El factor de respuesta sérica promueve la resistencia al estrés social crónico a través de la inducción de DeltaFosB. (2010)

COMENTARIOS: Aunque tanto el estrés como las drogas de abuso y ciertas recompensas naturales desencadenan una acumulación de DeltaFosB, el estrés activa diferentes células posteriores y luego diferentes receptores y genes. En otras palabras, las adicciones y la resistencia al estrés dependen de mecanismos fundamentalmente diferentes.

Estudio completo

J Neurosci. 2010 Oct 27; 30 (43): 14585-92.

Vialou V, Maze I, Renthal W, LaPlant QC, Watts EL, Mouzon E, Ghose S, Tamminga CA, Nestler EJ.

Fuente

Departamento de Neurociencia de Fishberg, Escuela de Medicina Mount Sinai, Nueva York, Nueva York 10029, EE. UU.

Resumen

Los mecanismos moleculares subyacentes al estrés y las adaptaciones neuronales inducidas por fármacos no se comprenden completamente. Una molécula implicada en tales adaptaciones es ΔFosB, un factor de transcripción que se acumula en el núcleo de roedor accumbens (NAc), una región clave de recompensa cerebral, en respuesta a estrés crónico o exposición repetida a drogas de abuso. TLos mecanismos de transcripción aguas arriba que controlan la inducción de ΔFosB por estos estímulos ambientales siguen siendo esquivos. Aquí, identificamos el factor de transcripción dependiente de la actividad, el factor de respuesta del suero (SRF), como un nuevo mediador de estrés en la fase inicial, pero no cocaína-, ΔFosB inducido. La SRF está regulada a la baja en NAc tanto de pacientes humanos deprimidos como en ratones expuestos crónicamente al estrés por derrota social. Esta regulación a la baja de SRF está ausente en los animales resilientes. A través del uso de mutagénesis inducible, mostramos que la inducción de stressFosB mediada por el estrés, que ocurre predominantemente en ratones resistentes, depende de la expresión de SRF en esta región del cerebro. Además, la eliminación genética específica de NAc de la SRF promueve una variedad de fenotipos similares a los prodepresores y proanxiety y hace a los animales más sensibles a los efectos nocivos del estrés crónico. En contraste, demostramos que la SRF no desempeña un papel en la acumulación de osFosB en NAc en respuesta a la exposición crónica a la cocaína. Además, la eliminación específica de NAF de SRF no tiene ningún efecto sobre los comportamientos inducidos por la cocaína, lo que indica que el estrés por derrota social crónica y la exposición repetida a la cocaína regulan la acumulación de ΔFosB y la sensibilidad de comportamiento a través de mecanismos independientes.

Introducción

El núcleo accumbens (NAc), una región clave para la recompensa del cerebro, es importante para la integración de entradas sensoriales y cognitivas que conducen conductas motivacionales relevantes en respuesta a estímulos ambientales (Nestler y Carlezon, 2006; Sesack y Grace, 2010). La NAc también se ha implicado en anomalías de comportamiento asociadas con la adicción a las drogas y la depresión. En consecuencia, se ha demostrado que el tratamiento de la NAc con estimulación cerebral profunda alivia los comportamientos similares a la depresión y la adicción tanto en humanos como en roedores (Schlaepfer et al., 2008; Vassoler et al., 2008; Heinze et al., 2009; Kuhn et al., 2009).

La exposición repetida a drogas de abuso o estrés induce patrones alterados de expresión génica en NAc, potencialmente subyacentes a la cronicidad de la adicción y la depresión (Berton et al., 2006; Krishnan et al., 2007; Maze et al., 2010; Vialou et al ., 2010). Curiosamente, el factor de transcripción ΔFosB, un producto de empalme del gen fosB, se acumula en NAc en respuesta a la exposición repetida al fármaco o al estrés (Nestler, 2008; Perrotti et al., 2008; Vialou et al., 2010). ΔFosB se ha propuesto como un posible cambio molecular que guía la transición del uso recreativo de drogas al estado de adicción crónica (Nestler et al., 1999; McClung et al., 2004; Renthal et al., 2009), ya que su acumulación en NAc mejora Respuestas gratificantes a varias drogas de abuso. Más recientemente, se ha dilucidado el papel de la inducción de ΔFosB en NAc después de un estrés de derrota social crónico (Nikulina et al., 2008; Vialou et al., 2010): ΔFosB promueve respuestas de afrontamiento activas ante estímulos estresantes y aumenta la resiliencia. Aunque la inducción de ΔFosB se produce de una manera dependiente del estímulo, los mecanismos responsables de la acumulación de osFosB inducida por drogas y estrés en NAc siguen siendo desconocidos.

El factor de respuesta sérica (SRF) es un factor de transcripción necesario para la activación transcripcional dependiente de la actividad de varios genes tempranos inmediatos, incluidos c-fos, fosb, Egr1 y Arc (Knöll y Nordheim, 2009). Estudios recientes han demostrado los efectos de SRF sobre las propiedades morfológicas y citoarquitectónicas de las neuronas, incluida la regulación de la actividad sináptica y la formación de circuitos en el cerebro adulto (Knöll y Nordheim, 2009). Estos hallazgos nos llevaron a investigar si la SRF está regulada funcionalmente por la exposición crónica a drogas de abuso o estrés, así como el impacto potencial de dicha regulación en la inducción de ΔFosB en estas condiciones.

Aquí, describimos un mecanismo novedoso a través del cual la regulación a la baja de SRF en NAc promueve fenotipos prodepresores y ansiogénicos, lo que finalmente aumenta la vulnerabilidad de un animal a los efectos deletéreos del estrés crónico.. Estos efectos están mediados, en parte, por la pérdida de inducción de ΔFosB en NAc de animales estresados. Las disminuciones observadas en la expresión de SRF y ΔFosB en tejido de NAc post mortem obtenido de pacientes deprimidos apoyan la relevancia de nuestros hallazgos para la depresión humana. Curiosamente, este mecanismo que controla la acumulación de ΔFosB parece ser específico del estrés: la exposición crónica a la cocaína no tiene ningún efecto sobre la expresión de SRF, la deleción de SRF del NAc no tiene ningún impacto en la acumulación de ΔFosB después de la exposición crónica a la cocaína, y dicha deleción de SRF no tiene ningún efecto sobre la cocaína. conductas inducidas. Esta nueva interacción entre SRF y ΔFosB, en el contexto del estrés, puede representar un importante mecanismo homeostático que regula la sensibilidad de un individuo al estrés crónico.

Materiales y Métodos

Animales

Se usaron ratones machos C57BL / 6J de ocho semanas de edad (Laboratorio Jackson) en todos los experimentos de comportamiento y bioquímicos. Todos los animales se habituaron a la instalación de animales durante al menos 1 semana antes de las manipulaciones experimentales y se mantuvieron en 23 – 25 ° C en un ciclo de luz / oscuridad 12 h (luces encendidas de 7: 00 AM a 7: 00 PM) con ad libitum Acceso a comida y agua. Los experimentos se realizaron de acuerdo con los lineamientos de la Society for Neuroscience y el comité institucional de cuidado y uso de animales en la Escuela de Medicina Mount Sinai.

Para los experimentos con cocaína [Western blotting e inmunoprecipitación de cromatina cuantitativa (ChIP)], se utilizaron ratones C8BL / 10J de 57 a 6 de una semana de edad. Los animales recibieron siete inyecciones intraperitoneales diarias de solución salina o cocaína (20 mg / kg de cocaína-HCl; Sigma). Los ratones se utilizaron 24 h después del tratamiento final. Para los experimentos de comportamiento, los ratones se alojaron individualmente después de la cirugía y se trataron con 10 mg / kg (sensibilización locomotora) o 7.5 mg / kg (preferencia de lugar condicionado) cocaína-HCl por vía intraperitoneal, como se describe a continuación.

Se generaron ratones Srffl / fl como se describió previamente (Ramanan et al., 2005). La eliminación específica específica de NAc de Srf se logró mediante una inyección estereotáxica y la sobreexpresión viral posterior de la recombinasa Cre (Cre) fusionada a la proteína verde fluorescente (GFP) utilizando vectores de virus adenoasociados (AAV). Se utilizó un Cre que no se elimina a sí mismo. AAV-GFP se inyectó en lugar de AAV-Cre-GFP en ratones Srffl / fl como control. Brevemente, los ratones se anestesiaron utilizando una mezcla de ketamina (10 mg / kg) y xilazina (10 mg / kg), con las siguientes coordenadas estereotáxicas utilizadas para el suministro viral: + 1.6 (anterior / posterior), + 1.5 (lateral), 4.4 (dorsal / ventral) en un ángulo de 10 ° desde la línea media (en relación con bregma). Se administró un total de 0.5 μl de virus purificado bilateralmente durante un período mínimo de 5 (0.1 μl / min), seguido de 5 min de descanso. Los ratones se analizaron 2 semanas después de la cirugía, cuando la expresión viral era máxima, y ​​los sitios de inyección viral se confirmaron para todos los animales utilizando métodos histológicos estándar. La eficacia de la expresión de Cre mediada por virus se validó mediante inmunohistoquímica y mediante PCR de transcriptasa inversa para Srf realizada en punzones de NAc microdiseccionados de animales que recibieron AAV-Cre-GFP y AAV-GFP en el NAc. Los virus AAV-GFP y AAV-Cre-GFP se generaron como se describió anteriormente (Maze et al., 2010).

Procedimientos de comportamiento

El estrés de la derrota social.

Los ratones C57BL / 6J fueron sometidos a estrés por derrota social crónica durante días consecutivos de 10 como se describió anteriormente (Berton y otros, 2006; Krishnan y otros, 2007; Vialou y otros, 2010). Brevemente, cada ratón se expuso a un ratón reproductor CD1 retirado, desconocido y agresivo, para 5 min por día. Tras la interacción directa con el agresor CD1, los animales se colocaron en un compartimento adyacente de la misma jaula para el siguiente 24 h con contacto sensorial pero no físico. Los animales de control se alojaron en jaulas equivalentes pero con miembros de la misma cepa. Las pruebas de interacción social se realizaron 24 h después del último día de la derrota.

La evitación social hacia un ratón macho CD1 desconocido se evaluó de acuerdo con los protocolos publicados (Berton et al., 2006; Krishnan et al., 2007; Vialou et al., 2010). El ratón experimental se introdujo por primera vez en un campo abierto que contenía una jaula de malla de alambre vacía durante 2.5 min. Durante una segunda sesión, se introdujo un ratón macho CD1 desconocido en la jaula con cables. Se midió el tiempo pasado en la zona de interacción (un pasillo de 8 cm de ancho que rodea la jaula). La segregación de los ratones derrotados en subpoblaciones susceptibles y resistentes se realizó como se describió anteriormente (Krishnan et al., 2007; Vialou et al., 2010). Dado que la mayoría de los ratones de control pasaron más tiempo interactuando con un objetivo social que con un recinto de objetivo vacío, se estableció como límite una relación de interacción de 100 (el mismo tiempo pasado en la zona de interacción en presencia o ausencia de un objetivo social). Los ratones con puntuaciones <100 se etiquetaron como susceptibles, y aquellos con puntuaciones ≥ 100 se etiquetaron como resistentes. Amplios análisis de comportamiento, bioquímicos y electrofisiológicos respaldan la validez de estas distintas subpoblaciones susceptibles y resistentes (Krishnan et al., 2007; Wilkinson et al., 2009; Vialou et al., 2010).

Para examinar la vulnerabilidad de los ratones Srffl / fl al estrés por derrota social, los ratones, inyectados bilateralmente con AAV-GFP o AAV-Cre-GFP, fueron sometidos a tres derrotas consecutivas el mismo día y luego se probaron para la interacción social 24 h más tarde. Este procedimiento de derrota submáxima se ha validado previamente para revelar los fenotipos de prosusceptibilidad después de manipulaciones genéticas (Krishnan et al., 2007; Vialou et al., 2010).

Indefensión aprendida.

Los ratones Srffl / fl que sobreexpresan AAV-GFP o AAV-Cre-GFP se sometieron al procedimiento de impotencia aprendido como se describió anteriormente (Berton et al., 2007). Brevemente, los ratones se expusieron a choques de pies ineludibles e intermitentes para 1 h durante 2 días consecutivos (0.45 mA, duración de 5). El día de la prueba, los ratones fueron reintroducidos en la caja para pruebas de escape consecutivas de 15. Durante cada prueba, se administró un shock continuo y se dio a los ratones la oportunidad de escapar entrando en el compartimento adyacente, no electrificado. Tras un escape exitoso, la puerta se cerró automáticamente y se registró la latencia del escape. Cuando los ratones no escaparon dentro de 25 s, el ensayo finalizó y se registró como un fracaso. Estudios anteriores han demostrado que la expresión viral en NAc y otras regiones no tiene ningún efecto sobre el comportamiento de escape inicial en ausencia de estrés (Newton et al., 2002; Berton et al., 2007).

Sensibilización locomotora.

Dos semanas después de las inyecciones intra-NAc de AAV-GFP o AAV-Cre-GFP, los ratones Srffl / fl se sometieron a sensibilización locomotora. Los ratones se habituaron a la arena locomotora durante 30 minutos por día durante 4 días. Después de la habituación, los animales se inyectaron por vía intraperitoneal con 10 mg / kg de cocaína-HCl y se colocaron en las cajas locomotoras. Las actividades locomotoras de los animales se registraron utilizando un sistema de haz fotoeléctrico (San Diego Instruments) como interrupciones del haz ambulatorio durante 30 minutos por día. La sensibilización locomotora se registró durante un período de 6 d.

Preferencia de lugar condicionado.

El procedimiento de acondicionamiento del lugar se realizó como se describió anteriormente (Maze et al., 2010), con las siguientes modificaciones. Brevemente, 18 d después de las infusiones intra-NAc de AAV-GFP o AAV-Cre-GFP en ratones Srffl / fl, los animales se colocaron en las cámaras de acondicionamiento, que consistían en tres entornos contextualmente distintos. Los ratones que mostraban una preferencia significativa por cualquiera de las dos cámaras de acondicionamiento fueron excluidos del estudio (<10% de todos los animales). Los grupos de acondicionamiento se equilibraron aún más para ajustar cualquier sesgo de la cámara que aún pueda existir. En los días siguientes, los animales fueron inyectados con solución salina y confinados en una cámara por la tarde durante 30 minutos y luego inyectados con cocaína (7.5 mg / kg, ip) y confinados durante 30 minutos a la otra cámara al día siguiente, lo que equivale a un total de dos rondas de entrenamiento de asociación por tratamiento (dos combinaciones de solución salina y dos de cocaína). El día de la prueba, los ratones se volvieron a colocar en el aparato sin tratamiento durante 20 minutos y se probaron para evaluar la preferencia lateral. Las respuestas locomotoras a la cocaína se evaluaron mediante interrupciones del haz en las cámaras emparejadas de cocaína para garantizar la eficacia del tratamiento antidrogas. Para todos los grupos, se evaluó la locomoción inicial en respuesta a la solución salina para asegurar que la locomoción no se viera afectada por el tratamiento viral.

Otras pruebas de comportamiento.

Los ratones Srffl / fl se analizaron en pruebas de campo abierto, luz / oscuridad y natación forzada según los protocolos publicados (Vialou et al., 2010). La actividad de los ratones en campo abierto se registró para 5 min utilizando un sistema de seguimiento de video (Ethovision) en condiciones de luz roja. Para la prueba de luz / oscuridad, a los ratones se les permitió explorar libremente una caja de dos cámaras compuesta por una gran arena iluminada conectada a una arena cerrada más pequeña. Los ratones se analizaron durante un período de 5 min para evaluar la cantidad de tiempo que pasaron en cada recinto. En las pruebas de campo abierto y luz / oscuridad, el tiempo pasado en el centro y la luz, respectivamente, se evaluó como un índice inverso de respuestas relacionadas con la ansiedad. Se realizó una prueba de natación forzada 1 d durante un período de 5 min. El aumento en el tiempo de inmovilidad durante la prueba de natación forzada se interpretó como un comportamiento similar al de un adeptor. La prueba de natación forzada 1 d se ha utilizado ampliamente en ratones y se ha validado como una medida de validez predictiva, ya que las terapias antidepresivas reducen los tiempos de inmovilidad.

Inmunohistoquímica

Los ratones Srffl / fl fueron anestesiados y perfundidos intracardialmente con 4% paraformaldehído / PBS. Los cerebros fueron removidos y crioprotegidos en 30% sacarosa / PBS. Las secciones coronales (30 μm) se cortaron en un microtomo de congelación y se procesaron para análisis inmunohistoquímicos. La validación de la eliminación de Srffl / fl se realizó utilizando un anticuerpo policlonal dirigido contra SRF (1 / 2000; Santa Cruz Biotechnology). La expresión de Cre se confirmó mediante la expresión de GFP (pollo policlonal, 1 / 8000, Aves Labs) en los cerebros disecados, ya que el Cre se fusiona con GFP. Para la cuantificación de la inducción de ΔFosB después del estrés por derrota social en ratones knock-out Srffl / fl, se detectó ΔFosB utilizando un anticuerpo policlonal de conejo producido contra la región N-terminal de la proteína (1 / 1000; Santa Cruz Biotecnología) Las imágenes se tomaron con un microscopio confocal (aumento 20 ×; Zeiss). La cantidad de células inmunopositivas GFP contabilizadas como negativa y positiva para la inmunorreactividad a BFosB se cuantificó en imágenes múltiples para cada animal, con valores medios calculados posteriormente para cada animal. Cada animal fue considerado una observación individual para análisis estadístico.

Tejido humano postmortem NAc

El tejido cerebral humano post mórtem se obtuvo de la Dallas Brain Collection, donde se recolecta tejido de la Oficina del Médico Forense de Dallas y el Programa de Trasplante de Tejido de la Universidad de Texas (UT) Southwestern después del consentimiento del pariente más cercano. Se analizó el tejido de machos y hembras emparejados por edad, intervalo post mórtem, número de integridad del ARN (RIN) y pH. Factores agónicos específicos, que incluyen coma, hipoxia, pirexia, convulsiones, deshidratación, hipoglucemia, insuficiencia orgánica múltiple e ingestión de sustancias neurotóxicas en el momento de la muerte, influyen en la integridad del ARN en los tejidos cerebrales post mortem (Tomita et al., 2004). Usamos una escala de factor agonal (AFS) para caracterizar muestras de tejido en cada una de estas ocho condiciones. A la ausencia de un factor agónico se le asignó una puntuación de 0 y su presencia se puntuó como 1 para proporcionar una puntuación total de AFS entre 0 y 8. El tejido con puntuaciones agónicas de 0 o 1 refleja muestras de buena calidad; los datos demográficos del caso se dan en la Tabla 1. Los valores altos de RIN confirmaron una calidad de tejido excepcional. Los casos se sometieron a una disección estándar antes de la congelación rápida en isopentano -40 ° C y el almacenamiento a -80 ° C; Se realizó una disección adicional de NAc sobre tejido congelado. La junta de revisión institucional de UT Southwestern revisó y aprobó la recolección de este tejido para uso en investigación. Posteriormente, se realizó una entrevista directa al informante para cada caso de depresión, donde se documentó información sobre la enfermedad del caso; Dos psiquiatras de investigación realizaron un diagnóstico de consenso de trastorno depresivo mayor utilizando los criterios del DSM-IV. Ninguno de los casos incluidos en este estudio tuvo pruebas de toxicología de la sangre positivas para drogas de abuso, alcohol o medicamentos recetados distintos de los antidepresivos. A pesar del tratamiento con antidepresivos, todos los sujetos estaban clínicamente deprimidos en el momento de la muerte. Las muestras de tejido se distribuyeron de forma ciega para su análisis.

Tabla 1.

Datos demográficos para estudio post mortem humano

Western blotting

Las muestras de NAc de humanos y ratones se procesaron como se describió anteriormente (Maze et al., 2010). El tejido congelado se sonicó en un tampón de lisis 5 mM HEPES que contenía 1% SDS con proteasa (Roche) e inhibidores de fosfatasa (Sigma). Las concentraciones de proteína se determinaron mediante el ensayo de proteína Dc (Bio-Rad). Cantidades iguales de muestras de proteínas se sometieron a SDS-PAGE y transferencia de Western. Las transferencias Western se sondaron utilizando un anticuerpo para SRF (1 / 2000; Santa Cruz Biotechnology) o GAPDH (1 / 1500; Abcam) y luego se escanearon y cuantificaron utilizando el sistema de imágenes Odyssey (Licor).

Aislamiento de ARN y PCR cuantitativa.

El aislamiento de ARN, la PCR cuantitativa (qPCR) y el análisis de datos se realizaron como se describió anteriormente (Maze et al., 2010; Vialou et al., 2010). Brevemente, el ARN se aisló con reactivo de TriZol (Invitrogen) y se purificó adicionalmente con micro kits RNAeasy de Qiagen. Se determinó que todas las muestras de ARN tenían valores 260 / 280 y 260 / 230 ≥1.8. La transcripción inversa se realizó utilizando iScript (Bio-Rad). qPCR utilizando SYBR verde (Quanta) se realizó con un sistema de PCR 7900HT RT de Applied Biosystems con los siguientes parámetros de ciclo: 2 min a 95 ° C; Ciclos 40 de 95 ° C para 15 s, 59 ° C para 30 s, 72 ° C para 33 s; y calentamiento gradual a 95 ° C para generar curvas de disociación para la confirmación de productos de PCR individuales. Los datos se analizaron comparando los valores de C (t) de la condición de tratamiento (control frente a ratones susceptibles o resistentes, o controles humanos frente a pacientes deprimidos) con el método ΔΔC (t) (Tsankova et al., 2006). PrimFosB qPCR primers: Foward, AGGCAGAGCTCTGGAGTCGGAGAT y reverso, GCCGAGGACTTGAACTTCACTCG.

Chip

ChIP se realizó como se describió previamente (Maze et al., 2010) en punzones NAc bilaterales combinados de ratones control, susceptibles y resistentes (cuatro punzones de calibre 14 / ratón) 1 h después de la última experiencia de derrota y de salino y cocaína Los animales tratados 24 h después del tratamiento final. El tejido se reticuló en 1% formaldehído. La fijación se interrumpió posteriormente mediante la aplicación de glicina, y el tejido se lavó y se mantuvo a -80 ° C hasta su uso. La cromatina cortada se incubó durante la noche con un anticuerpo anti-SRF (Santa Cruz Biotechnology) previamente unido a perlas magnéticas (Dynabeads M-280; Invitrogen). Después de la reticulación inversa y la purificación del ADN, la unión de SRF al promotor de fosb se determinó mediante qPCR utilizando cebadores que abarcan una región del promotor de fosb que contiene dos sitios de unión del elemento de respuesta del suero. Los despliegues SRF se enriquecieron significativamente en comparación con los controles sin anticuerpos. Cebadores promotores del gen fosb del ratón: adelante, CCCTCTGACGTAATTGCTAGG y reverso, ACCTCCCAAACTCTCCCTTC.

Análisis estadístico

Se utilizaron ANOVA unidireccionales para comparar medias entre ratones de control, susceptibles y resistentes en análisis bioquímicos y de comportamiento. Se utilizaron ANOVA bidireccionales para comparar la inducción de ΔFosB por derrota social en ratones knock-out locales de Srf, así como para comparar el efecto de knock-out de Srf en los protocolos de sensibilización locomotora y desamparo aprendido. Se utilizaron pruebas t de Student para comparar medias en el efecto de la eliminación de Srf sobre la inducción de ΔFosB, y entre grupos en el análisis de tejido post mortem humano y de ChIP de ratón. Las diferencias entre las condiciones experimentales se consideraron estadísticamente significativas cuando p ≤ 0.05.

Resultados

Expresión de SRF y ΔFosB en la depresión humana y ratones socialmente derrotados

Para explorar un papel potencial de SRF en el desarrollo de comportamientos depresivos, primero evaluamos la expresión de la proteína SRF en NAc de pacientes humanos con depresión post mórtem. Los sujetos deprimidos mostraron niveles de SRF significativamente reducidos en NAc en comparación con sus controles de la misma edad (t (19) = 1.9; p <0.05) (Fig. 1A). Dado el papel de SRF en la regulación de la expresión génica temprana inmediata dependiente de la actividad (Ramanan et al., 2005), planteamos la hipótesis de que SRF puede estar implicado en el control de la expresión de ΔFosB en esta región del cerebro. En apoyo de esta hipótesis, observamos que los niveles de ARNm de Δfosb también se redujeron significativamente en la NAc de humanos deprimidos (t (16) = 1.8; p <0.05) (Fig. 1B). Esto también es consistente con hallazgos recientes de niveles reducidos de proteína ΔFosB bajo estas condiciones (Vialou et al., 2010).

Figura 1.

La represión de SRF inducida por estrés crónico se correlaciona con una disminución de la transcripción de ΔFosB en NAc. A, B, los pacientes con depresión humana postmortem muestran niveles reducidos de proteína SRF (n = 10 / grupo; A) y expresión de ARNm de Δfosb en NAc (n = 8 / grupo; B). C, Los ratones sometidos a estrés por derrota social crónica (10 días) se agruparon en subpoblaciones susceptibles y resistentes. D, El estrés por derrota social crónica reduce los niveles de proteína SRF en NAc de ratones susceptibles, pero no en ratones resistentes, en comparación con los controles 24 h después de la prueba de interacción social mostrada en C. E, los niveles de ARNm de ΔfosB en NAc no se alteran en ratones susceptibles, pero significativamente regulado positivamente en animales resilientes (n = 7-15 / grupo). F, la proteína SRF muestra un aumento de la unión al promotor del gen fosb después del estrés por derrota social crónica solo en ratones resistentes y no susceptibles (n = 5 / grupo). Los datos mostrados se expresan como media ± SEM (representados como barras de error). Con., Control; Dep., Deprimido; Sus., Susceptible; Res., Resiliente. * p <0.05 frente al control; *** p <0.001 frente al control; #p <0.05 frente a susceptible; ## p <0.01 frente a susceptibles; ### p <0.001 frente a susceptibles.

Para ampliar estos hallazgos, utilizamos el protocolo de estrés por derrota social crónica en ratones. Dos grupos distinguibles de ratones derrotados, susceptibles y resistentes, fueron evidentes (Krishnan et al., 2007) basados ​​en una medida de evitación social, en la que los animales susceptibles mostraron una interacción social significativamente reducida en comparación con los animales de control y resistentes (F (2,23, 157.2) = 0.001; p <0.001; pruebas t con corrección de Bonferroni, susceptible vs control, p <0.05; resiliente vs control, p <0.01; resiliente vs susceptible, p <1) (Fig.2,32C). Dos días después del último episodio de derrota, se analizaron ratones de control susceptibles, resilientes y no derrotados para determinar la expresión de SRF en NAc. De manera similar a los hallazgos en la depresión humana, los niveles de proteína SRF se redujeron significativamente en NAc de ratones susceptibles en comparación con los controles, mientras que los niveles de SRF no se vieron afectados en NAc de ratones resilientes (F (4.7) = 0.05; p <0.05; pruebas t con un Corrección de Bonferroni, susceptible vs control, p <0.05; resiliente vs susceptible, p <1) (Fig. XNUMXD).

A continuación, examinamos la expresión de ARNm de Δfosb en NAc de estos tres grupos de animales y observamos un aumento significativo en la expresión de Δfosb solo en animales resilientes, con una tendencia pero no un aumento significativo observado en ratones susceptibles (t (14) = 2.1; p <0.05 ) (Figura 1E). Para investigar más a fondo las posibles interacciones entre los niveles de SRF y la transcripción de Δfosb, utilizamos ChIP para examinar si la unión de SRF al promotor del gen fosb se alteró después del estrés por derrota social crónica en cohortes separadas de ratones susceptibles y resistentes. Los animales resilientes mostraron una unión de SRF significativamente mejorada al promotor fosb en NAc en comparación con los controles (t (8) = 2.1; p <0.05) así como en comparación con los ratones susceptibles (t (8) = 2.0; p <0.05). No se observaron diferencias entre los controles y los ratones susceptibles, probablemente reflejando la falta de inducción de SRF en los ratones susceptibles (Fig. 1F).

Para confirmar el papel de SRF en la regulación de ΔFosB después del estrés por derrota social crónica, se utilizaron ratones Srffl / fl para examinar el efecto de una deleción selectiva de SRF del NAc sobre la inducción de estrés de ΔFosB. Se inyectaron estereotáxicamente ratones Srffl / fl intra-NAc con vectores AAV que expresan GFP o Cre-GFP. Se confirmó inmunohistoquímicamente una desactivación específica de NAc de SRF inducida por AAV-Cre-GFP (Fig. 2A). De hecho, no hubo superposición entre la tinción de SRF y la expresión de Cre, lo que demuestra la eficacia del knock-out. En perforaciones NAc microdiseccionadas, detectamos una disminución significativa del 50% en los niveles de proteína SRF (t (11) = 4.3; p <0.001). La magnitud probablemente refleja el hecho de que una fracción del tejido en tales microdisecciones no está infectado por virus.

Figura 2.

SRF media la inducción de ΔFosB por estrés de derrota social crónica. A, La inyección de AAV-Cre-GFP en el NAc de ratones Srffl / fl da como resultado la desactivación de la proteína SRF en neuronas que expresan Cre. La inyección de AAV-GFP no tuvo un efecto apreciable. B, Dicha eliminación selectiva de SRF de NAc bloquea completamente la inducción de ΔFosB en NAc después del estrés por derrota social crónica (n = 4 / grupo). Los datos mostrados se expresan como media ± SEM (representados como barras de error). * p <0.05 frente al control de AAV-GFP; ** p <0.01 frente a la derrota de AAV-GFP.

A continuación, realizamos inmunohistoquímica cuantitativa para ΔFosB en NAc de ratones derrotados Srffl / fl inyectados intra-NAc con AAV-Cre-GFP o AAV-GFP. Después del estrés por derrota social crónica, la expresión de ΔFosB se indujo significativamente en NAc de animales inyectados con AAV-GFP (interacción virus × tratamiento, F (1,12) = 6.4; pruebas t con una corrección de Bonferroni, control vs derrota, p <0.05; AAV-Cre frente a AAV-GFP, p <0.01). Sin embargo, esta inducción no se observó en ratones Srffl / fl que recibieron AAV-Cre-GFP (Fig. 2B), lo que demuestra que la inducción de ΔFosB en NAc por estrés crónico requiere SRF.

La eliminación de SRF en NAc promueve fenotipos de pro-ansiedad y pro-ansiedad

Dado que la inducción de ΔFosB por el estrés por derrota social crónica ha demostrado previamente que media la resiliencia (Vialou et al., 2010), planteamos la hipótesis de que la regulación a la baja de SRF, y la pérdida resultante de la inducción de ΔFosB, en animales susceptibles puede representar una adaptación negativa que, en última instancia, produce animales más vulnerables a los efectos nocivos del estrés. Para probar esta hipótesis, indujimos una deleción local específica de NAc del gen Srf en ratones adultos Srffl / fl como se describió anteriormente, y los ratones resultantes y sus controles se probaron en una batería de paradigmas de comportamiento para evaluar la depresión y la ansiedad de referencia. como comportamiento. La deleción local de NAc de SRF promovió un efecto similar a la prodepresión según se midió mediante la prueba de nado forzado (t (30) = 2.5; p <0.05), así como un efecto ansiogénico medido en campo abierto (t (38) = 1.9; p <0.05) y pruebas de luz / oscuridad (t (8) = 1.9; p <0.05). Por lo tanto, los ratones Srffl / fl que recibieron AAV-Cre-GFP en el NAc mostraron una menor latencia a la inmovilidad en la prueba de nado forzado, menos tiempo en el centro de un campo abierto y menos tiempo en el compartimento claro de una caja clara / oscura. en comparación con los animales inyectados con AAV-GFP (Fig. 3A-C). Sin embargo, la deleción intra-NAc de SRF no alteró los niveles basales de locomoción, lo que sugiere que los efectos conductuales observados en los animales deficientes en SRF no se debieron a anomalías en la actividad locomotora general (Fig. 3D). Estos datos son interesantes a la luz de informes anteriores que sugieren que, aunque ΔFosB en NAc regula comportamientos de tipo depresivo, no parece estar involucrado en respuestas relacionadas con la ansiedad (Vialou et al., 2010). Nuestros hallazgos actuales de que la pérdida de SRF induce respuestas ansiogénicas sugieren que lo hace a través de objetivos distintos de ΔFosB.

Figura 3.

La eliminación de SRF de la NAc promueve fenotipos de tipo prodepresión y proansiedad. A – C, eliminación selectiva de SRF de NAc, lograda mediante la inyección de AAV-Cre-GFP en la NAc de ratones Srffl / fl, reduce la latencia a la inmovilidad en la prueba de nado forzado (n = 14-18 / grupo; A) y reduce el tiempo pasado en el centro y el tiempo pasado en el compartimento de luz en las pruebas de campo abierto (B) y luz / oscuridad (C), respectivamente (n = 5-15 / grupo). D, No se observaron diferencias en la actividad locomotora basal en el campo abierto de ratones que recibieron inyecciones intra-NAc de AAV-GFP o AAV-Cre-GFP. E, F, mayor susceptibilidad a la indefensión aprendida (n = 7-8 / grupo; E) y al estrés por derrota social (n = 5-6 / grupo; F), medidos, respectivamente, por la latencia para escapar y el tiempo de interacción social . Los datos mostrados se expresan como media ± SEM (representados como barras de error). * p <0.05 frente a GFP o frente a objetivo ausente; ** p <0.01 frente a GFP; *** p <0.001 frente a GFP.

A continuación, estudiamos si la deleción de SRF en NAc también aumenta la vulnerabilidad de un animal a los efectos perjudiciales del estrés repetido. Se examinaron ratones Srffl / fl, inyectados con AAV-Cre-GFP o AAV-GFP en el NAc, en dos modelos de depresión, desamparo aprendido y estrés por derrota social crónica. En la indefensión aprendida, los animales Srffl / fl que recibieron AAV-Cre-GFP mostraron una mayor latencia para escapar de un choque en el pie después de una exposición previa a un estrés de choque en el pie ineludible (interacción tratamiento × ensayos, F (14,180) = 10.2; pruebas t con una corrección de Bonferroni, p <0.001; AAV-Cre frente a AAV-GFP, p <0.01), lo que indica una mayor susceptibilidad a los déficits conductuales inducidos por el estrés (Fig. 3E). De manera similar, la deleción de SRF local de NAc también aumentó la aversión social (t (10) = 1.8; p <0.05) en comparación con los animales de control inyectados con AAV-GFP después del estrés por derrota social crónica (Fig. 3F), un efecto similar a la prodepresión.

Falta de participación de la SRF en la inducción de osFosB y respuestas de comportamiento a la cocaína

Dado que ΔFosB también se induce en NAc en respuesta a drogas de abuso como la cocaína, resultó interesante examinar un papel potencial de SRF en la acción de la cocaína. A diferencia del estrés por derrota social crónica, la exposición repetida a la cocaína no alteró la expresión de la proteína SRF en NAc (t (14) = 0.8; p> 0.05) (Fig.4A) y no tuvo ningún efecto sobre la unión de SRF al promotor del gen fosB en esta región del cerebro. (t (4) = 0.7; p> 0.05) (Figura 4B). Esto sugiere que, contrariamente al estrés, la inducción de ΔFosB después de la cocaína crónica no está mediada por SRF. Probamos esto directamente examinando si la acumulación de ΔFosB después de la cocaína crónica está alterada en animales Srffl / fl que reciben AAV-Cre-GFP frente a AAV-GFP en NAc. Encontramos que la deleción de SRF no tenía ningún efecto sobre la acumulación de ΔFosB inducida por cocaína en esta región del cerebro (Fig. 4C).

Figura 4.

La pérdida de SRF no tuvo ningún efecto sobre la inducción de la cocaína de ΔFosB o los comportamientos regulados por la cocaína. A, B, la exposición repetida a la cocaína (7 d, 20 mg / kg de cocaína-HCl) no tuvo efecto en la expresión de la proteína SRF en NAc (A) o en la unión de SRF al promotor del gen fosB en esta región del cerebro (B) 24 h después exposición al fármaco (n = 5 / grupo). C, la acumulación de BFosB, medida inmunocitoquímicamente, después de la exposición crónica a la cocaína no se ve afectada por el knock-out específico de NAc de la SRF. D, E, la eliminación local de SRF de la NAc tampoco tuvo ningún efecto sobre la actividad locomotora después de una inyección de solución salina (d 1) sobre la actividad locomotora inducida por cocaína y la sensibilización (n = 8 / grupo) (d 1 – 7; D) o sobre la preferencia de lugar condicionada por la cocaína (n = 8 / grupo; E). Los datos mostrados se expresan como media ± SEM (representados como barras de error).

Para dar seguimiento a este sorprendente hallazgo, investigamos si un knock-out selectivo de SRF de NAc altera las respuestas conductuales a la cocaína. De acuerdo con la falta de regulación de SRF de la inducción de ΔFosB por cocaína, la eliminación de SRF específica de NAc no tuvo ningún efecto sobre la actividad locomotora inducida por cocaína aguda o la sensibilización locomotora observada después de exposiciones repetidas a cocaína (interacción tratamiento × tiempo, F (4,80) = 0.3; p> 0.05) (figura 4D). Del mismo modo, la eliminación de SRF específica de NAc no tuvo ningún efecto sobre la preferencia de lugar condicionada por la cocaína (t (14) = 0.1; p> 0.05) (Fig. 4E), lo que proporciona una medida indirecta de la recompensa de la cocaína.

Discusión

Este estudio identificó a la SRF como un nuevo mediador de FosB en NAc después del estrés por una derrota social crónica, e implica a la SRF en el desarrollo de conductas depresivas y similares a la ansiedad. Proporcionamos evidencia directa de que el estrés por derrota social crónica disminuye los niveles de SRF en animales CNA susceptibles, pero no resilientes, y que esta regulación negativa previene la inducción de ΔFosB en esta región del cerebro, que hemos demostrado es necesaria para hacer frente al estrés crónico. es decir, resiliencia (Vialou et al., 2010). Se encontró una reducción similar en la expresión de SRF en NAc de humanos deprimidos, donde también se redujo la expresión de mRNA y proteína de alsoFosB. En contraste, los niveles de ΔFosB no se redujeron en la NAc de ratones susceptibles, a pesar de una regulación a la baja de SRF, lo que implica otros mecanismos transcripcionales, aún desconocidos, en el control de la expresión de ΔFosB. Se estableció una función causal de la SRF en la mediación de la inducción de BFosB en NAc después de un estrés crónico mediante el uso de la eliminación genética inducible de la SRF de esta región del cerebro. El análisis del comportamiento de los ratones con esta eliminación de SRF específica de NAc implica aún más que la SRF desempeña un papel clave en el desarrollo tanto de la línea de base como de los comportamientos de depresión y ansiedad inducidos por el estrés. En sorprendente contraste, la eliminación de SRF no tuvo efecto en la inducción de ΔFosB en respuesta a la administración crónica de cocaína o en los efectos de comportamiento de la cocaína. Estos hallazgos apoyan un nuevo papel específico del estímulo para la SRF en la regulación de la inducción de FosB y de las respuestas de comportamiento a distintas perturbaciones ambientales.

Se ha demostrado previamente que la transcripción mediada por SRF responde a la actividad sináptica, provocada en gran medida por el aumento de la afluencia de calcio, así como a la actividad neurotrófica aumentada, particularmente en el caso del factor neurotrófico derivado del cerebro (BDNF) (Bading et al., 1993; Xia et al., 1996; Johnson et al., 1997; Chang et al., 2004; Kalita et al., 2006; Knöll y Nordheim, 2009). Esto plantea la interesante pregunta de por qué la SRF está regulada a la baja en NAc de ratones susceptibles, pero no resistentes, después del estrés crónico de la derrota social. Es probable que esta regulación diferencial no esté mediada por la dopamina o la señalización de BDNF, ya que los ratones susceptibles muestran niveles de proteína BDNF incrementados y señalización de BDNF en sentido descendente mayor en NAc, así como una activación por ráfaga mejorada de las neuronas de dopamina del área tegmental ventral (VTA), que inervan la NAc, mientras que los animales resilientes muestran niveles normales de señalización BDNF y velocidades de disparo VTA (Krishnan et al., 2007). Una posibilidad alternativa es que la expresión de SRF se suprima en NAc en respuesta a la inervación glutamatérgica alterada de esta región cerebral, que hemos demostrado está regulada diferencialmente en ratones susceptibles frente a resistentes (Vialou et al., 2010). Se necesita más trabajo para estudiar directamente este y otros posibles mecanismos.

Estudios recientes que utilizan el genoma y otros métodos sugieren que el ∼5-10% de los genes diana de SRF en las neuronas son genes tempranos inmediatos (Philippar et al., 2004; Ramanan et al., 2005; Etkin et al., 2006; Knöll and Nordheim, 2009). Esto es consistente con nuestros datos que demuestran un papel crítico para la SRF en la inducción de ΔFosB, un producto truncado del gen temprano inmediato de fosb, por el estrés crónico. Curiosamente, numerosos genes diana SRF identificados en estos diversos estudios también representan dianas conocidas de ΔFosB en NAc (Kumar et al., 2005; Renthal et al., 2008, 2009; Maze et al., 2010). Entre estos genes comúnmente regulados hay varios que se sabe que regulan el citoesqueleto neuronal (por ejemplo, Cdk5, Arc y Actb). Esto, a su vez, es consistente con los informes de que la SRF influye en la dinámica de la actina y la motilidad neuronal en varios tipos de células neuronales (Alberti et al., 2005; Ramanan et al., 2005; Knöll et al., 2006), mientras que ΔFosB es conocido por afectan el crecimiento de la columna dendrítica de las neuronas NAc (Maze et al., 2010). Estos puntos finales funcionales comunes pueden reflejar los efectos concertados de la SRF, combinados con su inducción de ΔFosB, actuando sobre una serie de genes diana comunes para influir en la morfología neuronal y, en última instancia, en el comportamiento complejo.

También se ha demostrado que la SRF desempeña funciones críticas en la regulación de la plasticidad sináptica y la expresión y el comportamiento de los genes dependientes de la actividad neuronal. Por ejemplo, la pérdida de la inducción dependiente de SRF de genes tempranos inmediatos en respuesta a una exploración voluntaria de un nuevo entorno o la activación neuronal por convulsiones electroconvulsivas se ha asociado con una potenciación sináptica a largo plazo en el hipocampo de los mutantes de Srf (Ramanan et al. , 2005; Etkin et al., 2006). Además, se ha demostrado que el agotamiento de SRF en el hipocampo causa déficits en la depresión sináptica a largo plazo, la expresión inmediata de genes temprana inducida por un contexto novedoso y el deterioro de la habituación durante la exploración de un entorno novedoso (Etkin et al., 2006). Estos datos establecen la importancia de los SRF en la capacidad de un animal para adaptarse adecuadamente a las perturbaciones ambientales, como en el caso antes mencionado de aprender a habituarse a un nuevo entorno, o, en el caso de adaptarse a estímulos estresantes negativos, para prevenir la promulgación del estrés. deficiencias conductuales inducidas, como en nuestro estudio actual. Por lo tanto, observamos que los animales que exhiben déficits en la expresión de SRF, ya sea en respuesta al estrés por derrota social en individuos susceptibles o mediante la eliminación directa de SRF, muestran un aumento de los comportamientos depresivos y similares a la ansiedad. Dado que los sujetos humanos deprimidos también presentan niveles reducidos de SRF en el NAc, es concebible que SRF desempeñe un papel fundamental en la regulación de la capacidad de un individuo para adaptarse positivamente a los estímulos ambientales negativos, en parte a través de la regulación de la expresión de ΔFosB en el NAc.

MECANISMOS DIFERENTES: ADICCIÓN CONTRA RESISTENCIA AL ESTRÉS

Un hallazgo sorprendente del presente estudio es que, aunque se requiere SRF para la acumulación de osFosB en NAc en respuesta al estrés crónico, no se requiere para la inducción de ΔFosB en la misma región del cerebro en respuesta a la cocaína crónica. Del mismo modo, no se requiere SRF para respuestas de comportamiento normales al medicamento. Estos datos muestran que, a pesar del hecho de que ΔFosB se induce en NAc en respuesta a muchos tipos de estímulos (Nestler et al., 1999; Nestler, 2008), parece haber distintas vías moleculares que conducen a la inducción de ΔFosB. Una posible explicación de estos hallazgos son los tipos de células parcialmente diferentes que muestran la acumulación de BFosB en respuesta al estrés frente a la cocaína. El estrés crónico induce ΔFosB aproximadamente por igual en las dos subpoblaciones principales de neuronas espinosas del medio NAc, las que expresan predominantemente los receptores de dopamina D1 frente a D2, mientras que la cocaína crónica induce a ΔFosB predominantemente dentro de las neuronas D1 + (Kelz et al., 1999; Xuzxi; Xuzx; . Por lo tanto, es posible que las vías dependientes de SRF sean importantes para la inducción de ΔFosB en neuronas D2004 +. Sin embargo, esto no explicaría la pérdida completa de la inducción de ΔFosB en ratones knock-out SRF después del estrés crónico, ya que la inducción se produce en ambos subtipos neuronales. Una explicación alternativa es que el estrés crónico y la cocaína crónica inciden en distintas cascadas de señalización intracelular, en virtud de sus distintos modos de acción sobre las neuronas NAc, y el estrés crónico tal vez funcione a través de la transmisión glutamatérgica alterada, como se señaló anteriormente, y la cocaína crónica que trabaja principalmente a través de D1 Señalización del receptor (Nestler, 2008). Otra posibilidad más es que la inducción de BFosB por el estrés crónico versus la cocaína crónica depende de distintos mecanismos de transcripción que se controlan de manera diferencial mediante entradas neurales distintas que inervan la NAc de varias regiones de proyección glutamatérgica, por ejemplo, varias regiones de la corteza prefrontal, hipocampo y amígdala. Se necesita mucho más trabajo para explorar estas y alternativas alternativas.

Juntos, nuestros hallazgos identifican un nuevo mecanismo transcripcional a través del cual se induce ΔFosB en NAc para mediar las respuestas de proresiliencia ante estímulos estresantes. Este estudio también proporciona información nueva e importante sobre el papel desempeñado por la SRF a nivel de la NAc en la regulación de los comportamientos de depresión y ansiedad.. Obtener una mejor comprensión del papel transcripcional de SRF en la regulación de tales comportamientos ayudará en la identificación de nuevos objetivos genéticos involucrados en la resiliencia a los trastornos relacionados con el estrés y puede facilitar el desarrollo futuro de terapias antidepresivas más efectivas.

Este trabajo fue apoyado por subvenciones del Instituto Nacional de Salud Mental y el Instituto Nacional sobre el Abuso de Drogas y por una alianza de investigación con AstraZeneca. Agradecemos a David D. Ginty por proporcionar los ratones Srffl / fl.

La correspondencia debe dirigirse a Eric J. Nestler, Departamento de Neurociencia de Fishberg, Escuela de Medicina Mount Sinai, One Gustave L. Levy Place, Box 1065, Nueva York, NY 10029-6574. [correo electrónico protegido]

Copyright © 2010 los autores 0270-6474 / 10 / 3014585-08 $ 15.00 / 0

Referencias

1. ↵

1. Alberti S,

2. Krause SM,

3. Kretz O,

4. Philippar U,

5. Lemberger T,

6. Casanova E,

7. Wiebel FF,

8. Schwarz H,

9. Frotscher M,

10. Schütz G,

11. Nordheim A

(2005) La migración neuronal en la corriente migratoria rostral murina requiere factor de respuesta sérica. Proc Natl Acad Sci USA 102: 6148 – 6153.

Resumen / texto completo GRATIS

2. ↵

1. Bading H,

2. Ginty dd,

3. Greenberg ME

(1993) Regulación de la expresión génica en neuronas del hipocampo mediante distintas vías de señalización del calcio. Ciencia 260: 181 – 186.

Resumen / texto completo GRATIS

3. ↵

1. Berton O,

2. McClung CA,

3. Dileone RJ,

4. Krishnan V,

5. Renthal W,

6. Russo SJ,

7. Graham D,

8. Tsankova NM,

9. Bolanos CA,

10. Rios m

11. Monteggia LM,

12. Auto DW,

13. Nestler EJ

(2006b) Papel esencial de BDNF en la vía de dopamina mesolímbica en el estrés por derrota social. Ciencia 311: 864 – 868.

Resumen / texto completo GRATIS

4. ↵

1. Berton O,

2. Covington HE 3rd.,

3. Ebner K,

4. Tsankova NM,

5. Carle TL,

6. Ulery P,

7. Bhonsle A,

8. Barrot M,

9. Krishnan V,

10. Singewald GM,

11. Singewald N,

12. Birnbaum S,

13. Nunca yo,

14. Nestler EJ

(2007) La inducción de ΔFosB en el gris periacueductal por estrés promueve respuestas de afrontamiento activas. Neuron 55: 289 – 300.

CrossRefMedline

5. ↵

1. Chang SH,

2. Poser S,

3. Xia Z

(2004) Un nuevo papel para el factor de respuesta del suero en la supervivencia neuronal. J Neurosci 24: 2277 – 2285.

Resumen / texto completo GRATIS

6. ↵

1. Etkin A,

2. Alarcón JM,

3. Weisberg SP,

4. Touzani K,

5. Huang YY,

6. Nordheim A,

7. Kandel ER

(2006) Un rol en el aprendizaje para SRF: la eliminación en el cerebro anterior del adulto interrumpe el LTD y la formación de una memoria inmediata de un contexto nuevo. Neuron 50: 127 – 143.

CrossRefMedline

7. ↵

1. Heinze HJ,

2. Heldmann M,

3. Voges J,

4. Hinrichs H,

5. Marco-Pallares J,

6. Hopf JM,

7. Müller UJ,

8. Galazky yo

9. Sturm V,

10. Bogerts B,

11. Münte TF

(2009) Sensibilización de incentivo contrarrestante en la dependencia severa del alcohol usando estimulación cerebral profunda del núcleo accumbens: aspectos clínicos y de ciencia básica Frente Hum Neurosci 3: 22.

Medline

8. ↵

1. Johnson CM,

2. Hill CS,

3. Chawla S,

4. Treisman R,

5. Bading H

(1997) El calcio controla la expresión génica a través de tres vías distintas que pueden funcionar independientemente de la cascada de señalización Ras / mitógeno activadas por proteína quinasas (ERK). J Neurosci 17: 6189 – 6202.

Resumen / texto completo GRATIS

9. ↵

1. Kalita K,

2. Kharebava G,

3. Zheng JJ,

4. Hetman M

(2006) Papel de la leucemia aguda megacarioblástica-1 en la estimulación dependiente de ERK1 / 2 de la transcripción dirigida por el factor de respuesta del suero por BDNF o aumento de la actividad sináptica. J Neurosci 26: 10020 – 10032.

Resumen / texto completo GRATIS

10. ↵

1. Kelz MB,

2. Chen J,

3. Carlezon WA Jr.,

4. Whisler K,

5. Gilden L,

6. Beckmann AM,

7. Steffen C,

8. Zhang YJ,

9. Marotti l,

10. Auto DW,

11. Tkatch T,

12. Baranauskas G,

13. Surmeier DJ,

14. Nunca yo,

15. Duman RS,

16. Picciotto MR,

17. Nestler EJ

(1999) La expresión del factor de transcripción ΔFosB en el cerebro controla la sensibilidad a la cocaína. Naturaleza 401: 272 – 276.

CrossRefMedline

11. ↵

1. Knöll B,

2. Nordheim A

(2009) Versatilidad funcional de los factores de transcripción en el sistema nervioso: el paradigma SRF. Tendencias Neurosci 32: 432 – 442.

CrossRefMedline

12. ↵

1. Knöll B,

2. Kretz O,

3. Fiedler C,

4. Alberti S,

5. Schütz G,

6. Frotscher M,

7. Nordheim A

(2006) El factor de respuesta sérica controla el ensamblaje del circuito neuronal en el hipocampo. Nat Neurosci 9: 195 – 204.

CrossRefMedline

13. ↵

1. Krishnan V,

2. Han MH,

3. Graham DL,

4. Berton O,

5. Renthal W,

6. Russo SJ,

7. Laplant Q,

8. Graham un

9. Lutter M,

10. Lagace DC,

11. Ghose S,

12. Reister R,

13. Tannous P,

14. TA verde,

15. Nunca yo,

16. Chakravarty S,

17. Kumar A,

18. Eisch AJ,

19. Auto DW,

20. Lee FS,

21. et al.

(2007) Adaptaciones moleculares subyacentes a la susceptibilidad y resistencia a la derrota social en regiones de recompensa cerebral. Celda 131: 391 – 404.

CrossRefMedline

14. ↵

1. Kuhn J,

2. Bauer R,

3. Pohl s,

4. Lenartz d,

5. Huff W,

6. Kim EH,

7. Klosterkoetter J,

8. Sturm V

(2009) Observaciones sobre el abandono del hábito de fumar después de la estimulación cerebral profunda del núcleo accumbens. Eur Addict Res 15: 196 – 201.

CrossRefMedline

15. ↵

1. Kumar A,

2. Choi KH,

3. Renthal W,

4. Tsankova NM,

5. Theobald DE,

6. Truong HT,

7. Russo SJ,

8. Laplant Q,

9. Sasaki TS,

10. Whistler KN,

11. Nunca yo,

12. Auto DW,

13. Nestler EJ

(2005) La remodelación de la cromatina es un mecanismo clave que subyace en la plasticidad inducida por la cocaína en el cuerpo estriado. Neuron 48: 303 – 314.

CrossRefMedline

16. ↵

1. Laberinto I,

2. Covington HE 3rd.,

3. Dietz DM,

4. LaPlant Q,

5. Renthal W,

6. Russo SJ,

7. Mecánico m

8. Mouzon E,

9. Nunca yo,

10. Haggarty SJ,

11. Ren Y,

12. Sampath SC,

13. Hurd YL,

14. Greengard P,

15. Tarakhovsky A,

16. Schaefer A,

17. Nestler EJ

(2010) Papel esencial de la histona metiltransferasa G9a en la plasticidad inducida por la cocaína. Ciencia 327: 213 – 216.

Resumen / texto completo GRATIS

17. ↵

1. McClung CA,

2. Ulery PG,

3. Perrotti LI,

4. Zachariou V,

5. Berton O,

6. Nestler EJ

(2004) DeltaFosB: un cambio molecular para la adaptación a largo plazo en el cerebro. Brain Res Mol Brain Res 132: 146 – 154.

Medline

18. ↵

1. Nestler EJ

(2008) Mecanismos transcripcionales de adicción: rol de deltaFosB. Philos Trans R Soc Lond B Biol Sci 363: 3245 – 3255.

Resumen / texto completo GRATIS

19. ↵

1. Nestler EJ,

2. Carlezon WA Jr.

(2006) El circuito mesolímbico de recompensa de dopamina en la depresión. Psiquiatría Biológica 59: 1151 – 1159.

CrossRefMedline

20. ↵

1. Nestler EJ,

2. Kelz MB,

3. Chen J

(1999) ΔFosB: un mediador molecular de la plasticidad neural y conductual a largo plazo. Brain Res 835: 10 – 17.

CrossRefMedline

21. ↵

1. Newton SS,

2. Thome J,

3. Wallace TL,

4. Shirayama Y,

5. Schlesinger L,

6. Sakai N,

7. Chen J,

8. Nunca,

9. Nestler EJ,

10. Duman RS

(2002) La inhibición de la proteína de unión al elemento de respuesta al cAMP o la dinorfina en el núcleo accumbens produce un efecto de tipo antidepresivo. J Neurosci 22: 10883 – 10890.

Resumen / texto completo GRATIS

22. ↵

1. Nikulina EM,

2. Arrillaga-Romany I,

3. Miczek KA,

4. Hammer RP Jr.

(2008) Alteración de larga duración en las estructuras mesocorticolímbicas después del estrés por repetición de la derrota social en ratas: evolución temporal del ARNm del receptor opioide mu e inmunorreactividad a FosB / DeltaFosB. Eur J Neurosci 27: 2272 – 2284.

CrossRefMedline

23. ↵

1. Perrotti LI,

2. Hadeishi Y,

3. Ulery PG,

4. Barrot M,

5. Monteggia L,

6. Duman RS,

7. Nestler EJ

(2004) Inducción de ΔFosB en estructuras cerebrales relacionadas con la recompensa después del estrés crónico. J Neurosci 24: 10594 – 10602.

Resumen / texto completo GRATIS

24. ↵

1. Perrotti LI,

2. Tejedor RR,

3. Robison B,

4. Renthal W,

5. Laberinto I,

6. Yazdani S,

7. Elmore RG,

8. Knapp DJ,

9. Selley DE,

10. Martin BR,

11. Sim-Selley L,

12. Bachtell RK,

13. Auto DW,

14. Nestler EJ

(2008) Distintos patrones de inducción de DeltaFosB en el cerebro por drogas de abuso. Synapse 62: 358 – 369.

CrossRefMedline

25. ↵

1. Philippar U,

2. Schratt G,

3. Dieterich C,

4. Müller JM,

5. Galgóczy P,

6. Engel FB,

7. Keating MT,

8. Gertler F,

9. Schüle R,

10. Vingron M,

11. Nordheim A

(2004) El gen diana SRF Fhl2 antagoniza la activación de SRF dependiente de RhoA / MAL. Mol Cell 16: 867 – 880.

CrossRefMedline

26. ↵

1. Ramanan N,

2. Shen Y,

3. Sarsfield S,

4. Lemberger T,

5. Schütz G,

6. Linden DJ,

7. Ginty dd

(2005) SRF media la expresión génica inducida por la actividad y la plasticidad sináptica pero no la viabilidad neuronal. Nat Neurosci 8: 759 – 767.

CrossRefMedline

27. ↵

1. Renthal W,

2. Carle TL,

3. Laberinto I,

4. Covington HE 3rd.,

5. Truong HT,

6. Alibhai I,

7. Kumar A,

8. Montgomery RL,

9. Olson EN,

10. Nestler EJ

(2008) Delta FosB media la desensibilización epigenética del gen c-fos después de la exposición crónica a la anfetamina. J Neurosci 28: 7344 – 7349.

Resumen / texto completo GRATIS

28. ↵

1. Renthal W,

2. Kumar A,

3. Xiao G,

4. Wilkinson M,

5. Covington HE 3rd.,

6. Laberinto I,

7. Sikder D,

8. Robison AJ,

9. LaPlant Q,

10. Dietz DM,

11. Russo SJ,

12. Vialou V,

13. Chakravarty S,

14. Kodadek TJ,

15. Pila A,

16. Kabbaj M,

17. Nestler EJ

(2009) El análisis del genoma de la regulación de la cromatina por la cocaína revela un papel para las sirtuinas. Neuron 62: 335 – 348.

CrossRefMedline

29. ↵

1. Schlaepfer TE,

2. Cohen MX,

3. Frick C,

4. Kosel M,

5. Brodesser D,

6. Axmacher N,

7. Joe AY,

8. Kreft M,

9. Lenartz d,

10. Sturm V

(2008) La estimulación cerebral profunda para recompensar los circuitos alivia la anhedonia en la depresión mayor refractaria. Neuropsicofarmacología 33: 368 – 377.

CrossRefMedline

30. ↵

1. Sesack SR,

2. Grace AA

(2010) Red de recompensa de ganglios cortico-basales: microcircuitos. Neuropsicofarmacología 35: 27 – 47.

CrossRefMedline

31. ↵

1. Tomita H,

2. Vawter MP,

3. Walsh DM,

4. Evans SJ,

5. Choudary PV,

6. Li J,

7. Overman KM,

8. Atz me

9. Myers RM,

10. Jones EG,

11. Watson SJ,

12. Akil H,

13. Bunney WE Jr.

(2004) Efecto de los factores agonales y postmortem en el perfil de expresión génica: control de calidad en análisis de micromatrices o cerebro humano postmortem. Psiquiatría Biol 55: 346 – 352.

CrossRefMedline

32. ↵

1. Tsankova NM,

2. Berton O,

3. Renthal W,

4. Kumar A,

5. Nunca yo,

6. Nestler EJ

(2006) Regulación sostenida de la cromatina del hipocampo en un modelo de depresión y acción antidepresiva en ratones. Nat Neurosci 9: 519 – 525.

CrossRefMedline

33. ↵

1. Vassoler FM,

2. Schmidt HD,

3. Gerard ME,

4. KR famoso,

5. Ciraulo DA,

6. Kornetsky C,

7. Knapp CM,

8. Pierce rc

(2008) La estimulación cerebral profunda del núcleo accumbens en la cáscara atenúa el restablecimiento inducido por el cebado de la cocaína en la búsqueda de drogas en ratas. J Neurosci 28: 8735 – 8739.

Resumen / texto completo GRATIS

34. ↵

1. Vialou V,

2. Robison AJ,

3. Laplant QC,

4. Covington HE 3rd.,

5. Dietz DM,

6. Ohnishi YN,

7. Mouzon E,

8. Rush AJ 3rd.,

9. Vatios el,

10. Wallace DL,

11. Iñiguez SD,

12. Ohnishi YH,

13. Steiner MA,

14. Warren BL,

15. Krishnan V,

16. Bolaños ca

17. Nunca yo,

18. Ghose S,

19. Berton O,

20. Tamminga CA,

21. Nestler EJ

(2010) ΔFosB en los circuitos de recompensa cerebral media la resistencia al estrés y las respuestas antidepresivas. Nat Neurosci 13: 745 – 752.

CrossRefMedline

35. ↵

1. Wilkinson MB,

2. Xiao G,

3. Kumar A,

4. LaPlant Q,

5. Renthal W,

6. Sikder D,

7. Kodadek TJ,

8. Nestler EJ

(2009) El tratamiento con imipramina y la resistencia exhiben una regulación de cromatina similar en una región clave de recompensa cerebral. J Neurosci 29: 7820 – 7832.

Resumen / texto completo GRATIS

36. ↵

1. Xia Z,

2. Dudek H,

3. Miranti CK,

4. Greenberg ME

(1996) El influjo de calcio a través del receptor NMDA induce la transcripción inmediata del gen por un mecanismo dependiente de MAP quinasa / ERK. J Neurosci 16: 5425 – 5436.

Resumen / texto completo GRATIS