(HUMAN) Elgsenos ir struktūrinis atsakas į lėtinį kokainą Reikalauja, kad Nucleus Accumbens Shell (2013) ląstelė, apimanti AFosB ir kalcio / kalmodulino priklausomą baltymų kinazę II

J Neuroscience. 2013 Mar 6;33(10):4295-4307.

Robison AJ, Vialou V, Mazei-Robison M, Feng J, Kourrich S, Collinsas M, Wee S, Koob G, Tureckis G, Neve R, Tomas M, Nestler EJ.

Šaltinis

Fishbergo neuromokslo ir Friedmano smegenų instituto, Sinajaus kalno medicinos mokyklos, Niujorkas, Niujorkas, 10029, Minesotos universiteto Neuromokslo ir psichologijos katedros, Žmogaus genetikos institutas, Mineapolis, Minesota 55455, Priklausomybės ligų neurologų komitetas. , „Scripps“ tyrimų institutas, La Jolla, Kalifornijos 92037 depresinių sutrikimų programa, Douglaso psichikos sveikatos universiteto institutas ir McGill universitetas, Monrealis, Kvebekas, Kanada, H4H 1R3, ir Smegenų ir pažinimo mokslų departamentas, Masačusetso technologijos institutas, Kembridžas, Masačusetsas .

Abstraktus

Transkripcijos faktorius ΔFosB ir nuo smegenų praturtintas nuo kalcio / kalmodulino priklausomas baltymo kinazė II (CaMKIIα) yra sukaupti branduolio akumuliatoriuose (NAc) lėtiniu kokaino ar kitų psichostimuliuojančių narkotikų poveikiu, kai šie du baltymai tarpininkauja jautrinamų vaistų reakcijose. . Nors ir ΔFosB, ir CaMKIIα reguliuoja AMPA gliutamato receptorių ekspresiją ir funkcijas NAc, dendritinio stuburo formavimąsi NAc terpės nerviniuose neuronuose (MSN) ir lokomotorinį jautrinimą kokainui, iki šiol nebuvo tirtas joks tiesioginis ryšys tarp šių molekulių. Čia mes parodome, kad MFosB yra fosforilinamas CaMKIIα baltymą stabilizuojančiame Ser27 ir kad CaMKII yra reikalingi kokaino sukauptam ΔFosB kaupimuisi žiurkių NAc.

Atvirkščiai, mes parodome, kad ΔFosB yra ir būtinas, ir pakankamas CaMKIIα geno ekspresijai in vivo sukelti kokainui, kuris yra selektyvus D1tipo MSN NAc apvalkalo subregione.

Be to, nuo CaMKII priklauso NAnd MSN dendritinių stuburo indukcija ir padidėjęs elgesio reagavimas į kokainą po NAc perdėtos FFosB ekspresijos.

Svarbu tai, kad pirmą kartą parodome ΔFosB ir CaMKII indukciją NAc žmonių, priklausančių nuo kokaino, siūlydami galimus būsimos terapinės intervencijos tikslus. Šie duomenys patvirtina, kad ΔFosB ir CaMKII įsitraukia į ląstelių tipo ir smegenų srities specifinę teigiamą grįžtamąją kilpą, kaip pagrindinį mechanizmą, reguliuojantį smegenų atlygio grandinę, reaguojant į lėtinį kokainą.

Įvadas

Vis daugiau įrodymų patvirtina požiūrį, kad genų ekspresijos pokyčiai prisideda prie narkomanijos mechanizmų (Robisonas ir Nestleris, 2011). Vienas svarbus šių pokyčių tarpininkas yra ΔFosB, Fos šeimos transkripcijos faktorius („Nestler“, „2008“). Lėtinis beveik bet kokio vaisto vartojimas sukelia ilgalaikį ΔFosB kaupimąsi branduolio akumuliatoriuose (NAc) - limbinėje srityje, būtinoje atlygio poelgiui. SUch indukcija atrodo būdinga NAc terpės nervinio nervo (MSN) klasei, kuri išreiškia D1 dopamino receptorius. Dėl neišvengiamo ΔFosB ekspresijos šiuose D1 tipo NAc MSN padidina lokomotorinį ir teigiamą atsaką į kokainą ir morfiną. (Kelz ir kt., 1999; Zachariou ir kt., 2006), įskaitant padidėjusį kokaino savarankišką vartojimą (Colby ir kt., 2003). Be to, genetinė ar virusinė ΔFosB transkripcijos aktyvumo blokada sumažina teigiamą šių vaistų poveikį (Zachariou ir kt., 2006), nurodant, kad ši nuolatinė ΔFosB indukcija yra kritinis tarpininkas, sukeliantis ilgalaikius NAc pokyčius, kuriuos sukelia lėtinis vaistų vartojimas.

Neįprastas ΔFosB stabilumas (palyginti su visais kitais Fos šeimos baltymais) yra būdinga molekulės savybė dėl degrono domenų, esančių viso ilgio FosB (Carle ir kt., 2007) ir reguliuojamas procesas. ΔFosB fosforilinamas in vitro ir in vivo ties Ser27, ir ši reakcija dar labiau stabilizuoja ΔFosB, ~ 10 kartus, ląstelių kultūroje ir NAc in vivo (Ulery-Reynolds ir kt., 2009). Nors įrodyta, kad Ser27-ΔFosB yra kazeino kinazės-2 substratas in vitro (Ulery ir kt., 2006), jo mechanizmas in vivo fosforilinimas vis dar nežinomas.

Nuo kalcio / kalmodulino priklausoma baltymo kinazė II (CaMKII) yra labai išreikšta serino / treonino kinazė, kurios α ir β izoformos sudaro dodekamerinius homo- ir hetero-holoenzimus. in vivo, ir yra būtinos įvairioms neuroplastiškumo formoms (Lisman ir kt., 2002; „Colbran and Brown“, „2004“). CaMKIIα selektyviai sukelia NAc apvalkalas lėtiniu amfetaminu (Loweth ir kt., 2010), o farmakologinė CaMKII aktyvumo blokada NAc apvalkale sumažina elgesio jautrinimą amfetaminu (Loweth ir kt., 2008) ir kokainas (Pierce ir kt., 1998), o virusinis per didelis CaMKIIα ekspresija šiame NAc subregione padidina lokomotorinį sensibilizavimą ir savaiminį amfetamino skyrimą (Loweth ir kt., 2010). CaMKIIα gali paveikti atlygio elgesį moduliuodamas AMPA glutamato receptorių subvienetus (Pierce ir kt., 1998), nes CaMKIIα aktyvumas ilgą laiką buvo susijęs su AMPA receptorių funkcija ir taikymu sinapsėms keliose neuroplastiškumo formose (Malinow ir Malenka, 2002).

Ši literatūra rodo keletą paralelių tarp ΔFosB ir CaMKII: abu yra būtini ir pakankami daugialypiams narkotikams, turintiems įvairių elgesio požymių, elgsenai, abu padidina dendritinius stuburo tipus įvairiuose neuroninių ląstelių tipuose. in vivo (Jourdain ir kt., 2003; Maze ir kt., 2010), ir abu daro bent tam tikrą savo elgesio poveikį moduliuodami AMPA receptorius (Kelz ir kt., 1999; Malinow ir Malenka, 2002; Vialou ir kt., 2010). Nepaisant šių paralelių, nėra žinomas joks funkcinis ryšys tarp ΔFosB ir CaMKII. Čia mes nustatome abipusį reguliavimą tarp ΔFosB ir CaMKII ir parodome, kad du baltymai sudaro D1 tipo MSN specifinę „peradresavimo“ kilpą NAc apvalkale, kurią sukelia kokainas, ir reguliuoja įvairius kokaino atsakus. in vivo.

Eiti į:

Medžiagos ir metodai

1 eksperimentas: NATRA apvalkalo ir šerdies proteino analizė iTRAQ po gydymo kokainu (1A pav)

Suaugusiems (8 savaitės) žiurkių patinams buvo skiriama 20 mg / kg kokaino arba fiziologinio tirpalo nešiklio IP vieną kartą per dieną septynias dienas. 24 val. Po paskutinės injekcijos, NAc apvalkalas ir šerdis buvo mikrodalijami (1A pav) ir blykste užšaldyta. iTRAQ analizės buvo atliktos, kaip aprašyta anksčiau (Ross ir kt., 2004; Davalos ir kt., 2010).

1 pav

1 pav

Kokainas sukelia specifinę CaMKII indukciją NAc su apvalkalu

2 eksperimentas: Kiekybiškai įvertinti baltymų pokyčiai žiurkės NAc šerdyje ir apvalkale po gydymo kokainu (1B – D pav)

Suaugusiems (8 savaitės) patinams patinams buvo švirkščiama 10 mg / kg kokaino arba fiziologinio tirpalo nešiklio IP vieną kartą per dieną septynias dienas lokomotorių registravimo kamerose. Lokomotoriniai atsakai į vienkartinę kokaino injekciją (5 mg / kg IP) buvo užregistruoti tiems gyvūnams, kurie anksčiau buvo gydyti kokainu (vadinami „lėtiniais“), ir daliai tų, kurie buvo gydomi fiziologiniu tirpalu (vadinamu „ūmiu“), ir lokomotoriniai atsakai į druskos tirpalą. atskirai užfiksuotas likusiems lėtiniu druskos tirpalu gydytiems gyvūnams (vadinamiems „fiziologiniu tirpalu“). Lokomotorinio aktyvumo tyrimai buvo atlikti kaip aprašyta (Hiroi ir kt., 1997). Trumpai tariant, suaugę žiurkės patinai buvo dedami į 18 “× 24” PAS atvirojo lauko registravimo dėžutes (San Diego Instruments), kad 30 min būtų įpratę, jiems buvo sušvirkšta viena fiziologinio tirpalo IP injekcija ir stebėta dar 30 min. vienkartinė 5 mg / kg kokaino injekcija IP ir stebima, ar 30 min.

24 val. Po šios paskutinės injekcijos žiurkėms buvo atlikta dekapsija be anestezijos, kad būtų išvengta anestetikų poveikio neuronų baltymų lygiui ir fosfo būsenoms. Smegenys nuosekliai pjaustomos 1.2 mm matricoje („Braintree Scientific“), o tikslinis audinys buvo pašalintas fosfatu buferiniame fiziologiniame tirpale, kuriame yra proteazės (Roche) ir fosfatazės (Sigma Aldrich) inhibitorių, naudojant 14 daviklį NAc šerdims ir 12 daviklį likusiam likusiam. NAc apvalkalo audinys (žr 1A pav) ir iškart užšaldomi ant sauso ledo. Mėginiai buvo homogenizuoti lengvu ultragarsu modifikuotame RIPA buferyje: 10 mM Tris bazė, 150 mM natrio chloridas, 1 mM EDTA, 0.1% natrio dodecilsulfato, 1% Triton X-100, 1% natrio deoksicholato, pH 7.4, proteazė. kaip aukščiau. Pridėjus Laemmli buferį, baltymai buvo atskirti ant 4 – 15% poliakrilamidinio gradiento gelių (Criterion System, BioRad) ir atliktas Western blotinimas naudojant Odisėjos sistemą (Li-Cor) pagal gamintojo protokolus.

3 eksperimentas: Kiekybiškai įvertinti baltymų pokyčiai žiurkės NAc šerdyje ir apvalkale po kokaino vartojimo (1E pav)

Suaugusiems (8 savaitės) žiurkių patinams buvo skiriama 10 mg / kg kokaino arba fiziologinio tirpalo nešiklio IP vieną kartą per dieną septynias dienas. 14 dienas po paskutinės injekcijos gyvūnams, gydomiems fiziologiniu tirpalu, buvo padaryta dar viena fiziologinio tirpalo injekcija (vadinama „fiziologiniu tirpalu“), o kokainu gydomiems gyvūnams buvo dar viena injekcija fiziologiniu tirpalu (vadinama 14 dienos nutraukimu arba „14d WD“) arba vienkartine kokaino injekcija ( vadinamas iššūkiu „14d WD Chal“). Praėjus vienai valandai po paskutinės injekcijos, gyvūnai buvo nukenksminti ir atliktas Western blot tyrimas kaip ir Eksperimentuokite 2.

4 eksperimentas: Kiekybiškai įvertinti baltymų pokyčiai žiurkės NAc šerdyje ir apvalkale po kokaino savitarnos (2A – C pav)

Žiurkės buvo mokomos savarankiškai leisti 0.5 mg / kg / kokaino infuziją per vienos valandos seansus pagal fiksuoto santykio 1 tvarkaraštį devynias dienas. Po devynių pradinių seansų žiurkės buvo padalytos į dvi grupes, subalansuotas atsižvelgiant į kokaino vartojimą per paskutinius du seansus. Vienai žiurkių grupei buvo leista savarankiškai vartoti kokainą (0.5 mg / kg / infuzija) per vienos valandos seansus (trumpa prieiga, ShA), o kitai žiurkių grupei kokainas savarankiškai skyrė kokainą šešių valandų sesijomis (ilgas priėjimas, LgA ) dešimt papildomų dienų (eskalavimo sesijos).

Smegenų skyriai buvo apdoroti imunohistochemijai, kaip aprašyta (Perrotti ir kt., 2004). Smegenys buvo perfuzuotos 18 – 24 val. Po paskutinio vaisto poveikio, todėl likęs pilnojo ilgio „FosB“ baltymas buvo suskaidytas taip, kad visas likęs imunoreaktyvumas atspindėtų ΔFosB. Šį degradaciją patvirtino Western blot, kuris neparodė žymaus dažymo antikūnu, nukreiptu prieš viso ilgio FosB C galą, kuris neatpažįsta ΔFosB (duomenys nepateikti). Padalijus į 35 μm sekcijas, aklas stebėtojas dviem pjūviais per kiekvienos žiurkės NAc nustatė ΔFosB imunopozityvių ląstelių skaičių, o tada kiekvienam gyvuliui buvo apskaičiuotos vidutinės 40 × lauko vertės. Kiekvienas gyvūnas buvo laikomas individualiu statistinės analizės stebėjimu. Dominantys regionai buvo nustatyti naudojant Paxinos ir Watson (Paxinos ir Watson, 2007).

CaMKIIα imunoreaktyvumo kiekybinis įvertinimas buvo atliktas naudojant Licor sistemą, kaip aprašyta (Covington ir kt., 2009). Integruoti CaMKII ir GAPDH intensyvumai buvo nustatyti naudojant „Odisėjos“ programinę įrangą. Rezultatai pateikiami kaip integruotosios intensyvumo vertės mm2 ir pateikiamos kaip vidurkis ± sem (n = 4 – 10 vienai grupei). GAPDH vertės buvo naudojamos kaip nuoroda normalizuojant CaMKII intensyvumą, atsižvelgiant į gabaliukų storį ir sąlygas.

2 pav

2 pav

CaMKII indukcija NAc apvalkale savarankiškai vartojančioms žiurkėms ir žmonėms, priklausantiems nuo kokaino

5 eksperimentas: Kiekybinis baltymų lygio nustatymas nuo kokaino priklausomiems žmonėms (2D pav)

Procedūra

Žmogaus smegenų audiniai po mirties buvo gauti iš Kvebeko savižudžių smegenų banko (Douglaso psichikos sveikatos universiteto institutas, Monrealis, Kvebekas, Kanada). Audiniai buvo išsaugomi iš esmės taip, kaip aprašyta (Quirion ir kt., 1987). Trumpai tariant, smegenys dedamos ant šlapio ledo į polistirolo putplasčio dėžutę ir skubamos į Kvebeko savižudžių smegenų banko patalpas. Pusrutuliai iškart atskiriami sagitaliniu pjūviu smegenų, smegenų kamieno ir smegenų viduryje. Kraujagyslės, kankorėžinė liauka, choroidinis rezginys, pusiau smegenėlės ir pusiau smegenų kamienas paprastai yra išpjaustomos iš kairiojo pusrutulio, kuris prieš užšaldant vainikiniu būdu supjaustomas 1 cm storio griežinėliais. Pastaroji smegenėlių pusė prieš užšaldant sagitališkai supjaustoma 1cm storio griežinėliais. Audiniai greitai užšaldomi 2-metilbutane –40 ° C temperatūroje ~ 60 sek. Visi užšaldyti audiniai yra laikomi atskirai plastikiniuose maišuose –80 ° C temperatūroje, kad būtų galima ilgai laikyti. Tam, kad būtų kontroliuojama aplinkos temperatūra, nerūdijančio plieno plokštelėje su sausu ledu išpjaustomi specifiniai smegenų regionai iš užšaldytų vainikinių lazdelių. Western blotting buvo atliktas, kaip aprašyta Eksperimentuokite 2.

Kohortas

Grupę sudarė 37 vyrai ir 3 moterys, kurių amžius svyravo nuo 15 – 66 metų. Visi tiriamieji mirė staiga, be užsitęsusios agoninės būsenos ar užsitęsusios medicininės ligos. Kiekvienu atveju mirties priežastį išsiaiškino Kvebeko „Coroner“ įstaiga, o audinių mėginiais buvo atliktas toksikologinis patikrinimas, siekiant gauti informacijos apie vaistus ir neteisėtą medžiagų vartojimą mirties metu. Tiriamąją grupę sudarė 20 asmenys, kurie atitiko SCID-I priklausomybės nuo kokaino kriterijus. Kontrolinę grupę sudarė 20 tiriamieji, neturintys priklausomybės nuo kokaino ir neturintys didelių psichinių diagnozių. Visi tiriamieji staiga mirė dėl priežasčių, kurios neturėjo tiesioginės įtakos smegenų audiniui. Grupės buvo derinamos pagal vidutinį tiriamojo amžių, šaldymo vėlavimą ir pH. Visiems tiriamiesiems buvo atliktos psichologinės autopsijos, kaip aprašyta anksčiau (Dumais ir kt., 2005), leidžiančią mums pasiekti išsamią informaciją apie atvejus apie psichinę ir medicininę istoriją bei kitus svarbius klinikinius ir sociodemografinius duomenis. Trumpai tariant, apmokytas pašnekovas vedė DSM-IV struktūrinis klinikinis interviu Psichikos sutrikimai (SCID-I) su vienu ar daugiau mirusiojo informatorių. Klinikų gydytojų grupė peržiūrėjo SCID-I vertinimus, atvejų ataskaitas, koronerio užrašus ir medicininius įrašus, kad gautų bendrą psichiatrinę diagnozę.

6 eksperimentas: chromatino imuninis nusėdimas žiurkėms NAc (3A – C pav)

Suaugusiems (8 savaitės) žiurkių patinams buvo skiriama 10 mg / kg kokaino arba fiziologinio tirpalo nešiklio IP vieną kartą per dieną septynias dienas. 24 val. Po paskutinės injekcijos, NAc apvalkalas ir šerdis buvo mikrodalijami. Chromatino imunoprecipitacija (ChIP) buvo atlikta sujungiant dvišalius NAc štampus iš septynių žiurkių iš kiekvienos grupės 14 grupėse (98 gyvūnai iš viso, 7 kokaino baseinai, 7 druskos tirpalai). Audiniai buvo sukryžminti, nuplauti ir laikomi –80 ° C temperatūroje iki chromatino kirpimo ultragarsu. Kirptas chromatinas buvo inkubuotas per naktį su antikūnais, anksčiau sujungtais su magnetiniais rutuliukais (Dynabeads M-280, Invitrogen). Neimmuninis IgG buvo naudojamas kaip kontrolė. Po atvirkštinio kryžminio sujungimo ir DNR gryninimo, qPCR buvo naudojamas CaMKIIα promotoriaus DNR lygiams išmatuoti. Pradmenys buvo suprojektuoti amplifikuoti regioną, kuriame yra AP-1 sutarimo seka, esanti ~ 450 bp prieš transkripcijos pradžios vietą (pirmyn: ACTGACTCAGGAAGAGGGATA; atgal: TGTGCTCCTCAGAATCCACAA).

3 pav

3 pav

CaMKIIα indukcija ląstelių tipui ir regionui ΔFosB in vivo

7 eksperimentas: CaMKII nuorašo ir baltymo ekspresijos matavimas su ląstelių tipui būdinga ΔFosB raiška (3D pav)

Pelės patinai patinai, gauti iš NSE-tTA (A eilutė) × TetOp-ΔfosB (eilutė 11) ir NSE-tTA (B eilutė) × „TetOp-FLAG-ffosB“ pelės (eilutė 11) (Chen ir kt., 1998; Kelz ir kt., 1999; Werme ir kt., 2002; Zachariou ir kt., 2006) buvo sumanytos ir iškeltos ant 100 µg / ml doksiciklino, kad būtų slopinama ressFosB raiška vystymosi metu. Paukščių draugai buvo padalinti atjunkant: pusė liko ant doksiciklino, pusė - prie vandens, o gyvūnai buvo naudojami nuo 8 iki 11 po kelių savaičių, kai ΔFosB transkripcinis poveikis buvo maksimalus (Kelz ir kt., 1999; McClung ir Nestler, 2003). Atliekant transkripcijos analizę, pelės buvo greitai pašalintos, o smegenys pašalintos ir dedamos ant ledo. NAc dalys buvo paimtos naudojant adatą 14 matuokliu ir greitai užšaldytos ant sauso ledo, kol RNR buvo išgauta. RNR išskyrimas, qPCR ir duomenų analizė buvo atlikti, kaip aprašyta anksčiau (LaPlant ir kt., 2009). Trumpai tariant, RNR buvo išskirta naudojant „TriZol“ reagentą (Invitrogen), toliau išgryninta naudojant „RNAeasy“ mikro rinkinį iš „Qiagen“ ir patikrinta, ar kokybė yra „Agilent's Bioanalyzer“. Atvirkštinė transkripcija buvo atlikta naudojant „iScript“ („BioRad“). qPCR buvo atliktas naudojant „Applied Biosystems 7900HT RT PCR“ sistemą su šiais ciklo parametrais: 10 min, esant 95 ° C; 40 ciklai 95 ° C 1 min, 60 ° C 30 sek, 72 ° C 30 sec; laipsniškas kaitinimas iki 95 ° C, kad susidarytų disociacijos kreivės, kad būtų galima patvirtinti pavienius PGR produktus. Imunohistocheminiai ΔFosB ir CaMKIIα baltymų ekspresijos tyrimai buvo atlikti, kaip aprašyta Eksperimentuokite 4.

8 eksperimentas. Intra NAc D1 ir D2 dopamino receptorių antagonistų poveikis kokaino sukeltiems baltymų pokyčiams (3H pav)

Suaugusiems (8 savaitės) žiurkių patinams buvo skiriama 10 mg / kg kokaino arba fiziologinio tirpalo („nešiklio“ grupės) tirpalo IP kartą per dieną septynias dienas. 30 min. Prieš kiekvieną kokaino injekciją žiurkėms buvo švirkščiamas arba D1 receptorių antagonistas SCH 23390 (0.5 mg / kg, „D1 Ant“ grupė), arba D2 receptorių antagonistas etiklopridas (0.5 mg / kg, „D2 Ant“ grupė). , arba fiziologinio tirpalo kontrolinė injekcija („kokaino“ grupė). 24 val. Po paskutinės injekcijos gyvūnai buvo nukenksminti ir baltymai kiekybiškai įvertinti atliekant Western blot analizę Eksperimentuokite 2.

9 eksperimentas: AAV tarpininkaujamo ΔFosB ekspresijos poveikis baltymų ekspresijai (Pav. 4 A – C)

Stereotaksinė operacija buvo atlikta suaugusiems žiurkių patinams (8 savaitės), kad būtų sušvirkšta AAV-GFP (žaliai fluorescencinis baltymas) arba AAV-GFP-ΔFosB (Maze ir kt., 2010). Visoms operacijoms buvo naudojamos 33 adatos adatos (Hamiltonas), kurių metu 0.5 µl išgryninto aukšto titro viruso buvo įšvirkščiama per 5 min., O po to dar po 5 min. Po infuzijos. Visi atstumai matuojami Bregma atžvilgiu: 10 ° kampas, AP = + 1.7 mm, Lat = 2.5 mm, DV = −6.7 mm. 14 dienas po operacijos lokomotorinių stebėjimo kamerų metu gyvūnams buvo atlikta viena 10 mg / kg kokaino injekcija į IP, kad būtų galima įvertinti ΔFosB perdėtos ekspresijos elgesį. 24 val. Po šios paskutinės injekcijos žiurkėms buvo atlikta dekapitalizacija, kaip nurodyta Eksperimentuokite 2, ir audinių mikrodalys buvo atliekamas pagal fluorescencinę mikroskopą, kad būtų gautas GFP teigiamas NAc audinys. Tada buvo atliktas Western blotting Eksperimentuokite 2.

4 pav

4 pav

ΔFosB yra būtinas ir pakankamas kokaino tarpininkaujamam D1 receptorių priklausomam CaMKIIα indukcijai NAc apvalkale

10 eksperimentas: AAV tarpininkaujamo ΔJunD per didelis ekspresijos poveikis nuo kokaino priklausomai baltymo ekspresijai (4 D – F pav)

Stereotaksinis AAV-GFP arba AAV-GFP-JJun injekcija buvo atlikta pagal Eksperimentuokite 8. 14 dienas po operacijos, gyvūnams buvo švirkščiama 10 mg / kg kokaino arba fiziologinio tirpalo nešiklio IP vieną kartą per dieną septynias dienas lokomotorių registravimo kamerose. Buvo užfiksuotas lokomotorinis atsakas į vienkartinę kokaino (5 mg / kg IP) arba fiziologinio tirpalo injekciją. 24 val. Po šios paskutinės injekcijos, žiurkės buvo nuimtos nuo dekabilizacijos, paimti audiniai ir atlikti Western blot tyrimai kaip aprašyta Eksperimentuokite 9.

Eksperimentuokite 11: In Vitro Baltymų kinazės tyrimai (5A – D pav)

Rekombinantiniai CaMKIIα ir ΔFosB buvo išvalyti iš vabzdžių ląstelių (Brickey et al., 1990; Jorissen ir kt., 2007) ir baltymų kinazės tyrimai buvo atlikti („Colbran“, „1993“), kaip aprašyta anksčiau. Trumpai tariant, CaMKII buvo iš anksto inkubuotas ant ledo su 2.5 µM ​​(arba nurodyta koncentracija) ΔFosB, 1 mM Ca2+, 40 mM Mg2+, 15 µM ​​kalmodulinas ir 200 mM HEPES pH 7.5. Fosforilinimas buvo inicijuotas pridedant 200 µM ​​ATP su [γ-32P] ATP ir leidžiama tęsti 10 min kambario temperatūroje (5A ir B pav) arba 2 min ant ledo (5C ir D pav). Produktai buvo išspręsti naudojant Western blotting (5A ir B pav) arba skaičiuojant autoradiograma ir scintiliacija (B – D pav.).

5 pav

5 pav

ΔFosB yra stiprus CaMKIIα substratas

12 eksperimentas: „Ser27 ΔFosB“ fosforilinimo identifikavimas (5E pav)

In vitro kinazės testai buvo atlikti kaip nurodyta Eksperimentuokite 11baltymai buvo atskirti SDS-PAGE, o juostos, atitinkančios ΔFosB, buvo išpjaustytos ir atliktos tandeminė masės spektrometrija. Atitinkamų jonų fragmentų m / z paskirstymas visose plokštėse yra pažymėtas jonų smailių viršuje. Ne visi fragmentų jonai yra paženklinti dėl erdvės apribojimų. Paprastai fragmentų jonų etikečių tekstas yra juodos spalvos, išskyrus tuos atvejus, kai jie tiesiogiai patvirtina ar prideda įrodymų apie dominančias fosforilinimo vietas, tokiu atveju jie pažymimi raudonai. Su stuburo suskaidymo produktų įrodymais yra parodytas fosfopeptido sekos rodmuo su aptikta fosforilinimo liekanos vieta, pažymėta raudona spalva su viena aminorūgšties raide. Skaitinis stebimų fragmentų jonų aprašymas taip pat pažymimas peptido seka kaip b ir y jonai. Kiekvieno fragmento masės spektro viršuje pažymėti mastelio koeficientai m / z ašies atkarpoms, kad būtų parodyti mažesnio intensyvumo fragmentų jonai. Fragmentų jonai, parodyti H skydelyje, patvirtina, kad yra Ser27 fosforilintos izoformos, tačiau kitų fosforilintų izoformų mišinyje Ser28, Ser31, Ser34 ir Thr37 vietose. Pa5, pa5-P, pb5 ir pb5-P jonų buvimas vienareikšmiškai patvirtina Ser27 liekanos fosforilinimą.

13 eksperimentas: Ser27 fosforilinimo kiekybinis įvertinimas (5F pav)

Buvo sukurti standartiniai peptidai, imituojantys Ser27 ΔFosB fosforines ir nefosforines formas. Po sintezės ir gryninimo kiekvienas „sunkusis“ idiotipinis peptidas buvo ištirpintas 50 / 50 acetonitrilo / vandens buferyje ir nusiųstas aminorūgščių analizei, siekiant nustatyti absoliučią sintetinio peptido pradinio tirpalo koncentraciją. Tada kiekvienas „sunkusis“ peptidas buvo tiesiogiai infuzuotas į 4000 QTRAP masės spektrometrą (MS), siekiant nustatyti geriausią susidūrimo energiją MS / MS suskaidymui ir nuo dviejų iki keturių MRM perėjimų. Po to tvarkingi „sunkieji“ peptidai buvo tiriami LCMS 4000 QTRAP, kad būtų užtikrintas peptidų atskyrimas. Priemonė buvo paleista trigubo kvadrupolio režimu, kai Q1 buvo nustatyta pagal konkretaus pirmtako m / z reikšmę (Q1 nenuskaitoma), o Q3 nustatyta į konkrečią m / z reikšmę, atitinkančią konkretų to peptido fragmentą. MRM režimu paeiliui buvo matuojama keletas pavienių reakcijų (pirmtakų / fragmentų jonų perėjimai, kai susidūrimo energija sureguliuota taip, kad būtų optimizuotas įdomių fragmentų jonų intensyvumas), o ciklas (paprastai 1 – 2 sek.) visą HPLC atskyrimo laiką. MRM perėjimai buvo nustatyti pagal esamų peptidų MS / MS spektrus. Tada buvo pasirinkti du peptido perėjimai, atitinkantys didelio intensyvumo fragmentų jonus, ir susidūrimo energija optimizuota, siekiant maksimaliai padidinti MRM perėjimų signalo stiprumą, naudojant automatizavimo programinę įrangą. Po to, palyginti su standartiniais peptidais ir ΔFosB mėginiais, paveiktais CaMKII ar kontrole, gautos smailės buvo palygintos, siekiant nustatyti absoliučią kiekvienos peptido formos gausą reakcijoje. LC-MRM duomenų duomenų analizė atliekama naudojant „AB Multiquant 1.1“ programinę įrangą.

14 eksperimentas: ΔFosB indukcija pelėms, ekspresuojančioms CaMKII5G ir H pav)

Transgeninės pelės, per daug ekspresuojančios T286D CaMKII (Mayford ir kt., 1996; Kourrich ir kt., 2012) ir laukinio tipo pakratai buvo išauginti, nesant doksiciklino, kad būtų galima ekspresuoti transgeną. Suaugusioms pelėms buvo skiriama 20 mg / kg kokaino arba fiziologinio tirpalo IP kartą per parą 14 dienomis. 24 val. Po paskutinės injekcijos gyvūnai buvo nukenksminti ir imunohistochemija bei ΔFosB ekspresijos kiekybinis įvertinimas buvo atlikti taip, kaip Eksperimentuokite 4.

15 eksperimentas: HSV tarpininkaujamo ΔFosB ekspresijos ir CaMKII slopinimo poveikis NAc dendritiniams stuburokams (6A – E pav)

Suaugusiems pelių patinams (8 savaitės) stereotaksiniu būdu buvo švirkščiama NAc su HSV-GFP, HSV-GFP-ΔFosB (Olausson ir kt., 2006), HSV-GFPAC3I arba HSV-GFPAC3I-AFosB. Šiose konstrukcijose AC3I, peptidais pagrįstas CaMKII aktyvumo inhibitorius, yra sujungtas su GFP C galu. GFPAC3I buvo klonuota PGR naudojant pMM400-vektorių, kuriame yra GFPAC3I kaip šablonas su šių gruntų: GFPAC3I-F: 5 "CC GCTAGC GCCGCCACC ATGGTGAGCAAGGGCGAGGAGCTGT 3" (clampNheIKozakmet); „GFP-AC3I-R“: 5 „CC TCCGGA TTACAGGCAGTCCACGGCCT 3“ („clampBspEIstop“). Gautas PGR produktas buvo įterptas į p1005 + ir p1005 + -Δ FosB vektorius, naudojant NheI ir BspEI vietas. Konstruktas buvo patvirtintas sekvenavimu. Stereotaksinės koordinatės buvo: 10 ° kampas, AP = + 1.6 mm, Lat = + 1.5 mm, DV = –4.4 mm (Barrot et al., 2002). Buvo atlikta perfuzija ir smegenų pjūviai Eksperimentuokite 4.

Stuburo analizė buvo atlikta kaip aprašyta (Christoffel ir kt., 2011). Trumpai tariant, dendritiniai segmentai 50 – 150 µm atstumu nuo somos buvo atsitiktinai parinkti iš HSV infekuotų ląstelių, kurios ekspresuoja GFP. Vaizdai buvo gauti naudojant konfokalinį LSM 710 (Carl Zeiss) morfologinei analizei, naudojant NeuronStudio su rayburst algoritmu. „NeuronStudio“ klasifikuoja stuburus kaip plonus, grybo ar stuburinius pagal šias vertes: (1) kraštinių santykis, (2) galvos ir kaklo santykis ir (3) galvos skersmuo. Stuburėliai su kaklu gali būti klasifikuojami kaip ploni arba grybeliniai, o tie, kurie neturi reikšmingo kaklo, klasifikuojami kaip sustingę. Stuburėliai su kaklu žymimi kaip ploni arba grybai, atsižvelgiant į galvos skersmenį.

6 pav

6 pav

CaMKII aktyvumo blokada apsaugo nuo ΔFosB morfologinio ir elgesio poveikio NAc

16 eksperimentas: HSV tarpininkaujamo ΔFosB ekspresijos ir CaMKII slopinimo poveikis kokaino reakcijoms (6F pav)

Suaugusiems pelių patinėliams buvo suleista virusų Eksperimentuokite 15ir lokomotoriniai atsakai į vienkartinę 5 mg / kg kokaino injekciją buvo matuojami kaip nurodyta Eksperimentuokite 9. Lokomotoriniai duomenys išreiškiami kaip bendras spindulio pertraukimas per 30 min po kokaino injekcijos.

Papildoma informacija

Gyvūnų laikymas

Patinų Sprague Dawley žiurkės (250 – 275 g; Charles River Laboratories) buvo laikomos porose. Aštuonių savaičių amžiaus C57BL / 6J patinėliai (Džeksono laboratorijoje) buvo laikomi grupėje, ne daugiau kaip penki gyvūnai viename narve. Visi gyvūnai buvo pripratę prie gyvūnų laikymo vietos ≥1 savaitę prieš eksperimentines manipuliacijas ir laikomi klimato kontroliuojamose patalpose (23 – 25 ° C) per 12 valandos šviesos / tamsos ciklą (lemputės dega 7: 00 AM) su galimybe gauti maisto. ir vanduo ad libitum. Eksperimentai buvo atlikti vadovaujantis Neuromokslų draugijos ir institucinio gyvūnų priežiūros ir naudojimo komiteto (IACUC) gairėmis Sinajaus kalne.

Narkotikai

Vaistams buvo skiriama IP ir ištirpinama steriliame fiziologiniame tirpale, įskaitant kokainą (5 – 20 mg / kg per 10 µl pelėms, po 1 ml žiurkėms, NIDA) ir SCH 23390 arba etikloprido hidrochloridą (0.5 mg / kg vienam 1 ml, Tocris). . Stereotaksinės operacijos metu pelės buvo anestezuojamos steriliame fiziologiniame tirpale ketamino (100 mg / kg) ir ksilazino (10 mg / kg) (Henry Schein) „kokteiliu“.

Antikūnai

„CaMKIIα“ (iš viso): Upstate 05 – 532, 1: 5,000

„CaMKII“ fosfo-Thr286: „Promega V111A“, „1“: 1,000

ΔFosB (iš viso): ląstelių signalizavimas 5G4, 1: 250

ΔFosB fosfo-Ser27: fosfos tirpalai, 1: 500

„GluA1“ (iš viso): „Abcam“, „Ab31232“, „1“: „1,000“

„GluA1“ fosfo-Ser831: Millipore N453, 1: 1,000

„GluA1“ fosfo-Ser845: „Chemicon Ab5849“, 1: 2,000

„GluA2“: „Millipore 07 – 598“, „1“: 2,000

NR2A: Sigma HPA004692, 1: 2,500

NR2B: Millipore Ab1557P, 1: 1,000

Statistinė analizė

Visos statistinės analizės buvo atliktos naudojant „Prism 6“ programinės įrangos paketą (GraphPad). Studentų t-testai buvo naudojami visiems porų palyginimams (nurodyti Rezultatuose, kur nurodoma t vertė), o visiems kryptiniams palyginimams buvo naudojami vienpusiai ANOVA (nurodyti rezultatų skiltyje, kur pateikiama F vertė).

Eiti į:

rezultatai

Lėtinis kokainas sukelia CaMKII „NAc“ apvalkale

Daugybė tyrimų parodė, kad NAN apvalkalo ir šerdies MSN biocheminiai ir fiziologiniai atsakai į lėtinį piktnaudžiavimo narkotikų poveikį skiriasi (Kourrichas ir Tomas, 2009; Loweth ir kt., 2010) ir kad abu subregionai skirtingai reguliuoja elgesį su narkotikais (Ito ir kt., 2004). Nustatyti skirtingą kokaino poveikį baltymo NAc apvalkalo sudedamosioms dalims vs branduolys, mes panaudojome daugybinį izobinį žymėjimą (iTRAQ) ir tandeminę masių spektroskopiją (MS / MS). Suaugusiems žiurkių patinams kasdien buvo švirkščiama kokaino (20 mg / kg) arba fiziologinio tirpalo per dieną 7; 24 val. Po paskutinės injekcijos, NAc apvalkalas ir šerdis buvo mikrodalijami (1A pav) ir blykste užšaldyta. Tuomet šių mėginių baltymai buvo kiekybiškai įvertinti naudojant iTRAQ. Visų keturių CaMKII izoformų ekspresija padidėjo po gydymo kokainu, būdingų NAc apvalkalui, palyginti su šerdimi. Keletas baltymų fosfatazių, įskaitant PP1 katalizinį ir reguliavimo subvienetus ir PP2A, kurios anksčiau buvo susietos su įvairiais CaMKII substratais kitose sistemose („Colbran“, „2004“), laikėsi panašaus modelio. Šie duomenys pateikė naujų, nešališkų įrodymų, kad CaMKII signalizacijos kelią aiškiai nustato NAc kokainas, naudodamas lukštą.

Norėdami kiekybiškai patvirtinti šį atradimą, mes kaip anksčiau aprašytą žiurkę gydėme kokainu (skirtingomis dozėmis) arba fiziologiniu tirpalu ir išmatuojome lokomotorinę reakciją į kokaino (5 mg / kg) arba fiziologinio tirpalo dozę. Pakartotinis 10 mg / kg kokaino poveikis davė tipišką lokomotorinio sensibilizacijos modelį (1B pav). Tolesni šios dozavimo schemos tyrimai parodė, kad naudojant Western blot, kad pakartotinis kokainas po paskutinės kokaino injekcijos selektyviai sukelia CaMKIIα NAc apvalkalo 24 val.1C ir D pav; p = 0.0019; F = 7.943; df = 29). Be to, AMPA receptoriaus GluA831 subvieneto kanoninio CaMKII substrato Ser1 fosforilinimas žymiai padidėjo NAc apvalkale, o ne šerdyje (p = 0.0261; F = 4.208; df = 28), tuo tarpu CaMKIIα Thr286 autofosforilinimas neturėjo stipraus, bet reikšminga tendencija, kad indukcija vykdoma tik apvalkale (1D pav). Keli kiti glutamato receptoriai nebuvo paveikti. Skirtingai nuo šių CaMKII matavimų, tuose pačiuose audinių mėginiuose buvo ΔFosB indukcija NAc apvalkale (p = 0.0260; F = 4.189; df = 29) ir šerdyje (p = 0.0350; F = 3.807; df = 29). (1C ir D pav), suderinamas su ankstesnėmis išvadomis (Perrotti ir kt., 2008).

Kadangi keliuose ankstesniuose AMPA receptorių kokaino reguliavimo reguliavimo tyrimuose buvo analizuojami gyvūnai po ~ 14 dienų nuo lėtinio kokaino vartojimo (žr. Diskusiją), mes pakartojome šias biochemines analizes šiuo metu. Mes nustatėme, kad 14 dienomis po paskutinės kokaino injekcijos ΔFosB išlieka padidėjęs NAc (p = 0.0288; F = 4.258; df = 22), tuo tarpu nei CaMKII, nei GluA1 Ser831 fosforilinimas nepadidėjo (1E pav). Tačiau 1 valanda po vienkartinės 10 mg / kg kokaino dozės, bendro CaMKII (p = 0.0330; F = 3.947; df = 26) ir „GluA1 Ser831“ (p = 0.0213; F = 4.509; df = 27) lygio. fosforilinimas yra padidėjęs tiek, kiek panašus į po pradinio lėtinio kokaino poveikio (1E pav). Šie duomenys rodo, kad NAc apvalkalo neuronai yra paruošiami CaMKII indukcijai ilgesnį abstinencijos periodą, galbūt tiesiogiai pradėjus CaMKII geno promotorių (žr. Diskusiją). Be to, faktas, kad ΔFosB indukcija yra patvaresnė nei CaMKII indukcija, rodo, kad yra papildomų mechanizmų, pagrįstų chromatinu ar kitokiais, kurie „stabdo“ CaMKII reguliavimą, kaip aptarta diskusijoje.

Norėdami dar labiau sustiprinti šiuos pastebėjimus, mes ištyrėme kokaino savaiminio vartojimo modelius, kurie apima savanorišką narkotikų vartojimą. Suaugusiems žiurkių patinams buvo suteikta trumpalaikė arba ilga prieiga prie kokaino; kaip tikėtasi (Ahmed ir Koob, 1998), tik ilgos prieigos sąlygos paskatino padidėjusį savarankišką vaisto vartojimą (2A pav). ΔFosB buvo indukuojamas ilgą laiką vs trumpas priėjimas prie kokaino tiek NAc apvalkale (p = 0.0011; F = 11.12; df = 17), tiek šerdyje (p = 0.0004; F = 13.86; df = 17). Priešingai, CaMKIIα sukėlė NAc apvalkalą tik dėl ilgo kokaino vartojimo (2B ir C pav; p = 0.0236; F = 4.957; df = 16). Įdomu palyginti vidutinį paros kokaino suvartojimą trumpai prieinamiems gyvūnams (~ 12 mg / kg IV), ilgą prieigą turintiems gyvūnams (~ 70 mg / kg IV) ir eksperimentams skirtiems gyvūnams (10 mg / kg) ir paklauskite, kodėl pastarasis sukelia tvirtą ΔFosB ir CaMKII indukciją, tuo tarpu trumpalaikė prieiga to nedaro. Šis neatitikimas greičiausiai atsiranda dėl didžiausio kokaino lygio skirtumų (eksperimentuotojo vartojamas kokainas skiriamas kaip viena boliusinė IP, tuo tarpu savarankiškai vartojamas kokainas tiekiamas keliomis IV dozėmis) arba dėl skirtingo narkotikų poveikio ilgio (7 dienos eksperimentuotojui) vartojimas, 19 dienos savarankiškam vartojimui).

Nepaisant gausios literatūros apie ΔFosB ir CaMKII poveikį kokainui, šių baltymų tyrimų su kokaino vartotojais nėra. Pateikiame pirmuosius įrodymus, kad tiek nuo ΔFosB (p = 0.0316; t = 1.921; df = 34), tiek dėl CaMKII (p = 0.0444; t = 1.755; df = 32) padidėja nuo kokaino priklausomų žmonių NAc (2D pav, Lentelė 1). Šie duomenys rodo, kad mūsų atliktas tyrimas dėl ΔFosB ir CaMKII kokaino indukcijos graužikams NAc yra kliniškai svarbus priklausomybei nuo kokaino.

Lentelė 1

Lentelė 1

Žmonių kokaino narkomanų mėginių apibūdinimas ir suderinta kontrolinė grupė

ΔFosB selektyviai reguliuoja CaMKII transkripciją NAc apvalkalo D1 tipo MSN.

Išvados, kad tiek graužikų NAc, tiek kokainas padidina CaMKII ir ΔFosB, leido mums nustatyti, ar ΔFosB gali reguliuoti CaMKII geno transkripciją. Anksčiau pranešėme, kad CaMKIIα yra galimas ΔFosB taikinys atliekant nešališką NAc mikro matricos analizę (McClung ir Nestler, 2003), tačiau tame tyrime ši išvada nebuvo labiau patvirtinta. Pirmiausia mes panaudojome kiekybinį ChIP (qChIP – ChIP, o po to kiekybinį PGR), norėdami nustatyti, ar ΔFosB jungiasi su CaMKIIα geno promotoriumi suaugusių žiurkių patinų NAc, ir stebėtinai pastebėjome, kad šis surišimas žymiai padidėja dėl lėtinio kokaino vartojimo apvalkale ( p = 0.0133; t = 2.901; df = 12), bet ne pagrindinis, paregionis (3A pav). Norėdami išsamiau suprasti mechanizmus, susijusius su šiuo specifiniu subregiono skirtumu ΔFosB prisijungime prie CaMKIIα promotoriaus, mes panaudojome qChIP, kad apibūdintume histono modifikacijų būseną šiame genomo regione. Ankstesni tyrimai parodė, kad kokainas sukelia H3 acetilinimą CaMKIIα promotoriuje, esant bendrajam pelių NAc (Wang et al., 2010). Priešingai, mes nustatėme, kad kokainas sumažina H3 acetiliaciją CaMKIIα promotoriuje selektyviai NAc šerdyje (3B pav; p = 0.0213; t = 2.726; df = 10), nematant jokių apvalkalo pokyčių, atitinkančių subregionui būdingus chromatino pakitimus, nesusijusius su ΔFosB. qChIP už represinį ženklą, dimetilintą H3 liziną 9 (H3K9me2), atskleidė mažėjimo tendencijas tiek apvalkalo, tiek pagrindiniuose subregionuose (3C pav).

Norėdami nustatyti, ar ΔFosB reguliuoja CaMKIIα transkripciją in vivo, mes panaudojome dvi bitransgenines pelių linijas, kurios induktyviai per daug išreiškia ΔFosB, ypač D1 vs D2 tipo MSN tokiu būdu, kontroliuojamu doksiciklino vartojimo geriamajame vandenyje (Chen ir kt., 1998; Kelz ir kt., 1999; Werme ir kt., 2002). Suaugusiems pelių patinams, kurie ekspresuoja ΔFosB tik D1 tipo MSN, reikšmingai padidėjo CaMKIIα mRNR kiekis NAc (p = 0.0337; t = 1.996; df = 13). Poveikio nepastebėta pelėms, kurios ekspresuoja ΔFosB daugiausia (D2 tipo MSN) (daugiausia DXNUMX tipo MSN).3D pav). CaMKIIα mRNR padidėjimas, sukeltas ΔFosB ekspresijos D1 tipo MSN, lydėjo tuo pačiu metu CaMKIIα baltymo padidėjimo tiek NAc apvalkalo (p = 0.0030; t = 3.578; df = 14), tiek šerdies (p = 0.0392; t). = 2.275; df = 14; 3E ir F pav). Šie duomenys rodo, kad ΔFosB gali skatinti CaMKIIα geno ekspresiją D1 tipo MSN abiejuose subregionuose, nors Pav. 3B rodo, kad kokaino sukeliami chromatino pokyčiai CaMKIIα promotoriuje (pvz., sumažėjęs acetilinimas) neleidžia ΔFosB sureguliuoti CaMKII pagrindiniame subregione po kokaino.

Kadangi mūsų transgeninių pelių duomenys parodė, kad CaMKII geno ekspresijos ΔFosB indukcija yra būdinga D1 tipo MSN NAc, toliau siekėme nustatyti, ar nuo kokaino priklausomas CaMKII reguliavimas reikalauja D1 dopamino receptoriaus suaktyvinimo. Suaugusioms žiurkių patinoms buvo skiriamas lėtinis kokainas arba fiziologinis tirpalas, kaip ir anksčiau, tačiau 30 minučių prieš kiekvieną injekciją kokaino grupės žiurkėms buvo suleista fiziologinio tirpalo, D1 antagonisto SCH 23390 (0.5 mg / kg) arba D2 receptorių antagonisto etikloprido. (0.5 mg / kg). Gyvūnai buvo analizuojami praėjus 24 valandoms po paskutinės kokaino injekcijos. Western blot'as parodė, kad D1, bet ne D2, antagonistas visiškai blokavo kokaino sukeltą ΔFosB padidėjimą (p <0.0001; F = 18.96; df = 18), kaip buvo pranešta anksčiauNye ir kt., 1995), taip pat CaMKII (p = 0.0005; F = 10.99; df = 18; 3G ir H pav). Šie duomenys patvirtina hipotezę, kad kokainas sukelia ΔFosB tarpininkaujamą CaMKII geno ekspresijos padidėjimą, ypač NAc apvalkalo D1 tipo MSN. Būsimuose tyrimuose būtų svarbu tiesiogiai parodyti šį specifinį ląstelienos kokaino poveikį CaMKII ekspresijai šioje smegenų srityje.

ΔFosB yra reikalingas ir pakankamas CaMKII indukcijai kokainu NAc apvalkale.

Norėdami papildyti bitransgeninių pelių naudojimą, mes toliau tyrėme ΔFosB vaidmenį tarpininkaujant kokaino indukcijai CaMKIIα, naudojant viruso sukeltą genų perdavimą žiurkėms. Mes abipusiai suleidome adeno-viruso (AAV) daleles į suaugusių žiurkių patinų NAc apvalkalą (kur apvalkalas gali būti selektyviai nukreiptas), kad būtų ekspresuojamas ΔFosB ir GFP arba GFP. Tada gyvūnams buvo sušvirkšta vienkartinė 10 mg / kg kokaino IP. Gyvūnams, kurie per daug ekspresuoja ΔFosB / GFP, pasireiškė padidėjęs lokomotorinis atsakas, palyginti su gyvūnais, kurie per daug ekspresuoja GFP (4A pav). 24 val. Po vienkartinės kokaino injekcijos iš šių gyvūnų buvo pašalintas GFP teigiamas NAc audinys, išpjaustant jį fluorescenciniu šviesos šaltiniu. Šio audinio Vakarų pūtimas (4B ir C pav) parodė stiprią ΔFosB per didelę ekspresiją, taip pat reikšmingą bendro CaMKIIα baltymo padidėjimą, palyginti su GFP gyvūnais (p = 0.0070; t = 2.894; df = 30), panašiai kaip indukcija, pastebėta vartojant lėtinį kokainą. Be to, CaMKIIα autofosforilinimas Thr286 (rodantis fermento aktyvaciją) padidėjo ΔFosB perdėta ekspresija (p = 0.0330; t = 2.243; df = 28), kaip ir fosforilinimas CaMKII substrato, Ser831 iš GluA1; 0.0540; df = 2.012), vėl imituodamas lėtinio kokaino (1C ir D pav). TVisi šie duomenys pateikia papildomą įrodymą, kad ΔFosB ekspresija NAc apvalkale yra pakankama, kad būtų padidinta lokomotorinė sensibilizacija kokainui ir CaMKII indukcija ir aktyvacija šiame subregione.

Mes taikėme panašų metodą, kad nustatytume, ar ΔFosB taip pat yra būtinas kokaino sukeltam CaMKIIα indukcijai NAc apvalkale. AAV buvo naudojamas apipjaustyto JunD baltymo, vadinamo ΔJunD, ekspresijai, kuris yra neigiamas ΔFosB transkripcijos aktyvacijos reguliatorius (Winstanley ir kt., 2007) plius GFP arba GFP. Po dviejų savaičių, kai transgeno ekspresija yra maksimali, gyvūnams buvo skiriama kokaino (10 mg / kg) arba fiziologinio tirpalo kasdien 7 dienas ir jie buvo tiriami dėl lokomotorinių reakcijų į kokaino poveikį (5 mg / kg) 24 val. Po paskutinės lėtinės injekcijos (4D pav). Dėl ΔJunD perdėtos ekspozicijos buvo išvengta lokomotorinio sensibilizacijos kokainui, taip pat užkirstas kelias CaMKIIα indukcijai ir aktyvacijai NAc apvalkale (4E ir F pav; p = 0.0437; F = 2.997; bendras df = 38), rodantis, kad ΔFosB transkripcijos aktyvumas yra būtinas kokaino sukeltam CaMKIIα indukcijai šiame subregione. Įdomu tai, kad mes nustatėme, kad ΔJunD sumažino ΔFosB lygį tiek fiziologiniu tirpalu, tiek kokainu gydomomis sąlygomis (p = 0.0004; F = 8.110; df = 35), iškeldami naują galimybę, kad ΔFosB priklauso nuo AP-1 aktyvumo savo išraiškos lygiams.

„CaMKII“ fosforilina ΔFosB „Ser27“

Naudojant in vitro baltymų kinazės tyrimais, mes nustatėme, kad išgrynintas ΔFosB yra tvirtas CaMKIIα substratas. Jo inkubacija6-ΔFosB su CaMKIIα ir ATP sukėlė ΔFosB elektroforezinio judrumo poslinkį į viršų (5A pav); kelios gautos juostos pasiūlė kelias fosforilinimo vietas. Panašus in vitro kinazės tyrimai naudojant [γ-32P] ATP parodė radioaktyviai paženklinto fosfato įsiskverbimą į paslinktas ΔFosB juostas (5B pav), demonstruodamas tiesioginį baltymo fosforilinimą. Mes sukūrėme fosfo-specifinį antikūną prieš anksčiau apibūdintą ΔFosB Ser27 (Ulery ir kt., 2006). Nors šis antikūnas nesukuria signalo prieš smegenų ekstraktus, kuriuose yra Ser27 fosforilinto ΔFosB (duomenys nepateikti), mes sugebėjome nustatyti Ser27 fosforilinimą in vitro kinazės tyrimas naudojant CaMKII (5B pav). Kinetinės ΔFosB CaMKII fosforilinimo analizės rodo, kad tai yra stiprus kinazės substratas (5C pav), su tariamu KM 5.7 ± 2.0µM ir KKATĖ 2.3 ± 0.3min-1. Šie rezultatai yra palyginami su daugeliu gerai apibūdintų in vivo CaMKII substratai („Colbran and Brown“, „2004“). Be to, mes nustatėme, kad CaMKII fosforilina ΔFosB, esant stechiometrijai 2.27 ± 0.07 mol / mol (5D pav), nurodant, kad His yra bent trys CaMKII fosforilinimo vietos6-AFosB baltymas, suderintas su 5A pav.

Norėdami ištirti atskiras fosforilinimo vietas, atlikome MS mėginius iš mūsų in vitro kinazės tyrimai. 5E pav demonstruoja ΔFosB fosforilinimą anksčiau apibūdintame Ser27 ir keliose papildomose vietose (duomenys nepateikti). Atsižvelgdami į ankstesnį „Ser27“ funkcinį apibūdinimą, mes sutelkėme dėmesį į šią svetainę kurdami paženklintus sintetinius peptidus, imituojančius „Ser27“ fosforines ir nefosforines būsenas, tada panaudojome žinomus šių peptidų kiekius kaip standartus MRM analizėje ΔFosB prieš ir po in vitro fosforilinimas CaMKII. Tolesnis kiekybinis nustatymas (5F pav) patvirtina, kad Ser27 yra stiprus CaMKII substratas. Šie rezultatai rodo, kad tarp daugybės fosforilintų liekanų, esančių ΔFosB, Ser27 yra ypač efektyvus CaMKII substratas.

„CaMKII“ tarpininkauja kokainui kaupiant ΔFosB „NAc“ apvalkale

Kadangi CaMKII gali fosforilinti ΔFosB in vitro toje vietoje, kuri žymiai padidina jo stabilumą in vitro ir in vivo (Ulery ir kt., 2006; Ulery-Reynolds ir kt., 2009), nustatėme, ar CaMKII aktyvumas kontroliuoja ΔFosB lygį NAc in vivo. Norėdami išspręsti šį klausimą, pirmiausia panaudojome pelių liniją, perrašančią nuo kalcio nepriklausomą CaMKIIα (T286D) mutantą keliuose smegenų regionuose, įskaitant NAc (Mayford ir kt., 1996; Kourrich ir kt., 2012). Kartą per dieną 20 dienomis mes švirkšdavome amžių atitinkančius suaugusių vyrų mutantus ir laukinio tipo pakratus 14 mg / kg kokaino ar fiziologinio tirpalo, tada vieną dieną po paskutinės injekcijos gyvūnus išanalizavome. Mes nustatėme, kad NAc apvalkalo mutantų gyvūnams padidėjo bazinis ΔFosB lygis (p = 0.0001; F = 9.207; df = 37), bet nebuvo šerdies (5G ir H pav). Keista, bet nuo kokaino priklausoma ΔFosB indukcija buvo blokuojama gyvūnų, turinčių mutantą, apvalkale ir šerdyje. Tai rodo, kad nors CaMKII gali tiesiogiai reguliuoti ΔFosB stabilumą NAc apvalkale, jis taip pat gali būti priešais ΔFosB kokaino aktyvuotuose keliuose abiejuose NAc subregionuose. .

CaMKII aktyvumas reikalingas ΔFosB tarpininkaujant struktūriniam ir elgesio plastiškumui

Kokaino sukeliamos dendritinės sruogos NAc MSN yra viena iš geriausiai žinomų narkotikų sukeltų adaptacijų šiame smegenų regione, o tokia stuburo indukcija buvo koreliuojama su jautriomis elgesio reakcijomis į vaistą (Robinson ir Kolb, 2004; Russo ir kt., 2010) ir pranešama, kad jie yra selektyvūs D1 tipo MSN (Lee ir kt., 2006). Neseniai parodėme, kad kokaino dendritinių stuburo sukėlimas NAc yra priklausomas nuo FosB ir jo pasrovės transkripcijos programos (Maze ir kt., 2010). Nors yra daugybė literatūros apie CaMKII dalyvavimą dendritinės stuburo dalies morfologijoje ir indukciją kituose smegenų regionuose ir eksperimentinėse sistemose (Jourdain ir kt., 2003; Penzes ir kt., 2008; Okamoto ir kt., 2009), jo vaidmuo NAc MSN stuburo formavime nebuvo ištirtas. Todėl mes nustatėme, ar CaMKII aktyvumas reikalingas ΔFosB sukeltam MSN dendritinių stuburo indukcijai, panaudodamas HSV tarpininkaujamą CaMKII inhibitoriaus peptido AC3I, sujungto su GFP, ekspresiją, konstruktą, kuris anksčiau buvo slopinamas CaMKII aktyvumas. in vivo (Zhang ir kt., 2005; Klug ir kt., 2012). Virusinė ΔFosB ekspresija suaugusių pelių NAc apvalkale sukėlė reikšmingą MSN dendritinio stuburo tankio padidėjimą (p <0.0001; F = 8.558; df = 59; 6A ir B pav), kaip buvo pranešta anksčiau (Maze ir kt., 2010), o šį padidėjimą pirmiausia lėmė ploni (p = 0.0027; F = 5.319; df = 59) ir užsispyrę (p = 0.0378; F = 2.988; df = 59) stuburo tipai (abu laikomi nesubrendusiais stuburo slanksteliais) (Pav. 6C – E). Brandesniems, grybo formos spygliams jokio poveikio nepastebėta. Tačiau kai GFP-AC3I buvo ekspresuojamas kartu, stuburo ΔFosB indukcija buvo visiškai panaikinta (6A – E pav), nurodant, kad CaMKII aktyvumas reikalingas ΔFosB indukcijai dendritiniams spygliams NAc apvalkale.

Tada mes panaudojome tuos pačius virusinius įrankius, kad nustatytume, ar reikalingas CaMKII aktyvumas ΔFosB poveikiui elgesio jautrumui kokainui. 72 val. Po viruso injekcijos į NAc apvalkalą gyvūnams buvo sušvirkšta vienkartinė 5 mg / kg kokaino dozė ir užfiksuotas jų lokomotorinis aktyvumas. Kaip parodyta anksčiau, labiau išplėtus AAV ekspresiją FFosB (4A pav), Dėl HSV sukelto perdėto ofFosB ekspresijos padidėjo lokomotorinis jautrumas kokainui (p = 0.0002; F = 8.823; df = 37; 6F pav). Kaip ir dendritinių stuburo indukcijos atveju, CaMKII aktyvumo slopinimas kartu ekspresuojant GFP-AC3I visiškai blokavo ΔFosB sąlygojamą kokaino jautrumo padidėjimą, tai rodo, kad CaMKII aktyvumas reikalingas ΔFosB sukeltiems kokaino elgesio pokyčiams.

Eiti į:

Diskusija

Šis tyrimas nusako naują persiuntimo į priekį mechanizmą, kai kokainas NAc sukelia ΔFosB, kuris selektyviai padidina CaMKIIα geno transkripciją NAc apvalkale. Vėliau CaMKIIα fosforiluojasi ir stabilizuoja ΔFosB, sukeldamas didesnį ΔFosB kaupimąsi ir tolesnį CaMKIIα indukciją (Pav. 6G). Dviejų baltymų koncentracijos padidėjimas lėtinio kokaino poveikio metu iš esmės prisideda prie sensibilizuoto elgesio reakcijos į vaistą. Tai ypač patraukli hipotezė, nes anksčiau buvo įrodyta, kad tiek ΔFosB, tiek CaMKII reikalingi padidėjusiam elgesio reakcijai į kokainą. (Pierce ir kt., 1998; Peakman ir kt., 2003), ir mes pakartojame šį radinį ΔFosB NAc apvalkale, naudodami virusinį metodą (Fig. 4 ir And66).

Nors transgeninė ΔFosB ekspresija D1 tipo MSN gali paskatinti CaMKII indukciją tiek su NAc apvalkalu, tiek su kokainu anksčiau negydytų gyvūnų šerdyje, kokaino kontekste endogeninio ΔFosB kaupimasis, vykstantis abiejuose subregionuose, skatina CaMKII indukciją būtent NAc apvalkale. . Šis skirtumas gali būti susijęs su aukštesniais ΔFosB lygiais, sukeltais mūsų bitransgeniniame modelyje, tačiau tai taip pat gali atspindėti kokaino sugebėjimą diferencijuotai pakeisti CaMKIIα promotorių apvalkale vs pagrindiniai MSN, kad skatintų ΔFosB jungimąsi pirmajame, arba pašalintų jį antrajame subregione. Tiesą sakant, mūsų ChIP duomenys, kurie atskleidžia kokaino sukeltą histonų deacetilinimą CaMKIIα geno promotoriuje tik NAc šerdyje, patvirtina galimą chromatino mechanizmo įsitraukimą. Laikantis šios hipotezės, DFNBX tipo MSN ekspresija ΔFosB galėjo paskatinti CaMKIIα indukciją NAc šerdyje, jei nebuvo kokaino (3F pav), leidžia daryti prielaidą, kad yra aktyvių CaMKIIα promotoriaus modifikacijų, kurios užkerta kelią šiai indukcijai lėtinio kokaino poveikio metu. Chromatino kraštovaizdžio reguliavimas CaMKII promotoriuje taip pat galėtų paaiškinti, kodėl CaMKII sukelia sąlyginė kokaino dozė lėtinio kokaino vartojimo nutraukiančių žiurkių NAc apvalkale (1E pav), bet ne nuo narkotikų negydytų gyvūnų (1D pav). Tai gali parodyti epigenetinį geneFosB „genų pradą“ (Robisonas ir Nestleris, 2011) ir tokiu būdu galėtų būti vienas iš kokaino potraukio inkubacijos molekulių (Pickens ir kt., 2011). Tačiau tam, kad šis chromatino pokytis būtų priežastiniu ryšiu susijęs su potraukio inkubavimu, laikui bėgant jis turėtų padidėti. Bus įdomu išsiaiškinti, ar taip yra, ir ištirti, ar kiti genai rodo kokaino reguliavimą nuo ΔFosB priklausomo, subregiono specifinio. Taip pat svarbu atkreipti dėmesį į tai, kad mūsų aprašyta tiekimo linija nesudaro begalinio CaMKII ar ΔFosB kaupimosi (1E pav); atidaryti už tai atsakingą molekulinį „stabdį“ yra svarbus būsimų tyrimų tikslas.

Žinomos ΔFosB ir CaMKII funkcijos keliose eksperimentinėse sistemose ir smegenų regionuose susilieja įvairiais lygiais (6F pav). Abi molekulės yra glaudžiai susijusios su dendritiniu stuburo augimu: CaMKII sąveikauja su aktino citoskeletu (Okamoto ir kt., 2009), reguliuoja stuburo galvos dydį (Matsuzaki ir kt., 2004), ir yra būtinas, ir pakankamas plastikumo sukeltam filopodijos ir sinapsių skaičiaus padidėjimui hipokampo organotipinių pjūvių kultūrose (Jourdain ir kt., 2003), while ΔFosB yra ir būtinas, ir pakankamas kokaino sukeltam dendritiniam stuburo formavimui NAc MSN (Maze ir kt., 2010). Be to, abi molekulės buvo susijusios su AMPA gliutamato receptorių reguliavimu. CaMKII nereglamentuoja bendro AMPA receptorių subvienetų lygio, tačiau skatina AMPA receptorių įterpimą į sinapses ir padidina AMPA kanalo laidumą fosforilindamas GluA1 „Ser831“ hipokampinio piramidiniuose neuronuose kultūroje ir in vivo (peržiūrėta (Malinow ir Malenka, 2002; „Colbran and Brown“, „2004“)). Toks padidėjęs GluA1 vartojimas sinapsėms taip pat susijęs su lėtiniu kokaino veikimu (Boudreau ir Wolf, 2005). Be to, elgesio reakcijas į AMPA receptorių aktyvavimą NAc sustiprina CaMKIIα per didelis ekspresija priklausomai nuo D1 dopamino receptorių (Singer ir kt., 2010). Įrodyta, kad ilgalaikis D1 specifinis ΔFosB ekspresija sukelia GluA2 transkripciją NAc (Kelz ir kt., 1999), kuris slopina AMPA reakcijas, tarpininkaujamas per „GluA1“, tuo tarpu čia parodyta, kad trumpesnio laikotarpio ΔFosB perdėta raiška, taip pat trumpesnio laikotarpio kokaino ekspozicija neturi jokio poveikio šiam subvienetui (Pav 1). Nepaisant to, neseniai pastebėjome, kad trumpalaikis ΔFosB perraiškymas vis dėlto sumažina AMPA atsaką D1 tipo MSN NAc (Grueter ir kt., 2013). Šie duomenys rodo laikinai skirtingus mechanizmus, kurie gali sudaryti kokaino neuroadaptacijų, priklausančių nuo laiko, seriją, kuria grindžiami skirtingi priklausomybės progresavimo aspektai, dar nežinomi. Lokomotoriniam sensibilizacijai kokainu reikalingi tiek CaMKII, tiek ΔFosB (elgesio lygmenyje) (žr. Aukščiau) ir abu yra būtini nuolatiniam kokaino savarankiškam vartojimui graužikams (Colby ir kt., 2003; Wang et al., 2010), teigdami, kad abu baltymai yra svarbūs tiek trumpalaikiam, tiek ilgalaikiam elgesio prisitaikymui prie narkotikų poveikio, nors ir iš dalies skirtingais pagrindiniais mechanizmais. Manoma, kad ΔFosB ir CaMKII reguliuoja tokį sudėtingą elgesio pritaikymą pakeisdami NAc sinapsinę funkciją, nors reikia daug daugiau darbo, kad sinapsiniai reiškiniai būtų tiesiogiai susieti su elgesio pokyčiais.

CaMKII holoenzimas tuo pačiu metu sąveikauja su įvairiais sinapsėmis susijusiais baltymais (Robison ir kt., 2005), kurie, kaip manoma, reguliuoja jo taikymą į postsinapsinį tankį (PSD) - reiškinys, kuris siūlomas kaip svarbus sinapsiniam plastiškumui. Neseniai buvo įrodyta, kad CaMKII sąveika su NMDA tipo glutamato receptoriaus GluN2B subvienetu reguliuoja ir sinapsinį plastiškumą, ir mokymąsi (Halt ir kt., 2012). Nors AC3I peptidas imituoja CaMKII autoinhibicinį domeną ir tokiu būdu slopina fermento katalizinį aktyvumą, jis taip pat blokuoja daugybę baltymų ir baltymų sąveikų (Strack ir kt., 2000; Robison ir kt., 2005). Taigi, čia aprašytas HSV-GFP-AC3I elgesio ir morfologinis poveikis gali atsirasti dėl sumažėjusio CaMKII tikslinių baltymų fosforilinimo, CaMKII taikymo pokyčių arba dėl CaMKII siūlomo struktūrinio vaidmens sinapsėse pokyčių (Lisman ir kt., 2002).

Siūlomos ΔFosB-CaMKII kilpos apribojimas NAc apvalkalu yra ypatingas, nes naujausi darbai parodė keletą fiziologinių skirtumų tarp NAc apvalkalo ir šerdies, reaguojant į kokaino vartojimą. Tai patvirtina mūsų nešališkas iTRAQ (S1 lentelė) duomenys. . NAc apvalkale esantys MSN rodo, kad po lėtinio kokaino vartojimo sumažėja šaudymo pajėgumai, kurie tęsiasi kelias savaites, tuo tarpu tų pačių gyvūnų pagrindiniai MSN rodo laikiną (1 – 3 dieną) šaudymo pajėgumo padidėjimą, kuris grįžta į bazinį lygį per 2 savaites (Kourrichas ir Tomas, 2009). Be to, daugybė sinapsinių baltymų yra skirtingai reguliuojami NAc apvalkaluose vs gyvūnų, paveiktų lėtiniu kokainu, įskaitant GluA2 (Knackstedt ir kt., 2010). Kadangi lėtinis amfetaminas sukelia CaMKIIα būtent NAc apvalkale (Loweth ir kt., 2010), nenuostabu, kad panašų poveikį pastebime ir su kokainu. Tačiau kadangi ΔFosB sukelia ir NAc apvalkalą, ir šerdį lėtinis kokainas (Perrotti ir kt., 2008), ir kadangi mes parodome, kad CaMKIIα indukcija apvalkale priklauso nuo ΔFosB, mūsų išvados pateikia naujų įrodymų apie skirtingus CaMKIIα promotoriaus transkripcijos mechanizmus tarp šių dviejų subregionų, kurie yra atsakingi už selektyvią CaMKIIα indukciją apvalkale.

Daugybė pastarojo meto darbų buvo nukreipti į skirtumų tarp D1 ir D2 tipo NAc MSN apibrėžimą. Nors ir D1, ir D2 receptoriai yra susiję su teigiamu kokaino poveikiu (Aš, 2010), naujausias darbas rodo, kad optogenetinis D1 tipo MSN aktyvinimas padidina elgesio reakcijas į kokainą, o D2 tipo MSN aktyvinimas turi priešingą poveikį (Lobo ir kt., 2010). Remiantis šiais duomenimis, D1 receptorių išmušimo pelėms trūksta įgūdžių savarankiškai vartoti kokainą (Caine ir kt., 2007), o D2 nokautai nėra (Caine ir kt., 2002). D1 agonistų vartojimas tiesiai į NAc sukelia kokaino ieškomą elgesį atkūrimo paradigmose (Aš, 2010). Įdomu tai, kad šiam efektui reikia nuo D1 receptorių priklausomo CaMKII aktyvumo padidėjimo NAc apvalkale, bet ne šerdies (Anderson ir kt., 2008), rezultatas, kuris gražiai dera su čia pasiūlyta D1 ir apvalkalui būdinga ΔFosB-CaMKII kilpa.

Anksčiau pranešėme, kad ΔFosB esančią Ser27 galima fosforilinti kazeino kinaze-2 (Ulery ir kt., 2006), tačiau čia nustatome, kad CaMKII fosforilina ΔFosB šioje ir kitose vietose, kur kinetika ir stechiometrija yra daug didesnė, ir gali atkartoti didesnį tariamąjį Mr stebimas ΔFosB (5A pav) vartojant kokainą in vivo („Nestler“, „2008“). Mes jau žinome, kad Ser27 fosforilinimas padidina FosB stabilumą ir transkripcijos aktyvumą (Ulery ir kt., 2006; Ulery ir Nestler, 2007; Ulery-Reynolds ir kt., 2009). Ateityje darbas bus sutelktas į naujų ΔFosB fosforilinimo vietų identifikavimą ir funkcines pasekmes, nurodytas šiame tyrime.

Čia aprašyta informacijos perdavimo linija suteikia patikimą naują mechanizmą, pagal kurį pakartotinis kokaino vartojimas skatina progresuojančius NAc pokyčius. Iš esmės šis biocheminis kelias gali būti svarbus būsimos terapinės intervencijos į priklausomybės sutrikimus taikinys. Kadangi CaMKII yra visur paplitęs ir reikalingas daugeliui bazinių neuronų ir elgesio funkcijų, buvo išvengta tiesioginio CaMKII inhibitorių naudojimo kaip priklausomybės gydymo. Mūsų duomenys rodo, kad subtilesnis CaMKII indukcijos mechanizmo taikymas, būdingas individualiam ląstelių tipui ir smegenų atlygio grandinės subregionui, galėtų suteikti terapinį taikinį, kuris padėtų išvengti sisteminio CaMKII slopinimo komplikacijų.

Eiti į:

Padėka

Šis darbas buvo remiamas iš Nacionalinio piktnaudžiavimo narkotikais instituto (EJN), NIDA-Jeilio proteomikos centro DA018343 (AJR ir EJN) ir Hartwell fondo (AJR) subsidijų. Autoriai norėtų padėkoti Gabby Rundenko už dosnią išgryninto FosB dovaną ir Rogeriui Colbranui už dosnią išgryninto CaMKIIα dovaną.

Eiti į:

Nuorodos

  1. Ahmed SH, Koob GF. Perėjimas nuo vidutinio iki pernelyg didelio narkotikų vartojimo: pokyčiai hedoniniame taške. Mokslas. 1998: 282: 298 – 300. [PubMed]
  2. Andersonas SM, garsusis KR, Sadri-Vakili G, Kumaresan V, Schmidt HD, Bass CE, Terwilliger EF, Cha JH, Pierce RC. CaMKII: biocheminis tiltas, jungiantis kaupiamų dopamino ir gliutamato sistemas ieškant kokaino. Nat Neurosci. 2008; 11: 344 – 353. [PubMed]
  3. „Boudreau AC“, „Wolf ME“. Elgesio sensibilizacija kokainui yra susijusi su padidėjusia AMPA receptoriaus paviršiaus ekspresija branduolio akumuliatoriuose. J Neurosci. 2005; 25: 9144 – 9151. [PubMed]
  4. „Brickey DA“, „Colbran RJ“, „Fong YL“, „Soderling TR“. Ca2 + / nuo kalmodulino priklausomos baltymo kinazės II alfa subvienetų raiška ir apibūdinimas naudojant bakuloviruso ekspresijos sistemą. Biochem Biophys Res Commun. 1990; 173: 578 – 584. [PubMed]
  5. Caine SB, Negus SS, Mello NK, Patel S, Bristow L, Kulagowski J, Vallone D, Saiardi A, Borrelli E. Dopamino D2 receptorių vaidmuo savarankiškai vartojant kokainą: tyrimai su D2 receptorių mutantais pelėmis ir nauji D2 receptoriai. antagonistai. J Neurosci. 2002; 22: 2977 – 2988. [PubMed]
  6. „Caine SB“, „Thomsen M“, „Gabriel KI“, „Berkowitz JS“, „Gold LH“, „Koob GF“, „Tonegawa S“, „Zhang J“, „Xu M.“. Kokaino savarankiško vartojimo trūkumas dopamino D1 receptorių išmuštose pelėse. J Neurosci. 2007; 27: 13140 – 13150. [PMC nemokamas straipsnis] [PubMed]
  7. Carle TL, Ohnishi YN, Ohnishi YH, Alibhai IN, Wilkinson MB, Kumar A, Nestler EJ. Proteasomų priklausomi ir nepriklausomi FosB destabilizavimo mechanizmai: FosB degronų domenų identifikavimas ir poveikis DeltaFosB stabilumui. Eur J Neurosci. 2007: 25: 3009 – 3019. [PubMed]
  8. Chen J, Kelz MB, Zeng G, Sakai N, Steffen C, Shockett PE, Picciotto MR, Duman RS, Nestler EJ. Transgeniniai gyvūnai su indukuotu tiksliniu genų ekspresija smegenyse. Mol Pharmacol. 1998: 54: 495 – 503. [PubMed]
  9. Christoffel DJ, „Golden SA“, Dumitriu D, Robison AJ, Janssen WG, Ahn HF, Krishnan V, Reyes CM, Han MH, Ables JL, Eisch AJ, Dietz DM, Ferguson D, Neve RL, Greengard P, Kim Y, Morrison JH , Russo SJ. IkappaB kinazė reguliuoja streso sukeltą sinapsinį ir elgesio plastiškumą. J Neurosci. 2011; 31: 314 – 321. [PMC nemokamas straipsnis] [PubMed]
  10. „Colbran RJ“. Ca2 + / nuo kalmodulino priklausomos baltymo kinazės II inaktyvacija bazinio autofosforilinimo būdu. J Biol Chem. 1993; 268: 7163 – 7170. [PubMed]
  11. „Colbran RJ“. Baltymų fosfatazės ir nuo kalcio / kalmodulino priklausomas baltymų kinazės II priklausomas sinapsinis plastiškumas. J Neurosci. 2004; 24: 8404 – 8409. [PubMed]
  12. Colbran RJ, Brown AM. Nuo kalcio / kalmodulino priklausoma baltymo kinazė II ir sinapsinis plastiškumas. Curr Opin Neurobiol. 2004; 14: 318 – 327. [PubMed]
  13. Colby CR, Whisler K, Steffen C, Nestler EJ, Self DW. Striatyvinė ląstelių tipo specifinė „DeltaFosB“ ekspresija padidina kokaino skatinimą. J Neurosci. 2003: 23: 2488 – 2493. [PubMed]
  14. Covington HE, 3rd, Maze I, LaPlant QC, Vialou VF, Ohnishi YN, Berton O, Fass DM, Renthal W, Rush AJ, 3rd, Wu EY, Ghose S, Krishnan V, Russo SJ, Tamminga C, Haggarty SJ, Nestler EJ. Histonedecetilazės inhibitorių antidepresantai. J Neurosci. 2009; 29: 11451 – 11460. [PMC nemokamas straipsnis] [PubMed]
  15. Davalos A, Fernandez-Hernando C, Sowa G, Derakhshan B, Lin MI, Lee JY, Zhao H, Luo R, Colangelo C, Sessa WC. Kaveolino-1 reguliuojamų baltymų kiekybinė proteomika: polimerazės i ir transkripto atpalaidavimo faktoriaus / CAVIN-1 apibūdinimas endotelio ląstelėse. Molinių ląstelių proteomika. 2010; 9: 2109 – 2124. [PMC nemokamas straipsnis] [PubMed]
  16. Dumais A, Lesage AD, Alda M, Rouleau G, Dumont M, Chawky N, Roy M, Mann JJ, Benkelfat C, Turecki G. Savižudybės pabaigimo rizikos veiksniai sergant didžiausia depresija: impulsyvaus ir agresyvaus elgesio atvejų kontrolės tyrimas vyrai. Am J psichiatrija. 2005; 162: 2116 – 2124. [PubMed]
  17. „Grueter BA“, „Robison AJ“, „Neve RL“, „Nestler EJ“, „Malenka RC“. ΔFosB diferencijuotai moduliuoja branduolio akumuliatorių tiesioginį ir netiesioginį kelią. Proc Natl Acad Sci JAV. 2013 spaudoje. [PMC nemokamas straipsnis] [PubMed]
  18. „Halt AR“, „Dallapiazza RF“, Zhou Y, Stein IS, Qian H, Juntti S, Wojcik S, „Brose N“, „Silva AJ“, „Hell JW“. „CaMKII“ prisijungimas prie „GluN2B“ yra kritinis atminties konsolidavimo metu. EMBO J. 2012; 31: 1203 – 1216. [PMC nemokamas straipsnis] [PubMed]
  19. Hiroi N, Brown JR, Haile CN, Ye H, Greenberg ME, Nestler EJ. FosB mutantinės pelės: lėtinio su kokosu susijusių baltymų indukcijos praradimas kokainu ir padidėjęs jautrumas kokaino psichomotorui ir naudingas poveikis. Proc Natl Acad Sci, JAV, A. A. 1997; 94: 10397–10402. [PMC nemokamas straipsnis] [PubMed]
  20. Ito R, Robbins TW, Everitt BJ. Branduolio accumbens branduolio ir korpuso diferencinė kokaino paieškos elgsenos kontrolė. Nat Neurosci. 2004: 7: 389 – 397. [PubMed]
  21. Jorissen HJ, Ulery PG, Henry L, Gourneni S, Nestler EJ, Rudenko G. Transkripcijos faktoriaus DeltaFosB dimerizacijos ir DNR surišimo savybės. Biochemija. 2007; 46: 8360 – 8372. [PubMed]
  22. Jourdain P, Fukunaga K, Muller D. Nuo kalcio / kalmodulino priklausanti baltymo kinazė II prisideda prie filofodijos augimo ir stuburo formavimo. J Neurosci. 2003; 23: 10645 – 10649. [PubMed]
  23. Kelz MB, Chen J, Carlezon WA, Jr, Whisler K, Gilden L, Beckmann AM, Steffen C, Zhang YJ, Marotti L, Self DW, Tkatch T, Baranauskas G, Surmeier DJ, Neve RL, Duman RS, Picciotto MR, Duman RS Nestler EJ. Transkripcijos faktoriaus deltaFosB ekspresija smegenyse kontroliuoja jautrumą kokainui. Gamta. 1999: 401: 272 – 276. [PubMed]
  24. Klug JR, Mathur BN, Kash TL, Wang HD, Matthews RT, Robison AJ, Anderson ME, Deutch AY, Lovinger DM, Colbran RJ, Winder DG. Genetinis CaMKII slopinimas vidiniame nugaros smegenų nervo nervo nervo neurone sumažina funkcinę sužadinimo sinapsę ir padidina vidinį jaudrumą. „PLoS One“. 2012; 7: e45323. [PMC nemokamas straipsnis] [PubMed]
  25. „Knackstedt LA“, „Moussawi K“, „Lalumiere R“, „Schwendt M“, „Klugmann M“, „Kalivas PW“. Išnykimo treniruotės po kokaino vartojimo savaime sukelia glutamaterginį plastiškumą ir slopina kokaino paieškas. J Neurosci. 2010; 30: 7984 – 7992. [PMC nemokamas straipsnis] [PubMed]
  26. Kourrichas S, Thomas MJ. Panašūs neuronai, priešingos adaptacijos: psichostimuliatorių patirtis skirtingai keičia akumuliatorių šerdies ir apvalkalo degimo savybes. J Neurosci. 2009; 29: 12275 – 12283. [PMC nemokamas straipsnis] [PubMed]
  27. Kourrichas S, Klug JR, Mayford M, Thomas MJ. Nuo AMPAR nepriklausomas striatos alphaCaMKII poveikis skatina jautrumą kokainui. J Neurosci. 2012; 32: 6578 – 6586. [PMC nemokamas straipsnis] [PubMed]
  28. LaPlant Q, Chakravarty S, Vialou V, Mukherjee S, Koo JW, Kalahasti G, Bradbury KR, Taylor SV, Maze I, Kumar A, Graham A, Birnbaum SG, Krishnan V, Truong HT, Neve RL, Nestler EJ, Russo SJ. . Branduolinio faktoriaus kappaB vaidmuo padidėjusio kiaušidžių hormonų sukeliamo streso metu pelėms. Biolo psichiatrija. 2009; 65: 874 – 880. [PMC nemokamas straipsnis] [PubMed]
  29. Lee KW, Kim Y, Kim AM, Helmin K, Nairn AC, Greengard P. Kokaino sukeltas dendritinio stuburo formavimas D1 ir D2 dopamino receptorių turinčiuose vidutiniuose dygsniuotuose neuronuose branduolių akumuliatoriuose. „Proc Natl Acad Sci“, JAV A. 2006; 103: 3399 – 3404. [PMC nemokamas straipsnis] [PubMed]
  30. Lisman J, Schulman H, Cline H. CaMKII funkcijos molekuliniai pagrindai sinapsinėje ir elgesio atmintyje. Nat Rev Neurosci. 2002; 3: 175 – 190. [PubMed]
  31. Lobo MK, Covington HE, 3rd, Chaudhury D, Friedman AK, Sun H, Damez-Werno D, Dietz DM, Zaman S, Koo JW, Kennedy PJ, Mouzon E, Mogri M, Neve RL, Deisseroth K, Han MH, Nestler EJ. Ląstelių tipui būdingas BDNF signalų praradimas imituoja optogenetinę kokaino naudos kontrolę. Mokslas. 2010; 330: 385 – 390. [PMC nemokamas straipsnis] [PubMed]
  32. Loweth JA, „Baker LK“, „Guptaa T“, „Guillory AM“, Vezina P. CaMKII slopinimas branduolio akumuliatoriaus apvalkale sumažina padidėjusį amfetamino vartojimą jautrioms žiurkėms. „Neurosci Lett“. 2008; 444: 157 – 160. [PMC nemokamas straipsnis] [PubMed]
  33. Žemas JA, Dainininkas BF, Bakeris LK, Wilke G, Inaminas H, Bubula N, Aleksandras JK, Carlezon WA, Jr, Neve RL, Vezina P. Pereinamojo laikotarpio alfa-Ca2 + / nuo kalmodulino priklausomos baltymo kinazės II ekspresija branduolio akumuliatorių lukštuose pagerina elgesį reaguojant į amfetaminą. J Neurosci. 2010; 30: 939 – 949. [PMC nemokamas straipsnis] [PubMed]
  34. Malinow R, Malenka RC. Prekyba AMPA receptoriais ir sinapsinis plastiškumas. Annu Rev Neurosci. 2002; 25: 103 – 126. [PubMed]
  35. Matsuzaki M, Honkura N, Ellis-Davies GC, Kasai H. Pavienių dendritinių stuburų ilgalaikio potencialo struktūriniai pagrindai. Gamta. 2004; 429: 761 – 766. [PubMed]
  36. Mayford M, Bach ME, Huang YY, Wang L, Hawkins RD, Kandel ER. Atminties formavimo kontrolė kontroliuojamu CaMKII transgeno išraiška. Mokslas. 1996; 274: 1678 – 1683. [PubMed]
  37. Maze I, Covington HE, 3rd, Dietz DM, LaPlant Q, Renthal W, Russo SJ, Mechanic M, Mouzon E, Neve RL, Haggarty SJ, Ren Y, Sampath SC, Hurd YL, Greengard P, Tarakhovsky A, Schaefer A, Nestler EJ. Esminis histono metiltransferazės G9a vaidmuo kokaino sukeliamame plastikume. Mokslas. 2010: 327: 213 – 216. [PMC nemokamas straipsnis] [PubMed]
  38. McClung CA, Nestler EJ. CREB ir DeltaFosB reguliuoja geno ekspresiją ir kokaino atlygį. Nat Neurosci. 2003: 6: 1208 – 1215. [PubMed]
  39. Nestler EJ. Peržiūra. Transkripcijos priklausomybės mechanizmai: DeltaFosB vaidmuo. Philos Trans R Soc Lond B Biol Sci. 2008: 363: 3245 – 3255. [PMC nemokamas straipsnis] [PubMed]
  40. Nye HE, Hope BT, Kelz MB, Iadarola M, Nestler EJ. Farmakologiniai tyrimai, susiję su lėtinio FOS susijusio antigeno indukcijos, kurią sukelia kokainas, reguliavimu striatum ir nucleus accumbens. J Pharmacol Exp Ther. 1995: 275: 1671 – 1680. [PubMed]
  41. Okamoto K, Bosch M, Hayashi Y. CaMKII ir F-aktino vaidmenys dendritinių smaigalių struktūriniame plastiškume: ar galima sinapsinės žymos molekulinė tapatybė? Fiziologija (Bethesda) 2009; 24: 357 – 366. [PubMed]
  42. Olausson P, Jentsch JD, Tronson N, Neve RL, Nestler EJ, Taylor JR. DeltaFosB branduolyje accumbens reguliuoja sustiprintą instrumentinį elgesį ir motyvaciją. J Neurosci. 2006: 26: 9196 – 9204. [PubMed]
  43. Paxinos G, Watson C. Žiurkės smegenys stereotaksinėmis koordinatėmis. 6th Edition. Amsterdamas; Bostonas: Academic Press / Elsevier; 2007.
  44. Peakman MC, Colby C, Perrotti LI, Tekumalla P, Carle T, Ulery P, Chao J, Duman C, Steffen C, Monteggia L, Allen MR, Stock JL, Duman RS, McNeish JD, Barrot M, Self DW, Nestler EJ , Schaeffer E. Inducible, smegenų srities specifinė dominuojančio neigiamo c-Jun mutanto ekspresija transgeninėse pelėse mažina jautrumą kokainui. Brain Res. 2003: 970: 73 – 86. [PubMed]
  45. Penzes P, Cahill ME, Jones KA, Srivastava DP. Konvergenciniai CaMK ir RacGEF signalai kontroliuoja dendritinę struktūrą ir funkcijas. Trends Cell Biol. 2008; 18: 405 – 413. [PubMed]
  46. Perrotti LI, Hadeishi Y, Ulery PG, Barrot M, Monteggia L, Duman RS, Nestler EJ. DeltaFosB indukcija su lydinčiomis smegenų struktūromis po lėtinio streso. J Neurosci. 2004: 24: 10594 – 10602. [PubMed]
  47. Perrotti LI, Weaver RR, Robison B, Renthal W, Maze I, Yazdani S, Elmore RG, Knapp DJ, Selley DE, Martin BR, Sim-Selley L, Bachtell RK, Self DW, Nestler EJ. Skirtingi DeltaFosB indukcijos modeliai smegenyse, naudojant narkotikus. Sinapsija. 2008: 62: 358 – 369. [PMC nemokamas straipsnis] [PubMed]
  48. Pickens CL, Airavaara M, Theberge F, Fanous S, Hope BT, Shaham Y. Narkotikų potraukio inkubacijos neurobiologija. Tendencijos Neurosci. 2011; 34: 411 – 420. [PMC nemokamas straipsnis] [PubMed]
  49. „Pierce RC“, „Quick EA“, „Reeder DC“, „Morgan ZR“, „Kalivas PW“. Antrieji pasiuntiniai, turintys kalcio, modifikuoja elgesio jautrinimo kokainui išraišką. J Pharmacol Exp Ther. 1998; 286: 1171 – 1176. [PubMed]
  50. „Quirion R“, „Robitaille Y“, „Martial J“, „Chabot JG“, „Lemoine P“, „Pilapil C“, „Dalpe M.“. Žmogaus smegenų receptorių autoradiografija, naudojant visus pusrutulio skyrius: bendras metodas, sumažinantis audinių artefaktus. Sinapsė. 1987; 1: 446 – 454. [PubMed]
  51. Robinson TE, Kolb B. Struktūrinis plastiškumas, susijęs su piktnaudžiavimo narkotikais poveikiu. Neurofarmakologija. 2004; 47 (Suppl 1): 33 – 46. [PubMed]
  52. Robison AJ, Nestler EJ. Transkripciniai ir epigenetiniai priklausomybės mechanizmai. Nat Rev Neurosci. 2011; 12: 623 – 637. [PMC nemokamas straipsnis] [PubMed]
  53. Robison AJ, Bass MA, Jiao Y, MacMillan LB, Carmody LC, Bartlett RK, Colbran RJ. Daugiavalentė kalcio / kalmodulino priklausomo baltymo kinazės II sąveika su postsinapsinio tankio baltymais NR2B, densin-180 ir alfa-aktininu-2. J Biol Chem. 2005; 280: 35329 – 35336. [PubMed]
  54. Ross PL, Huang YN, Marchese JN, Williamson B, Parker K, Hattan S, Khainovski N, Pillai S, Dey S, Daniels S, Purkayastha S, Juhasz P, Martin S, Bartlet-Jones M, He F, Jacobson A, „Pappin DJ“. Padauginta baltymų kiekybė Saccharomyces cerevisiae, naudojant aminams reaktyvius izobarinius žymėjimo reagentus. Molinių ląstelių proteomika. 2004; 3: 1154 – 1169. [PubMed]
  55. Russo SJ, Dietz DM, Dumitriu D, Morrison JH, Malenka RC, Nestler EJ. Priklausomybė sinapsė: sinaptinio ir struktūrinio plastiškumo mechanizmai branduoliuose. Tendencijos Neurosci. 2010: 33: 267 – 276. [PMC nemokamas straipsnis] [PubMed]
  56. Savarankiškas DW. In: Dopamino receptoriai. Neve KA, redaktorius. Niujorkas: „Humana Press“; 2010. 479 – 524 psl.
  57. Dainininkė BF, Loweth JA, Neve RL, Vezina P. Dėl trumpalaikio virusų sukelto alfa-kalcio / kalmodulino-priklausomos baltymo kinazės II perraiškos branduolio akumuliatoriaus apvalkale sukelia ilgalaikį alfa-amino-3-hidroksilo-5 funkcinį padidėjimą. -metil-4-izoksazolo-propionato receptoriai: dopamino tipo-1 receptorių ir baltymų kinazės A priklausomybė. Eur J Neurosci. 2010; 31: 1243 – 1251. [PMC nemokamas straipsnis] [PubMed]
  58. „Strack S“, „McNeill RB“, „Colbran RJ“. Kalcio / kalmodulino priklausomos baltymo kinazės II, taikomo N-metil-D-aspartato receptoriaus NR2B subvienetui, mechanizmas ir reguliavimas. J Biol Chem. 2000; 275: 23798 – 23806. [PubMed]
  59. „Ulery-Reynolds PG“, „Castillo MA“, „Vialou V“, „Russo SJ“, „Nestler EJ“. Fosforilinant DeltaFosB tarpininkauja jo stabilumas in vivo. Neuromokslas. 2009; 158: 369 – 372. [PMC nemokamas straipsnis] [PubMed]
  60. Ulery PG, Nestler EJ. DeltaFosB transkripcijos aktyvumo reguliavimas, naudojant fosforilinimą Ser27. Eur J Neurosci. 2007: 25: 224 – 230. [PubMed]
  61. Ulery PG, Rudenko G, Nestler EJ. DeltaFosB stabilumo reguliavimas fosforilinimo būdu. J Neurosci. 2006: 26: 5131 – 5142. [PubMed]
  62. „Vialou V“ ir kt. „DeltaFosB“ smegenų atlygio grandinėse tarpininkauja atsparumui stresui ir antidepresantams. Nat Neurosci. 2010; 13: 745 – 752. [PMC nemokamas straipsnis] [PubMed]
  63. Wang L, Lv Z, Hu Z, Sheng J, Hui B, Sun J, Ma L. Lėtinis kokaino sukeltas H3 acetilinimas ir CaMKIIalfa transkripcinis aktyvavimas akumuliaciniuose branduoliuose yra labai svarbus motyvacijai stiprinti narkotikus. Neuropsichofarmakologija. 2010; 35: 913 – 928. [PMC nemokamas straipsnis] [PubMed]
  64. Werme M, Messer C, Olson L, Gilden L, Thoren P, Nestler EJ, Brene S. Delta FosB reguliuoja ratų važiavimą. J Neurosci. 2002: 22: 8133 – 8138. [PubMed]
  65. Winstanley CA, LaPlant Q, Theobald DE, Green TA, Bachtell RK, Perrotti LI, DiLeone RJ, Russo SJ, Garth WJ, Self DW, Nestler EJ. DeltaFosB indukcija orbitofrontalinėje žievėje skleidžia toleranciją kokaino sukeltai kognityvinei disfunkcijai. J Neurosci. 2007: 27: 10497 – 10507. [PubMed]
  66. Zachariou V, Bolanos CA, Selley DE, Theobald D, Cassidy MP, Kelz MB, Shaw-Lutchman T, Berton O, Sim-Selley LJ, Dileone RJ, Kumar A, Nestler EJ. Esminis DeltaFosB vaidmuo branduolio akumbensuose morfino veikloje. Nat Neurosci. 2006: 9: 205 – 211. [PubMed]
  67. Zhang R, Khoo MS, Wu Y, Yang Y, Grueter CE, Ni G, Price EE, Jr, Thiel W, Guatimosim S, Song LS, Madu EC, Shah AN, Vishnivetskaya TA, Atkinson JB, Gurevich VV, Salama G, Lederis WJ, Colbran RJ, Andersonas ME. Kalmodulino kinazės II slopinimas apsaugo nuo struktūrinių širdies ligų. Nat Med. 2005; 11: 409 – 417. [PubMed]