Cdk5 fosforyluje receptor dopaminowy D2 i tłumi sygnały w dół (2013)

Uwagi: Pojawia się, aby pokazać, że Cdk5 powoduje obniżenie regulacji receptorów dopaminy D2. O dziwo, współczynnik translacji deltafosb indukuje produkcję Cdk5.


Jeong J, Park YU, Kim DK, Lee S, Kwak Y, et al. (2013) PLoS ONE 8 (12): e84482. doi: 10.1371 / journal.pone.0084482

Abstrakcyjny

Receptor dopaminy D2 (DRD2) jest kluczowym receptorem, który pośredniczy w funkcjach mózgu związanych z dopaminą, takich jak nastrój, nagroda i emocje. Cyklinozależna kinaza 5 (Cdk5) jest kinazą serynowo / treoninową kierowaną przez prolinę, której funkcja związana jest z obwodem nagrody w mózgu. W tym badaniu ujawniliśmy, że reszta 321 seryny (S321) w trzeciej pętli wewnątrzkomórkowej DRD2 (D2i3) jest nowym miejscem regulacyjnym Cdk5. Fosforylację S5 zależną od Cdk321 w D2i3 zaobserwowano w in vitro i systemy hodowli komórkowej.

Ponadto zaobserwowaliśmy, że fosforylacja S321 osłabiała stymulowaną przez agonistę ekspresję powierzchniową DRD2 i zmniejszone sprzęganie białka G z DRD2. Ponadto na szlak cAMP znajdujący się poniżej wpływał układ heterologiczny i pierwotne hodowle neuronów z zarodków z nokautem p35, prawdopodobnie ze względu na zmniejszoną aktywność hamującą DRD2. Wyniki te wskazują, że fosforylacja S5 za pośrednictwem Cdk321 hamuje funkcję DRD2, zapewniając nowy mechanizm regulacyjny dla sygnalizacji dopaminy.

Postacie

Cytat: Jeong J, Park YU, Kim DK, Lee S, Kwak Y, et al. (2013) Cdk5 Phosphorylates Dopamine D2 Receptor i tłumi sygnał downstream. PLoS ONE 8 (12): e84482. doi: 10.1371 / journal.pone.0084482

Redaktor: James Porter, University of North Dakota, Stany Zjednoczone Ameryki

Odebrane: Maj 20, 2013; Przyjęty: Listopad 14, 2013; Opublikowano: 31 grudnia 2013 r.

Prawa autorskie: © 2013 Jeong i in. Jest to artykuł o otwartym dostępie dystrybuowany zgodnie z warunkami Licencja Creative Commons - uznanie autorstwa, który pozwala na nieograniczone użycie, dystrybucję i reprodukcję w dowolnym medium, pod warunkiem, że autor i źródło są uznawane.

Finansowanie: Prace te były wspierane przez dotacje (NRF-2012R1A2A2A01012923 i NRF-2012R1A4A1028200) od rządu koreańskiego (MSIP), a także wspierane w ramach programu współpracy międzynarodowej zarządzanego przez NRF Korei (2012K2A1A2033117) i Korea Brain Research Institute (KBRI) Podstawowy program badań MSIP (2031-415). SKP był odbiorcą 2004 i 2006 National Alliance for Research on Schizophrenia and Depression (NARSAD) Young Investigator Awards. Darczyńcy nie mieli żadnej roli w projektowaniu badań, zbieraniu i analizowaniu danych, podejmowaniu decyzji o publikacji lub przygotowaniu manuskryptu.

Konkurencyjne zainteresowania: Autorzy zadeklarowali, że nie istnieją konkurencyjne interesy.

Wprowadzenie

Sygnalizacja dopaminowa jest zaangażowana w różne funkcje mózgu, w tym koordynację ruchową, kontrolę nastroju i mechanizmy nagrody [1]. Głównym składnikiem sygnalizacji dopaminy u kręgowców są neurony kolczaste prążkowia (MSN), które selektywnie eksprymują podzbiór receptorów dopaminy i otrzymują dopaminergiczny wkład głównie z brzusznej strefy nakrywkowej (VTA) i istoty czarnej (SN) [2]. Receptory dopaminy są receptorami sprzężonymi z białkiem G (GPCR) z siedmioma domenami transbłonowymi i składają się z dwóch podtypów, Receptory podobne do D1 i D2, które pośredniczą w wzajemnych działaniach w sygnalizacji dopaminy [1]. Na przykład receptory dopaminowe D1-podobne (D1, D5) aktywują cyklazę adenylylową przez Gαs i zwiększają wewnątrzkomórkowy poziom cAMP, ale receptory dopaminowe D2-podobne (D2, D3, D4) hamują cyklazę adenylylową przez Gαi i zmniejszyć wewnątrzkomórkowy poziom cAMP [1], [3].

Wśród receptorów dopaminowych receptor D2 (DRD2) odgrywa rolę w patofizjologii wielu poważnych zaburzeń psychicznych, w tym schizofrenii i narkomanii [4]tak, że wiele leków przeciwpsychotycznych przynajmniej częściowo celuje w DRD2. Wiadomo również, że aktywność DRD2 dobrze koreluje z behawioralnymi konsekwencjami narkotyków w modelach zwierzęcych [5]. Skuteczność leków przeciwdepresyjnych i stabilizatorów nastroju powiązano również ze zmianami w ekspresji DRD2 na powierzchni komórki lub sygnalizacji wewnątrzkomórkowej w dół za pośrednictwem PKA, ERK i GSK3 [1], [4], [6]. Pomimo tych krytycznych ról DRD2 w mózgu, szczegółowe mechanizmy regulacyjne, które nadają heterogeniczność i złożoność właściwościom DRD2, nie są w pełni zrozumiałe.

Zbieżne linie dowodowe wskazują, że liczne modyfikacje posttranslacyjne są zaangażowane w dostrajanie aktywności DRD2. Szeroko zakrojona glikozylacja DRD2 została ujawniona w badaniach wczesnego znakowania powinowactwa do fotografii [7]i tworzenie wiązań disiarczkowych w DRD2 również zidentyfikowano jako ważną modyfikację wiązania ligandu [8]. Ponadto miejsca fosforylacji DRD2 zostały początkowo zidentyfikowane przez in vitro test z radioizotopami, zapewniający drogi dla różnych szlaków regulatorowych, w których pośredniczą różne kinazy [9]. Rzeczywiście, kinaza białkowa C (PKC) reguluje mobilizację wapnia wewnątrzkomórkowego za pośrednictwem DRD2 i moduluje oddziaływanie DRD2 z białkami cytoszkieletu [10]. Fosforylacja przez kinazę GPCR 2 (GRK2) reguluje indukowane przez agonistę wzorce rensytyzacji DRD2 [11].

Cyklinozależna kinaza 5 (Cdk5) jest kinazą serynowo / treoninową kierowaną proliną, która ma preferencyjną aktywność ze względu na specyficzną dla mózgu ekspresję jej istotnych aktywatorów, p35 i p39 [12]. Cdk5 bierze udział w różnych procesach neuronalnych, w tym w migracji neuronów i prowadzeniu aksonów, a myszy Cdk5 i p35 null wykazują defekty w warstwach korowych [13]. Ostatnio wykazano, że fosforylacja WAVE1 i epheksyny przez Cdk5 reguluje morfogenezę kręgosłupa dendrytycznego [14]. Ponadto, Cdk5 reguluje również poziomy ekspresji powierzchniowej w prądzie NMDA, w którym pośredniczy receptor NMDA, NR2B i NR2A [15], [16]. Warto zauważyć, że wiele dowodów sugeruje intymny związek między Cdk5 a układem dopaminowym. Cdk5 fosforyluje hydroksylazę tyrozynową (TH), regulując jej stabilność, a tym samym utrzymując homeostazę dopaminergiczną [17]. W neuronach postsynaptycznych, gdy reszta T75 fosfoproteiny 32kD regulowanej przez dopaminę i AMP jest fosforylowana przez Cdk32, może hamować aktywność PKA, a tym samym antagonizować sygnalizację PKA za pośrednictwem DRD5, w której pośredniczy dopamina [18]. Co ciekawe, gdy kokaina, pośredni agonista receptorów dopaminowych, jest podawana przewlekle u szczurów, poziomy mRNA i białka we wzroście Cdk5 w średnich neuronach kolczastych [19]. Podsumowując, wydaje się, że Cdk5 bierze udział w indukowanych lekami adaptacjach synaptycznych. W tym badaniu wykazaliśmy funkcjonalną interakcję DRD2 i Cdk5, która dodatkowo rozszerza rolę Cdk5 w sygnalizacji dopaminy.

Materiały i Metody

Przeciwciała

Surowice przeciwkrólicze hodowano przeciwko peptydom zawierającym fosfo-serynę 321 (pS321) trzeciej pętli wewnątrzkomórkowej DRD2 (D2i3). Fosfo-peptyd, CNPDpSPAKPEK (PEPTRON), zastosowano do wytworzenia kolumny sprzężonej z peptydem do oczyszczania przez powinowactwo (20401, PIERCE). Przeciwciało anty-pS321 wzbogacono o system oczyszczania powinowactwa zgodnie z instrukcjami producenta. Oczyszczone fosfo-przeciwciało przechowywano w PBS z 0.1% azydkiem sodu i 0.1% żelatyną. Anty-mysie przeciwciało anty-Cdk5 (sc-249) i przeciwkrólicze przeciwciało anty-p35 (sc-820) zastosowano do Western blotting i immunocytochemii Cdk5 / p35. Anty-mysie przeciwciało anty-GFP (sc-9996) zastosowano do immunoprecypitacji i Western blot DRD2-GFP. Anty-królicze przeciwciało anty-FLAG (sc-807), przeciwkrólicze przeciwciało anty-HA (sc-805), przeciw-mysie przeciwciało anty-GST (sc-138) i przeciw-mysie przeciwciało anty-GAPDH (sc- 32293) zostały zakupione w Santa Cruz Biotechnologies.

Zwierzęta

Mysz z nokautem p35 była uprzejmym prezentem od dr Katsuhiko Mikoshiby z Instytutu Brain Science RIKEN w Japonii i wykorzystywana do pierwotnej kultury neuronów. Zestawy starterów do genotypowania to 5′- GGTCTCCTCTTCTGTCAAGAAG, 5′-GCTCTGCTAGACACATACTGTAC i 5′-TCCATCT GCACGAGACTAGT jak opisano wcześniej [20]. Myszy ICR i szczury Sprague Dawley zastosowano do przygotowania lizatu mózgu. Wszystkie procedury na zwierzętach zostały zatwierdzone przez Instytucję ds. Opieki nad Zwierzętami i Technologią Uniwersytetu Pohang.

Konstrukcje plazmidowe

Stosowano ludzką izoformę długą DRD2 w wektorze plazmidowym EGFP-N1 i trzecią wewnątrzkomórkową pętlę DRD2 (reszty aminokwasowe 212-373, w tym dodatkowe reszty aminokwasowe 29 unikalne dla izoformy długiej DRD2) w wektorze plazmidowym pFLAG-CMV-2. Ludzki Cdk5 wstawiono do wektora plazmidowego pCMV-HA i ludzki p35 wstawiono do wektora plazmidowego pcDNA 3.1. Ludzki Cdk5 wstawiono pod promotorem cytomegalowirusa (CMV) wraz z ludzkim p35 w wektorze pcDNA 3.1 w celu wytworzenia podwójnego konstruktu ekspresyjnego (Cdk5 / p35) do immunocytochemii, test internalizacji receptora, [35S] -GTPγTest wiązania S, test wiązania radioliganda i enzymatyczny test immunologiczny cAMP.

In Vitro Test kinazy

Połączony z IP in vitro test kinazy przeprowadzono jak następuje. Jeden cały mózg myszy poddano lizie w buforze do lizy erytrocytów 3 mL (ELB) (50 mM Tris (pH 8.0), 250 mM NaCl, 5 mM EDTA, 0.1% NP-40) za pomocą pociągnięć 20 homogenizatora Dounce, aby uzyskać homogenizowane lizaty mózgu . Lizaty inkubowano na lodzie przez 30 min, sonikowano i wirowano przy 16,000 × g dla 10 min. Supernatanty poddano immunoprecypitacji za pomocą anty-króliczego przeciwciała anty-p35, aby uzyskać aktywny kompleks Cdk5 / p35. Kompleks Cdk5 / p35 i oczyszczone białko fuzyjne GST zmieszano z trifosforanem 5′ adenozyny, [γ-32P] (NEG-502H, PerkinElmer) i inkubowano w buforze kinazowym (30 mM HEPES (pH 7.2), 10 mM MgCl2, 0.2 mM DTT) dla 1 hw temperaturze pokojowej [18], [21]. Zastosowano również oczyszczony kompleks Cdk5 / p25 (14 – 516, Millipore) in vitro test kinazy jak opisano powyżej. Bufor do ładowania próbki 2 × dodano do mieszaniny reakcyjnej i gotowano w 100 ° C. Próbki następnie poddano SDS-PAGE i wysuszony żel oceniono metodą autoradiografii.

Chromatografia cieczowa (LC) - Analiza spektrometrii masowej (MS) / MS

Rekombinowane białko GST-D2i3 analizowano metodą LC-MS / MS po połączeniu z IP in vitro test kinazy. Przeprowadziliśmy identyfikację peptydów danych LC-MS / MS za pomocą X !! Tandem (wersja Dec-01-2008). Każdy plik danych RAW był najpierw konwertowany na mzXML przy użyciu potoku trans-proteomicznego (TPP; wersja 4.3). Skany MS / MS w przekształconych mzXML poddano następnie przeszukaniu w bazie danych sekwencji białek myszy UniProt (uwolnienie 2010_07), w tym sekwencji GST-D2i3 z użyciem X !! Tandem. Tolerancję ustawiono na 3 Da dla jonów prekursorowych i 2 Da dla jonów fragmentów. Zastosowano specyficzność enzymatyczną trypsyny. Do modyfikacji karbamidometylowania cysteiny (57.021 Da), utleniania metioniny (15.995 Da), hydrolizy asparaginy (0.987 Da) i fosforylacji seryny (79.966 Da) zastosowano opcje modyfikacji zmiennych.

Immunoprecypitacja

Immunoprecypitację przeprowadzono na lizatach komórkowych w buforze do lizy ELB. Przeciwciało anty-GFP dodano do lizatów i inkubowano przez 3 hw 4 ° C. Immunokompleksy oczyszczono stosując agarozę białko-A. Osady inkubowano z buforem do ładowania próbek SDS dla 30 min w 37 ° C i poddano SDS-PAGE i Western blot.

Test ściągania GST

10 µg oczyszczonego GST i GST – D2i3 inkubowano z lizatem mózgu szczura dla 1.5 hw 4 ° C. Dodano 30 µL perełek Sepharose 4B sprzężonych z glutationem (GSH) (17-0756-01, GE Healthcare) zrównoważonych buforem do lizy i inkubowano przez dodatkowe 1 h. Kulki zebrano przez wirowanie przy 2,000 ×g i przemywa się buforem do lizy 4 razy [22], [23]. Osady analizowano metodą Western blot stosując przeciwciała anty-Cdk5 i anty-p35.

Immunocytochemia

Transfekowane komórki HEK 293 i neurony prążkowia hodowane na szkiełkach nakrywkowych przemyto raz solą fizjologiczną buforowaną fosforanem (PBS) i utrwalono przez zanurzenie w zimnym 4% paraformaldehydzie / PBS dla 30 min. Pierwotne przeciwciało rozcieńczono w roztworze blokującym (2% surowica końska i 1% Triton X-100 w PBS). Przeciwciało anty-mysie sprzężone z Alexafluor-647 (A20990, Invitrogen) i sprzężone z Alexafluor-568 przeciwciało przeciwkrólicze (A11011, Invitrogen) zastosowano jako przeciwciała drugorzędowe. Hoechst stosowano do barwienia jąder. Obrazy uzyskano za pomocą mikroskopii konfokalnej (Olympus, FluoView-1000).

Test internalizacji receptora

24 h po transfekcji komórki traktowano chinpirolem 1 µM ​​(Q102, Sigma) przez 30 min i 90 min w 37 ° C. Komórki ponownie zawieszano w 2 mL zimne porcje PBS i 200 µL stosowano do każdej reakcji. Terapie lekami prowadzono w temperaturze pokojowej dla 3h w następujących stężeniach; 3 nM [3H] -spiperon (NET-565, PerkinElmer), 3 µM ​​sulpiryd (895, TOCRIS), 10 µM ​​haloperidol (H1512, Sigma). Hydrofobowy [3H] -spiperon zastosowano do znakowania receptorów wyrażanych w całości, a hydrofilowy sulpiryd zastosowano do zastąpienia błoniastego receptora [3H] -spiperonowe sygnały. Sygnały receptora związanego z błoną obliczono przez odjęcie wartości receptora wewnątrzkomórkowego od całkowitej wartości wyrażonego receptora. Komórki przesączono przez filtr GF / B (Millipore) i przemyto 3 razy buforem do przemywania (50 mM Tris-HCl (pH 7.4), 100 mM NaCl). Filtry wysuszono i zmierzono resztkową radioaktywność za pomocą ciekłego licznika scyntylacyjnego [24].

Przygotowanie błon komórkowych

Zlewające się komórki w szalkach hodowlanych 100 mm po transfekcji przemyto lodowatym PBS i zebrano w buforze HME 1 mL (25 mM HEPES (pH 7.5), 2 mM MgCl2, 1 mM EDTA). Homogenizowane lizaty odwirowano za pomocą 500 x g przez 15 min, a supernatanty następnie odwirowano za pomocą 36,000 x g dla 30 min. Peletki ponownie zawieszone w buforze HME użyto do testów.

[35S] -GTPγS Test wiązania

Frakcje błon komórkowych wstępnie inkubowano z chinpirolem 1? M (Q102, Sigma) w buforze testowym (25 mM HEPES (pH 7.5), 1.5 mM MgCl2, 100 mM NaCl, 1 mM EDTA i 0.01 mM GDP) dla 10 min. [35S] -GTPγS (NET-030H, PerkinElmer) dodano do końcowego stężenia 3 nM w 30 µL i dalej inkubowano przez 90 min. 170 µL buforu chłodzonego lodem (10 mM Tris-HCl (pH 8.0), 100 mM NaCl, 10 mM MgCl2i 0.1 mM GTP) dodano w celu zatrzymania reakcji. Membrany przesączono przez filtr GF / B (Millipore) i przemyto 3 razy buforem do przemywania (50 mM Tris-HCl (pH 7.4), 100 mM NaCl). Filtry wysuszono i zmierzono radioaktywność za pomocą licznika scyntylacyjnego [25], [26].

Test wiązania radioligandu

Przygotowane błony komórkowe inkubowano z 0.01 nM [3H] -spiperon (NET-565, PerkinElmer) i wzrastające stężenia chinpirolu (Q102, Sigma) dla 30 min w buforze testowym (25 mM HEPES (pH 7.5), 1.5 mM MgCl2, 100 mM NaCl, 1 mM EDTA). Membrany przesączono przez filtr GF / B (Millipore) i przemyto 3 razy buforem do przemywania (50 mM Tris-HCl (pH 7.4), 100 mM NaCl). Reakcję zakończono przez szybką filtrację przez filtry GF / C. Resztkową radioaktywność mierzono za pomocą ciekłego licznika scyntylacyjnego [27]-[29].

cAMP Enzyme Immunoassay

Transfekowane komórki HEK 293 traktowano wstępnie 10 µM ​​rolipram (R6520, Sigma) dla 1 h, a następnie traktowano 0.1 µM ​​forskoliną (F6886, Sigma) i wzrastającymi stężeniami chinpirolu (Q102, Sigma) dla 30 min. Pierwotne hodowane neurony prążkowia traktowano XMUMX µM ​​rolipramem dla 10 h, a następnie 1 µM ​​dopaminą dla 1 h [22]. Lizaty komórkowe przygotowano z użyciem 0.1 M HCl i poziomy cAMP wykryto za pomocą zestawu cAMP enzymatycznego testu immunologicznego (Sapphire Bioscience) zgodnie z instrukcjami producenta.

Pierwotny hodowlany neuron prążkowany

Obszar prążkowia wyizolowano z mysiego embrionalnego mózgu (E15). Rozcięta tkanka została zdysocjowana w minimalnej niezbędnej pożywce (MEM) (11095, Invitrogen) zawierającej 0.25% trypsynę (T4549-100, Sigma) i 0.1% DNase I dla 6 min w 37 ° C. Komórki ponownie zawieszono w podłożu do wysiewania (MEM z 0.01 M HEPES (pH 7.4) i 10% (obj./obj.) Surowicą końską (16050-122, GIBCO)). Neurony hodowano przez 7 dni in vitro (DIV 7) w MEM z suplementem B27 (17504-044, Invitrogen) przed nałożeniem na enzymatyczne testy immunologiczne cAMP.

wyniki

Cdk5 Phosphorylates Serine 321 w trzeciej wewnątrzkomórkowej pętli DRD2 in vitro

Aby zidentyfikować nowe substraty Cdk5, przeprowadziliśmy systematyczne wyszukiwanie przy użyciu (S / T) PX (K / H / R) jako sekwencji konsensusowych rozpoznawania Cdk5 [30] i zidentyfikował DRD2 jako kandydata na substrat. Sekwencja konsensusowa, w tym seryna 321, znajduje się w trzeciej pętli wewnątrzkomórkowej DRD2 (D2i3), w której zaangażowano różne mechanizmy regulacyjne [3], [10], [11]. Sekwencja jest ewolucyjnie zachowana w DRD2 u kręgowców, co sugeruje funkcjonalne znaczenie pozostałości (Rys. 1A).

miniatur

Rysunek 1. Cdk5 fosforyluje serynę 321 w trzeciej pętli wewnątrzkomórkowej DRD2 in vitro.

(A) Dopasowanie sekwencji aminokwasowej pokazujące konserwowane regiony DRD2 z różnych gatunków (zacienione). Potencjalne miejsce fosforylacji Cdk5 jest oznaczone gwiazdką. (B) Powiązane z IP in vitro test kinazy z rekombinowanymi białkami zmutowanymi GST-D2i3 i GST-D2i3. Kompleks Cdk5 / p35 wzbogacony z ekstraktu mózgu myszy za pomocą immunoprecypitacji anty-p35 zastosowano do reakcji kinazy. Pokazano autoradiogram fosforylowanych białek wraz z barwieniem błękitem brylantowym Coomassie tego samego żelu. Grot strzałki wskazuje sygnał radioaktywny odpowiadający GST-D2i3 i otwarty grot strzałki wskazuje sygnały radioaktywne z p35. (C) Widmo MS / MS fosforylowanego fragmentu peptydowego D2i3. Teoretyczne wzory fragmentacji są pokazane poniżej widma. Wśród wszystkich jonów fragmentów wykryte jony y i b są oznaczone w widmie. One6 i y7 jony silnie wskazują na fosforylację seryny 321. (RE) In vitro test kinazy z oczyszczonym kompleksem Cdk5 / GST-p25 przy użyciu zmutowanych białek GST-D2i3 i GST-D2i3. Fosforylowane białka pokazano na autoradiogramie wraz z barwieniem błękitem brylantowym Coomassie. Grot strzałki wskazuje sygnał radioaktywny odpowiadający GST-D2i3 i otwarta strzałka wskazuje sygnały radioaktywne z GST-p25.

doi: 10.1371 / journal.pone.0084482.g001

Aby ocenić zdolność Cdk5 do fosforylacji D2i3, przeprowadziliśmy połączenie IP in vitro testy kinazy z użyciem aktywnego kompleksu Cdk5 / p35 wzbogaconego z lizatu mózgu myszy za pomocą immunoprecypitacji p35 z oczyszczonymi rekombinowanymi białkami GST-D2i3 (reszty aminokwasowe 212-373) jako substratami. Zaobserwowaliśmy sygnały fosforylacji w oczyszczonych białkach S2A GST-D3i2 i GST-D3i297, ale sygnał był znacząco zmniejszony przy użyciu GST-D2i3 S321A (Rys. 1B). Aby dodatkowo zweryfikować fosforylację seryny 321 w GST-D2i3, przeprowadziliśmy analizę LC-MS / MS próbek z połączenia IP in vitro testy kinaz przy użyciu spektrometrii mas LTQ XL. Zgodnie z tym odzyskano fosfopeptydy odpowiadające masie peptydów 321 fosfo-seryny (Rys. 1C). Biorąc pod uwagę, że pozyskiwanie danych zależne od danych podczas analizy LC-MS / MS ma tendencję do wykrywania obfitych białek w próbce [31]dane te sugerują, że reszta 321 seryny jest dominującym miejscem fosforylacji Cdk5 w regionie D2i3. Aby udowodnić bezpośrednią fosforylację seryny 321 w GST-D2i3 przez Cdk5, in vitro przeprowadzono test kinazy z użyciem oczyszczonego kompleksu Cdk5 / GST-p25 z oczyszczonymi rekombinowanymi białkami GST-D2i3. Zidentyfikowaliśmy znaczący sygnał fosforylacji w GST-D2i3, którego nie było w GST-D2i3 S321A (Rys. 1D). Podsumowując, wyniki te wskazują, że reszta D2i3 S321 jest preferencyjnym celem fosforylacji za pośrednictwem Cdk5.

Cdk5 Phosphorylates Serine 321 w trzeciej wewnątrzkomórkowej pętli DRD2 w komórkach

Aby zidentyfikować fosforylację seryny 321, uzyskaliśmy przeciwciała specyficzne dla fosfo-seryny 321 (pS321). Próbki z łącza IP in vitro test kinazy analizowano metodą Western blot z użyciem przeciwciała anty-pS321. Bloty wykazały wyraźny prążek w reakcji kinazy zależnej od GST-D2i3 (Rys. 2A). Aby zweryfikować potencjalną fosforylację seryny 321 w DRD2 przez Cdk5 w komórkach, immunoprecypitaty anty-GFP z komórek HEK 293 eksprymujących DRD2-GFP i DRD2 S321A-GFP z lub bez HA-Cdk5 i p35 analizowano metodą Western blotting stosując anty-GFP i przeciwciała anty-pS321. Charakterystyczne sygnały rozmazanego pasma przez przeciwciało anty-GFP, o których wiadomo, że są spowodowane nadmierną glikozylacją DRD2, obserwuje się tylko w obecności DRD2-GFP, a przeciwciało anty-pS321 wykryło podobne sygnały DRD2 tylko z ekspresją Cdk5 / p35 (Rys. 2B) [7]. W celu dalszej weryfikacji wytworzono fosforylację seryny 321 przez Cdk5, D2i3 (FLAG-D2i3) i zmutowaną postać D2i3 (FLAG-D2i3 S321A). FLAG-D2i3 i FLAG-D2i3 S321A ulegające ekspresji z lub bez HA-Cdk5 i p35 w komórkach HEK 293 analizowano w teście przesunięcia SDS-żel. Znaczące przesunięcie ruchliwości zależne od Cdk5 zaobserwowano dla FLAG-D2i3, ale nie dla FLAG-D2i3 S321A (Rys. 2C). Oceniliśmy również poziom fosforylacji DRD2 w Ser321 po stymulacji agonistą. Komórki HEK 293 eksprymujące kompleks DRD2-GFP i Cdk5 / p35 stymulowano chinpirolem, a immunoprecypitaty anty-GFP z lizatów komórkowych analizowano metodą Western blot stosując przeciwciała anty-GFP i anty-pS321. Stwierdziliśmy, że na stymulowaną przez Cdk5 fosforylację DRD2 w Ser321 nie wpływa stymulacja agonistyczna, która wydaje się różna od fosforylacji za pośrednictwem GRK i PKC (Rys. 2D) [32], [33]. Łącznie wyniki te wskazują, że Cdk5 może fosforylować resztę 321 seryny DRD2 w środowisku komórkowym.

miniatur

Rysunek 2. Cdk5 fosforyluje serynę 321 w trzeciej pętli wewnątrzkomórkowej DRD2 w komórkach.

Fosforylację seryny 5 za pośrednictwem Cdk321 analizowano przy użyciu przeciwciała anty-pS321. (A) Próbki z połączenia IP in vitro test kinazy przy użyciu białek GST-D2i3 analizowano metodą Western blot (WB) ze wskazanymi przeciwciałami. Groty strzałek wskazują GST-D2i3. (B) DRD2-GFP i DRD2 S321A-GFP ulegały ekspresji z lub bez HA-Cdk5 i p35 w komórkach HEK 293. Immunoprecypitaty anty-GFP analizowano metodą Western blot stosując przeciwciała anty-GFP i anty-pS321. Nawias wskazuje sygnały DRD2, a otwarty grot wskazuje nieswoiste sygnały z immunoprecypitatów anty-GFP. „% wkładu” to% objętości całkowitego lizatu dla reakcji IP. Słabe endogenne sygnały Cdk5 oznaczono gwiazdkami. (C) Test przesunięcia żelowego. Komórki HEK 293 transfekowane jak wskazano analizowano metodą Western blot. (D) Transfekowane komórki HEK 293 traktowano chinpirolem i immunoprecypitaty anty-GFP analizowano metodą Western blot z przeciwciałami anty-GFP i anty-pS321. Otwarty grot wskazuje nieswoiste sygnały z immunoprecypitatów anty-GFP.

doi: 10.1371 / journal.pone.0084482.g002

Kompleks Cdk5 / p35 i DRD2 są fizycznie powiązane

Zbadaliśmy potencjalną fizyczną interakcję między kompleksem Cdk5 / p35 a DRD2, ponieważ wiadomo, że wiele substratów Cdk5 jest fizycznie związanych z kompleksem Cdk5 / p35 [23], [34], [35]. Najpierw wykonano eksperyment GST. Oczyszczone rekombinowane białko GST-D2i3 inkubowano z lizatem mózgu szczura, a wytrącone osady GST analizowano na Western blotting. Jak pokazano w Rys. 3A, endogenne Cdk5 i p35 zidentyfikowano w wytrąconych osadach, wskazując fizyczną interakcję między DRD2 a kompleksem Cdk5 / p35 (Rys. 3A). Ponadto wykryto HA-Cdk5 i p35 w immunoprecypitatach anty-GFP z lizatów komórkowych HEK 293 wyrażających DRD2-GFP i Cdk5 / p35 (Rys. 3B). Ponadto przeprowadziliśmy analizy immunocytochemiczne i zaobserwowaliśmy, że DRD2-GFP, HA-Cdk5 i p35 wykazują znaczące sygnały kolokalizacji w obszarze błonowym komórek HEK 293 (Rys. 3C, górne panele). Badaliśmy również kolokalizację DRD2 i Cdk5 / p35 w kontekście neuronalnym. Zgodnie z tym DRD2-GFP wykazał również znaczącą kolokalizację z endogennymi Cdk5 i p35 w hodowanych neuronach prążkowia (DIV7), dodatkowo wspierając funkcjonalne powiązania między DRD2 i Cdk5 / p35 (Rys. 3C, dolne panele). Wyniki wskazują, że DRD2 i Cdk5 / p35 mogą tworzyć kompleks, a zatem potwierdzają pogląd, że DRD2 jest fizjologicznym substratem Cdk5.

miniatur

Rysunek 3. Cdk5 / p35 może tworzyć kompleks z DRD2.

(A) Test obniżania GST przy użyciu oczyszczonego rekombinowanego białka GST-D2i3 z ekstraktem z mózgu szczura. Opadające osady GST poddano analizie Western blotting. „Koralik” wskazuje na odciągający osad bez białek GST. (B) Immunoprecypitacja kompleksu DRD2 i Cdk5 / p35. Anty-GFP IP z lizatów z transfekowanych komórek poddano analizie Western blotting. Nawias wskazuje sygnały DRD2, a otwarty grot wskazuje nieswoiste sygnały z immunoprecypitatów anty-GFP. Przekroczone prześwietlenie dla wejść jest również pokazane po prawej stronie. (C) Analizy immunocytochemiczne DRD2 i Cdk5 / p35. Komórki HEK 293 eksprymujące DRD2-GFP i Cdk5 / p35 barwiono przeciwciałami anty-Cdk5 i anty-p35 (górne panele). DRD2-GFP eksprymowano sam w hodowanych neuronach prążkowia i barwiono przeciwciałami anty-Cdk5 i anty-p35 (dolne panele). Hoechst stosowano do barwienia jąder. Pasek skali to 5 µm. Wszystkie obrazy uzyskano za pomocą mikroskopii konfokalnej (Olympus, FluoView-1000).

doi: 10.1371 / journal.pone.0084482.g003

Fosforylacja DRD5 za pośrednictwem Cdk2 osłabia aktywność receptora

Doniesiono, że fosforylacja moduluje krytyczne właściwości GPCR, takie jak sprzęganie białka G, internalizacja receptora, lokalizacja wewnątrzkomórkowa i asocjacja z białkami modulatora [9], [11], [24], ZAindukowana gonistami internalizacja receptora jest krytycznym procesem regulacyjnym transdukcji sygnału. Badaliśmy modulację internalizacji DRD5 za pośrednictwem Cdk2. Komórki HEK 293 eksprymujące DRD2-GFP i DRD2 S321A-GFP z lub bez Cdk5 / p35 inkubowano z chinpirolem 1 µM ​​w celu wywołania stymulowanej agonistą internalizacji DRD2 (Rys. 4A). [3Sygnały H] -spiperonu komórek wyrażających DRD2-GFP były znacząco zmniejszone przy leczeniu chinpirolem 30 min i odzyskiwane w 90 min. Co ciekawe, [3Sygnały H] -spiperonu komórek eksprymujących DRD2-GFP i Cdk5 / p35 również zmniejszono przy leczeniu chinpirolem 30 min, ale nie odzyskano przy 90 min (Rys. 4A, druga sekcja). Z drugiej strony, [3Sygnały H] -spiperonu komórek eksprymujących DRD2 S321A-GFP zmniejszono w 30 min i odzyskano w 90 min, niezależnie od koekspresji z Cdk5 / p35. Poprzednie badania wykazały, że zinternalizowany DRD2 powraca do błony plazmatycznej po przedłużonej stymulacji agonistycznej [11]. TWydaje się, że fosforylacja DRD5 za pośrednictwem Cdk2 bierze udział w procesach ponownego uwrażliwienia po internalizacji DRD2 indukowanej przez agonistę.

miniatur

Rysunek 4. Fosforylacja za pośrednictwem Cdk5 osłabia ekspresję powierzchni DRD2 i sygnalizację w dół.

(A) Wyrażenie powierzchni DRD2 mierzone przez [3H] - test wiązania spiperonu. Transfekowane komórki HEK293 stymulowano chinpirolem 1 µM ​​przez wskazany czas i zbierano, a następnie 3 nM [3Leczenie H] -spiperonem przez 3 godziny. Zmierzono radioaktywność i obliczono sygnały powierzchniowe. Słupki błędów przedstawiają średnią ± SE (n = 8; * p <0.05, ** p <0.01; jednoczynnikowa ANOVA z testem post hoc Dunnetta: porównaj wszystkie kolumny z kolumną kontrolną). (B) [35S] -GTPγTest wiązania S. Błony komórkowe przygotowano z komórek transfekowanych jak wskazano. Preparaty błon inkubowano z chinpirolem 1 µM, a następnie 3 nM [35S] -GTPγS przez 90 min. Słupki błędu przedstawiają średnią ± SE (n = 8; * p <0.05, ** p <0.01, *** p <0.001; Jednokierunkowa ANOVA z testem post hoc Bonferroniego: porównaj wszystkie pary kolumn). (C) Konkurujący z chinpirolem [3H] - test wiązania spiperonu. Preparaty błon z transfekowanych komórek inkubowano z 0.01 nM [3H] -spiperon i zwiększanie stężenia chinpirolu przez 30 min. Nieliniową regresję uzyskano za pomocą GraphPad. Słupki błędów wskazują średnią ± SE (n = 3). (D) Testy immunologiczne z enzymem cAMP w transfekowanych komórkach HEK 293. Transfekowane komórki wstępnie traktowano 10 µM rolipramem przez 1 godzinę, a następnie współdziałano z 0.1 µM forskoliną i rosnącym stężeniem chinpirolu przez 30 minut. Nieliniową regresję uzyskano za pomocą GraphPad. Słupki błędów przedstawiają średnią ± SE (n = 4; ** p <0.01; dwustronne t-testy). (E) Hodowane neurony prążkowia z zarodków typu dzikiego i nokautu p35 (DIV 7) traktowano XMUMX µM ​​rolipramem dla 10 h, a następnie dopaminą 1 µM ​​dla 1 h. Słupki błędów oznaczają średnią ± SE (n = 1; **p<0.01; dwustronny t-testy).

doi: 10.1371 / journal.pone.0084482.g004

Następnie oceniliśmy potencjalną zmianę sprzężonego z agonistą sprzężenia białka G z DRD2 związaną z fosforylacją za pośrednictwem Cdk5 przy użyciu [35S] -GTPγTest wiązania S [25], [26]. DRD2-GFP i DRD2 S321A-GFP z lub bez Cdk5 / p35 ulegały ekspresji w komórkach HEK 293. Błony przygotowano i stymulowano chinpirolem 1 µM ​​i dalej umożliwiono [35S] -GTPγWłączenie S. Błona komórkowa wykazująca ekspresję DRD2-GFP i Cdk5 / p35 wykazała znaczne upośledzenie [35S] -GTPγS wiązanie w porównaniu do wszystkich innych błon komórkowych (Rys. 4B). Wyniki te wskazują, że fosforylacja, w której pośredniczy Cdk5, zmniejsza regulowane przez agonistę wiązanie białka G w DRD2.

Dodatkowo konkurujące z chinpirolem [3Testy wiązania H] -spiperonu przeprowadzono w celu zbadania potencjalnej zmiany powinowactwa agonistycznego w DRD2 przez fosforylację za pośrednictwem Cdk5. Konkurencyjne wiązanie [3Zmierzono H] -spiperon po traktowaniu wzrastających stężeń chinpirolu do preparatu błonowego z transfekcji. Konkurencyjne wiązanie chinpirolu i [3H] -spiperon w DRD2-GFP i DRD2 S321A-GFP zrobił podobny logKi wartości (-9.789 dla DRD2-GFP; -9.691 dla DRD2 S321A-GFP), wskazując, że powinowactwo liganda do DRD2 nie jest znacząco zmienione przez fosforylację za pośrednictwem Cdk5 w DRD2 (Rys. 4C).

Fosforylacja za pośrednictwem Cdk5 obniża szlak sygnałowy DRD2-cAMP

Następnie zbadaliśmy, czy modyfikacja DRD2 przez Cdk5 wpływa na dalsze szlaki sygnalizacyjne. Monitorowaliśmy zależne od DRD2 hamowanie stymulowanego forskoliną wytwarzania cAMP przez cyklazę adenylową w komórkach eksprymujących DRD2-GFP i DRD2 S321A-GFP przy użyciu enzymatycznego testu cAMP. Komórki eksprymujące DRD2 wykazywały obniżone poziomy cAMP w odpowiedzi na chinpirol w sposób zależny od dawki. Co ciekawe, koekspresja Cdk5 / p35 znacznie zmniejszyła maksymalne hamowanie tworzenia cAMP (Rys. 4D, lewy panel). Z drugiej strony, w komórkach wyrażających DRD2 S321A-GFP, formacje cAMP były skutecznie hamowane w odpowiedzi na leczenie chinpirolem, niezależnie od ekspresji Cdk5 / p35 (Rys. 4D, prawy panel). Wyniki te wskazują, że fosforylacja DRD5, w której pośredniczy Cdk2, osłabia aktywność hamującą DRD2 na szlaku sygnałowym poniżej cAMP. Aby jeszcze bardziej potwierdzić zjawiska w bardziej fizjologicznie odpowiednim otoczeniu, wykorzystaliśmy pierwotnie hodowane neurony z nokautowych zarodków z niedoborem p35, niezbędnego aktywatora Cdk5. Pierwotne hodowane neurony prążkowia traktowano dopaminą 1 µM ​​i analizowano testem immunoenzymatycznym cAMP. Neurony z myszy z nokautem p35 wykazywały obniżone poziomy cAMP w porównaniu z neuronami typu dzikiego po stymulacji dopaminą (Rys. 4E). Twspólnie stwierdziliśmy, że fosforylacja DRD5 za pośrednictwem Cdk2 powoduje zmniejszenie tonu hamowania na szlaku cAMP wywieranym przez DRD2.

Dyskusja

Zidentyfikowaliśmy DRD2 jako nowy substrat Cdk5. Fosforylacja wydaje się zmniejszać ekspresję powierzchni DRD2 poprzez wpływ na los DRD2 po internalizacji receptora, zmniejszając tym samym DRD2 Gi-sprzężenie i szlak cAMP poniżej. Ponieważ reszta fosforylacyjna S321 istnieje zarówno w długich, jak i krótkich izoformach DRD2, mechanizm zaproponowany w tym badaniu może być ogólnym sposobem regulacji sygnalizacji za pośrednictwem DRD2.

DRD2 w średnich neuronach kolczastych jest nie tylko uważany za główny podtyp receptora dopaminy, ale został także uznany za podatność na zmiany dostępności w odpowiedzi na bodźce środowiskowe. Densytyzacja wywołana przez agonistę i ponowne uwrażliwienie DRD2 były szeroko badane [11], [24]. W szczególności wiele badań wykazało, że skutkom przewlekłej ekspozycji psychostymulującej, takiej jak kokaina i amfetamina, które podnoszą pozakomórkowy poziom dopaminy w synapsie prążkowia, towarzyszą dynamiczne zmiany postsynaptycznie w DRD2 [36]. Wiadomo, że chroniczni użytkownicy kokainy mają obniżony poziom DRD2 w obszarze prążkowia, a dostępność DRD2 w jądrze półleżącym (NAcc) wykazuje ujemną korelację z poszukiwaniem leku i zachowaniami wzmacniającymi u myszy i naczelnych [37]-[39]. Odkrycia te wskazują, że funkcjonalność DRD2 jest wysoce podatna na regulację adaptacyjną lub kompensacyjną w odpowiedzi na różne bodźce, w tym chroniczną ekspozycję na lek. Nasze wyniki pokazują, że reszta S321 w trzeciej pętli wewnątrzkomórkowej DRD2 może być fosforylowana przez Cdk5, co powoduje zmniejszenie hamującego wpływu DRD2 na szlak cAMP. Ta interakcja proponuje nowy mechanizm regulacyjny związany z Cdk5 w neuronach dopaminoceptywnych, które mogą być powiązane z dynamiczną naturą dostępności powierzchni DRD2.

Należy zauważyć, że Cdk5 jest znany jako kluczowy element pośredniczenia w zmianach adaptacyjnych środowiska neuronalnego. Na przykład, strukturalne i funkcjonalne zmiany kolców dendrytycznych w neuronach obwodu limbicznego są jedną z konsekwencji powtarzanej ekspozycji psychostymulującej [40]. Zmianom tym towarzyszą różne zmiany molekularne, w tym indukcja białka wiążącego element odpowiedzi cAMP (CREB) i ΔFosB, czynniki transkrypcyjne, które wykazują trwałą regulację w górę w odpowiedzi na przewlekłe podawanie kokainy [41], [42]. Co ważne, Cdk5 jest celem ΔFosB [19], i wiele krytycznych składników zaangażowanych w dynamikę kręgosłupa dendrytycznego, takich jak PSD-95, kinaza aktywowana p21 (PAK), β-katenina i spinofilina, zgłoszono jako substraty Cdk5 [43]-[46]. Konsekwentnie, genetyczne lub farmakologiczne manipulacje aktywności Cdk5 wywołują zmiany morfologii kręgosłupa dendrytycznego i odpowiedzi behawioralnej na kokainę, sugerując krytyczne role Cdk5 w molekularnych i morfologicznych zmianach mezolimbicznych obwodów dopaminowych [47], [48]. Nasze wyniki pokazujące, że DRD2 jest nowym celem Cdk5 zapewnia dodatkowy wgląd w adaptacyjne zmiany układu dopaminowego w odpowiedzi na przewlekłe narażenie na lek z powodu późniejszej regulacji Cdk5 za pośrednictwem ΔFosB może wywołać toniczny wzrost fosforylacji DRD2 . Ponadto wiadomo, że DRD2 wpływa na liczne procesy komórkowe, w tym regulację szlaków kinazy cAMP i MAP oraz zdarzeń transkrypcyjnych w dół [42], [49]. Zatem wyniki tego badania mogą nie tylko przedstawiać bezpośrednią regulację DRD2 przez Cdk5, ale także dostarczać nowatorskiego wglądu w adaptacyjne reakcje układu dopaminowego na chroniczną ekspozycję na lek.

Autorskie Wkłady

Pomyślano i zaprojektowano eksperymenty: JJ YUP DH SKP. Wykonał eksperymenty: JJ YUP DKK YK. Analiza danych: JJ YUP DKK SL YK SAL HL YSG DH SKP. Przyczyniły się odczynniki / materiały / narzędzia do analizy: YHS. Napisał artykuł: JJ SKP.

Referencje

  1. 1. Missale C, Nash SR, Robinson SW, Jaber M, Caron MG (1998) Receptory dopaminy: od struktury do funkcjonowania. Physiol Rev 78: 189 – 225.
  2. 2. Wise RA (2002) Obwód nagrody mózgu: wgląd w nieuzasadnione zachęty. Neuron 36: 229 – 240. doi: 10.1016 / s0896-6273 (02) 00965-0
  3. Zobacz artykuł
  4. PubMed / NCBI
  5. Google Scholar
  6. Zobacz artykuł
  7. PubMed / NCBI
  8. Google Scholar
  9. Zobacz artykuł
  10. PubMed / NCBI
  11. Google Scholar
  12. Zobacz artykuł
  13. PubMed / NCBI
  14. Google Scholar
  15. Zobacz artykuł
  16. PubMed / NCBI
  17. Google Scholar
  18. Zobacz artykuł
  19. PubMed / NCBI
  20. Google Scholar
  21. Zobacz artykuł
  22. PubMed / NCBI
  23. Google Scholar
  24. Zobacz artykuł
  25. PubMed / NCBI
  26. Google Scholar
  27. Zobacz artykuł
  28. PubMed / NCBI
  29. Google Scholar
  30. Zobacz artykuł
  31. PubMed / NCBI
  32. Google Scholar
  33. Zobacz artykuł
  34. PubMed / NCBI
  35. Google Scholar
  36. Zobacz artykuł
  37. PubMed / NCBI
  38. Google Scholar
  39. Zobacz artykuł
  40. PubMed / NCBI
  41. Google Scholar
  42. Zobacz artykuł
  43. PubMed / NCBI
  44. Google Scholar
  45. Zobacz artykuł
  46. PubMed / NCBI
  47. Google Scholar
  48. Zobacz artykuł
  49. PubMed / NCBI
  50. Google Scholar
  51. Zobacz artykuł
  52. PubMed / NCBI
  53. Google Scholar
  54. Zobacz artykuł
  55. PubMed / NCBI
  56. Google Scholar
  57. Zobacz artykuł
  58. PubMed / NCBI
  59. Google Scholar
  60. Zobacz artykuł
  61. PubMed / NCBI
  62. Google Scholar
  63. Zobacz artykuł
  64. PubMed / NCBI
  65. Google Scholar
  66. Zobacz artykuł
  67. PubMed / NCBI
  68. Google Scholar
  69. Zobacz artykuł
  70. PubMed / NCBI
  71. Google Scholar
  72. Zobacz artykuł
  73. PubMed / NCBI
  74. Google Scholar
  75. Zobacz artykuł
  76. PubMed / NCBI
  77. Google Scholar
  78. Zobacz artykuł
  79. PubMed / NCBI
  80. Google Scholar
  81. Zobacz artykuł
  82. PubMed / NCBI
  83. Google Scholar
  84. Zobacz artykuł
  85. PubMed / NCBI
  86. Google Scholar
  87. Zobacz artykuł
  88. PubMed / NCBI
  89. Google Scholar
  90. Zobacz artykuł
  91. PubMed / NCBI
  92. Google Scholar
  93. Zobacz artykuł
  94. PubMed / NCBI
  95. Google Scholar
  96. Zobacz artykuł
  97. PubMed / NCBI
  98. Google Scholar
  99. Zobacz artykuł
  100. PubMed / NCBI
  101. Google Scholar
  102. Zobacz artykuł
  103. PubMed / NCBI
  104. Google Scholar
  105. Zobacz artykuł
  106. PubMed / NCBI
  107. Google Scholar
  108. Zobacz artykuł
  109. PubMed / NCBI
  110. Google Scholar
  111. Zobacz artykuł
  112. PubMed / NCBI
  113. Google Scholar
  114. Zobacz artykuł
  115. PubMed / NCBI
  116. Google Scholar
  117. Zobacz artykuł
  118. PubMed / NCBI
  119. Google Scholar
  120. Zobacz artykuł
  121. PubMed / NCBI
  122. Google Scholar
  123. Zobacz artykuł
  124. PubMed / NCBI
  125. Google Scholar
  126. Zobacz artykuł
  127. PubMed / NCBI
  128. Google Scholar
  129. Zobacz artykuł
  130. PubMed / NCBI
  131. Google Scholar
  132. Zobacz artykuł
  133. PubMed / NCBI
  134. Google Scholar
  135. Zobacz artykuł
  136. PubMed / NCBI
  137. Google Scholar
  138. Zobacz artykuł
  139. PubMed / NCBI
  140. Google Scholar
  141. Zobacz artykuł
  142. PubMed / NCBI
  143. Google Scholar
  144. 3. Neve KA, Seamans JK, Trantham-Davidson H (2004) Sygnalizacja receptora dopaminy. J Receptus Transduct sygnału Res 24: 165 – 205. doi: 10.1081 / lrst-200029981
  145. 4. Amar S, Shaltiel G, Mann L, Shamir A, Dean B i in. (2008) Możliwy udział składników sygnalizacji receptora D2 po dopaminie w patofizjologii schizofrenii. Int J Neuropsychopharmacol 11: 197 – 205. doi: 10.1017 / s1461145707007948
  146. 5. Caine SB, Negus SS, Mello NK, Patel S, Bristow L, et al. (2002) Rola receptorów dopaminopodobnych D2 w samopodawaniu kokainy: badania z udziałem myszy ze zmutowanym receptorem D2 i nowych antagonistów receptora D2. J Neurosci 22: 2977 – 2988.
  147. 6. Lee S, Jeong J, Park YU, Kwak Y, Lee SA i in. (2012) Walproinian zmienia sygnalizację dopaminy w połączeniu z indukcją ekspresji białka Par-4. PLoS One 7: e45618. doi: 10.1371 / journal.pone.0045618
  148. 7. Fishburn CS, Elazar Z, Fuchs S (1995) Różnicowa glikozylacja i transport wewnątrzkomórkowy dla długich i krótkich izoform receptora dopaminy D2. J Biol Chem 270: 29819 – 29824. doi: 10.1074 / jbc.270.50.29819
  149. 8. Czytelnik TA, Molina-Holgado E, Lima L, Boulianne S, Dewar KM (1992) Specyficzne [3H] wiązanie raclopopride do neuropatialnych receptorów dopaminy D2: rola grup disiarczkowych i sulfhydrylowych. Neurochem Res 17: 749 – 759. doi: 10.1007 / bf00969008
  150. 9. Ng GY, O'Dowd BF, Caron M, Dennis M, Brann MR, i in. (1994) Fosforylacja i palmitoilacja ludzkiego receptora dopaminy D2L w komórkach Sf9. J Neurochem 63: 1589 – 1595. doi: 10.1046 / j.1471-4159.1994.63051589.x
  151. 10. Li M, Bermak JC, Wang ZW, Zhou QY (2000) Modulacja sygnalizacji receptora dopaminy D (2) przez białko wiążące aktynę (ABP-280). Mol Pharmacol 57: 446 – 452.
  152. 11. Cho D, Zheng M, Min C, Ma L, Kurose H, i in. (2010) Endocytoza indukowana przez agonistę i fosforylacja receptora pośredniczą w resensytyzacji receptorów dopaminowych D (2). Mol Endocrinol 24: 574 – 586. doi: 10.1210 / me.2009-0369
  153. 12. Tsai LH, Delalle I, Caviness VS Jr, Chae T, Harlow E (1994) p35 jest specyficzną dla nerwów podjednostką regulacyjną kinazy zależnej od cykliny 5. Nature 371: 419 – 423. doi: 10.1038 / 371419a0
  154. 13. Dhavan R, Tsai LH (2001) Dekada CDK5. Nat Rev Mol Cell Biol 2: 749 – 759. doi: 10.1038 / 35096019
  155. 14. Fu AK, Ip NY (2007) Kinaza zależna od cykliny 5 łączy pozakomórkowe sygnały z cytoszkieletem aktyny podczas rozwoju kręgosłupa dendrytycznego. Cell Adh Migr 1: 110 – 112. doi: 10.4161 / cam.1.2.4617
  156. 15. Wang J, Liu S, Fu Y, Wang JH, Lu Y (2003) Aktywacja Cdk5 indukuje śmierć komórek CA1 hipokampa przez bezpośrednią fosforylację receptorów NMDA. Nat Neurosci 6: 1039 – 1047. doi: 10.1038 / nn1119
  157. 16. Zhang S, Edelmann L, Liu J, Crandall JE, Morabito MA (2008) Cdk5 reguluje fosforylację tyrozyny 1472 NR2B i ekspresję powierzchniową receptorów NMDA. J Neurosci 28: 415 – 424. doi: 10.1523 / jneurosci.1900-07.2008
  158. 17. Moy LY, Tsai LH (2004) Kinaza zależna od cykliny 5 fosforyluje serynę 31 hydroksylazy tyrozynowej i reguluje jej stabilność. J Biol Chem 279: 54487 – 54493. doi: 10.1074 / jbc.m406636200
  159. 18. Bibb JA, Snyder GL, Nishi A, Yan Z, Meijer L, et al. (1999) Fosforylacja DARPP-32 przez Cdk5 moduluje sygnalizację dopaminy w neuronach. Nature 402: 669 – 671.
  160. 19. Bibb JA, Chen J, Taylor JR, Svenningsson P, Nishi A i in. (2001) Wpływ przewlekłej ekspozycji na kokainę jest regulowany przez białko neuronalne Cdk5. Nature 410: 376 – 380.
  161. 20. Ohshima T, Ogawa M, Veeranna, Hirasawa M, Longenecker G, et al. (2001) Synergiczny udział kinazy zależnej od cyklin 5 / p35 i Reelin / Dab1 w pozycjonowaniu neuronów korowych w mózgu rozwijającej się myszy. Proc Natl Acad Sci USA 98: 2764 – 2769. doi: 10.1073 / pnas.051628498
  162. 21. Morabito MA, Sheng M, Tsai LH (2004) Kinaza zależna od cykliny 5 fosforyluje domenę N-końcową białka gęstości postsynaptycznej PSD-95 w neuronach. J Neurosci 24: 865 – 876. doi: 10.1523 / jneurosci.4582-03.2004
  163. 22. Park SK, Nguyen MD, Fischer A, Luke MP, Affar el B i in. (2005) Par-4 łączy sygnalizację dopaminy i depresję. Cell 122: 275 – 287. doi: 10.1016 / j.cell.2005.05.031
  164. 23. Niethammer M, Smith DS, Ayala R, Peng J, Ko J, et al. (2000) NUDEL to nowy substrat Cdk5, który łączy się z LIS1 i dyneiną cytoplazmatyczną. Neuron 28: 697 – 711. doi: 10.1016 / s0896-6273 (00) 00147-1
  165. 24. Kim KM, Valenzano KJ, Robinson SR, Yao WD, Barak LS i in. (2001) Różnicowa regulacja receptorów dopaminy D2 i D3 przez kinazy receptorów sprzężonych z białkiem G i beta-aresztowaniami. J Biol Chem 276: 37409 – 37414. doi: 10.1074 / jbc.m106728200
  166. 25. Waldhoer M, Bofill-Cardona E, Milligan G, Freissmuth M, Nanoff C (1998) Rozdzielanie różnicowe receptorów dopaminowych A1 adenozyny i D2 przez suraminę i suraminę didemetylowaną (NF037). Mol Pharmacol 53: 808 – 818.
  167. 26. Bofill-Cardona E, Kudlacek O, Yang Q, Ahorn H, Freissmuth M, et al. (2000) Wiązanie kalmoduliny z receptorem D2-dopamina zmniejsza sygnalizację receptora przez zatrzymanie przełącznika aktywacji białka G. J Biol Chem 275: 32672 – 32680. doi: 10.1074 / jbc.m002780200
  168. 27. Rozdzielenie SJ, Seeman P (1981) składników receptora dopaminy i serotoniny wiązania [3H] spiperonu z regionami mózgu szczura. Proc Natl Acad Sci USA 78: 2620 – 2624. doi: 10.1073 / pnas.78.4.2620
  169. 28. Działanie agonistyczne Gardner B, Strange PG (1998) na D2 (długie) receptory dopaminy: wiązanie ligandu i testy funkcjonalne. Br J Pharmacol 124: 978 – 984. doi: 10.1038 / sj.bjp.0701926
  170. 29. Seeman P, Tallerico T, Ko F (2003) Dopamina wypiera [3H] domperidon z miejsc o wysokim powinowactwie receptora dopaminy D2, ale nie [3H] raclopopride lub [3H] spiperonu w ośrodku izotonicznym: Implikacje dla ludzkiej pozytronowej tomografii emisyjnej. Synapse 49: 209 – 215. doi: 10.1002 / syn.10232
  171. 30. Obenauer JC, Cantley LC, Yaffe MB (2003) Scansite 2.0: Całościowe przewidywanie interakcji sygnalizacji komórkowej przy użyciu krótkich motywów sekwencji. Kwasy nukleinowe Res 31: 3635 – 3641. doi: 10.1093 / nar / gkg584
  172. 31. Liu H, Sadygov RG, Yates JR 3rd (2004) Model losowego pobierania próbek i szacowania względnej obfitości białka w proteomice shotgun. Anal Chem 76: 4193 – 4201. doi: 10.1021 / ac0498563
  173. 32. Ito K, Haga T, Lameh J, Sadee W (1999) Sekwestracja receptorów dopaminy D2 zależy od koekspresji kinaz receptorów sprzężonych z białkiem G 2 lub 5. Eur J Biochem 260: 112 – 119. doi: 10.1046 / j.1432-1327.1999.00125.x
  174. 33. Namkung Y, Sibley DR (2004) Kinaza białkowa C pośredniczy w fosforylacji, odczulaniu i transporcie receptora dopaminy D2. J Biol Chem 279: 49533 – 49541. doi: 10.1074 / jbc.m408319200
  175. 34. Wong AS, Lee RH, Cheung AY, Yeung PK, Chung SK i in. (2011) Fosforylacja endofiliny B5 za pośrednictwem Cdk1 jest wymagana do indukowanej autofagii w modelach choroby Parkinsona. Nat Cell Biol 13: 568 – 579. doi: 10.1038 / ncb2217
  176. 35. Kesavapany S, Lau KF, McLoughlin DM, Brownlees J, Ackerley S, i in. (2001) p35 / cdk5 wiąże i fosforyluje beta-kateninę i reguluje interakcję beta-katenina / presenilin-1. Eur J Neurosci 13: 241 – 247. doi: 10.1046 / j.1460-9568.2001.01376.x
  177. 36. Kuhar MJ, Ritz MC, Boja JW (1991) Hipoteza dopaminy o wzmacniających właściwościach kokainy. Trendy Neurosci 14: 299 – 302. doi: 10.1016 / 0166-2236 (91) 90141-g
  178. 37. Volkow ND, Fowler JS, Wolf AP, Schlyer D, Shiue CY, et al. (1990) Wpływ przewlekłego nadużywania kokainy na postsynaptyczne receptory dopaminy. Am J Psychiatry 147: 719 – 724.
  179. 38. Dalley JW, Fryer TD, Brichard L, Robinson ES, Theobald DE i in. (2007) Nucleus accumbens D2 / 3 receptory przewidują impulsywność cechy i wzmocnienie kokainy. Science 315: 1267 – 1270. doi: 10.1126 / science.1137073
  180. 39. Nader MA, Morgan D, Gage HD, Nader SH, Calhoun TL, et al. (2006) Obrazowanie PET receptorów dopaminy D2 podczas przewlekłego samopodawania kokainy u małp. Nat Neurosci 9: 1050 – 1056. doi: 10.1038 / nn1737
  181. 40. Robinson TE, Kolb B (1997) Trwałe modyfikacje strukturalne w jądrze półleżącym i neuronach kory przedczołowej wytwarzane przez wcześniejsze doświadczenia z amfetaminą. J Neurosci 17: 8491 – 8497.
  182. 41. Robinson TE, Kolb B (1999) Zmiany w morfologii dendrytów i kolców dendrytycznych w jądrze półleżącym i korze przedczołowej po wielokrotnym leczeniu amfetaminą lub kokainą. Eur J Neurosci 11: 1598 – 1604. doi: 10.1046 / j.1460-9568.1999.00576.x
  183. 42. McClung CA, Nestler EJ (2003) Regulacja ekspresji genów i nagrody kokainowej przez CREB i DeltaFosB. Nat Neurosci 6: 1208 – 1215. doi: 10.1038 / nn1143
  184. 43. Feng J, Yan Z, Ferreira A, Tomizawa K, Liauw JA i in. (2000) Spinofilina reguluje tworzenie i działanie kolców dendrytycznych. Proc Natl Acad Sci USA 97: 9287 – 9292. doi: 10.1073 / pnas.97.16.9287
  185. 44. Prange O, Murphy TH (2001) Modularny transport klastrów gęstości postsynaptycznej-95 i powiązanie ze stabilnymi prekursorami kręgosłupa podczas wczesnego rozwoju neuronów korowych. J Neurosci 21: 9325 – 9333.
  186. 45. Murase S, Mosser E, Schuman EM (2002) Depolaryzacja prowadzi beta-kateninę do kolców neuronalnych, promując zmiany w strukturze i funkcji synaptycznej. Neuron 35: 91 – 105. doi: 10.1016 / s0896-6273 (02) 00764-x
  187. 46. Hayashi ML, Choi SY, Rao BS, Jung HY, Lee HK i in. (2004) Zmieniona korowa synaptyczna morfologia i upośledzona konsolidacja pamięci u myszy transgenicznych PAK swoistych dla przodomózgowia. Neuron 42: 773 – 787. doi: 10.1016 / j.neuron.2004.05.003
  188. 47. Benavides DR, Quinn JJ, Zhong P, Hawasli AH, DiLeone RJ, et al. (2007) Cdk5 moduluje nagrodę kokainową, motywację i pobudliwość neuronów prążkowia. J Neurosci 27: 12967 – 12976. doi: 10.1523 / jneurosci.4061-07.2007
  189. 48. Meyer DA, Richer E, Benkovic SA, Hayashi K, Kansy JW i in. (2008) Rozregulowanie prążkowia Cdk5 zmienia odpowiedź lokomotoryczną na kokainę, uczenie się motoryczne i morfologię dendrytyczną. Proc Natl Acad Sci USA 105: 18561 – 18566. doi: 10.1073 / pnas.0806078105
  190. 49. Impey S, Obrietan K, Storm DR (1999) Tworzenie nowych połączeń: rola sygnalizacji kinazy ERK / MAP w plastyczności neuronów. Neuron 23: 11 – 14. doi: 10.1016 / s0896-6273 (00) 80747-3