tadqiqotda ko'rsatilgan FosB fosforilatsiyasining yangi joylarining identifikatsiyasi va funktsional natijalariga qaratiladi.

Bu erda ta'riflangan besleme oldingi loop, takroran qo'zg'atadigan dastur kokainda NAc ichida progressiv anormalliklarni keltirib chiqaruvchi maqbul yangi mexanizmni taqdim etadi. Shunday qilib, ushbu biokimyoviy yondashuv giyohvandlikning buzilishida bo'lajak terapevtik aralashuv uchun muhim ahamiyatga ega bo'lishi mumkin. CaMKII har doim va har qanday bazal neyronal va xulq-atvor funktsiyalari uchun zarur bo'lganligi sababli, CaMKII inhibitörlerinin bevosita foydalanish, giyohvandlik davolash kabi yo'l qo'yilmaydi. Bizning ma'lumotlarga ko'ra, CaMKII induksiyasining mexanizmini yanada aniqroq aniqlab olish, ya'ni miya hujayralarining alohida hujayra turi va pastki qismi uchun xos bo'lgan tizimiy CaMKII inhibisyonunun asoratlarini oldini olish uchun terapevtik maqsadni ta'minlashi mumkin.

O'tish:

Rahmatlar

Bu ish Narkotik moddalarni suiiste'mol qilish milliy instituti (EJN), DA018343 (AJR va EJN) NIDA-Yale Proteomika markazi va Hartwell fondi (AJR) grantlari yordamida qo'llab-quvvatlandi. Mualliflar, Gabby Rundenkoga toza tozalangan CaMKIIa sovg'asi uchun saxiy DF va R. Colbran sovg'alari uchun minnatdorchilik bildiradi.

O'tish:

Manbalar

  1. Ahmad SH, Koob GF. O'rtacha dan ortiqcha giyohvand iste'moliga o'tish: hedonik nuqtada o'zgarish. Ilmiy. 1998; 282: 298-300. [PubMed]
  2. Anderson SM, mashhur KR, Sadri-Vakili G, Kumzaren V, Shmidt HD, Bass IE, Terwilliger EF, Cha JH, Pirs RC. CaMKII: giyohvand moddalarni qidirishda accumbens dopamin va glutamat tizimlarini bog'lovchi biokimyoviy ko'prik. Nat Neurosci. 2008; 11: 344-353. [PubMed]
  3. Boudreau AC, Wolf ME. Kokainga nisbatan xulq-atvorli munosabat, yadrodagi akumbenslarda AMPA retseptorlari sirtini ifoda etish bilan bog'liq. J Neurosci. 2005; 25: 9144-9151. [PubMed]
  4. Brickey DA, Colbran RJ, Fong YL, Soderling UZ. Baculovirus ekspresyon tizimi yordamida Ca2 + / calmodulinga bog'liq protein kinaz II ning alfa-subunitining ifodasi va xarakteristikasi. Biochem Biophys Res Commun. 1990; 173: 578-584. [PubMed]
  5. Kokain o'z-o'zini boshqarish sohasidagi dopamin D2-o'xshash retseptorlari roli: D2 retseptorlari mutant sichqonlari va yangi D2 retseptorlari bilan tadqiqotlar, Caine SB, Negus SS, Mello NK, Patel S, Bristow L, Kulagowski J, Vallone D, Saiardi A, Borrelli E. antagonistlar. J Neurosci. 2002; 22: 2977-2988. [PubMed]
  6. Dapamin D1 retseptorlari bilan to'qnashuvdagi sichqonlarda kokainni o'z-o'zini boshqarishning etishmasligi. Tsein SB, Tomsen M, Gabriel KI, Berkowitz JS, Gold LH, Koob GF, Tonegawa S, Zhang J, Xu M. J Neurosci. 2007; 27: 13140-13150. [PMC bepul maqola] [PubMed]
  7. Carle sh.b., Ohnishi YN, Ohnishi YH, Alibhai IN, Wilkinson MB, Kumar A, Nestler EJ. FosB stabilizatsiyasi uchun proteazomega bog'liq va mustaqil mexanizmlar: FosB degron ta'sir maydonlarini aniqlash va DeltaFosB barqarorligi uchun ta'sir. Eur J Neurosci. 2007; 25: 3009-3019. [PubMed]
  8. Chen J, Kelz MB, Zeng G, Sakai N, Steffen C, Shockett PE, Picciotto MR, Duman RS, Nestler EJ. Miyaning bevosita, maqsadli gen ekspozitsiyasi bilan transgenik hayvonlar. Mol Pharmacol. 1998; 54: 495-503. [PubMed]
  9. Christoffel DJ, Golden SA, Dumitriu D, Robison AJ, Janssen WG, Ahn HF, Krishnan V, Reyes CM, Xan MH, Ables JL, Eisch AJ, Dietz yassi, Ferguson D, Neve RL, Greengard P, Kim Y, Morrison JH , Russo SJ. IkappaB kinoaz ijtimoiy stressni keltirib chiqaradigan sinaptik va xulq-atvorli plastisiyani tartibga soladi. J Neurosci. 2011; 31: 314-321. [PMC bepul maqola] [PubMed]
  10. Colbran RJ. Ca2 + / calmodulinga bog'liq protein kinozasining II ning bazal otofosforilatsiyani inaktivatsiyasi. J Biol Chem. 1993; 268: 7163-7170. [PubMed]
  11. Colbran RJ. Proteinli fosfatazalar va kaltsiy / kalmodulinga bog'liq protein kinaz II-ga bog'liq bo'lgan sinaptik plastisit. J Neurosci. 2004; 24: 8404-8409. [PubMed]
  12. Colbran RJ, qora AM. Kaltsiy / kalmodulinga bog'liq protein kinaz II va sinaptik plastisit. Curr Opin Neurobiol. 2004; 14: 318-327. [PubMed]
  13. Colby CR, Whisler K, Steffen C, Nestler EJ, Self DW. DeltaFosBning striatal hujayra tipidagi maxsus ekspressionlari kokain uchun rag'batlanishni kuchaytiradi. J Neurosci. 2003; 23: 2488-2493. [PubMed]
  14. Covington HE, 3rd, Maze I, LaPlant QC, Vialou VF, Ohnishi YN, Berton O, Fass DX, Renthal W, Rush AJ, 3rd, Wu EY, Ghose S, Krishnan V, Russo SJ, Tamminga S, Xaggarty SJ, Nestler EJ. Histone deasetilaz inhibitörlerinin antidepresan harakatlar. J Neurosci. 2009; 29: 11451-11460. [PMC bepul maqola] [PubMed]
  15. Davalos A, Fernandez-Xernando S, Sowa G, Deraxshan B, Lin MI, Lee JY, Zhao H, Luo R, Colangelo S, Sessa WC. Caveolin-1-regulyatsiya qilingan oqsillarning miqdoriy proteomikasi: endotel hujayralarida polimeraza i va tranzitni ajratuvchi omil / CAVIN-1 ning xarakteristikasi. Mol hujayra oqimi proteomikasi. 2010; 9: 2109-2124. [PMC bepul maqola] [PubMed]
  16. Dumais A, Lesage AD, Alda M, Rouleau G, Dumont M, Chawky N, Roy M, Mann JJ, Benkelfat C, Turecki G. Depressiyada o'z joniga qasd qilishning xavfli omillari: erkak. Am J Psixiatriya. 2005; 162: 2116-2124. [PubMed]
  17. Grueter BA, Robison AJ, Neve RL, Nestler EJ, Malenka RC. DFOSB nukleus akumbenslarini bevosita va bilvosita yo'l harakati bilan modulyatsiya qiladi. Proc Natl Acad Sci AQSh. Matbuotda 2013. [PMC bepul maqola] [PubMed]
  18. Halt AR, Dallapiazza RF, Zhou Y, Stein IS, Qian H, Juntti S, Wojcik S, Brose N, Silva AJ, Jell JW. GluN2B ga bog'langan CaMKII xotira konsolidatsiyasi jarayonida juda muhimdir. EMBO J. 2012; 31: 1203-1216. [PMC bepul maqola] [PubMed]
  19. Xiroi N, Braun JR, Xayl CN, Ye H, Grinberg ME, Nestler EJ. FosB mutant sichqonlari: Fos bilan bog'liq oqsillarning surunkali kokain induktsiyasini yo'qotish va kokainning psixomotor va foydali ta'siriga nisbatan yuqori sezuvchanlik. Proc Natl Acad Sci AQSh A. 1997; 94: 10397-10402. [PMC bepul maqola] [PubMed]
  20. Ito R, Robbins TW, Everitt BJ. Nucleus accumbens yadrosi va qobig'i tomonidan kokainga mo'ljallangan xatti-harakatni differentsial nazorat qilish. Nat Neurosci. 2004; 7: 389-397. [PubMed]
  21. Jorissen HJ, Ulery PG, Genri L, Gourneni S, Nestler EJ, Rudenko G. DeltaFosB transkriptsion faktorining dimerizatsiyasi va DNKni bog'lash xususiyatlari. Biokimyo. 2007; 46: 8360-8372. [PubMed]
  22. Jourdain P, Fukunaga K, Muller D. Kaltsiy / kalmodulinga qaram protein kinaz II faollikka bog'liq bo'lgan filopodiya o'sishi va umurtqalarning paydo bo'lishiga yordam beradi. J Neurosci. 2003; 23: 10645-10649. [PubMed]
  23. Kelz MB, Chen J, Carlezon VV, Jr, Whisler K, Gilden L, Beckmann AM, Steffen S, Zhang YJ, Marotti L, Self DW, Tkatch T, Baranauskas G, Surmeier DJ, Neve RL, Duman RS, Picciotto MR, Nestler EJ. Miya ichidagi transkripsiyon faktor deltaFosB ning ifodasi kokainga sezgirlikni nazorat qiladi. Tabiat. 1999; 401: 272-276. [PubMed]
  24. Klug JR, Mathur BN, Kash TL, Vang HD, Matthews RT, Robison AJ, Anderson ME, Deutch AY, Lovinger DM, Colbran RJ, Winder DG. CaMKII ning Dorsal Striatal Mediada Spin Neuron'larda Genetika Ta'sirlanishi Funktsional Ekzototerik Sinapslarni kamaytiradi va Ichki Ekstremallikni yaxshilaydi. PLoS One. 2012; 7: e45323. [PMC bepul maqola] [PubMed]
  25. Knackstedt LA, Moussawi K, Lalumiere R, Schwendt M, Klugmann M, Kalivas PW. Kokainning o'z-o'zini boshqarishidan so'ng yo'qolib ketish ta'limoti kokain izlanishini inhibe qilish uchun glutamatergic plastisiteyi keltirib chiqaradi. J Neurosci. 2010; 30: 7984-7992. [PMC bepul maqola] [PubMed]
  26. Kourrich S, Tomas MJ. Shu kabi neyronlar, zid moslamalar: psixostimulyantlik tajribasi turli-tuman ravishda akumbens yadroidagi qobiqdagi otishni o'rganish xususiyatlarini o'zgartiradi. J Neurosci. 2009; 29: 12275-12283. [PMC bepul maqola] [PubMed]
  27. Kourrich S, Klug JR, Mayford M, Tomas MJ. AMPAR-Striatal alfaCaMKII ning mustaqil ta'siri kokain mukofoti sezuvchanligini oshiradi. J Neurosci. 2012; 32: 6578-6586. [PMC bepul maqola] [PubMed]
  28. LaPlant Q, Chakravarty S, Vialou V, Mukherjee S, Koo JW, Kalahasti G, Bradbury KR, Taylor SV, Maze I, Kumar A, Graham A, Birnbaum SG, Krishnan V, Truong HT, Neve RL, Nestler EJ, Russo SJ . Ayol sichqonlarida yumshoq gormon-vositachilardan stressli o'ta sezuvchanlikdagi yadroviy omil kappaBning ahamiyati. Biol psixiatriyasi. 2009; 65: 874-880. [PMC bepul maqola] [PubMed]
  29. Li KW, Kim Y, Kim AM, Helmin K, Nairn AC, Greengard P. D1 va D2 dopamin retseptorlari tarkibidagi yadroli akumbenslardagi kraxinli dendritik orqa miya hosilalari. Proc Natl Acad Sci AQSh A. 2006; 103: 3399-3404. [PMC bepul maqola] [PubMed]
  30. Lisman J, Schulman H, Cline H. Sinematik va xatti-xotirada CaMKII ning molekulyar asoslari. Nat Rev Neurosci. 2002; 3: 175-190. [PubMed]
  31. Lobo MK, Covington HE, 3rd, Chaudhury D, Fridman AK, Sun H, Damez-Verno D, Dietz DM, Zaman S, Koo JW, Kennedy PJ, Mouzon E, Mogri M, Neve RL, Deisseroth K, Han MH, Nestler EJ. BDNF signallarining hujayra turiga xos yo'qolishi kokaindan olingan mukofotning optogenetik nazoratini taqqoslaydi. Ilmiy. 2010; 330: 385-390. [PMC bepul maqola] [PubMed]
  32. Loweth JA, Baker LK, Guptaa T, Guillory AM, Vezina P. CaMKII ning yadrodagi akumbens qobig'idagi inhibatsiyasi sezgirlangan kalamushlarda amfetamin miqdorini oshiradi. Neurosci Lett. 2008; 444: 157-160. [PMC bepul maqola] [PubMed]
  33. Loweth JA, Singer BF, Beyker LK, Wilke G, Inamin H, Bubula N, Aleksandr JK, Carlezon VV, Jr, Neve RL, Vezina P. Alfa Ca2 + / calmodulinga bog'liq protein kinaz II ning yadrosidagi akumbens qobig'idagi vaqtinchalik ortiqcha namoyishi Amfetaminning xulq-atvorli javobini kuchaytiradi. J Neurosci. 2010; 30: 939-949. [PMC bepul maqola] [PubMed]
  34. Malinov R, Malenka RC. AMPA retseptorlari savdosi va sinaptik plastika. Annu Rev Neurosci. 2002; 25: 103-126. [PubMed]
  35. Matsuzaki M, Honkura N, Ellis-Davies GC, Kasai H. Yagona dendritik spinalarda uzoq muddatli kuchlanishning strukturaviy asoslari. Tabiat. 2004; 429: 761-766. [PubMed]
  36. Mayford M, Bach ME, Huang YY, Vang L, Hawkins RD, Kandel ER. CaMKII transgenining tartibga solinadigan ekspresiyasi orqali xotira hosil bo'lishini nazorat qilish. Ilmiy. 1996; 274: 1678-1683. [PubMed]
  37. Maze I, Covington HE, 3rd, Dietz DM, LaPlant Q, Renthal Vt, Russo SJ, Mexanik M, Mouzon E, Neve RL, Xaggarty SJ, Ren Y, Sampath SC, Hurd YL, Greengard P, Taraxovskiy A, Schaefer A, Nestler EJ. Giyoxin bilan bog'liq bo'lgan plastisitivada histon metiltransferaza G9a ning asosiy roli. Ilmiy. 2010; 327: 213-216. [PMC bepul maqola] [PubMed]
  38. McClung CA, Nestler EJ. CREB va DeltaFosB tomonidan gen ekspression va kokain mukofotini tartibga solish. Nat Neurosci. 2003; 6: 1208-1215. [PubMed]
  39. Nestler EJ. Ko'rib chiqish. Narkomaniyaning transkripsiya mexanizmlari: DeltaFosB ning ahamiyati. Filos Trans R Soc London B Biol Sci. 2008; 363: 3245-3255. [PMC bepul maqola] [PubMed]
  40. Nye HE, Hope BT, Kelz MB, Iadarola M, Nestler EJ. Striatum va nukleus akumbenslaridagi kokain tomonidan FOSga bog'liq surunkali antijenni induksiyalash to'g'risidagi farmakologik tadqiqotlar. J Pharmacol Exp Ther. 1995; 275: 1671-1680. [PubMed]
  41. Okamoto K, Bosch M, Hayashi Y. Dendritik spinalarning strukturaviy plastinkasida CaMKII va F-aktinlarning rollari: sinaptik yorliqning potentsial molekulyar identifikatori? Fiziologiya (Bethesda) 2009; 24: 357-366. [PubMed]
  42. Olausson P, Jentsch JD, Tronson N, Neve RL, Nestler EJ, Teylor JR. Nucleus accumbens-da DeltaFosB oziq-ovqatni kuchaytirish vositasi xatti-harakatini va motivatsiyasini boshqaradi. J Neurosci. 2006; 26: 9196-9204. [PubMed]
  43. Paxinos G, Watson S. Stereotaksik koordinatlardagi rat miyasi. 6th Edition. Amsterdam; Boston: Academic Press / Elsevier; 2007.
  44. Peakman MC, Colby C, Perrotti LI, Tekumalla P, Carle T, Uliya R, Chao J, Duman C, Steffen C, Monteggia L, Allen MR, Stock JL, Duman RS, McNeish JD, Barrot M, Self DW, Nestler EJ , Schaeffer E. Transgenik sichqonlardagi c-Jun ning dominant mutatsion mutatsiyasiga moslashgan, miya mintaqasiga xos ekspresiyasi kokainga sezuvchanlikni pasaytiradi. Brain Res. 2003; 970: 73-86. [PubMed]
  45. Penzes P, Cahill ME, Jones KA, Srivastava D.P. Konvergent CaMK va RacGEF signallari dendritik struktura va funktsiyalarni nazorat qiladi. Tarqoq Biol. 2008; 18: 405-413. [PubMed]
  46. Perrotti LI, Hadeishi Y, Ulery PG, Barrot M, Monteggia L, Duman RS, Nestler EJ. Surunkali stressdan so'ng mukofot bilan bog'liq miya strukturasida deltaFosB ning paydo bo'lishi. J Neurosci. 2004; 24: 10594-10602. [PubMed]
  47. Perrotti LI, Weaver RR, Robison B, Renthal V, Maze I, Yazdani S, Elmore RG, Knapp DJ, Selley DE, Martin BR, Sim-Selley L, Bachtell RK, Self DW, Nestler EJ. DeltaFosBning turli xil nayranglari miyadagi suiiste'mollik bilan bog'liq. Sinaps. 2008; 62: 358-369. [PMC bepul maqola] [PubMed]
  48. Pickens CL, Airavaara M, Theberge F, Fanous S, Hope BT, Shaham Y. Narkomaniya inkubatsiyasining neyrobiologiyasi. Trends Neurosci. 2011; 34: 411-420. [PMC bepul maqola] [PubMed]
  49. Pirs RC, Tez EA, Reeder shaharlari, Morgan ZR, Kalivas PW. Kaltsiy orqali yuborilgan ikkinchi xabarchilar giyohvandlikka nisbatan sezgirlikni ifodalashni ifodalaydi. J Pharmacol Exp Ther. 1998; 286: 1171-1176. [PubMed]
  50. Quirion R, Robitaille Y, Martial J, Chabot JG, Lemoin R, Pilapil C, Dalpe M. Barcha miya retseptorlari autoradiografiyasi: butun matonali asfaltlarni kamaytiradigan umumiy usul. Sinaps. 1987; 1: 446-454. [PubMed]
  51. Robinson TE, Kolb B. Dori-darmonlar bilan aloqadorligi bilan bog'liq strukturaviy plastika. Neyrofarmakologiya. 2004; 47 (Suppl 1): 33-46. [PubMed]
  52. Robison AJ, Nestler EJ. Narkomaniyaning transkripsiya va epigenetik mexanizmlari. Nat Rev Neurosci. 2011; 12: 623-637. [PMC bepul maqola] [PubMed]
  53. Robison AJ, Bass Ma, Jiao Y, MacMillan LB, Carmody LC, Bartlett RK, Colbran RJ. Kaltsiy / kalmodulinga bog'liq protein kinaz II ning multivalentli o'zaro ta'sirlari postsinaptik zichlik proteinlari bilan NR2B, densin-180 va alfa-aktinin-2. J Biol Chem. 2005; 280: 35329-35336. [PubMed]
  54. Ross PL, Huang YN, Marchese JN, Williamson B, Parker K, Xattan S, Xainovski N, Pillai S, Dey S, Daniels S, Purkayastha S, Juhasz P, Martin S, Bartlet-Jones M, Pappin DJ. Saccharomyces cerevisiae da amin reaktiv izobarik tagging reaktivlarini qo'llagan holda ko'paytiriluvchi protein miqdori. Mol hujayra oqimi proteomikasi. 2004; 3: 1154-1169. [PubMed]
  55. Russo SJ, Dietz DM, Dumitriu D, Morrison JH, Malenka RC, Nestler EJ. Amaldagi sinaps: yadrodagi akumbensdagi sinaptik va strukturali plastisiyani mexanizmlari. Trends Neurosci. 2010; 33: 267-276. [PMC bepul maqola] [PubMed]
  56. Self DW. In: Dopamin retseptorlari. Neve KA, muharriri. Nyu-York: Humana Press; 2010. 479-524-sahif.
  57. Singil BF, Loweth JA, Neve RL, Vezina P. Nukleus akumbens qobig'ida alfa-kaltsiy / kalmodulinga bog'liq bo'lgan oqsil kinazining o'tkir virusli vositalaridan ortiqcha ifodasi alfa-amino-3-gidroksil-5 ning uzoq muddatli funktsional upregozatsiyasiga olib keladi -metil-4-izoksazol-propionat retseptorlari: dopamin turi-1 retseptorlari va protein kinaz A bog'liqligi. Eur J Neurosci. 2010; 31: 1243-1251. [PMC bepul maqola] [PubMed]
  58. Strack S, McNeill RB, Colbran RJ. N-metil-D-aspartat retseptorining NR2B subunitiga mo'ljallangan kaltsiy / kalmodulinga bog'liq protein kinaz II mexanizmi va uni tartibga solish. J Biol Chem. 2000; 275: 23798-23806. [PubMed]
  59. Uler-Reynolds PG, Castillo Ma, Vialou V, Russo SJ, Nestler EJ. DeltaFosB ning fosforillanish darajasi uning in vivo jonli muvozanatini ta'minlaydi. Neuroscience. 2009; 158: 369-372. [PMC bepul maqola] [PubMed]
  60. Ulery PG, Nestler EJ. SerxNUMX fosforilatsiyasining DeltaFosB transkripsiyasi faoliyatini tartibga solish. Eur J Neurosci. 27; 2007: 25-224. [PubMed]
  61. Ulery PG, Rudenko G, Nestler EJ. DeltaFosBning barqarorligini fosforillanish bilan tartibga solish. J Neurosci. 2006; 26: 5131-5142. [PubMed]
  62. Vialou V va boshq. DeltaFosB, miya mukofotlari davrlarida stress va antidepressantlarga qarshi chidamlilikka yordam beradi. Nat Neurosci. 2010; 13: 745-752. [PMC bepul maqola] [PubMed]
  63. Vang L, Lv Z, Xu Z, Sheng J, Hui B, Sun J, Ma L. Surunkali giyoh moddalar bilan bog'liq bo'lgan H3 asetilasyonu va CaMKIIalpha'yı yadro akumbensindeki transkripsiyonel aktivasyonu, giyohvand mustahkamlash uchun motivasyon uchun juda muhim ahamiyatga ega. Neyropopsikofarmakologiya. 2010; 35: 913-928. [PMC bepul maqola] [PubMed]
  64. Werme M, Messer C, Olson L, Gilden L, Thoren P, Nestler EJ, Brenen shahri Rabva mahallasi Delta FosB g'ildirakni boshqaradi. J Neurosci. 2002; 22: 8133-8138. [PubMed]
  65. Winstanley CA, LaPlant Q, Theobald DE, Green TA, Bachtell RK, Perrotti LI, DiLeone RJ, Russo SJ, Garth WJ, Self DW, Nestler EJ. Orbitofrontal korteksdagi DeltaFosB induktsiya kokainga sabab bo'lgan kognitif disfunktsiyaga bardoshlik bilan ishlaydi. J Neurosci. 2007; 27: 10497-10507. [PubMed]
  66. Zachariou V, Bolanos CA, Selley DE, Theobald D, Cassidy MP, Kelz MB, Shaw-Lutchman T, Berton U, Sim-Selley LJ, Dileone RJ, Kumar A, Nestler EJ. DeltaFosB uchun morfin ta'siridagi yadrodagi akumbenslar uchun muhim rol. Nat Neurosci. 2006; 9: 205-211. [PubMed]
  67. Chingiz E, Vu Y, Yang Y, Grueter Idoralar, Ni G, Price EE, Jr, Thiel Vt, Guatimosim S, Song LS, Madu EC, Shoh AN, Vishnivetskaya TA, Atkinson JB, Gurevich VV, Salama G, Lederer WJ, Colbran RJ, Anderson ME. Calmodulin kinaz II inhibisyonu tizimli yurak kasalliklaridan himoya qiladi. Nat Med. 2005; 11: 409-417. [PubMed]