(LUDZI) Reakcje behawioralne i strukturalne na proliferację kokainy wymagają pętli feedforward z udziałem ΔFosB i zależnej od wapnia / kalmoduliny kinazy białkowej II w powłoce Nucleus Accumbens (2013)

J Neurosci. 2013 Mar 6;33(10):4295-4307.

Robison AJ, Vialou V, Mazei-Robison M, Feng J, Kourrich S, Collins M, Wee S, Koob G, Turecki G, Neve R, Thomas M, Nestler EJ.

Źródło

Fishberg Department of Neuroscience and Friedman Brain Institute, Mount Sinai School of Medicine, Nowy Jork, Nowy Jork, 10029, Wydziały Neuroscience and Psychology, Instytut Genetyki Człowieka, University of Minnesota, Minneapolis, Minnesota 55455, Komitet Neurobiologii Zaburzeń Uzależnień , The Scripps Research Institute, La Jolla, California 92037 Depressive Disorders Program, Douglas Mental Health University Institute i McGill University, Montréal, Quebec, Kanada, H4H 1R3, i Wydział Brain and Cognitive Sciences, Massachusetts Institute of Technology, Cambridge, Massachusetts 02139 .

Abstrakcyjny

Czynnik transkrypcyjny ΔFosB i wzbogacona w mózg wapń / kalmodulina zależna kinaza białkowa II (CaMKIIα) są indukowane w jądrze półleżącym (NAc) przez chroniczną ekspozycję na kokainę lub inne psychostymulujące leki nadużywające, w których te dwa białka pośredniczą w uczulonych reakcjach leków . Chociaż ΔFosB i CaMKIIα zarówno regulują ekspresję receptora glutaminianowego AMPA i funkcję w NAc, formowanie kręgosłupa dendrytycznego na średnich neuronach kolczystych NAc (MSN), oraz uczulenie na lokomotorę na kokainę, dotychczas nie badano żadnego bezpośredniego połączenia między tymi cząsteczkami. Tutaj pokazujemy, że ΔFosB jest fosforylowany przez CaMKIIα na stabilizującym białko Ser27 i że CaMKII jest wymagane dla pośredniczonej przez kokainę akumulacji ΔFosB w NAc szczura.

Odwrotnie, pokazujemy, że ΔFosB jest zarówno konieczne, jak i wystarczające do indukcji kokainy ekspresji genu CaMKIIα in vivo, efekt selektywny dla D1typu MSN w podregionie powłoki NAc.

Ponadto, indukcja kolców dendrytycznych na MSNs NAc i zwiększona reakcja behawioralna na kokainę po nadekspresji NAc przez FFosB są zależne od CaMKII.

Co ważne, po raz pierwszy wykazaliśmy indukcję ΔFosB i CaMKII w NAc of osoby uzależnione od kokainy, sugerując możliwe cele przyszłej interwencji terapeutycznej. Dane te potwierdzają, że ΔFosB i CaMKII angażują się w swoistą dla komórek i mózgu region pozytywnej pętli sprzężenia zwrotnego jako kluczowy mechanizm regulujący obwód nagrody mózgu w odpowiedzi na przewlekłą kokainę.

Wprowadzenie

Coraz więcej dowodów potwierdza pogląd, że zmiany w ekspresji genów przyczyniają się do mechanizmów uzależnienia od narkotyków (Robison i Nestler, 2011). Jednym z ważnych mediatorów tych zmian jest ΔFosB, czynnik transkrypcyjny z rodziny Fos (Nestler, 2008). Przewlekłe podawanie praktycznie każdego narkotyku wywołuje długotrwałą akumulację ΔFosB w jądrze półleżącym (NAc), regionie limbicznym niezbędnym do zachowań nagradzających. Sindukcja wydaje się specyficzna dla klasy neuronów kolczystych NAc (MSN), które wyrażają receptory dopaminy D1. Indukcyjna nadekspresja ΔFosB w tych MSN typu D1 zwiększa odpowiedź lokomotoryczną i nagradzającą na kokainę i morfinę (Kelz i wsp., 1999; Zachariou i wsp., 2006), w tym zwiększone samopodawanie kokainy (Colby i wsp., 2003). Ponadto genetyczna lub wirusowa blokada aktywności transkrypcyjnej ΔFosB zmniejsza satysfakcjonujące efekty tych leków (Zachariou i wsp., 2006), wskazując, że ta przedłużona indukcja ΔFosB jest krytycznym mediatorem trwałych zmian indukowanych w NAc przez przewlekłe podawanie leków.

Niezwykła stabilność ΔFosB (w stosunku do wszystkich innych białek z rodziny Fos) jest zarówno wewnętrzną właściwością cząsteczki, ze względu na obcięcie domen degron obecnych w pełnej długości FosB (Carle i in., 2007) i regulowany proces. ΔFosB jest fosforylowany in vitro i in vivo w Ser27, i ta reakcja dodatkowo stabilizuje ΔFosB, ~ 10-krotnie, w hodowli komórkowej i NAc in vivo (Ulery-Reynolds i in., 2009). Chociaż wykazano, że Ser27-ΔFosB jest substratem dla kinazy kazeinowej-2 in vitro (Ulery i in., 2006), jego mechanizm in vivo fosforylacja pozostaje nieznana.

Kinaza białkowa II zależna od wapnia / kalmoduliny (CaMKII) jest kinazą serynowo / treoninową o wysokiej ekspresji, której izoformy α i β tworzą dodekameryczne homo- i hetero-holoenzymy in vivoi są niezbędne dla wielu form neuroplastyczności (Lisman i in., 2002; Colbran i Brown, 2004). CaMKIIα jest indukowany selektywnie w powłoce NAc przez chroniczną amfetaminę (Loweth i in., 2010), a farmakologiczna blokada aktywności CaMKII w powłoce NAc zmniejsza uczulenie behawioralne na amfetaminę (Loweth i in., 2008) i kokaina (Pierce i in., 1998), podczas gdy nadekspresja wirusa CaMKIIα w tym subregionie NAc zwiększa uczulenie na narządy ruchowe i samopodawanie amfetaminy (Loweth i in., 2010). CaMKIIα może wpływać na zachowania nagrody poprzez modulację podjednostek receptora glutaminianowego AMPA (Pierce i in., 1998), ponieważ aktywność CaMKIIα od dawna jest związana z funkcją receptora AMPA i ukierunkowaniem synaptycznym w kilku postaciach neuroplastyczności (Malinow i Malenka, 2002).

Literatura ta pokazuje kilka podobieństw między ΔFosB i CaMKII: oba są konieczne i wystarczające dla wielu behawioralnych skutków nadużywania leków, zarówno w górę, jak i kolce dendrytyczne w różnych typach komórek nerwowych in vivo (Jourdain i in., 2003; Maze i wsp., 2010) i oba wywierają co najmniej niektóre ze swoich efektów behawioralnych poprzez modulację receptorów AMPA (Kelz i wsp., 1999; Malinow i Malenka, 2002; Vialou i wsp., 2010). Pomimo tych podobieństw nie jest znane żadne funkcjonalne połączenie między ΔFosB a CaMKII. Tutaj ustalamy wzajemną regulację pomiędzy ΔFosB i CaMKII, i wykazujemy, że dwa białka tworzą specyficzną dla MSX pętlę sprzężenia zwrotnego typu D1 w powłoce NAc, która jest indukowana przez kokainę i reguluje szereg reakcji kokainowych in vivo.

Idź do:

Materiały i Metody

Eksperyment 1: Analiza proteomiczna iTRAQ powłoki NAc i leczenie rdzeniowe po kokainie (Ryc. 1A)

Dorosłym (tygodnie 8) samcom szczurów podawano 20 mg / kg kokainy lub nośnik soli fizjologicznej IP raz dziennie przez siedem dni. 24 hr po ostatnim wstrzyknięciu, skorupa NAC i rdzeń zostały mikrodysseowane (Ryc. 1A) i zamrozić. Analizy iTRAQ przeprowadzono zgodnie z wcześniejszym opisem (Ross i in., 2004; Davalos i in., 2010).

Rysunek 1

Rysunek 1

Indukcja skorupy CaMKII w NAc przez kokainę

Eksperyment 2: Oznaczanie ilościowe zmian białek w rdzeniu szczura i powłoce po leczeniu kokainą (Rys. 1B – D)

Dorosłym (tygodnie 8) samcom szczurów podawano 10 mg / kg kokainy lub nośnik soli fizjologicznej IP raz dziennie przez siedem dni w komorach rejestrujących narządy ruchu. Reakcje lokomotoryczne na pojedyncze wstrzyknięcie kokainy (5 mg / kg IP) odnotowano u zwierząt leczonych uprzednio kokainą (zwaną „przewlekłą”) i części osób leczonych solą fizjologiczną (zwaną „ostrą”) oraz odpowiedzi ruchowej na sól fizjologiczną sam odnotowano u pozostałych przewlekłych zwierząt leczonych solą fizjologiczną (zwanych „solą fizjologiczną”). Testy aktywności lokomotorycznej przeprowadzono zgodnie z opisem (Hiroi i wsp., 1997). W skrócie, dorosłe samce szczurów umieszczono w pudełkach do zapisu otwartego pola 18 ”x 24” PAS (San Diego Instruments) dla 30 min w celu przyzwyczajenia, podano im pojedynczy wstrzyknięcie soli fizjologicznej IP i monitorowano przez dodatkową min 30, i podano im pojedyncze wstrzyknięcie IP 5 mg / kg kokainy i monitorowane przez 30 min.

24 hr po tym ostatnim wstrzyknięciu szczury dekapitowano bez znieczulenia, aby uniknąć wpływu środków znieczulających na poziom białek neuronalnych i fosfo-stany. Mózgi pocięto seryjnie na matrycę 1.2 mm (Braintree Scientific), a tkankę docelową usunięto w soli fizjologicznej buforowanej fosforanem zawierającej inhibitory proteazy (Roche) i fosfatazy (Sigma Aldrich) stosując stempel 14 do rdzenia NAc i stempel 12 pozostałego tkanka do powłoki NAc (patrz Ryc. 1A) i natychmiast zamrozić na suchym lodzie. Próbki homogenizowano przez lekką sonikację w zmodyfikowanym buforze RIPA: 10 mM Tris zasada, 150 mM chlorek sodu, 1 mM EDTA, 0.1% dodecylosiarczan sodu, 1% Triton X-100, 1% deoksycholan sodu, pH 7.4, inhibitory proteazy i fosfatazy 4, pH 15, inhibitory proteazy i fosfatazy jak wyżej. Po dodaniu buforu Laemmli, białka rozdzielono na żelach gradientowych XNUMX-XNUMX% gradientowych poliakrylamidów (Criterion System, BioRad) i przeprowadzono Western blotting stosując system Odyssey (Li-Cor) zgodnie z protokołami producenta.

Eksperyment 3: Określanie ilościowe zmian białek w rdzeniu szczura NAc i powłoce po odstawieniu kokainy (Rys. 1E)

Dorosłym (tygodnie 8) samcom szczurów podawano 10 mg / kg kokainy lub nośnik soli fizjologicznej IP raz dziennie przez siedem dni. 14 dni po ostatnim wstrzyknięciu zwierzętom traktowanym solą fizjologiczną podawano inny zastrzyk soli fizjologicznej (zwany „solą fizjologiczną”), a zwierzętom leczonym kokainą podawano kolejny zastrzyk soli fizjologicznej (zwany 14 dzień wycofania lub „14d WD”) lub pojedynczy zastrzyk kokainy ( o nazwie „14d WD Chal” na wyzwanie). Jedną godzinę po ostatnim wstrzyknięciu zwierzęta odcięto i przeprowadzono Western blotting jak w eksperyment 2.

Eksperyment 4: Oznaczanie ilościowe zmian białkowych w rdzeniu szczurzej NAC i samo-administracji po kokainie (Rys. 2A – C)

Szczury szkolono do samodzielnego podawania 0.5 mg / kg / infuzję kokainy w jednogodzinnych sesjach w ustalonym stosunku 1 przez dziewięć dni. Po dziewięciu sesjach wyjściowych szczury podzielono na dwie grupy zrównoważone spożyciem kokainy w dwóch ostatnich sesjach. Jednej grupie szczurów pozwolono na samodzielne podawanie kokainy (0.5 mg / kg / infuzję) w jednogodzinnych sesjach (krótki dostęp, ShA), podczas gdy w drugiej grupie szczurów podawano kokainę w sesjach sześciogodzinnych (długi dostęp, LgA ) przez dziesięć dodatkowych dni (sesje eskalacyjne).

Skrawki mózgu poddano obróbce immunohistochemicznej, jak opisano (Perrotti i wsp., 2004). Mózgi poddano perfuzji 18-24 h po ostatniej ekspozycji na lek, co spowodowało degradację jakiegokolwiek resztkowego białka FosB pełnej długości, tak że cała pozostała immunoreaktywność odzwierciedla ΔFosB. Tę degradację potwierdzono metodą Western blot, która nie wykazała znaczącego barwienia przeciwciałem skierowanym przeciwko C-końcowi pełnej długości FosB, który nie rozpoznaje ΔFosB (dane nie pokazane). Po pocięciu na skrawki 35 µm liczbę immunopozytywnych komórek ΔFosB oznaczono ilościowo za pomocą zaślepionego obserwatora w dwóch sekcjach przez NAc każdego szczura, a następnie obliczono średnie wartości na pole 40 × dla każdego zwierzęcia. Każde zwierzę uznano za indywidualną obserwację do analizy statystycznej. Regiony będące przedmiotem zainteresowania zidentyfikowano za pomocą Paxinos i Watson (Paxinos i Watson, 2007).

Oznaczenie ilościowe immunoreaktywności CaMKIIα przeprowadzono przy użyciu systemu Licor, jak opisano (Covington i in., 2009). Zintegrowane natężenia CaMKII i GAPDH określono za pomocą oprogramowania Odyssey. Wyniki przedstawiono jako zintegrowane wartości intensywności na mm2 i są przedstawiane jako średnie ± sem (n = 4 – 10 na grupę). Wartości dla GAPDH zastosowano jako odniesienie do znormalizowania intensywności CaMKII dla grubości warstwy i warunków.

Rysunek 2

Rysunek 2

Indukcja CaMKII w skorupie NAc samozwańczych szczurów i ludzi uzależnionych od kokainy

Eksperyment 5: ilościowe oznaczanie poziomów białek u ludzi uzależnionych od kokainy (Rys. 2D)

Procedura

Pośmiertne tkanki ludzkiego mózgu uzyskano z banku Quebec Suicide Brain Bank (Douglas Mental Health University Institute, Montreal, Quebec, Kanada). Zachowanie tkanki przebiegało zasadniczo zgodnie z opisem (Quirion i in., 1987). Krótko mówiąc, po wydobyciu mózg umieszcza się na mokrym lodzie w styropianowym pudełku i kieruje do obiektów banku Quebec Suicide Brain Bank. Półkule są natychmiast oddzielane strzałkowym cięciem w środku mózgu, pnia mózgu i móżdżku. Naczynia krwionośne, szyszynkę, splot naczyniówkowy, połowę móżdżku i pnia mózgu są zazwyczaj wycinane z lewej półkuli, którą następnie przed zamrożeniem tnie się koronalnie na plastry o grubości 1. Móżdżek drugiej połowy przed zamrożeniem jest cięty strzałkowo na plastry o grubości 1cm. Tkanki są szybko zamrażane w 2-metylobutanie w -40 ° C dla ~ 60 sek. Wszystkie zamrożone tkanki przechowuje się oddzielnie w plastikowych torebkach w -80 ° C do długotrwałego przechowywania. Specyficzne obszary mózgu są wycinane z zamrożonych plasterków koronalnych na płytce ze stali nierdzewnej z całym suchym lodem, aby kontrolować temperaturę otoczenia. Western blot przeprowadzono jak opisano w eksperyment 2.

Kohorta

Kohorta składała się z kobiet płci męskiej 37 i kobiet 3 w wieku od 15 do 66 lat. Wszyscy pacjenci zmarli nagle bez przedłużonego stanu agonalnego lub przewlekłej choroby medycznej. W każdym przypadku przyczyna śmierci została ustalona przez biuro koronera w Quebecu, a badanie toksykologiczne zostało przeprowadzone z próbkami tkanek w celu uzyskania informacji o lekach i nielegalnym używaniu substancji w chwili śmierci. Badana grupa składała się z osób 20, które spełniły kryteria SCID-I dotyczące uzależnienia od kokainy. Grupa kontrolna składała się z pacjentów z 20 bez historii uzależnienia od kokainy i bez poważnych diagnoz psychiatrycznych. Wszyscy pacjenci zmarli nagle z przyczyn, które nie miały bezpośredniego wpływu na tkankę mózgową. Grupy dobrano pod względem średniego wieku badanego, opóźnienia chłodzenia i pH. W przypadku wszystkich pacjentów autopsje psychologiczne przeprowadzono zgodnie z wcześniejszym opisem (Dumais i in., 2005), umożliwiając nam dostęp do szczegółowych informacji o przypadkach dotyczących historii psychiatrycznej i medycznej, a także innych istotnych danych klinicznych i socjodemograficznych. W skrócie, przeszkolony ankieter przeprowadził Zorganizowany wywiad kliniczny dla DSM-IV Zaburzenia psychiatryczne (SCID-I) z jednym lub kilkoma informatorami zmarłego. Zespół klinicystów dokonał przeglądu ocen SCID-I, opisów przypadków, not koronera i dokumentacji medycznej w celu uzyskania zgodnych diagnoz psychiatrycznych.

Eksperyment 6: immunoprecypitacja chromatyny dla szczura NAc (Rys. 3A – C)

Dorosłym (tygodnie 8) samcom szczurów podawano 10 mg / kg kokainy lub nośnik soli fizjologicznej IP raz dziennie przez siedem dni. 24 hr po ostatnim zastrzyku, skorupa NAc i rdzeń zostały poddane mikroodcinaniu. Immunoprecypitację chromatyny (ChIP) przeprowadzono łącząc dwustronne stemple NAc powłoki lub rdzenia z siedmiu szczurów na grupę w grupach całkowitych 14 (całkowita liczba zwierząt 98, pule kokainy 7, pule soli 7). Tkanki usieciowano, przemyto i przechowywano w -80 ° C aż do ścinania chromatyny przez sonikację. Strzyżoną chromatynę inkubowano przez noc z przeciwciałami wcześniej związanymi z kulkami magnetycznymi (Dynabeads M-280, Invitrogen). Jako kontrolę zastosowano nieimmunologiczne IgG. Po odwrotnym sieciowaniu i oczyszczaniu DNA zastosowano qPCR do pomiaru poziomów DNA promotora CaMKIIα. Startery zaprojektowano do amplifikacji regionu zawierającego sekwencję konsensusową AP-1 zlokalizowaną ~ 450 bp przed miejscem startu transkrypcji (Forward: ACTGACTCAGGAAGAGGGATA; Reverse: TGTGCTCCTCAGAATCCACAA).

Rysunek 3

Rysunek 3

Indukcja MFosB typu CaMKIIα typu komórkowego i regionu in vivo

Eksperyment 7: Pomiar transkrypcji CaMKII i ekspresji białek z nadekspresją specyficzną dla typu komórek ΔFosB (Rys. 3D)

Samce myszy transgenicznych pochodzące z NSE-tTA (linia A) × TetOp-ΔfosB (linia 11) i NSE-tTA (linia B) × TetOp-FLAG-ΔfosB (linia 11) myszy (Chen i wsp., 1998; Kelz i wsp., 1999; Werme i wsp., 2002; Zachariou i wsp., 2006) poczęto i hodowano na doksycyklinie 100 µg / ml w celu stłumienia ekspresji ΔFosB podczas rozwoju. Zwierzęta z miotu podzielono po odsadzeniu: połowa pozostała na doksycyklinie, a połowa została przełączona na wodę, a zwierzęta wykorzystano 8 do 11 kilka tygodni później, gdy efekty transkrypcyjne ΔFosB są maksymalne (Kelz i wsp., 1999; McClung i Nestler, 2003). Do analiz transkrypcyjnych myszy szybko dekapitowano, a mózgi usunięto i umieszczono na lodzie. Rozdzielenia NAc pobrano za pomocą stempla igłowego 14 i szybko zamrożono w suchym lodzie, aż do ekstrakcji RNA. Izolację RNA, qPCR i analizę danych przeprowadzono zgodnie z wcześniejszym opisem (LaPlant i in., 2009). W skrócie, RNA izolowano za pomocą odczynnika TriZol (Invitrogen), dalej oczyszczano za pomocą zestawu mikro RNAAasy z Qiagen i sprawdzano jakość za pomocą Bioanalyzer Agilent. Odwrotna transkrypcja została wykonana przy użyciu iScript (BioRad). qPCR przeprowadzono za pomocą systemu Applied Biosystems 7900HT RT PCR z następującymi parametrami cyklu: 10 min przy 95 ° C; Cykle 40 95 ° C dla 1 min, 60 ° C dla 30 sek, 72 ° C dla 30 sek; stopniowane ogrzewanie do 95 ° C w celu wygenerowania krzywych dysocjacji dla potwierdzenia pojedynczych produktów PCR. Analizy immunohistochemiczne ekspresji białka osFosB i CaMKIIα przeprowadzono jak opisano w eksperyment 4.

Eksperyment 8: Wpływ antagonistów receptora dopaminowego D1 i D2 wewnątrz-NAc na zmiany białek za pośrednictwem kokainy (Rys. 3H)

Dorosłym (8 tygodnie) samcom szczurów podawano 10 mg / kg kokainy lub nośnika soli fizjologicznej (grupa „nośnik”) IP raz dziennie przez siedem dni. 30 min przed każdym wstrzyknięciem kokainy szczurom podawano IP albo antagonistę receptora D1 SCH 23390 (0.5 mg / kg, grupa „D1 Ant”), albo antagonistę receptora D2 etykloprid (0.5 mg / kg, grupa „D2 Ant”) lub zastrzyk kontrolny z solą fizjologiczną (grupa „kokainowa”). 24 godz. Po ostatnim wstrzyknięciu, zwierzęta dekapitowano i oznaczano ilościowo białka metodą Western blotting jak na eksperyment 2.

Eksperyment 9: Wpływ ΔFosB za pośrednictwem AAV na ekspresję białka (Rys. 4 A – C)

Operację stereereaksji przeprowadzono na dorosłych samcach szczurów (tygodnie 8) w celu wstrzyknięcia AAV-GFP (białko zielonej fluorescencji) lub AAV-GFP-ΔFosB (Maze i wsp., 2010). Do wszystkich operacji zastosowano igły wskaźnikowe 33 (Hamilton), podczas których 0.5 µl oczyszczonego wirusa o wysokim mianie był obustronnie podawany we wlewie przez min 5, po czym następował dodatkowy okres odpoczynku po infuzji 5 min. Wszystkie odległości są mierzone względem Bregma: kąt 10 °, AP = + 1.7 mm, Lat = 2.5 mm, DV = −6.7 mm. 14 dni po zabiegu, zwierzętom podano pojedynczą iniekcję IP 10 mg / kg kokainy w komorach do monitorowania lokomotorycznego, aby ocenić behawioralne skutki nadekspresji ΔFosB. 24 hr po tym ostatnim wstrzyknięciu, szczury dekapitowano według eksperyment 2i mikrodyssekcja tkanek została przeprowadzona pod mikroskopowym prowadzeniem fluorescencyjnym w celu uzyskania tkanki NAc dodatniej pod względem GFP. Następnie przeprowadzono Western blotting Eksperymentuj 2.

Rysunek 4

Rysunek 4

ΔFosB jest zarówno niezbędna, jak i wystarczająca dla zależnej od kokainy indukowanej receptorem D1 CaMKIIα w powłoce NAc

Eksperyment 10: Efekty unJunD za pośrednictwem AAV nadekspresji na ekspresji białka zależnego od kokainy (Rys. 4 D – F)

Stereotaksyjne wstrzyknięcie AAV-GFP lub AAV-GFP-ΔJunD przeprowadzono zgodnie z Eksperymentuj 8. 14 dni po zabiegu, zwierzętom podawano 10 mg / kg kokainy lub nośnik soli fizjologicznej IP raz dziennie przez siedem dni w komorach rejestrujących lokomotor. Rejestrowano reakcje lokomotoryczne na pojedyncze wstrzyknięcie kokainy (5 mg / kg IP) lub soli fizjologicznej. 24 h po tym ostatnim wstrzyknięciu szczury pozbawiono głów, zebrano tkanki i przeprowadzono Western blot jak w Eksperymentuj 9.

Eksperyment 11: In Vitro Testy kinazy białkowej (Rys. 5A – D)

Rekombinowane CaMKIIα i osFosB oczyszczono z komórek owadzich (Brickey i in., 1990; Jorissen i in., 2007) i przeprowadzono testy kinazy białkowej (Colbran, 1993), jak opisano wcześniej. Pokrótce, CaMKII inkubowano wstępnie na lodzie z 2.5 µM ​​(lub wskazanym stężeniem) ΔFosB, 1 mM Ca2+, 40 mM Mg2+, 15 µM ​​kalmodulina i 200 mM HEPES pH 7.5. Fosforylację zapoczątkowano przez dodanie 200 µM ​​ATP z lub bez [γ-32P] ATP i pozostawiono na 10 min w temperaturze pokojowej (Rys. 5A i B.) lub 2 min na lodzie (Rys. 5C i D). Produkty zostały rozwiązane za pomocą Western blotting (Rys. 5A i B.) lub przez autoradiogram i zliczanie scyntylacji (rys. B – D).

Rysunek 5

Rysunek 5

ΔFosB jest silnym substratem dla CaMKIIα

Eksperyment 12: Identyfikacja fosforylacji Ser27 ΔFosB (Rys. 5E)

In vitro testy kinazy przeprowadzono zgodnie z eksperyment 11, białka rozdzielono metodą SDS-PAGE i wycięto prążki odpowiadające ΔFosB i poddano tandemowej spektrometrii mas. Przypisania m / z odpowiednich fragmentów jonów we wszystkich panelach są oznaczone na wierzchołkach pików jonowych. Nie wszystkie jony fragmentów są oznakowane ze względu na ograniczenia przestrzenne. Zasadniczo tekst etykiet jonów fragmentów jest zabarwiony na czarno, chyba że bezpośrednio potwierdzają lub dodają dowody do obecności interesujących miejsc fosforylacji, w którym to przypadku są zaznaczone na czerwono. Dowody na produkty fragmentacji szkieletu przedstawiono w odczycie sekwencji fosfopeptydu z wykrytym miejscem reszty fosforylacji wskazanym kolorem czerwonym z pojedynczym oznaczeniem literowym aminokwasu. Numeryczny opis obserwowanych jonów fragmentów jest również oznaczony na sekwencji peptydu jako jony b i y. Współczynniki powiększenia dla odcinków osi m / z, aby pokazać jony fragmentów o mniejszej intensywności, są zaznaczone na górze każdego widma masowego fragmentu. Jony fragmentów pokazane w panelu H potwierdzają obecność fosforylowanej izoformy Ser27, jednak w mieszaninie innych fosforylowanych izoform w miejscach Ser28, Ser31, Ser34 i Thr37. Obecność jonów pa5, pa5-P, pb5 i pb5-P jednoznacznie potwierdza fosforylację reszty Ser27.

Eksperyment 13: Kwantyfikacja fosforylacji Ser27 (Rys. 5F)

Zaprojektowano standardowe peptydy naśladujące formy fosfo i nie-fosfo Ser27 ΔFosB. Po syntezie i oczyszczeniu, każdy „ciężki” idiotypowy peptyd rozpuszczono w buforze acetonitrylowo / wodnym 50 / 50 i wysłano do analizy aminokwasów w celu określenia bezwzględnego stężenia na syntetycznym roztworze podstawowym peptydu. Każdy „ciężki” peptyd był następnie wlewany bezpośrednio do spektrometru mas 4000 QTRAP (MS) w celu określenia najlepszej energii zderzenia dla fragmentacji MS / MS i dwóch do czterech przejść MRM. Następnie czyste „ciężkie” peptydy poddano LCMS na 4000 QTRAP, aby zapewnić rozdział peptydów. Przyrząd pracował w trybie potrójnego kwadrupola, przy czym Q1 ustawiono na określoną wartość prekursora m / z (Q1 nie skanuje), a Q3 ustawiono na specyficzną wartość m / z odpowiadającą swoistemu fragmentowi tego peptydu. W trybie MRM szereg pojedynczych reakcji (przejścia jonów prekursora / fragmentu, w których energia zderzenia jest dostrojona w celu zoptymalizowania intensywności interesujących jonów fragmentów) mierzono sekwencyjnie, a cykl (zazwyczaj 1 – 2 sec) był zapętlony w całym cały czas rozdziału metodą HPLC. Przejścia MRM określono na podstawie widm MS / MS istniejących peptydów. Następnie wybrano dwa przejścia na peptyd, odpowiadające jonom fragmentów o wysokiej intensywności i zoptymalizowano energię kolizji, aby zmaksymalizować siłę sygnału przejść MRM przy użyciu oprogramowania automatyki. Piki wynikające ze standardowych peptydów i próbek ΔFosB poddanych działaniu CaMKII lub kontroli porównano następnie w celu określenia bezwzględnej obfitości każdej postaci peptydu w reakcji. Analizę danych na danych LC-MRM przeprowadza się przy użyciu oprogramowania AB Multiquant 1.1.

Eksperyment 14: Indukcja ΔFosB u myszy z nadekspresją CaMKII (Rys. 5G i H.)

Myszy transgeniczne z nadekspresją T286D CaMKII (Mayford i in., 1996; Kourrich i in., 2012) i myszy typu dzikiego z miotu hodowano w nieobecności doksycykliny, aby umożliwić ekspresję transgenu. Dorosłym myszom podawano 20 mg / kg kokainy lub sól fizjologiczną IP raz dziennie przez dni 14. 24 hr po ostatnim wstrzyknięciu zwierzęta pozbawiono głowy i wykonano immunohistochemię, a oznaczenie ilościowe ekspresji ΔFosB przeprowadzono jak w eksperyment 4.

Eksperyment 15: Wpływ mediowanej HSV ΔFosB nadekspresji i hamowania CaMKII na kolcach dendrytycznych NAc (Rys. 6A – E)

Dorosłe samce myszy (tygodnie 8) wstrzyknięto stereotaktycznie w NAc za pomocą HSV-GFP, HSV-GFP-ΔFosB (Olausson i wsp., 2006), HSV-GFPAC3I lub HSV-GFPAC3I-ΔFosB. W tych konstruktach AC3I, oparty na peptydzie inhibitor aktywności CaMKII, jest połączony z C-końcem GFP. GFPAC3I sklonowano za pomocą PCR stosując wektor pMM400 zawierający GFPAC3I jako matrycę z następującymi starterami: GFP-AC3I-F: 5 'CC GCTAGC GCCGCCACC ATGGTGAGCAAGGGCGAGGAGCTGT 3' (klamra NeIKozakmet); GFP-AC3I-R: 5 'CC TCCGGA TTACAGGCAGTCCACGGCCT 3' (clampBspEIstop). Powstały produkt PCR wstawiono do wektorów p1005 + i p1005 + -Δ FosB przy użyciu miejsc NheI i BspEI. Konstrukt potwierdzono przez sekwencjonowanie. Współrzędne stereotaksyczne to: kąt 10 °, AP = + 1.6 mm, Lat = + 1.5 mm, DV = -4.4 mm (Barrot i in., 2002). Perfuzję i wycinanie mózgu wykonywano według eksperyment 4.

Analizę kręgosłupa przeprowadzono zgodnie z opisem (Christoffel i in., 2011). W skrócie, segmenty dendrytyczne 50 – 150 µm od somy wybrano losowo z komórek zakażonych HSV, które eksprymują GFP. Obrazy uzyskano na konfokalnym LSM 710 (Carl Zeiss) w celu analizy morfologicznej przy użyciu NeuronStudio z algorytmem rayburst. NeuronStudio klasyfikuje kolce jako cienkie, grzybowe lub stubby w oparciu o następujące wartości: (1) współczynnik proporcji, (2) stosunek głowy do szyi i (3) średnica głowy. Kolce z szyją można sklasyfikować jako cienkie lub grzybowe, a te bez znaczącej szyi są klasyfikowane jako stubby. Kolce z szyjką są oznaczone jako cienkie lub grzybkowe na podstawie średnicy głowy.

Rysunek 6

Rysunek 6

Blokada aktywności CaMKII zapobiega efektom morfologicznym i behawioralnym ΔFosB w NAc

Eksperyment 16: Wpływ nadekspresji ΔFosB za pośrednictwem HSV i inhibicji CaMKII na reakcje kokainy (Rys. 6F)

Dorosłym samcom myszy wstrzykiwano wirusy według eksperyment 15i reakcje lokomotoryczne na pojedynczy wstrzyknięcie kokainy 5 mg / kg mierzono zgodnie z Eksperymentuj 9. Dane lokomotoryczne wyrażono jako całkowite pęknięcia wiązki w ciągu 30 min po wstrzyknięciu kokainy.

Dodatkowe informacje

Obudowa dla zwierząt

Samce szczurów Sprague Dawley (250 – 275 g; Charles River Laboratories) były trzymane w parze. Osiem tygodniowe samce myszy C57BL / 6J (The Jackson Laboratory) były trzymane w grupach z maksymalnie pięcioma zwierzętami na klatkę. Wszystkie zwierzęta przyzwyczajały się do obiektu dla zwierząt na ≥1 tydzień przed manipulacjami eksperymentalnymi i trzymano je w klimatyzowanych pomieszczeniach (23 – 25 ° C) w cyklu 12 hr światło / ciemność (światła na 7: 00 AM) z dostępem do żywności i woda ad libitum. Eksperymenty przeprowadzono zgodnie z wytycznymi Society for Neuroscience i instytucjonalnego komitetu do spraw opieki i użytkowania zwierząt (IACUC) na górze Synaj.

Narkotyki

Lekom podawano IP i rozpuszczano w jałowej soli fizjologicznej, w tym kokainie (5-20 mg / kg na 10 µl dla myszy, na 1 ml dla szczurów, NIDA) i SCH 23390 lub chlorowodorku etiklopridu (0.5 mg / kg na 1 ml, Tocris) . W przypadku chirurgii stereotaktycznej myszy znieczulono „koktajlem” ketaminy (100 mg / kg) i ksylazyny (10 mg / kg) (Henry Schein) w jałowym roztworze soli.

Przeciwciała

CaMKIIα (łącznie): Upstate 05 – 532, 1: 5,000

CaMKII fosfo-Thr286: Promega V111A, 1: 1,000

ΔFosB (łącznie): Cell Signaling 5G4, 1: 250

ΔFosB fosfo-Ser27: Fosfosolwiny, 1: 500

GluA1 (łącznie): Abcam, Ab31232, 1: 1,000

GluA1 fosfo-Ser831: Millipore N453, 1: 1,000

GluA1 fosfo-Ser845: Chemicon Ab5849, 1: 2,000

GluA2: Millipore 07 – 598, 1: 2,000

NR2A: Sigma HPA004692, 1: 2,500

NR2B: Millipore Ab1557P, 1: 1,000

Analizy statystyczne

Wszystkie analizy statystyczne przeprowadzono za pomocą pakietu oprogramowania Prism 6 (GraphPad). Testy t-Studenta zastosowano dla wszystkich porównań parami (wskazane w Wyniki, gdzie podano wartość t), a jednokierunkowe ANOVA zastosowano dla wszystkich porównań wielokrotnych (wskazane w sekcji wyników, gdzie podano wartość F).

Idź do:

wyniki

Chroniczna kokaina indukuje CaMKII w powłoce NAc

Wiele badań wykazało, że MSN w powłoce i rdzeniu NAc mają różne reakcje biochemiczne i fizjologiczne na chroniczne narażenie na narkotyki (Kourrich i Thomas, 2009; Loweth i in., 2010) oraz że oba podregiony różnie regulują zachowania związane z poszukiwaniem narkotyków (Ito i wsp., 2004). Określenie różnicowego wpływu kokainy na składniki białkowe powłoki NAc vs rdzeń wykorzystaliśmy multipleksowane znakowanie izobaryczne (iTRAQ) i tandemową spektroskopię masową (MS / MS). Dorosłym samcom szczurów wstrzykiwano IP kokainą (20 mg / kg) lub solą fizjologiczną codziennie przez 7 dni; 24 hr po ostatnim wstrzyknięciu, skorupa NAC i rdzeń zostały mikrodysseowane (Ryc. 1A) i zamrozić. Białka w tych próbkach oznaczano następnie ilościowo za pomocą iTRAQ. Wszystkie cztery izoformy CaMKII wykazywały duży wzrost ekspresji po leczeniu kokainą, które były specyficzne dla powłoki NAc w porównaniu z rdzeniem. Kilka fosfataz białkowych, w tym katalityczne i regulacyjne podjednostki PP1 oraz PP2A, które wcześniej były związane z różnymi substratami CaMKII w innych systemach (Colbran, 2004), zastosował podobny wzór. Odkrycia te dostarczyły nowych, bezstronnych dowodów na to, że szlak sygnalizacyjny CaMKII jest w znacznym stopniu regulowany przez kokainę w NAc w sposób swoisty dla powłoki.

Aby potwierdzić to stwierdzenie bardziej ilościowo, traktowaliśmy szczury jak powyżej kokainą (w różnych dawkach) lub solą fizjologiczną i mierzyliśmy reakcje lokomotoryczne na kokainę (5 mg / kg) lub dawkę prowokującą solą fizjologiczną. Powtarzająca się ekspozycja na 10 mg / kg kokainy spowodowała typowy wzorzec uczulenia narządu ruchu (Ryc. 1B). Dalsze badania z tym schematem dawkowania ujawniły, za pomocą Western blotting, że powtarzana kokaina indukuje selektywnie CaMKIIα w powłoce NAc 24 hr po ostatnim wstrzyknięciu kokainy (Rys. 1C i D; p = 0.0019; F = 7.943; df = 29). Ponadto fosforylacja kanonicznego substratu CaMKII Ser831 podjednostki GluA1 receptora AMPA była znacząco zwiększona w powłoce NAc, a nie w rdzeniu (p = 0.0261; F = 4.208; df = 28), podczas gdy autofosforylacja CaMKIIα Thr286 miała silny, ale nie znacząca tendencja do indukcji tylko w skorupkachRys. 1D). Kilka innych receptorów glutaminianowych nie uległo zmianie. W przeciwieństwie do tych pomiarów CaMKII, te same próbki tkanki wykazywały indukcję ΔFosB w obu powłokach (p = 0.0260; F = 4.189; df = 29) i rdzeniu (p = 0.0350; F = 3.807; df = 29) NAc (Rys. 1C i D), zgodne z wcześniejszymi ustaleniami (Perrotti i wsp., 2008).

Ponieważ kilka wcześniejszych badań nad regulacją kokainy receptorów AMPA analizowało zwierzęta po ~ 14 dniach odstawienia od chronicznej kokainy (patrz Dyskusja), powtórzyliśmy te analizy biochemiczne w tym punkcie czasowym. Odkryliśmy, że dni 14 po ostatnim wstrzyknięciu kokainy, ΔFosB pozostają podwyższone w NAc (p = 0.0288; F = 4.258; df = 22), podczas gdy ani CaMKII ani fosforylacja GluA1 Ser831 pozostaje zwiększona (Rys. 1E). Jednakże 1 hr po pojedynczej dawce 10 mg / kg prowokuje kokainę, poziomy całkowitego CaMKII (p = 0.0330; F = 3.947; df = 26) i GluA1 Ser831 (p = 0.0213; F = 4.509; df = 27) obie fosforylacje są podwyższone do stopnia podobnego do tego, który występuje po początkowej chronicznej ekspozycji na kokainęRys. 1E). Dane te wskazują, że neurony powłoki NAC są przygotowywane do indukcji CaMKII podczas dłuższych okresów abstynencji, być może przez bezpośrednie pobudzenie promotora genu CaMKII (patrz Dyskusja). Ponadto fakt, że indukcja ΔFosB jest bardziej trwała niż indukcja CaMKII sugeruje istnienie dodatkowych mechanizmów, opartych na chromatynie lub innych, które wywierają „hamulec” na regulację CaMKII, jak omówiono w dyskusji.

Aby dodatkowo wzmocnić te obserwacje, zbadaliśmy modele samopodawania kokainy, które obejmują dobrowolne przyjmowanie leków. Dorosłe samce szczurów otrzymały krótki lub długi dostęp do kokainy; zgodnie z oczekiwaniami (Ahmed i Koob, 1998), tylko długie warunki dostępu doprowadziły do ​​eskalacji samopodawania leku (Ryc. 2A). ΔFosB był indukowany w większym stopniu przez długi czas vs krótki dostęp do kokainy w obu powłokach NAc (p = 0.0011; F = 11.12; df = 17) i rdzeniu (p = 0.0004; F = 13.86; df = 17). W przeciwieństwie do tego, CaMKIIα był indukowany w powłoce NAc tylko przez długi dostęp do kokainy (Rys. 2B i C; p = 0.0236; F = 4.957; df = 16). Interesujące jest porównanie średniego dziennego spożycia kokainy u zwierząt o krótkim dostępie (~ 12 mg / kg IV), zwierząt o długim dostępie (~ 70 mg / kg IV) i zwierząt, którym podawano eksperymenty (10 mg / kg), i zapytaj, dlaczego ten drugi wywołuje silną indukcję ΔFosB i CaMKII, podczas gdy krótki dostęp nie. Ta rozbieżność jest prawdopodobnie spowodowana różnicami w szczytowym poziomie kokainy (kokaina podawana przez eksperymentatora jest podawana jako pojedynczy bolus IP, podczas gdy kokaina podawana samodzielnie jest podawana w wielu dawkach dożylnych) lub przez różnice w długości ekspozycji na lek (dni 7 dla eksperymentatora) podawanie, dni 19 do samodzielnego podawania).

Pomimo obszernej literatury dotyczącej ΔFosB i CaMKII w działaniu kokainy, nie ma badań tych białek u osób używających kokainy. Tutaj przedstawiamy pierwszy dowód, że poziomy ΔFosB (p = 0.0316; t = 1.921; df = 34) i CaMKII (p = 0.0444; t = 1.755; df = 32) są zwiększone w NAc ludzi uzależnionych od kokainy (Rys. 2D, Tabela 1). Dane te wskazują, że nasze badanie indukcji ΔFosB i CaMKII przez kokainę w NAc gryzoni jest klinicznie istotne dla uzależnienia od kokainy u ludzi.

Tabela 1

Tabela 1

Charakterystyka próbek od ludzi uzależnionych od kokainy i dopasowanej grupy kontrolnej

ΔFosB reguluje transkrypcję CaMKII selektywnie w MSN typu D1 powłoki NAc

Odkrycie, że zarówno CaMKII, jak i ΔFosB są podwyższone przez kokainę w NAc gryzonia, doprowadziło nas do ustalenia, czy ΔFosB może regulować transkrypcję genu CaMKII. Wcześniej opisywaliśmy CaMKIIα jako możliwy cel dla ΔFosB w bezstronnej analizie mikromacierzy NAc (McClung i Nestler, 2003), ale tego odkrycia nie potwierdzono w tym badaniu. Najpierw zastosowaliśmy ilościowy ChIP (qChIP-ChIP, a następnie ilościową PCR) w celu określenia, czy ΔFosB wiąże się z promotorem genu CaMKIIα u NAc dorosłych samców szczurów, i stwierdzono uderzająco, że to wiązanie jest znacznie zwiększone przez chroniczne podawanie kokainy w powłoce ( p = 0.0133; t = 2.901; df = 12), ale nie rdzeń, subregion (Ryc. 3A). Aby lepiej zrozumieć mechanizmy związane z tą specyficzną dla podregionu różnicą w wiązaniu ΔFosB z promotorem CaMKIIα, wykorzystaliśmy qChIP do scharakteryzowania stanu modulacji histonów w tym regionie genomowym. Wcześniejsze badania wykazały indukcję kokainy przez acetylację H3 w promotorze CaMKIIα w całkowitej mysiej NAc (Wang i wsp., 2010). Natomiast odkryliśmy, że kokaina selektywnie zmniejsza acetylację H3 w promotorze CaMKIIα w rdzeniu NAc (Ryc. 3B; p = 0.0213; t = 2.726; df = 10), bez zmian widocznych w powłoce, zgodnie z subregionowymi specyficznymi zmianami chromatyny poza wiązaniem ΔFosB. qChIP dla znaku represji, dimetylowana lizyna H3 9 (H3K9me2), ujawniła tendencje spadków zarówno w subregionach powłoki, jak i podregionach podstawowych (Rys 3C).

Aby określić, czy ΔFosB reguluje transkrypcję CaMKIIα in vivo, wykorzystaliśmy dwie bitransgeniczne linie mysie, które indukowalnie nadeksprymują ΔFosB specyficznie w D1 vs MSN typu D2 w sposób kontrolowany przez podawanie doksycykliny w wodzie pitnej (Chen i wsp., 1998; Kelz i wsp., 1999; Werme i wsp., 2002). Dorosłe samce myszy z nadekspresją ΔFosB wyłącznie w MSN typu D1 miały znacząco zwiększone poziomy mRNA CaMKIIα w NAc (p = 0.0337; t = 1.996; df = 13), efekt nie obserwowany u myszy z nadekspresją ΔFosB głównie w MSN typu D2 (Rys. 3D). Wzrostowi mRNA CaMKIIα, indukowanemu przez ekspresję ΔFosB w MSN typu D1, towarzyszył jednoczesny wzrost białka CaMKIIα w obu powłokach NAc (p = 0.0030; t = 3.578; df = 14) i rdzeniu (p = 0.0392; = 2.275; df = 14; Rysunki 3E i F). Dane te pokazują, że ΔFosB jest zdolny do kierowania ekspresją genu CaMKIIα w MSN typu D1 w obu podregionach, chociaż Rysunek 3B sugeruje, że zmiany chromatyny za pośrednictwem kokainy w promotorze CaMKIIα (np. zmniejszona acetylacja) uniemożliwiają ΔFosB zwiększanie CaMKII w podregionie rdzeniowym po kokainie.

Ponieważ nasze dane dotyczące myszy transgenicznych wykazały, że indukcja ekspresji genu CaMKII przez ΔFosB jest specyficzna dla MSN typu D1 w NAc, następnie staraliśmy się ustalić, czy zależna od kokainy regulacja w górę CaMKII wymaga aktywacji receptora dopaminy D1. Dorosłym samcom szczurów podawano przewlekle kokainę lub sól fizjologiczną, jak poprzednio, ale 30 minut przed każdym wstrzyknięciem szczurom z grupy kokainy podawano dootrzewnowo roztwór soli fizjologicznej, antagonistę D1 SCH 23390 (0.5 mg / kg) lub etiklopryd antagonisty receptora D2 (0.5 mg / kg). Zwierzęta analizowano 24 godziny po ostatnim wstrzyknięciu kokainy. Analiza Western blot ujawniła, że ​​antagonista D1, ale nie D2, całkowicie zablokował wzrost ΔFosB, w którym pośredniczy kokaina (p <0.0001; F = 18.96; df = 18), jak opisano wcześniej (Nye i wsp., 1995), jak również w CaMKII (p = 0.0005; F = 10.99; df = 18; Rys. 3G i H). Dane te potwierdzają hipotezę, że kokaina angażuje pośredniczony przez ΔFosB wzrost ekspresji genu CaMKII specyficznie w MSN typu D1 powłoki NAc. Istotne w przyszłych badaniach byłoby bezpośrednie wykazanie tego specyficznego dla komórki wpływu kokainy na ekspresję CaMKII w tym regionie mózgu.

ΔFosB jest zarówno niezbędny, jak i wystarczający do indukcji kokainy CaMKII w NAc Shell

Aby uzupełnić zastosowanie myszy transgenicznych, zbadaliśmy następnie rolę ΔFosB w pośredniczeniu w indukcji kokainy CaMKIIα przez zastosowanie transferu genów za pośrednictwem wirusa u szczurów. Obustronnie wstrzyknęliśmy cząstki wirusowe związane z adenowirusem (AAV) do powłoki NAc dorosłych samców szczurów (gdzie otoczka może być selektywnie ukierunkowana) w celu nadekspresji ΔFosB plus GFP lub sam GFP. Następnie zwierzętom podano pojedynczą iniekcję IP 10 mg / kg kokainy. Zwierzęta wykazujące nadekspresję ΔFosB / GFP wykazywały zwiększoną odpowiedź lokomotoryczną w porównaniu ze zwierzętami z nadekspresją samego GFP (Ryc. 4A). 24 hr po pojedynczej iniekcji kokainy, tkanki GFP-dodatnie NAc wycięto z tych zwierząt przez wycięcie pod fluorescencyjnym źródłem światła. Western blot tej tkanki (Rys. 4B i C) ujawnił silną nadekspresję ΔFosB, jak również znaczący wzrost całkowitego białka CaMKIIα w porównaniu ze zwierzętami GFP (p = 0.0070; t = 2.894; df = 30), podobny do indukcji obserwowanej przy przewlekłym podawaniu kokainy. Ponadto autofosforylacja CaMKIIα w Thr286 (wskazująca na aktywację enzymu) była zwiększona przez nadekspresję ΔFosB (p = 0.0330; t = 2.243; df = 28), podobnie jak fosforylacja substratu CaMKII, Ser831 z GluA1 (p = 0.0540; t = 2.012; df = 28), ponownie naśladując działania chronicznej kokainy (Rys. 1C i D). Tte dane razem dostarczają dalszych dowodów na to, że ekspresja ΔFosB w powłoce NAc jest wystarczająca do uczulenia lokomotorycznego na kokainę i indukcji i aktywacji CaMKII w tym podregionie.

Zastosowaliśmy podobne podejście, aby określić, czy ΔFosB jest również konieczne dla indukowanej kokainą indukcji CaMKIIα w powłoce NAc. AAV zastosowano do nadekspresji skróconego białka JunD, zwanego ΔJunD, który jest ujemnym regulatorem aktywacji transkrypcyjnej ΔFosB (Winstanley i wsp., 2007) plus sam GFP lub GFP. Dwa tygodnie później, gdy ekspresja transgenu jest maksymalna, zwierzętom podawano kokainę (10 mg / kg) lub sól fizjologiczną codziennie przez 7 dni i badano pod kątem odpowiedzi lokomotorycznych na prowokację kokainą (5 mg / kg) 24 hr po ostatnim przewlekłym wstrzyknięciu (Rys. 4D). Nadekspresja DJunD zapobiegała uczuleniu lokomotorycznemu na kokainę, a także zapobiegała indukcji i aktywacji CaMKIIα w powłoce NAc (Rys. 4E i F; p = 0.0437; F = 2.997; całkowita df = 38), wskazując, że aktywność transkrypcyjna ΔFosB jest konieczna dla indukowanej kokainą indukcji CaMKIIα w tym podregionie. Co ciekawe, stwierdziliśmy, że ΔJunD obniża poziomy ΔFosB zarówno w warunkach soli fizjologicznej, jak i w warunkach leczenia kokainą (p = 0.0004; F = 8.110; df = 35), podnosząc nową możliwość, że ΔFosB zależy od aktywności AP-1 dla własnych poziomów ekspresji.

CaMKII Phosphorylates ΔFosB w Ser27

Korzystanie z in vitro oznaczenia kinazy białkowej, stwierdziliśmy, że oczyszczony ΔFosB jest silnym substratem dla CaMKIIα. Inkubacja Jego6-ΔFosB z CaMKIIα i ATP spowodowało przesunięcie w górę ruchliwości elektroforetycznej ΔFosB (Ryc. 5A); kilka powstałych pasm sugerowało wiele miejsc fosforylacji. Podobny in vitro testy kinaz przy użyciu [γ-32P] ATP wykazał włączenie znakowanego radioaktywnie fosforanu do przesuniętych pasm ΔFosB (Ryc. 5B), wykazując bezpośrednią fosforylację białka. Wygenerowaliśmy przeciwciało specyficzne dla fosfo do wcześniej scharakteryzowanego Ser27 z ΔFosB (Ulery i in., 2006). Chociaż to przeciwciało nie wytwarza sygnału przeciwko ekstraktom mózgu, które zawierają ΔFosB fosforylowane przez Ser27 (dane nie pokazane), byliśmy w stanie wykryć fosforylację Ser27 w in vitro test kinazy przy użyciu CaMKII (Ryc. 5B). Analizy kinetyczne fosforylacji MFosB CaMKII wskazują, że jest silnym substratem dla kinazy (Rys 5C), z widocznym KM 5.7 ± 2.0µM i KCAT 2.3 ± 0.3min-1. Wyniki te są porównywalne z wieloma dobrze scharakteryzowanymi in vivo substraty CaMKII (Colbran i Brown, 2004). Ponadto ustaliliśmy, że CaMKII fosforyluje ΔFosB ze stechiometrią 2.27 ± 0.07 mol / mol (Rys. 5D), wskazując, że w His istnieją co najmniej trzy miejsca fosforylacji CaMKII6-AFosB białko, w porozumieniu z Ryc. 5A.

Aby zbadać poszczególne miejsca fosforylacji, wykorzystaliśmy analizy MS próbek z naszego in vitro testy kinazy. Rys. 5E demonstruje fosforylację ΔFosB przy wcześniej scharakteryzowanym Ser27 iw kilku dodatkowych miejscach (dane nie pokazane). Biorąc pod uwagę wcześniejszą charakterystykę funkcjonalną Ser27, skupiliśmy się na tym miejscu, wytwarzając wyznakowane syntetyczne peptydy naśladujące stany fosfo- i niefosfo Ser27, a następnie wykorzystaliśmy znane ilości tych peptydów jako standardy w analizach MRM ΔFosB przed i po in vitro fosforylacja przez CaMKII. Kolejna kwantyfikacja (Rys. 5F) potwierdza, że ​​Ser27 jest silnym substratem dla CaMKII. Wyniki te wskazują, że spośród wielu fosforylowanych reszt w obrębie ΔFosB, Ser27 jest szczególnie skutecznym substratem dla CaMKII.

CaMKII pośredniczy w akumulacji kokainy ΔFosB w powłoce NAc

Ponieważ CaMKII może fosforylować ΔFosB in vitro na stronie, która znacznie zwiększa jego stabilność in vitro i in vivo (Ulery i in., 2006; Ulery-Reynolds i in., 2009), określiliśmy, czy aktywność CaMKII kontroluje poziomy ΔFosB w NAc in vivo. Aby rozwiązać to pytanie, po raz pierwszy zastosowaliśmy linię myszy z nadekspresją niezależnego od wapnia mutanta CaMKIIα (T286D) w wielu regionach mózgu, w tym w NAc (Mayford i in., 1996; Kourrich i in., 2012). Wstrzyknęliśmy dobranym pod względem wieku dorosłemu samcowi mutanta i dzikiego rodzeństwa z 20 mg / kg kokainy lub soli fizjologicznej raz dziennie przez 14 dni, a następnie analizowano zwierzęta jeden dzień po ostatnim wstrzyknięciu. Odkryliśmy, że podstawowe poziomy ΔFosB wzrosły u zmutowanych zwierząt w powłoce NAc (p = 0.0001; F = 9.207; df = 37), ale nie rdzeń (Rys. 5G i H). Zaskakująco, zależna od kokainy indukcja ΔFosB została zablokowana u zmutowanych zwierząt zarówno w skorupce jak i rdzeniu, co sugeruje, że chociaż CaMKII może bezpośrednio regulować stabilność ΔFosB w powłoce NAc, może również leżeć powyżej ΔFosB w szlakach aktywowanych kokainą w obu podregionach NAc .

Aktywność CaMKII jest wymagana dla plastyczności strukturalnej i behawioralnej za pośrednictwem FosB

Indukcja kokainy kolców dendrytycznych na NAc MSN jest jedną z najlepiej przystosowanych indukowanych lekami adaptacji w tym regionie mózgu, a taka indukcja kręgosłupa została skorelowana z uczulonymi reakcjami behawioralnymi na lek (Robinson i Kolb, 2004; Russo i wsp., 2010) i zgłoszono, że są selektywne dla MSN typu D1 (Lee i wsp., 2006). Wykazaliśmy ostatnio, że indukcja kokainy kolców dendrytycznych w NAc zależy od ΔFosB i jego programu transkrypcyjnego w dół (Maze i wsp., 2010). Chociaż istnieje obszerna literatura dotycząca udziału CaMKII w morfologii i indukcji kręgosłupa dendrytycznego w innych regionach mózgu i systemach eksperymentalnych (Jourdain i in., 2003; Penzes i in., 2008; Okamoto i in., 2009), jego rola w tworzeniu kręgosłupa MSN nie została zbadana. Dlatego określiliśmy, czy aktywność CaMKII jest wymagana dla indukowanej przez ΔFosB indukcji kolców dendrytycznych MSN przez wykorzystanie nadekspresji zależnej od HSV peptydu inhibitorowego CaMKII AC3I połączonego z GFP, konstruktu uprzednio hamującego aktywność CaMKII in vivo (Zhang i in., 2005; Klug i in., 2012). Wirusowa nadekspresja ΔFosB w powłoce NAc dorosłych myszy indukowała znaczący wzrost gęstości dendrytycznej kręgosłupa MSN (p <0.0001; F = 8.558; df = 59; Rys. 6A i B) jak wcześniej informowano (Maze i wsp., 2010), a wzrost ten był napędzany głównie przez cienkie (p = 0.0027; F = 5.319; df = 59) i stubby (p = 0.0378; F = 2.988; df = 59) typy kręgosłupa (oba uważane za niedojrzałe kolce) (Rys. 6C – E). Nie zaobserwowano żadnego wpływu na bardziej dojrzałe kolce w kształcie grzybów. Jednak, gdy GFP-AC3I był koeksprymowany, indukcja kolców ΔFosB została całkowicie zniesiona (Rys. 6A – E), wskazując, że aktywność CaMKII jest wymagana do indukcji ΔFosB kolców dendrytycznych w powłoce NAc.

Następnie wykorzystaliśmy te same narzędzia wirusowe do określenia, czy aktywność CaMKII jest wymagana do wpływu ΔFosB na wrażliwość behawioralną na kokainę. 72 hr po wstrzyknięciu wirusa do powłoki NAc, zwierzętom podawano pojedyncze wstrzyknięcie 5 mg / kg kokainy i rejestrowano ich aktywność lokomotoryczną. Jak poprzednio pokazano z większą rozszerzeniem ΔFosB nadekspresji AAV (Ryc. 4A), Nadekspresja ΔFosB za pośrednictwem HSV zwiększała wrażliwość lokomotoryczną na kokainę (p = 0.0002; F = 8.823; df = 37; Rys. 6F). Podobnie jak w przypadku indukcji kolców dendrytycznych, hamowanie aktywności CaMKII przez koekspresję GFP-AC3I całkowicie blokowało wzrost wrażliwości na kokainę za pośrednictwem ΔFosB, co wskazuje, że aktywność CaMKII jest wymagana dla indukowanych ΔFosB zmian w efektach behawioralnych kokainy.

Idź do:

Dyskusja

Niniejsze badanie przedstawia nowatorski mechanizm sprzężenia zwrotnego, w którym kokaina indukuje ΔFosB w NAc, która reguluje w górę transkrypcję genu CaMKIIα selektywnie w powłoce NAc. CaMKIIα następnie fosforyluje i stabilizuje ΔFosB, co prowadzi do większej akumulacji ΔFosB i dalszej indukcji CaMKIIα (Rys. 6G). Współ eskalujące poziomy dwóch białek podczas przewlekłej ekspozycji na kokainę przyczyniają się następnie w istotny sposób do uwrażliwienia reakcji behawioralnych na lek. Jest to szczególnie interesująca hipoteza, ponieważ zarówno ΔFosB, jak i CaMKII, jak wykazano wcześniej, są wymagane do zwiększenia reakcji behawioralnych na kokainę (Pierce i in., 1998; Peakman i wsp., 2003), i replikujemy to odkrycie dla ΔFosB w powłoce NAc specyficznie stosując podejście wirusowe (Rysunki 4 i I 66).

Chociaż transgeniczna nadekspresja ΔFosB w MSN typu D1 może napędzać indukcję CaMKII zarówno w skorupie NAc, jak i rdzeniu zwierząt nieleczonych kokainą, w kontekście kokainy, akumulacja endogennej ΔFosB, która występuje w obu podregionach, napędza indukcję CaMKII specyficznie w powłoce NAc . Ta różnica może odnosić się do wyższych poziomów ΔFosB indukowanych w naszym modelu transgenicznym, jednak może również odzwierciedlać zdolność kokainy do różnicowej zmiany promotora CaMKIIα w powłoce vs podstawowe MSN, aby promować wiązanie ΔFosB w pierwszym lub wykluczyć go w drugim podregionie. W rzeczywistości nasze dane ChIP, które ujawniają deacetylację histonów za pośrednictwem kokainy tylko w promotorze genu CaMKIIα w rdzeniu NAc, potwierdzają możliwy udział mechanizmu chromatyny. Zgodnie z tą hipotezą nadekspresja ΔFosB w MSN typu D1 była w stanie napędzać indukcję CaMKIIα w rdzeniu NAc przy braku kokainy (Rys. 3F), sugerując, że istnieją aktywne modyfikacje promotora CaMKIIα, które zapobiegają tej indukcji podczas przewlekłej ekspozycji na kokainę. Regulacja pejzażu chromatyny w promotorze CaMKII może również wyjaśnić, dlaczego CaMKII jest indukowany przez dawkę prowokującą kokainy w powłoce NAc przewlekłych szczurów wycofujących kokainę (Rys. 1E), ale nie na zwierzętach, które nie są narkotykami (Rys. 1D). Może to reprezentować epigenetyczny efekt „primingu genów” ΔFosB (Robison i Nestler, 2011), a zatem może być jednym molekularnym mechanizmem inkubacji głodu kokainowego (Pickens i in., 2011). Jednakże, aby ta zmiana chromatyny była przyczynowo związana z inkubacją głodu, musiałaby z czasem wzrastać. Interesujące będzie ustalenie, czy tak jest i zbadanie, czy inne geny wykazują zależną od ΔFosB, specyficzną dla podregionu regulację kokainą. Ważne jest również, aby pamiętać, że opisana przez nas pętla feed-forward nie prowadzi do niekończącej się akumulacji CaMKII lub ΔFosB (Rys. 1E); odkrycie molekularnego „hamulca” odpowiedzialnego za to jest ważnym celem przyszłych badań.

Znane funkcje ΔFosB i CaMKII w kilku systemach eksperymentalnych i obszarach mózgu zbiegają się na wielu poziomach (Rys. 6F). Obie cząsteczki są ściśle związane ze wzrostem kręgosłupa dendrytycznego: CaMKII oddziałuje z cytoszkieletem aktynowym (Okamoto i in., 2009), reguluje rozmiar głowy kręgosłupa (Matsuzaki i in., 2004), i jest zarówno niezbędny, jak i wystarczający do wywołanego plastycznością wzrostu liczby filopodiów i liczby synaps w hipokampowych kulturach organotypowych kromek (Jourdain i in., 2003), wHile ΔFosB jest zarówno konieczne, jak i wystarczające do wywołanego przez kokainę powstawania kręgosłupa dendrytycznego w NAc MSN (Maze i wsp., 2010). Ponadto obie cząsteczki związane są z regulacją receptorów glutaminianowych AMPA. CaMKII nie reguluje całkowitych poziomów podjednostek receptora AMPA, ale kieruje insercją receptorów AMPA do synaps i zwiększa przewodnictwo kanału AMPA przez fosforylację GluA1 w Ser831 w hipokampowych neuronach piramidowych w hodowli i in vivo (recenzja w (Malinow i Malenka, 2002; Colbran i Brown, 2004)). Taki zwiększony ruch GluA1 do synapsy jest również związany z przewlekłym działaniem kokainy (Boudreau i Wolf, 2005). Ponadto reakcje behawioralne na aktywację receptora AMPA w NAc są wzmocnione przez nadekspresję CaMKIIα w sposób zależny od receptora dopaminy D1 (Singer i in., 2010). Wykazano, że długotrwała specyficzna dla D1 nadekspresja ΔFosB indukuje transkrypcję GluA2 u NAc (Kelz i wsp., 1999), co tłumi reakcje AMPA za pośrednictwem GluA1, podczas gdy pokazujemy tutaj, że krótszy okres nadekspresji ΔFosB - jak również krótkoterminowa ekspozycja na kokainę - nie ma wpływu na tę podjednostkę (Rys. 1). Niemniej jednak odkryliśmy ostatnio, że krótkoterminowa nadekspresja ΔFosB zmniejsza jednak odpowiedzi AMPA w MSN typu D1 w NAc (Grueter i in., 2013). Dane te sugerują czasowo odrębne mechanizmy, które mogą stanowić zależną od czasu serię neuroadaptacji do kokainy, które leżą u podstaw różnych aspektów progresji uzależnień, które nie są jeszcze dobrze poznane. Na poziomie behawioralnym, zarówno CaMKII, jak i ΔFosB są wymagane do uczulenia lokomotorycznego na kokainę (patrz wyżej), i oba są wymagane do trwałego samopodawania kokainy u gryzoni (Colby i wsp., 2003; Wang i wsp., 2010), sugerując, że te dwa białka są ważne zarówno dla krótko-, jak i długoterminowych adaptacyjnych zachowań związanych z ekspozycją na lek, chociaż poprzez częściowo różne mechanizmy leżące u ich podstaw. Przypuszczalnie ΔFosB i CaMKII regulują takie złożone adaptacje behawioralne poprzez zmiany w funkcji synaptycznej NAc, chociaż potrzebne są dalsze prace, aby bezpośrednio powiązać zjawiska synaptyczne ze zmianą behawioralną.

Holoenzym CaMKII współdziała jednocześnie z różnymi białkami związanymi z synapsami (Robison i in., 2005), które, jak się uważa, regulują ukierunkowanie na gęstość postsynaptyczną (PSD), zjawisko sugerowane jako ważne dla plastyczności synaptycznej. W szczególności wykazano, że interakcja CaMKII z podjednostką GluN2B receptora glutaminianu typu NMDA reguluje zarówno plastyczność synaptyczną, jak i uczenie się (Halt i in., 2012). Podczas gdy peptyd AC3I naśladuje domenę autoinhibitującą CaMKII, a zatem hamuje aktywność katalityczną enzymów, blokuje również wiele interakcji białko-białko (Strack i in., 2000; Robison i in., 2005). Zatem opisane tutaj behawioralne i morfologiczne efekty HSV-GFP-AC3I mogą wystąpić poprzez zmniejszoną fosforylację docelowych białek CaMKII, zmiany w celowaniu CaMKII lub zmianę proponowanej strukturalnej roli CaMKII w synapsach (Lisman i in., 2002).

Szczególne znaczenie ma ograniczenie proponowanej pętli ΔFosB-CaMKII do powłoki NAc, ponieważ ostatnie prace wykazały kilka różnic fizjologicznych między skorupą i rdzeniem NAc w odpowiedzi na podawanie kokainy, co zostało potwierdzone przez nasze obiektywne dane iTRAQ (tabela S1) . MSN w powłoce NAc wykazują depresję zdolności wypalania po przewlekłej kokainie, która utrzymuje się przez tygodnie, podczas gdy podstawowe MSN od tych samych zwierząt wykazują przejściowy (dzień 1 – 3) wzrost zdolności strzelania, który powraca do poziomów podstawowych w ciągu tygodni 2 (Kourrich i Thomas, 2009). Ponadto, wiele białek synaptycznych jest różnie regulowanych w powłoce NAc vs rdzeń zwierząt narażonych na chroniczną kokainę, w tym GluA2 (Knackstedt i in., 2010). Jako chroniczna amfetamina indukuje CaMKIIα szczególnie w powłoce NAc (Loweth i in., 2010), nie jest zaskakujące, że znajdujemy podobny efekt w przypadku kokainy. Jednakże, ponieważ ΔFosB jest indukowany zarówno w powłoce NAc, jak i rdzeniu przez chroniczną kokainę (Perrotti i wsp., 2008), a ponieważ pokazujemy, że indukcja CaMKIIα w powłoce jest zależna od ΔFosB, nasze odkrycia dostarczają nowych dowodów na odrębne mechanizmy transkrypcyjne w promotorze CaMKIIα między tymi dwoma podregionami, które są odpowiedzialne za selektywną indukcję CaMKIIα w powłoce.

Wiele ostatnich prac skupiło się na określeniu różnic między MSN typu NAc D1 i D2. Chociaż zarówno receptory D1, jak i D2 są zaangażowane w nagradzające działanie kokainy (Self, 2010), ostatnie prace pokazują, że aktywacja optyczna MSN typu D1 zwiększa reakcje behawioralne na kokainę, podczas gdy aktywacja MSN typu D2 ma odwrotny skutek (Lobo i in., 2010). Zgodnie z tymi odkryciami myszy pozbawione receptora D1 mają niedobór nabywania kokainy we własnym zakresie (Caine i in., 2007), podczas gdy nokauty D2 nie są (Caine i in., 2002). Podawanie agonisty D1 bezpośrednio do NAc wywołuje zachowania szukające kokainy w paradygmatach przywracania (Self, 2010). Co ciekawe, efekt ten wymaga zależnego od receptora D1 wzrostu aktywności CaMKII w powłoce NAc, ale nie rdzeniowej (Anderson i in., 2008), wynik, który ładnie pasuje do proponowanej tutaj pętli D1 i powłoki ΔFosB-CaMKII.

Wcześniej informowaliśmy, że Ser27 w ΔFosB może być fosforylowany przez kinazę kazeinową-2 (Ulery i in., 2006), jednak ustalamy tutaj, że CaMKII fosforyluje ΔFosB w tym i innych miejscach o znacznie większej kinetyce i stechiometrii i może replikować wyższe pozorne Mr obserwowane dla ΔFosB (Ryc. 5A) z narażeniem na kokainę in vivo (Nestler, 2008). Wiemy już, że fosforylacja Ser27 zwiększa stabilność ΔFosB i aktywność transkrypcyjną (Ulery i in., 2006; Ulery i Nestler, 2007; Ulery-Reynolds i in., 2009). Przyszłe prace skupią się teraz na identyfikacji i konsekwencjach funkcjonalnych nowych miejsc fosforylacji ΔFosB wskazanych w niniejszym badaniu.

Opisana tutaj pętla sprzężenia zwrotnego zapewnia wiarygodny nowy mechanizm, dzięki któremu powtarzane podawanie kokainy napędza postępujące nieprawidłowości w NAc. Jako taki, ten szlak biochemiczny może stanowić ważny cel przyszłej interwencji terapeutycznej w zaburzeniach uzależniających. Ponieważ CaMKII jest wszechobecny i wymagany do wielu podstawowych funkcji neuronalnych i behawioralnych, unika się bezpośredniego stosowania inhibitorów CaMKII jako leczenia uzależnień. Nasze dane sugerują, że bardziej subtelne ukierunkowanie mechanizmu indukcji CaMKII, które jest specyficzne dla pojedynczego typu komórek i podregionu obwodów nagrody mózgu, mogłoby dostarczyć celu terapeutycznego, który pozwoliłby uniknąć powikłań układowego hamowania CaMKII.

Idź do:

Podziękowania

Praca ta była wspierana przez dotacje z Narodowego Instytutu Narkomanii (EJN), NIDA-Yale Proteomics Center DA018343 (AJR i EJN) oraz Hartwell Foundation (AJR). Autorzy pragną podziękować Gabby Rundenko za hojny dar oczyszczonej ΔFosB i Roger Colbran za hojny dar oczyszczonego CaMKIIα.

Idź do:

Referencje

  1. Ahmed SH, Koob GF. Przejście od umiarkowanego do nadmiernego spożycia narkotyków: zmiana hedonicznej wartości zadanej. Nauka. 1998; 282: 298-300. [PubMed]
  2. Anderson SM, Famous KR, Sadri-Vakili G, Kumaresan V, Schmidt HD, Bass CE, Terwilliger EF, Cha JH, Pierce RC. CaMKII: biochemiczny most łączący układy dopaminy i glutaminianu półleżącego w poszukiwaniu kokainy. Nat Neurosci. 2008; 11: 344 – 353. [PubMed]
  3. Boudreau AC, Wolf ME. Uczulenie behawioralne na kokainę jest związane ze zwiększoną ekspresją powierzchni receptora AMPA w jądrze półleżącym. J Neurosci. 2005; 25: 9144 – 9151. [PubMed]
  4. Brickey DA, Colbran RJ, Fong YL, Soderling TR. Ekspresja i charakterystyka podjednostki alfa Ca2 + / kinazy białkowej zależnej od kalmoduliny II przy użyciu bakulowirusowego systemu ekspresyjnego. Biochem Biophys Res Commun. 1990; 173: 578 – 584. [PubMed]
  5. Caine SB, Negus SS, Mello NK, Patel S, Bristow L, Kulagowski J, Vallone D, Saiardi A, Borrelli E. Rola receptorów dopaminopodobnych D2 w samopodawaniu kokainy: badania z myszami z mutacją receptora D2 i nowym receptorem D2 antagoniści. J Neurosci. 2002; 22: 2977 – 2988. [PubMed]
  6. Caine SB, Thomsen M, Gabriel KI, Berkowitz JS, Gold LH, Koob GF, Tonegawa S, Zhang J, Xu M. Brak samodzielnego podawania kokainy myszom z nokautem receptora dopaminy D1. J Neurosci. 2007; 27: 13140 – 13150. [Artykuł bezpłatny PMC] [PubMed]
  7. Carle TL, Ohnishi YN, Ohnishi YH, Alibhai IN, Wilkinson MB, Kumar A, Nestler EJ. Mechanizmy zależne od proteasomu i niezależne dla destabilizacji FosB: identyfikacja domen degronu FosB i implikacje dla stabilności DeltaFosB. Eur J Neurosci. 2007; 25: 3009 – 3019. [PubMed]
  8. Chen J, Kelz MB, Zeng G, Sakai N, Steffen C, Shockett PE, Picciotto MR, Duman RS, Nestler EJ. Zwierzęta transgeniczne z indukowalną, ukierunkowaną ekspresją genów w mózgu. Mol Pharmacol. 1998; 54: 495 – 503. [PubMed]
  9. Christoffel DJ, Golden SA, Dumitriu D, Robison AJ, Janssen WG, Ahn HF, Krishnan V, Reyes CM, Han MH, Ables JL, Eisch AJ, Dietz DM, Ferguson D, Neve RL, Greengard P, Kim Y, Morrison JH , Russo SJ. Kinaza IkappaB reguluje plastyczność synaptyczną i behawioralną wywołaną stresem społecznym. J Neurosci. 2011; 31: 314 – 321. [Artykuł bezpłatny PMC] [PubMed]
  10. Colbran RJ. Inaktywacja Ca2 + / kinazy białkowej zależnej od kalmoduliny II przez podstawową autofosforylację. J Biol Chem. 1993; 268: 7163 – 7170. [PubMed]
  11. Colbran RJ. Fosfatazy białkowe i zależna od wapnia / kalmoduliny zależna od kinazy białkowej II plastyczność synaptyczna. J Neurosci. 2004; 24: 8404 – 8409. [PubMed]
  12. Colbran RJ, Brown AM. Kinaza białkowa II zależna od wapnia / kalmoduliny i plastyczność synaptyczna. Curr Opin Neurobiol. 2004; 14: 318 – 327. [PubMed]
  13. Colby CR, Whisler K, Steffen C, Nestler EJ, Self DW. Nadekspresja DeltaFosB specyficzna dla komórek prążkowia zwiększa zachętę do kokainy. J Neurosci. 2003; 23: 2488 – 2493. [PubMed]
  14. Covington HE, 3rd, Maze I, LaPlant QC, Vialou VF, Ohnishi YN, Berton O, Fass DM, Renthal W, Rush AJ, 3rd, Wu EY, Ghose S, Krishnan V, Russo SJ, Tamminga C, Haggarty SJ, Nestler EJ. Działanie przeciwdepresyjne inhibitorów deacetylazy histonowej. J Neurosci. 2009; 29: 11451 – 11460. [Artykuł bezpłatny PMC] [PubMed]
  15. Davalos A, Fernandez-Hernando C, Sowa G, Derakhshan B, Lin MI, Lee JY, Zhao H, Luo R, Colangelo C, Sessa WC. Ilościowa proteomika białek regulowanych przez kaweolinę-1: charakterystyka polimerazy i czynnika uwalniającego transkrypt / CAVIN-1 IN w komórkach śródbłonka. Mol Cell Proteomics. 2010; 9: 2109 – 2124. [Artykuł bezpłatny PMC] [PubMed]
  16. Dumais A, Lesage AD, Alda M, Rouleau G, Dumont M, Chawky N, Roy M, Mann JJ, Benkelfat C, Turecki G. Czynniki ryzyka zakończenia samobójstwa w ciężkiej depresji: badanie przypadków zachowań impulsywnych i agresywnych w mężczyźni. Am J Psychiatry. 2005; 162: 2116 – 2124. [PubMed]
  17. Grueter BA, Robison AJ, Neve RL, Nestler EJ, Malenka RC. ΔFosB moduluje różnicowo funkcję jądra półleżącego bezpośrednio i pośrednio. Proc Natl Acad Sci USA. 2013 w prasie. [Artykuł bezpłatny PMC] [PubMed]
  18. Halt AR, Dallapiazza RF, Zhou Y, Stein IS, Qian H, Juntti S, Wójcik S, Brose N, Silva AJ, Hell JW. Wiązanie CaMKII z GluN2B ma kluczowe znaczenie podczas konsolidacji pamięci. EMBO J. 2012; 31: 1203 – 1216. [Artykuł bezpłatny PMC] [PubMed]
  19. Hiroi N, Brown JR, Haile CN, Ye H, Greenberg ME, Nestler EJ. Myszy z mutacją FosB: utrata przewlekłej indukcji kokainy białek związanych z Fos i zwiększona wrażliwość na psychomotoryczne i nagradzające efekty kokainy. Proc Natl Acad Sci US A. 1997; 94: 10397–10402. [Artykuł bezpłatny PMC] [PubMed]
  20. Ito R, Robbins TW, Everitt BJ. Kontrola różnicowa nad poszukiwaniem kokainy przez jądro półleżące rdzeń i skorupa. Nat Neurosci. 2004; 7: 389 – 397. [PubMed]
  21. Jorissen HJ, Ulery PG, Henry L, Gourneni S, Nestler EJ, Rudenko G. Dimeryzacja i właściwości wiązania czynnika transkrypcyjnego DeltaFosB. Biochemia. 2007; 46: 8360 – 8372. [PubMed]
  22. Jourdain P, Fukunaga K, Muller D. Kinaza białkowa II zależna od wapnia / kalmoduliny przyczynia się do wzrostu filopodiów zależnych od aktywności i tworzenia kręgosłupa. J Neurosci. 2003; 23: 10645 – 10649. [PubMed]
  23. Kelz MB, Chen J, Carlezon WA, Jr, Whisler K, Gilden L, Beckmann AM, Steffen C, Zhang YJ, Marotti L, Self DW, Tkatch T, Baranauskas G, Surmeier DJ, Neve RL, Duman RS, Picciotto MR, Nestler EJ. Ekspresja czynnika transkrypcyjnego deltaFosB w mózgu kontroluje wrażliwość na kokainę. Natura. 1999; 401: 272 – 276. [PubMed]
  24. Klug JR, Mathur BN, Kash TL, Wang HD, Matthews RT, Robison AJ, Anderson ME, Deutch AY, Lovinger DM, Colbran RJ, Winder DG. Genetyczne hamowanie CaMKII w grzbietowym prążkowiu Średnie kolczaste neurony zmniejszają funkcjonalne pobudzenie synaps i zwiększają wewnętrzną pobudliwość. PLoS One. 2012; 7: e45323. [Artykuł bezpłatny PMC] [PubMed]
  25. Knackstedt LA, Moussawi K, Lalumiere R, Schwendt M, Klugmann M, Kalivas PW. Trening wymierania po samodzielnym podaniu kokainy wywołuje plastyczność glutaminergiczną, która hamuje poszukiwanie kokainy. J Neurosci. 2010; 30: 7984 – 7992. [Artykuł bezpłatny PMC] [PubMed]
  26. Kourrich S, Thomas MJ. Podobne neurony, przeciwne adaptacje: doświadczenie psychostymulujące zmienia w różny sposób właściwości wypalania w rdzeniu półleżącym w stosunku do powłoki. J Neurosci. 2009; 29: 12275 – 12283. [Artykuł bezpłatny PMC] [PubMed]
  27. Kourrich S, Klug JR, Mayford M, Thomas MJ. Niezależny od AMPAR efekt prążkowia alphaCaMKII promuje uczulenie na nagrodę kokainową. J Neurosci. 2012; 32: 6578 – 6586. [Artykuł bezpłatny PMC] [PubMed]
  28. LaPlant Q, Chakravarty S, Vialou V, Mukherjee S, Koo JW, Kalahasti G, Bradbury KR, Taylor SV, Maze I, Kumar A, Graham A, Birnbaum SG, Krishnan V, Truong HT, Neve RL, Nestler EJ, Russo SJ . Rola czynnika jądrowego kappaB w nadwrażliwości na stres hormonu jajnikowego u samic myszy. Biol Psychiatry. 2009; 65: 874 – 880. [Artykuł bezpłatny PMC] [PubMed]
  29. Lee KW, Kim Y, Kim AM, Helmin K, Nairn AC, Greengard P. Cocaine wywołał tworzenie się kręgosłupa dendrytycznego w średnich kolczastych neuronach kolistych receptorów dopaminy D1 i D2 w jądrze półleżącym. Proc Natl Acad Sci US A. 2006; 103: 3399 – 3404. [Artykuł bezpłatny PMC] [PubMed]
  30. Lisman J, Schulman H, Cline H. Molekularne podstawy funkcji CaMKII w pamięci synaptycznej i behawioralnej. Nat Rev Neurosci. 2002; 3: 175 – 190. [PubMed]
  31. Lobo MK, Covington HE, 3rd, Chaudhury D, Friedman AK, Sun H, Damez-Werno D, Dietz DM, Zaman S, Koo JW, Kennedy PJ, Mouzon E, Mogri M, Neve RL, Deisseroth K, Han MH, Nestler EJ. Specyficzna dla komórek utrata sygnalizacji BDNF naśladuje optogenetyczną kontrolę nagrody kokainowej. Nauka. 2010; 330: 385 – 390. [Artykuł bezpłatny PMC] [PubMed]
  32. Loweth JA, Baker LK, Guptaa T, Guillory AM, Vezina P. Hamowanie CaMKII w jądrze półleżącym zmniejsza nasilone spożycie amfetaminy u uczulonych szczurów. Neurosci Lett. 2008; 444: 157 – 160. [Artykuł bezpłatny PMC] [PubMed]
  33. Loweth JA, Singer BF, Baker LK, Wilke G, Inamine H, Bubula N, Alexander JK, Carlezon WA, Jr, Neve RL, Vezina P. Przejściowa nadekspresja kinazy alfa-Ca2 + / zależnej od kalmoduliny kinazy białkowej II w jądrze półleżącym zwiększa reakcję behawioralną na amfetaminę. J Neurosci. 2010; 30: 939 – 949. [Artykuł bezpłatny PMC] [PubMed]
  34. Malinow R, Malenka RC. Handel receptorem AMPA i plastyczność synaptyczna. Annu Rev Neurosci. 2002; 25: 103 – 126. [PubMed]
  35. Matsuzaki M, Honkura N, Ellis-Davies GC, Kasai H. Strukturalne podstawy długotrwałego wzmocnienia w pojedynczych kolcach dendrytycznych. Natura. 2004; 429: 761 – 766. [PubMed]
  36. Mayford M, Bach ME, Huang YY, Wang L, Hawkins RD, Kandel ER. Kontrola tworzenia pamięci poprzez regulowaną ekspresję transgenu CaMKII. Nauka. 1996; 274: 1678 – 1683. [PubMed]
  37. Maze I, Covington HE, 3rd, Dietz DM, LaPlant Q, Renthal W, Russo SJ, Mechanik M, Mouzon E, Neve RL, Haggarty SJ, Ren Y, Sampath SC, Hurd YL, Greengard P, Tarakhovsky A, Schaefer A, Nestler EJ. Istotna rola metylotransferazy histonowej G9a w plastyczności indukowanej kokainą. Nauka. 2010; 327: 213 – 216. [Artykuł bezpłatny PMC] [PubMed]
  38. McClung CA, Nestler EJ. Regulacja ekspresji genów i nagrody kokainowej przez CREB i DeltaFosB. Nat Neurosci. 2003; 6: 1208 – 1215. [PubMed]
  39. Nestler EJ. Przejrzeć. Transkrypcyjne mechanizmy uzależnienia: rola DeltaFosB. Philos Trans R Soc Lond B Biol Sci. 2008; 363: 3245 – 3255. [Artykuł bezpłatny PMC] [PubMed]
  40. Nye HE, Hope BT, Kelz MB, Iadarola M, Nestler EJ. Badania farmakologiczne regulacji przewlekłej indukowanej przez FOS antygenu przez kokainę w prążkowiu i jądrze półleżącym. J Pharmacol Exp Ther. 1995; 275: 1671 – 1680. [PubMed]
  41. Okamoto K, Bosch M, Hayashi Y. Rola CaMKII i F-aktyny w plastyczności strukturalnej kolców dendrytycznych: potencjalna tożsamość molekularna znacznika synaptycznego? Fizjologia (Bethesda) 2009; 24: 357 – 366. [PubMed]
  42. Olausson P, Jentsch JD, Tronson N, Neve RL, Nestler EJ, Taylor JR. DeltaFosB w jądrze półleżącym reguluje wzmacniane żywnością zachowanie instrumentalne i motywację. J Neurosci. 2006; 26: 9196 – 9204. [PubMed]
  43. Paxinos G, Watson C. Mózg szczura o współrzędnych stereotaktycznych. 6th Edition. Amsterdam; Boston: Academic Press / Elsevier; 2007.
  44. Peakman MC, Colby C, Perrotti LI, Tekumalla P, Carle T, Ulery P, Chao J, Duman C, Steffen C, Monteggia L, Allen MR, Stock JL, Duman RS, McNeish JD, Barrot M, Self DW, Nestler EJ , Schaeffer E. Indukowalna, specyficzna dla regionu ekspresja dominującego negatywnego mutanta c-Jun u myszy transgenicznych zmniejsza wrażliwość na kokainę. Brain Res. 2003; 970: 73 – 86. [PubMed]
  45. Penzes P, Cahill ME, Jones KA, Srivastava DP. Sygnały zbieżnego CaMK i RacGEF sterują strukturą i funkcją dendrytyczną. Trends Cell Biol. 2008; 18: 405 – 413. [PubMed]
  46. Perrotti LI, Hadeishi Y, Ulery PG, Barrot M, Monteggia L, Duman RS, Nestler EJ. Indukcja deltaFosB w strukturach mózgu związanych z nagrodą po przewlekłym stresie. J Neurosci. 2004; 24: 10594 – 10602. [PubMed]
  47. Perrotti LI, Weaver RR, Robison B, Renthal W, Maze I, Yazdani S, Elmore RG, Knapp DJ, Selley DE, Martin BR, Sim-Selley L, Bachtell RK, Self DW, Nestler EJ. Wyraźne wzory indukcji DeltaFosB w mózgu przez narkotyki. Synapsa. 2008; 62: 358 – 369. [Artykuł bezpłatny PMC] [PubMed]
  48. Pickens CL, Airavaara M., Theberge F, Fanous S, Hope BT, Shaham Y. Neurobiologia inkubacji głodu narkotykowego. Trendy Neurosci. 2011; 34: 411 – 420. [Artykuł bezpłatny PMC] [PubMed]
  49. Pierce RC, Quick EA, Reeder DC, Morgan ZR, Kalivas PW. Drugie przekaźniki pośredniczone przez wapń modulują ekspresję behawioralnego uczulenia na kokainę. J Pharmacol Exp Ther. 1998; 286: 1171 – 1176. [PubMed]
  50. Quirion R, Robitaille Y, Martial J, Chabot JG, Lemoine P, Pilapil C, Dalpe M. Autoradiografia ludzkiego mózgu z wykorzystaniem skrawków całej półkuli: ogólna metoda, która minimalizuje artefakty tkankowe. Synapsa. 1987; 1: 446 – 454. [PubMed]
  51. Robinson TE, Kolb B. Plastyczność strukturalna związana z ekspozycją na narkotyki. Neuropharmakologia. 2004; 47 (Suppl 1): 33 – 46. [PubMed]
  52. Robison AJ, Nestler EJ. Transkrypcyjne i epigenetyczne mechanizmy uzależnienia. Nat Rev Neurosci. 2011; 12: 623 – 637. [Artykuł bezpłatny PMC] [PubMed]
  53. Robison AJ, Bass MA, Jiao Y, MacMillan LB, Carmody LC, Bartlett RK, Colbran RJ. Wielowartościowe interakcje zależnej od wapnia / kalmoduliny kinazy białkowej II z białkami gęstości postsynaptycznej NR2B, densin-180 i alfa-aktynina-2. J Biol Chem. 2005; 280: 35329 – 35336. [PubMed]
  54. Ross PL, Huang YN, Marchese JN, Williamson B, Parker K, Hattan S, Khainovski N, Pillai S, Dey S, Daniels S, Purkayastha S, Juhasz P, Martin S, Bartlet-Jones M, He F, Jacobson A, DJ Pappin. Wielokrotne oznaczanie ilościowe białek w Saccharomyces cerevisiae przy użyciu izobarycznych reagentów znakujących reagujących z aminami. Mol Cell Proteomics. 2004; 3: 1154 – 1169. [PubMed]
  55. Russo SJ, Dietz DM, Dumitriu D, Morrison JH, Malenka RC, Nestler EJ. Uzależniona synapsa: mechanizmy synaptycznej i strukturalnej plastyczności jądra półleżącego. Trendy Neurosci. 2010; 33: 267 – 276. [Artykuł bezpłatny PMC] [PubMed]
  56. Self DW. W: Receptory dopaminy. Neve KA, redaktor. Nowy Jork: Humana Press; 2010. str. 479 – 524.
  57. Singer BF, Loweth JA, Neve RL, Vezina P. Przemijająca wirusowa nadekspresja kinazy białkowej alfa-wapń / kalmodulina II w powłoce jądra półleżącego prowadzi do długotrwałej funkcjonalnej regulacji alfa-amino-3-hydroksy-5 -metylo-4-receptory izoksazolu-propionianu: receptor dopaminy-1 i kinaza białkowa Zależność. Eur J Neurosci. 2010; 31: 1243 – 1251. [Artykuł bezpłatny PMC] [PubMed]
  58. Strack S, McNeill RB, Colbran RJ. Mechanizm i regulacja ukierunkowania kinazy białkowej II zależnej od wapnia / kalmoduliny na podjednostkę NR2B receptora N-metylo-D-asparaginianu. J Biol Chem. 2000; 275: 23798 – 23806. [PubMed]
  59. Ulery-Reynolds PG, MA Castillo, Vialou V, Russo SJ, Nestler EJ. Fosforylacja DeltaFosB pośredniczy w jego stabilności in vivo. Neuroscience. 2009; 158: 369 – 372. [Artykuł bezpłatny PMC] [PubMed]
  60. Ulery PG, Nestler EJ. Regulacja aktywności transkrypcyjnej DeltaFosB przez fosforylację Ser27. Eur J Neurosci. 2007; 25: 224 – 230. [PubMed]
  61. Ulery PG, Rudenko G, Nestler EJ. Regulacja stabilności DeltaFosB przez fosforylację. J Neurosci. 2006; 26: 5131 – 5142. [PubMed]
  62. Vialou V, i in. DeltaFosB w obwodach nagrody mózgowej pośredniczy w odporności na stres i odpowiedzi przeciwdepresyjne. Nat Neurosci. 2010; 13: 745 – 752. [Artykuł bezpłatny PMC] [PubMed]
  63. Wang L, Lv Z, Hu Z, Sheng J, Hui B, Sun J, Ma L. Przewlekła indukowana kokainą acetylacja H3 i transkrypcyjna aktywacja CaMKIIalfa w jądrze półleżącym jest krytyczna dla motywacji do wzmocnienia leku. Neuropsychofarmakologia. 2010; 35: 913 – 928. [Artykuł bezpłatny PMC] [PubMed]
  64. Werme M, Messer C, Olson L, Gilden L, Thoren P, Nestler EJ, Brene S. Delta FosB reguluje pracę kół. J Neurosci. 2002; 22: 8133 – 8138. [PubMed]
  65. Winstanley CA, LaPlant Q, Theobald DE, Green TA, Bachtell RK, Perrotti LI, DiLeone RJ, Russo SJ, Garth WJ, Self DW, Nestler EJ. Indukcja DeltaFosB w korze oczodołowo-czołowej pośredniczy w tolerancji na indukowane kokainą zaburzenia poznawcze. J Neurosci. 2007; 27: 10497 – 10507. [PubMed]
  66. Zachariou V, Bolanos CA, Selley DE, Theobald D, Cassidy MP, Kelz MB, Shaw-Lutchman T, Berton O, Sim-Selley LJ, Dileone RJ, Kumar A, Nestler EJ. Istotna rola DeltaFosB w jądrze półleżącym w działaniu morfiny. Nat Neurosci. 2006; 9: 205 – 211. [PubMed]
  67. Zhang R, Khoo MS, Wu Y, Yang Y, Grueter CE, Ni G, Price EE, Jr, Thiel W, Guatimosim S, Song LS, Madu EC, Shah AN, Vishnivetskaya TA, Atkinson JB, Gurevich VV, Salama G, Lederer WJ, Colbran RJ, Anderson ME. Hamowanie kinazy kalmodulinowej II chroni przed strukturalną chorobą serca. Nat Med. 2005; 11: 409 – 417. [PubMed]