Cdk5 fosforylater Dopamin D2 Receptor och dämpar Downstream Signalering (2013)

Kommentarer: Visas för att visa att Cdk5 orsakar nedreglering av dopamin D2-receptorer. Otroligt nog inducerar översättningsfaktor deltafosb produktionen av Cdk5. Slutsatsen Deltafosb spelar en viktig roll i både sensibilisering och desensibilisering


Jeong J, Park YU, Kim DK, Lee S, Kwak Y, et al. (2013) PLOS ONE 8 (12): e84482. doi: 10.1371 / journal.pone.0084482

Abstrakt

Dopamin D2-receptorn (DRD2) är en nyckelreceptor som medger dopaminrelaterade hjärnfunktioner som humör, belöning och känslor. Cyklinberoende kinas 5 (Cdk5) är en prolinriktad serin / treoninkinas vars funktion har blivit implicerad i hjärnbelöningskretsen. I denna studie avslöjade vi att serin 321-resten (S321) i den tredje intracellulära slingan av DRD2 (D2i3) är en ny regleringsplats för Cdk5. Cdk5-beroende fosforylering av S321 i D2i3 observerades i vitro och cellodlingssystem.

Vi observerade vidare att fosforyleringen av S321 försämrade det agoniststimulerade ytuttrycket av DRD2 och minskad G-proteinkoppling till DRD2. Vidare påverkades den nedströms cAMP-vägen i det heterologa systemet och i primära neuronkulturer från p35 knockout-embryon troligen på grund av den reducerade inhiberande aktiviteten hos DRD2. Dessa resultat indikerar att Cdk5-medierad fosforylering av S321 hämmar DRD2-funktionen, vilket ger en ny regleringsmekanism för dopamin-signalering.

siffror

12

Citation: Jeong J, Park YU, Kim DK, Lee S, Kwak Y, et al. (2013) Cdk5 fosforylaterar Dopamin D2 Receptor och dämpar nedströms signalering. PLOS ONE 8 (12): e84482. doi: 10.1371 / journal.pone.0084482

Redaktör: James Porter, University of North Dakota, USA

Mottagen: Maj 20, 2013; Accepterad: November 14, 2013; Publicerad: December 31, 2013

Upphovsrätt: © 2013 Jeong m.fl. Detta är en artikel med öppen åtkomst som distribueras enligt villkoren i Creative Commons Attribution License, som tillåter obegränsad användning, distribution och reproduktion i vilket medium som helst, förutsatt att den ursprungliga författaren och källan krediteras.

finansiering: Detta arbete stöddes av bidrag (NRF-2012R1A2A2A01012923 och NRF-2012R1A4A1028200) från den koreanska regeringen (MSIP) och stöddes också inom ramen för det internationella samarbetsprogrammet förvaltat av NRF i Korea (2012K2A1A2033117) och Korea Brain Research Institute (KBRI) Grundläggande forskningsprogram för MSIP (2031-415). SKP var mottagare av 2004 och 2006 National Alliance for Research on Schizophrenia and Depression (NARSAD) Young Investigator Awards. Fundrarna hade ingen roll i studiedesign, datainsamling och analys, beslut att publicera eller förbereda manuskriptet.

Konkurrerande intressen: Författarna har förklarat att inga konkurrerande intressen existerar.

Beskrivning

Dopamin signaleringen är inblandad i olika hjärnfunktioner, inklusive motorkoordination, humörkontroll och belöningsmekanismer [1]. En viktig del av dopamin-signaleringen hos ryggradsdjur utövas av striatala mediumspiny neuroner (MSN) som selektivt uttrycker en delmängd av dopaminreceptorer och mottar dopaminerg inmatning huvudsakligen från ventral tegmentalområdet (VTA) och substantia nigra (SN) [2]. Dopaminreceptorer är G-proteinkopplade receptorer (GPCR) med sju transmembrana domäner och består av två subtyper, D1-liknande och D2-liknande receptorer, som medierar ömsesidiga åtgärder vid dopamin-signalering [1]. Exempelvis aktiverar dopamin D1-liknande receptorer (D1, D5) adenylylcyklas genom GaS och öka den intracellulära nivån av cAMP, men dopamin D2-liknande receptorer (D2, D3, D4) hämmar adenylylcyklas genom Gai och minska intracellulär nivå av cAMP [1], [3].

Bland dopaminreceptorer är D2-receptorn (DRD2) implicerad i patofysiologin av flera större psykiatriska störningar inklusive schizofreni och drogmissbruk [4], så att många antipsykotiska läkemedel åtminstone delvis är riktade mot DRD2. Det är också känt att DRD2-aktivitet korrelerar väl med de beteendemässiga följderna av missbruk av droger i djurmodeller [5]. Antidepressiva medel och humörstabiliseringseffektivitet har också kopplats till förändringar i cellytaxpressionen av DRD2 eller nedströms intracellulär signalering medierad av PKA, ERK och GSK3 [1], [4], [6]. Trots dessa kritiska roller för DRD2 i hjärnan är de detaljerade regleringsmekanismerna som ger heterogenitet och komplexitet till DRD2 egenskaper inte fullständigt förstådda.

Konvergerande bevislinjer indikerar att flera posttranslationella modifieringar är inblandade i finjustering av DRD2-aktiviteten. Omfattande glykosylering av DRD2 avslöjades i tidiga studier om fotoaffinitetsmärkning [7], och disulfidbindningsbildning inom DRD2 identifierades också som en viktig modifikation för ligandbindning [8]. Vidare identifierades fosforyleringsställen för DRD2 initialt av vitro analys med radioisotoper, vilket tillhandahåller vägar för olika regulatoriska vägar medierade av olika kinaser [9]. Faktum är att proteinkinas C (PKC) reglerar DRD2-medierad mobilisering av intracellulärt kalcium och modulerar interaktionen mellan DRD2 och cytoskeletala proteiner [10]. Fosforylering av GPCR-kinas 2 (GRK2) reglerar agonistinducerade resensibiliseringsmönster av DRD2 [11].

Cyklinberoende kinas 5 (Cdk5) är ett prolinriktat serin / treoninkinas som har förmånsaktivitet på grund av hjärnspecifik expression av dess väsentliga aktivatorer, p35 och p39 [12]. Cdk5 är involverad i olika neuronprocesser, inklusive neuronal migration och axonvägledning, och Cdk5 och p35 null-mus visar defekter i kortikal layering [13]. Nyligen visades att fosforylering av WAVE1 och ephexin av Cdk5 reglerar dendritisk ryggradsmorfogenes [14]. Vidare reglerar Cdk5 också ytuttrycksnivåer av NMDA-receptorn, NR2B och NR2A-medierade NMDA-strömmar [15], [16]. Det är anmärkningsvärt att flera bevis visar ett intimt förhållande mellan Cdk5 och dopamin-systemet. Cdk5 fosforylerar tyrosinhydroxylas (TH), reglerar dess stabilitet och därigenom upprätthåller dopaminerg homeostas [17]. I postsynaptiska neuroner, när T75-återstoden av dopamin och cykliskt AMP-reglerat fosfoprotein-32kD (DARPP-32) fosforyleras av Cdk5, kan det hämma PKA-aktivitet och därmed antagonisera dopamin DRD1-medierad PKA-signalering [18]. Intressant är att när kokain, en indirekt agonist av dopaminreceptorer administreras kroniskt hos råttor, ökar mRNA- och proteinnivåerna av Cdk5 i medelstora snygga neuroner [19]. Sammantaget verkar Cdk5 vara involverad i läkemedelsinducerad synaptisk anpassning. I denna studie visar vi en funktionell interaktion av DRD2 och Cdk5 som ytterligare utökar rollen som Cdk5 i dopamin-signalering.

Material och metoder

antikroppar

Anti-kaninserum höjdes mot peptider innehållande fosforserin 321 (pS321) hos den tredje intracellulära slingan av DRD2 (D2i3). Fosforpeptid, CNPDpSPAKPEK (PEPTRON) användes för att framställa en peptid-konjugerad kolonn för affinitetsrening (20401, PIERCE). Anti-pS321-antikroppen berikades genom ett affinitetsreningssystem enligt tillverkarens instruktioner. Renad fosforantikropp lagrades i PBS med 0.1% natriumazid och 0.1% gelatin. Anti-mus anti-Cdk5 antikropp (sc-249) och anti-kanin anti-p35 antikropp (sc-820) användes för Western blotting och immuncytokemi av Cdk5 / p35. Anti-mus anti-GFP antikropp (sc-9996) användes för immunutfällningen och Western blotting av DRD2-GFP. Anti-kanin anti-FLAG-antikropp (sc-807), anti-kanin anti-HA antikropp (sc-805), anti-mus anti-GST antikropp (sc-138) och anti-mus anti-GAPDH antikropp 32293) köptes från Santa Cruz Biotechnologies.

djur

P35 knockout-musen var en snäll present från Dr. Katsuhiko Mikoshiba vid RIKEN Brain Science Institute i Japan och användes för primär neuronkultur. Primersatser för genotypning var 5'- GGTCTCCTCTTCTGTCAAGAAG, 5'-GCTCTGCTAGACACATACTGTAC och 5'- TCCATCT GCACGAGACTAGT som tidigare beskrivits [20]. ICR-möss och Sprague Dawley-råttor användes för framställning av hjärnlysat. Alla djurprocesser godkändes av Pohang University of Science and Technology Institutionell djurvård och användningskommitté.

Plasmidkonstruktioner

Humant DRD2 lång isoform i en EGFP-N1-plasmidvektor och den tredje intracellulära slingan av DRD2 (212-373-aminosyrarester, inklusive de extra aminosyraresterna 29 som är unika för DRD2 lång isoform) i en pFLAG-CMV-2-plasmidvektor användes. Mänsklig Cdk5 infördes i en pCMV-HA-plasmidvektor och human p35 infördes i en PCDNA 3.1-plasmidvektor. Humant Cdk5 infördes under en cytomegalovirus (CMV) promotor tillsammans med human p35 i en pcDNA 3.1-vektor för att skapa en dubbel expressionskonstruktion (Cdk5 / p35) för immuncytokemi, receptorinternaliseringsanalys, [35S] -GTPγS-bindningsanalys, radioligandbindningsanalys och immun-test av cAMP-enzym.

vitro Kinasassay

IP-kopplade vitro kinasassay utfördes som följer. En helmusshjärna lyserades i 3 mL erytrocytlys-buffert (ELB) (50 mM Tris (pH 8.0), 250 mM NaCl, 5 mM EDTA, 0.1% NP-40) genom 20-slag av en Dounce-homogenisator för att få homogeniserade hjärnlysater . Lysaten inkuberades på is för 30 min, sonikerades och centrifugerades vid 16,000 × g för 10 min. Supernatanterna immunoprecipiterade med anti-kanin anti-p35-antikropp för att erhålla ett aktivt Cdk5 / p35-komplex. Cdk5 / p35-komplexet och renat GST-fusionsprotein blandades med adenosin 5'-trifosfat, [y-32P] (NEG-502H, PerkinElmer) och inkuberad i kinasbuffert (30 mM HEPES (pH 7.2), 10 mM MgCl2, 0.2 mM DTT) för 1 h vid rumstemperatur [18], [21]. Renat Cdk5 / p25-komplex (14-516, Millipore) användes också för vitro kinasassay såsom beskrivits ovan. 2x-provbelastningsbufferten sattes till reaktionsblandningen och kokades vid 100 ° C. Proven utsattes därefter för SDS-PAGE och den torkade gelén bedömdes genom autoradiografi.

Vätskekromatografi (LC) -Mass-spektrometri (MS) / MS-analys

Det rekombinanta GST-D2i3-proteinet analyserades genom LC-MS / MS efter IP-kopplad vitro kinasassay. Vi utförde peptididentifiering av LC-MS / MS-data med X !! Tandem (version Dec-01-2008). Varje RAW-datafil omvandlades först till mzXML med hjälp av den transproteomiska rörledningen (TPP; version 4.3). MS / MS-skanningar i de konverterade mzXML: erna utsattes sedan för att söka mot UniProt-musproteinsekvensdatabasen (release 2010_07) inklusive GST-D2i3-sekvens med användning av X !! Tandem. Toleransen sattes till 3 Da för prekursorjoner och 2 Da för fragmentjoner. Enzymspecificitet för trypsin användes. Variabla modifieringsalternativ användes för karbamidometyleringen av cystein (57.021 Da), oxidationen av metionin (15.995 Da), asylogenhydrolysen (0.987 Da) och fosforyleringen av serin (79.966 Da).

immunoprecipitation

Immunfällning utfördes på celllysat i ELB-lysbuffert. Anti-GFP antikropp sattes till lysaten och inkuberades för 3 h vid 4 ° C. Immunokomplexen renades med användning av protein-A-agaros. Fällningarna inkuberades med SDS-provbelastningsbuffert för 30 min vid 37 ° C och utsattes för SDS-PAGE och Western blots.

GST-drag-down-analys

10 ^ g renat GST och GST-D2i3 inkuberades med råtthjärna-lysat för 1.5 h vid 4 ° C. 30 μL glutation (GSH) -konjugerade Sepharose 4B-pärlor (17-0756-01, GE Healthcare) ekvilibrerad med lysbuffert tillsattes och inkuberades för ytterligare 1 h. Pärlor uppsamlades genom centrifugering vid 2,000 ×g och sköljdes med lysisbuffert 4 gånger [22], [23]. Utfällningar analyserades genom Western blotting med användning av anti-Cdk5 och anti-p35 antikroppar.

immunocytokemi

Transfekterade HEK 293-celler och striatalneuroner odlade på täckplåtar tvättades en gång med fosfatbuffrad saltlösning (PBS) och fixerades genom nedsänkning i kall 4% paraformaldehyd / PBS för 30 min. Primär antikropp späddes i blockeringslösningen (2% hästserum och 1% Triton X-100 i PBS). Alexafluor-647-konjugerad anti-mus antikropp (A20990, Invitrogen) och Alexafluor-568-konjugerad anti-kaninantikropp (A11011, Invitrogen) användes som sekundära antikroppar. Hoechst användes för kärnfärgning. Bilder erhölls genom konfokal mikroskopi (Olympus, FluoView-1000).

Receptorinternaliseringsanalys

24 h efter transfektion behandlades celler med 1 | MM quinpirole (Q102, Sigma) för 30 min och 90 min vid 37 ° C. Cellerna återuppslammades i 2 mL kall PBS och 200 ^ l-alikvoter användes för varje reaktion. Drogbehandlingar utfördes vid rumstemperatur för 3 h vid följande koncentrationer; 3 nM [3H] -spiperon (NET-565, PerkinElmer), 3 ^ M-sulpirid (895, TOCRIS), 10 ^ M-haloperidol (H1512, Sigma). Hydrofob [3H] -spiperon användes för att märka totalt uttryckta receptorer och hydrofil sulpirid användes för att ersätta membranös receptorbunden [3H] -spiperon-signaler. Membranassocierade receptorsignaler beräknades genom att subtrahera intracellulära receptorvärden från de totala uttryckta receptorvärdena. Celler filtrerades på ett GF / B (Millipore) filter och tvättades 3 gånger med tvättbuffert (50 mM Tris-HCl (pH 7.4), 100 mM NaCl). Filter torkades ut och återstående radioaktivitet uppmättes med användning av en vätskescintillationsräknare [24].

Cellmembranberedning

Konfluenta celler i 100 mm odlingsrätter efter transfektion tvättades med iskall PBS och skördades i 1 mL HME-buffert (25 mM HEPES (pH 7.5), 2 mM MgCl22, 1 mM EDTA). Homogeniserade lysater centrifugerades med 500 x g för 15 min och supernatanterna centrifugerades därefter med 36,000 x g för 30 min. Pellets som återuppslammades i HME-buffert användes för analyser.

[35S] -GTPγS bindningsanalys

Cellmembranfraktioner förinkuberades med 1 ^ M kinpirole (Q102, Sigma) i analysbufferten (25 mM HEPES (pH 7.5), 1.5 mM MgCl22, 100 mM NaCl, 1 mM EDTA och 0.01 mM BNP) för 10 min. [35S] -GTPγS (NET-030H, PerkinElmer) tillsattes till den slutliga koncentrationen av 3 nM i 30 μL och inkuberades ytterligare för 90 min. 170 μL iskall buffert (10 mM Tris-HCl (pH 8.0), 100 mM NaCl, 10 mM MgCl2, och 0.1 mM GTP) tillsattes för att stoppa reaktionen. Membran filtrerades på ett GF / B-filter (Millipore) och tvättades 3 gånger med tvättbuffert (50 mM Tris-HCl (pH 7.4), 100 mM NaCl). Filter torkades och radioaktivitet uppmättes med användning av scintillationsräknaren [25], [26].

Radioligandbindningsanalys

Beredda cellmembran inkuberades med 0.01 nM [3H] -spiperon (NET-565, PerkinElmer) och ökande koncentrationer av kinpirole (Q102, Sigma) för 30 min i analysbufferten (25 mM HEPES (pH 7.5), 1.5 mM MgCl2, 100 mM NaCl, 1 mM EDTA). Membran filtrerades på ett GF / B-filter (Millipore) och tvättades 3 gånger med tvättbuffert (50 mM Tris-HCl (pH 7.4), 100 mM NaCl). Reaktionen avslutades genom snabb filtrering genom GF / C-filter. Återstående radioaktivitet uppmättes med användning av en vätskescintillationsräknare [27]-[29].

cAMP-enzymimmunanalys

Transfekterade HEK 293-celler förbehandlades med 10 ^ M rolipram (R6520, Sigma) för 1 h och behandlades sedan med 0.1 ^ M forskolin (F6886, Sigma) och ökade koncentrationer av quinpirole (Q102, Sigma) för 30 min. Primär odlade striatala neuroner behandlades med 10 / M rolipram för 1 h och därefter 1 ^ M dopamin för 1 h [22]. Celllysat framställdes med 0.1 M HCl och cAMP-nivåer detekterades genom cAMP-enzym-immunoassay-kit (Sapphire Bioscience) enligt tillverkarens instruktioner.

Primärkultiverad Striatal Neuron

Striatalområdet isolerades från musens embryonala hjärna (E15). Dissekterad vävnad dissocierades i minimalt essentiellt medium (MEM) (11095, Invitrogen) innehållande 0.25% trypsin (T4549-100, Sigma) och 0.1% DNase I för 6 min vid 37 ° C. Cellerna suspenderades igen i pläteringsmediet (MEM med 0.01 M HEPES (pH 7.4) och 10% (vol / vol) hästserum (16050-122, GIBCO)). Neuroner odlades under 7 dagar vitro (DIV 7) i MEM med B27-tillägg (17504-044, Invitrogen) innan de applicerades på cAMP-enzymimmunanalyser.

Resultat

Cdk5-fosforylater Serine 321 i den tredje intracellulära slingan av DRD2 vitro

För att identifiera nya Cdk5-substrat utförde vi en systematisk sökning med (S / T) PX (K / H / R) som Cdk5-erkännande konsensussekvenserna [30] och identifierade DRD2 som ett kandidatsubstrat. Konsensussekvensen, inkluderande serin 321, är lokaliserad i den tredje intracellulära slingan av DRD2 (D2i3) där olika regleringsmekanismer har blivit implicerade [3], [10], [11]. Sekvensen konserveras evolutionärt i DRD2 hos ryggradsdjur, vilket indikerar en funktionell betydelse för återstoden (Fig. 1A).

miniatyr

Figur 1. Cdk5 fosforylerar serin 321 i den tredje intracellulära slingan av DRD2 in vitro.

(A) Aminosyrasekvensinriktning som visar konserverade områden av DRD2 från olika arter (skuggad). Den potentiella Cdk5 fosforyleringsstället anges med en asterisk. (B) IP-länkad vitro kinasassay med rekombinanta GST-D2i3- och GST-D2i3-mutanta proteiner. Cdk5 / p35-komplex berikat från mushartsekstrakt genom anti-p35-immunutfällning användes för kinasreaktioner. En autoradiograf av fosforylerade proteiner visas tillsammans med Coomassie briljantblåfärgning av samma gel. Pilhuvudet indikerar radioaktiv signal som motsvarar GST-D2i3s och öppet pilhuvud anger radioaktiva signaler från p35. (C) MS / MS-spektrum av det fosforylerade peptidfragmentet av D2i3. De teoretiska fragmenteringsmönstren visas under spektret. Bland alla fragmentjonerna betecknas de detekterade y- och b-joner i spektret. De6 och y7 joner indikerar starkt fosforyleringen av serin 321. (D) In vitro kinasassay med renat Cdk5 / GST-p25-komplex med användning av GST-D2i3 och GST-D2i3-mutanta proteiner. Fosforylerade proteiner visades i en autoradiograf tillsammans med Coomassie briljantblåfärgning. Pilhuvud indikerar radioaktiv signal motsvarande GST-D2i3 och öppet pilhuvud anger radioaktiva signaler från GST-p25.

doi: 10.1371 / journal.pone.0084482.g001

För att bedöma Cdk5s förmåga att fosforylera D2i3 utförde vi IP-länkade vitro kinasanalyser med användning av ett aktivt Cdk5 / p35-komplex berikat från mushjärnalysat genom p35-immunutfällning med renade rekombinanta GST-D2i3 (aminosyrarester 212-373) proteiner som substraten. Vi observerade fosforyleringssignaler i de renade GST-D2i3- och GST-D2i3 S297A-proteinerna, men signalen minskades signifikant med användning av GST-D2i3 S321A (Fig. 1B). För att ytterligare verifiera fosforylering av serin 321 i GST-D2i3 utförde vi LC-MS / MS-analys av proverna från IP-länkade vitro kinasanalyser med användning av LTQ XL masspektrometri. Konsekvent återfanns fosforpeptider motsvarande massan av fosforserin 321-peptider (Fig. 1C). Med tanke på att det databeroende förvärvet under LC-MS / MS-analys tenderar att detektera överflödiga proteiner i provet [31], tyder dessa data på att serin 321-resten är den dominerande fosforyleringsstället för Cdk5 i D2i3-regionen. För att bevisa direkt fosforylering av serin 321 i GST-D2i3 av Cdk5, vitro kinasassay med användning av renat Cdk5 / GST-p25-komplex med renade rekombinanta GST-D2i3-proteiner utfördes. Vi identifierade en signifikant fosforyleringssignal i GST-D2i3 som saknades i GST-D2i3 S321A (Fig. 1D). Sammantaget indikerar dessa resultat att D2i3 S321-resten är ett preferensmål för Cdk5-medierad fosforylering.

Cdk5 fosforylerar Serine 321 i den tredje intracellulära slingan av DRD2 i celler

För att identifiera fosforyleringen av serin 321, höjde vi antikropp specifikt för fosfoserin 321 (pS321). Prover från IP-länken vitro kinasassay analyserades genom Western blotting med användning av anti-pS321-antikropp. Blots visade ett distinkt band i kinasreaktionen som var beroende av GST-D2i3 (Fig. 2A). För att verifiera den potentiella fosforyleringen av serin 321 i DRD2 av Cdk5 i celler, immunpresiputerar anti-GFP från HEK 293-celler som uttrycker DRD2-GFP och DRD2 S321A-GFP med eller utan HA-Cdk5 och p35 analyserades genom Western blotting med anti-GFP och anti-pS321-antikroppar. Karakteristiska smörjbandssignaler av anti-GFP-antikroppar som är kända för att vara beroende av överdriven glykosylering av DRD2 observeras endast i närvaro av DRD2-GFP och anti-pS321-antikropp upptäckte liknande DRD2-signaler endast med Cdk5 / p35-samuttryck (Fig. 2B) [7]. För att ytterligare verifiera fosforyleringen av serin 321 med Cdk5 genererades D2i3 (FLAG-D2i3) och mutantform av D2i3 (FLAG-D2i3 S321A). FLAG-D2i3 och FLAG-D2i3 S321A uttryckt med eller utan HA-Cdk5 och p35 i HEK 293-celler analyserades genom en SDS-gel-mobilitetsskiftanalys. En signifikant Cdk5-beroende rörelseförändring observerades för FLAG-D2i3, men inte för FLAG-D2i3 S321A (Fig. 2C). Vi bedömde också fosforyleringsnivån för DRD2 vid Ser321 vid agoniststimulering. HEK 293-celler som uttryckte DRD2-GFP och Cdk5 / p35-komplexet stimulerades av quinpirole och anti-GFP-immunprecipitater från celllysaten analyserades genom Western blotting med användning av anti-GFP och anti-pS321-antikroppar. Vi fann att Cdk5-medierad fosforylering av DRD2 vid Ser321 inte påverkades av agoniststimulering, vilket framträder annorlunda än GRK- och PKC-medierade fosforyleringar (Fig. 2D) [32], [33]. Tillsammans indikerar dessa resultat att Cdk5 kan fosforylera serin 321-resten av DRD2 i den cellulära miljön.

miniatyr

Figur 2. Cdk5 fosforylerar serin 321 i den tredje intracellulära slingan av DRD2 i celler.

Cdk5-medierad fosforylering av serin 321 analyserades med användning av anti-pS321-antikropp. (A) Prover från IP-länkade vitro kinasanalys med användning av GST-D2i3-proteiner analyserades genom Western blotting (WB) med angivna antikroppar. Arrowheads indikerar GST-D2i3s. (B) DRD2-GFP och DRD2 S321A-GFP uttrycktes med eller utan HA-Cdk5 och p35 i HEK 293-celler. Anti-GFP immunprecipitater analyserades genom Western blotting med användning av anti-GFP och anti-pS321 antikroppar. Fästet indikerar DRD2-signaler och öppet pilhuvud indikerar ospecifika signaler från anti-GFP-immunutfällningarna. '% input' är% volym av totalt lysat för en IP-reaktion. Svaga endogena Cdk5-signaler indikerades med asterisker. (C) Rörmobilitetsskiftanalys. HEK 293-celler transfekterade som angivits analyserades genom Western blotting. (D) Transfekterade HEK 293-celler behandlades med quinpirole och anti-GFP immunprecipitater analyserades genom Western blotting med anti-GFP och anti-pS321 antikroppar. Öppet pilhuvud indikerar ospecifika signaler från anti-GFP immunprecipitater.

doi: 10.1371 / journal.pone.0084482.g002

Cdk5 / p35 Complex och DRD2 är fysiskt associerade

Vi undersökte den potentiella fysiska interaktionen mellan Cdk5 / p35-komplexet och DRD2 eftersom många Cdk5-substrat är kända att vara fysiskt associerade med Cdk5 / p35-komplexet [23], [34], [35]. Först utfördes GST-neddragningsförsöket. Renat rekombinant GST-D2i3-protein inkuberades med råtthjärna-lysat och GST-nedfällningsfällningar analyserades för Western blotting. Som visas i Fig. 3Aendogen Cdk5 och p35 identifierades i neddragningsfällningarna, vilket indikerar en fysisk interaktion mellan DRD2 och Cdk5 / p35-komplexet (Fig. 3A). Vidare detekterades HA-Cdk5 och p35 i anti-GFP-immunprecipitaten från HEK 293-celllysat som uttrycker DRD2-GFP och Cdk5 / p35 (Fig. 3B). Dessutom utförde vi immuncytokemiska analyser och observerade att DRD2-GFP, HA-Cdk5 och p35 uppvisar signifikanta samlokaliseringssignaler i membranområdet av HEK 293-celler (Fig. 3C, övre paneler). Vi undersökte också samlokalisering av DRD2 och Cdk5 / p35 i neuronalt sammanhang. Konsekvent visade DRD2-GFP också signifikant samlokalisering med endogen Cdk5 och p35 i de odlade striatala neuronerna (DIV7), ytterligare stödande funktionella kopplingar mellan DRD2 och Cdk5 / p35 (Fig. 3C, bottenpaneler). Resultaten indikerar att DRD2 och Cdk5 / p35 kan bilda ett komplex och därmed stödja uppfattningen att DRD2 är ett fysiologiskt substrat av Cdk5.

miniatyr

Figur 3. Cdk5 / p35 kan bilda ett komplex med DRD2.

(A) GST-neddragningsanalys med användning av renat rekombinant GST-D2i3-protein med råtthjärnaxtrakt. GST-nedfällningsfällningar utsattes för Western blotting-analyser. "Pärla" indikerar neddragningsfällningen utan GST-proteiner. (B) Immunutfällning av DRD2 och Cdk5 / p35-komplex. Anti-GFP IP från lysat från transfekterade celler utsattes för Western blotting analyser. Fästet indikerar DRD2-signaler och öppet pilhuvud indikerar ospecifika signaler från anti-GFP-immunutfällningarna. En överexponerad blot för ingångar visas också till höger. (C) Immunocytokemiska analyser av DRD2 och Cdk5 / p35. HEK 293-celler som uttryckte DRD2-GFP och Cdk5 / p35 färgades med anti-Cdk5 och anti-p35-antikroppar (övre paneler). DRD2-GFP uttrycktes ensamt i de odlade striatala neuronerna och färgades med anti-Cdk5 och anti-p35-antikroppar (nedre paneler). Hoechst användes för kärnfärgning. Skalfältet är 5 μm. Alla bilder erhölls med hjälp av konfokal mikroskopi (Olympus, FluoView-1000).

doi: 10.1371 / journal.pone.0084482.g003

Cdk5-medierad fosforylering av DRD2 dämpar receptoraktiviteten

Det har rapporterats att fosforylering modulerar kritiska egenskaper hos GPCR, såsom G-proteinkoppling, receptorinternalisering, intracellulär lokalisering och association med modulatorproteiner [9], [11], [24]. Engonistinducerad receptorinternalisering är en kritisk reglerande process för signaltransduktion. Vi undersökte Cdk5-medierad modulering av DRD2-internalisering. HEK 293-celler som uttryckte DRD2-GFP och DRD2 S321A-GFP med eller utan Cdk5 / p35 inkuberades med 1 ^ M quinpirole för att inducera agoniststimulerad DRD2-internalisering (Fig. 4A). [3H] -spiperon-signaler av DRD2-GFP-uttryckande celler reducerades signifikant vid 30 min-quinpirole-behandling och utvanns vid 90 min. Intressant är att [3H] -spiperonsignaler av DRD2-GFP och Cdk5 / p35-uttrycksceller reducerades också vid 30 min-quinpirole-behandling men inte återhämtad vid 90 min (Fig. 4A, andra avsnittet). Å andra sidan, [3H] -spiperon-signaler av DRD2 S321A-GFP-uttryckande celler reducerades vid 30 min och återvanns vid 90 min, oberoende av samuttrycket med Cdk5 / p35. Tidigare studier har visat att den internaliserade DRD2 återvinner tillbaka till plasmamembranet vid långvarig agoniststimulering [11]. Thus verkar det som om Cdk5-medierad fosforylering av DRD2 är involverad i resensibiliseringsprocesserna efter agonistinducerad DRD2-internalisering.

miniatyr

Figur 4. Cdk5-medierad fosforylering dämpar DRD2 ytuttryck och nedströms signalering.

(A) DRD2 ytuttryck mätt med [3H] -spiperonbindningsanalys. Transfekterade HEK293-celler stimulerades med 1 ^ M quinpirole för den angivna tiden och skördades följt av 3 nM [3H] -spiperonbehandling under 3 timmar. Radioaktivitet mättes och ytsignaler beräknades. Felstaplar representerar medelvärde ± SE (n = 8; * p <0.05, ** p <0.01; Envägs ANOVA med Dunnett post hoc-test: jämför alla kolumner kontra kontrollkolumn). (B) [35S] -GTPγS bindningsanalys. Cellmembran framställdes från cellerna transfekterade som angivits. Membranpreparationer inkuberades med 1 ^ M kinpirole följt av 3 nM [35S] -GTPγS i 90 min. Felstaplar representerar medelvärde ± SE (n = 8; * p <0.05, ** p <0.01, *** p <0.001; Envägs ANOVA med Bonferroni post hoc-test: jämför alla kolumner). (C) Quinpirol-konkurrerande [3H] -spiperonbindningsanalys. Membranpreparat från transfekterade celler inkuberades med 0.01 nM [3H] -spiperon och ökande koncentrationer av kinpirol under 30 min. Icke-linjär regression erhölls av GraphPad. Felstaplar anger medelvärde ± SE (n = 3). (D) cAMP-enzymimmunanalyser i transfekterade HEK 293-celler. Transfekterade celler förbehandlades med 10 pM rolipram i 1 timme och behandlades därefter med 0.1 pM forskolin och ökande koncentrationer av kinpirol under 30 minuter. Icke-linjär regression erhölls av GraphPad. Felstaplar representerar medelvärde ± SE (n = 4; ** p <0.01; två-tailed t-tests). (E) Odlade striatala neuroner från vildtyp och p35 knockoutembryon (DIV 7) behandlades med 10 μM rolipram för 1 h följt av 1 μM dopamin för 1 h. Felstänger representerar medelvärdet ± SE (n = 4; **p<0.01; tvåstjärtad t-tests).

doi: 10.1371 / journal.pone.0084482.g004

Vi utvärderade vidare en potentiell förändring av agoniststimulerad G-proteinkoppling till DRD2 associerad med Cdk5-medierad fosforylering med användning av [35S] -GTPγS bindningsanalys [25], [26]. DRD2-GFP och DRD2 S321A-GFP med eller utan Cdk5 / p35 uttrycktes i HEK 293-celler. Membran framställdes och stimulerades med 1 ^ M kinpirole och vidare tilläts [35S] -GTPγS inkorporering. DRD2-GFP och Cdk5 / p35 uttryckande cellmembran uppvisade signifikant försämrad [35S] -GTPγS-bindning jämfört med alla andra cellmembran (Fig. 4B). Dessa resultat indikerar att Cdk5-medierad fosforylering nedreglerar agoniststimulerad G-proteinbindning vid DRD2.

Dessutom är quinpirole-konkurrerande [3H] -spiperonbindningsanalyser utfördes för att undersöka eventuell förändring av agonistaffinitet vid DRD2 genom Cdk5-medierad fosforylering. Konkurrenskraftig bindning av [3H] -spiperon vid behandling av ökande koncentrationer av kinpirole till membranpreparatet från transfekterades mättes. Konkurrerande bindning av quinpirole och [3H] -spiperon vid DRD2-GFP och DRD2 S321A-GFP gjorde liknande logKi värden (-9.789 för DRD2-GFP; -9.691 för DRD2 S321A-GFP), vilket indikerar att affiniteten för ligand till DRD2 inte påverkas signifikant av Cdk5-medierad fosforylering vid DRD2 (Fig. 4C).

Cdk5-medierad fosforylering nedregulerar DRD2-cAMP Signalvägen

Därefter undersökte vi om modifieringen av DRD2 av Cdk5 påverkar nedströms signaleringsvägar. Vi övervakade DRD2-medierad inhibering av forskolinstimulerad cAMP-produktion genom adenylylcyklas i cellerna som uttrycker DRD2-GFP och DRD2 S321A-GFP med användning av cAMP-enzymimmunanalys. DRD2-uttryckande celler uppvisade minskade cAMP-nivåer som svar på quinpirole på ett dosberoende sätt. Anmärkningsvärt minskade samuttrycket av Cdk5 / p35 signifikant den maximala inhiberingen av cAMP-bildning (Fig. 4D, vänster panel). Å andra sidan inhiberades cAMP-formationerna i DRD2 S321A-GFP-uttryckande celler effektivt som svar på quinpirole-behandling oberoende av uttrycket av Cdk5 / p35 (Fig. 4D, höger panel). Dessa resultat indikerar att Cdk5-medierad fosforylering av DRD2 dämpar den inhiberande aktiviteten hos DRD2 på nedströms cAMP-signaleringsvägen. För att ytterligare bekräfta fenomenen i en mer fysiologiskt relevant miljö användes primära odlade neuroner från knockout-embryon som saknar p35, en väsentlig Cdk5-aktivator. Primär odlade striatala neuroner behandlades med 1 ^ M dopamin och analyserades genom cAMP-enzymimmunanalys. Neuroner från p35 knockout-möss uppvisade reducerade cAMP-nivåer jämfört med vildtypsneuroner när de stimulerades med dopamin (Fig. 4E). Taken tillsammans, konstaterade vi att Cdk5-medierad fosforylering av DRD2 resulterar i en minskning av den inhiberande tonen på cAMP-vägen som utövas av DRD2.

Diskussion

Vi identifierade DRD2 som ett nytt substrat av Cdk5. Fosforyleringen tycks nedreglera DRD2-ytaxpression genom att påverka ödet för DRD2 efter receptorinternalisering och därigenom reducera DRD2 Gikoppling och nedströms cAMP-vägen. Eftersom fosforyleringsrester S321 existerar både i DRD2 långa och korta isoformer, kan mekanismen som föreslagits i denna studie vara ett generellt sätt för reglering i DRD2-medierad signalering.

DRD2 i medelstarka nervceller har inte enbart betraktats som en stor dopaminreceptorsubtyp utan har också erkänts för dess mottaglighet för förändringar i tillgänglighet som svar på miljöstimuli. Agonist-inducerad desensibilisering och resensibilisering av DRD2 har studerats omfattande [11], [24]. I synnerhet har ett antal studier visat att effekterna av kronisk psykostimulansexponering, såsom kokain och amfetamin, vilket ökar den extracellulära nivån av dopamin i striatalsynaps, åtföljs av dynamiska förändringar av DRD2 postsynaptiskt [36]. Faktum är att kroniska kokainanvändare är kända för att ha minskat DRD2-nivåer i striatalområdet och att DRD2-tillgängligheten i nukleär accumbens (NAcc) visar en negativ korrelation med läkemedelssökande och förstärkning beteenden hos möss och primater [37]-[39]. Dessa resultat tyder på att funktionaliteten för DRD2 är mycket mottaglig för adaptiv eller kompensatorisk reglering som svar på olika stimuli inklusive kronisk drogexponering. Våra resultat visar att S321-rester i den tredje intracellulära slingan av DRD2 kan fosforyleras av Cdk5, vilket resulterar i en minskning av hämmande påverkan av DRD2 på cAMP-vägen. Denna interaktion föreslår en ny regleringsmekanism förknippad med Cdk5 i dopaminoceptiva neuroner som kan kopplas till den dynamiska naturen av DRD2-ytans tillgänglighet.

Det bör noteras att Cdk5 är känt för att vara en nyckelkomponent för att mediera adaptiva förändringar av neuronmiljön. Exempelvis är strukturella och funktionella förändringar av dendritiska ryggrad i neuronerna i den limbiska kretsen en av konsekvenserna av upprepad psykostimulerande exponering [40]. Dessa förändringar åtföljs av olika molekylära förändringar innefattande induktionen av cAMP-responselementbindande protein (CREB) och FFB, transkriptionsfaktorer som uppvisar en varaktig uppreglering som svar på kronisk kokainadministration [41], [42]. Viktigt är att Cdk5 är ett mål för ΔFosB [19], och många kritiska komponenter involverade i dendritisk ryggradsdynamik, såsom PSD-95, p21-aktiverad kinase (PAK), β-katenin och spinofilin, rapporterades som Cdk5-substrat [43]-[46]. Konsekvent genererar genetiska eller farmakologiska manipuleringar av Cdk5-aktivitet förändringar av dendritisk ryggradsmorfologi och beteendehantering mot kokain, vilket medför kritiska roller för Cdk5 i de molekylära och morfologiska förändringarna av mesolimbiska dopaminkretsar [47], [48]. Våra resultat som visar att DRD2 är ett nytt mål för Cdk5 ger ytterligare insikt i de adaptiva förändringarna av dopaminsystemet som svar på kronisk drogexponering på grund av den efterföljande ΔFosB-medierade uppreglering av Cdk5 kan inducera en tonisk ökning av fosforyleringen av DRD2 . Vidare är DRD2 känt att påverka många cellulära processer, innefattande reglering av cAMP- och MAP-kinasvägar och nedströms transkriptionshändelser [42], [49]. Således kan resultaten i denna studie inte bara avbilda en direktreglering av DRD2 av Cdk5 utan också ge en ny inblick i adaptiva responserna av dopaminsystemet till kronisk drogexponering.

Författarbidrag

Upptäckt och utformat experimenten: JJ YUP DH SKP. Utförde experimenten: JJ YUP DKK YK. Analyserade data: JJ YUP DKK SL YK SAL HL YSG DH SKP. Bidragande reagens / material / analysverktyg: YHS. Skrev papperet: JJ SKP.

referenser

  1. 1. Missale C, Nash SR, Robinson SW, Jaber M, Caron MG (1998) Dopaminreceptorer: från struktur till funktion. Physiol Rev 78: 189-225.
  2. 2. Wise RA (2002) Brain belöningskretsar: insikter från oönskade incitament. Neuron 36: 229-240. doi: 10.1016 / s0896-6273 (02) 00965-0
  3. Visa artikel
  4. PubMed / NCBI
  5. Google Scholar
  6. Visa artikel
  7. PubMed / NCBI
  8. Google Scholar
  9. Visa artikel
  10. PubMed / NCBI
  11. Google Scholar
  12. Visa artikel
  13. PubMed / NCBI
  14. Google Scholar
  15. Visa artikel
  16. PubMed / NCBI
  17. Google Scholar
  18. Visa artikel
  19. PubMed / NCBI
  20. Google Scholar
  21. Visa artikel
  22. PubMed / NCBI
  23. Google Scholar
  24. Visa artikel
  25. PubMed / NCBI
  26. Google Scholar
  27. Visa artikel
  28. PubMed / NCBI
  29. Google Scholar
  30. Visa artikel
  31. PubMed / NCBI
  32. Google Scholar
  33. Visa artikel
  34. PubMed / NCBI
  35. Google Scholar
  36. Visa artikel
  37. PubMed / NCBI
  38. Google Scholar
  39. Visa artikel
  40. PubMed / NCBI
  41. Google Scholar
  42. Visa artikel
  43. PubMed / NCBI
  44. Google Scholar
  45. Visa artikel
  46. PubMed / NCBI
  47. Google Scholar
  48. Visa artikel
  49. PubMed / NCBI
  50. Google Scholar
  51. Visa artikel
  52. PubMed / NCBI
  53. Google Scholar
  54. Visa artikel
  55. PubMed / NCBI
  56. Google Scholar
  57. Visa artikel
  58. PubMed / NCBI
  59. Google Scholar
  60. Visa artikel
  61. PubMed / NCBI
  62. Google Scholar
  63. Visa artikel
  64. PubMed / NCBI
  65. Google Scholar
  66. Visa artikel
  67. PubMed / NCBI
  68. Google Scholar
  69. Visa artikel
  70. PubMed / NCBI
  71. Google Scholar
  72. Visa artikel
  73. PubMed / NCBI
  74. Google Scholar
  75. Visa artikel
  76. PubMed / NCBI
  77. Google Scholar
  78. Visa artikel
  79. PubMed / NCBI
  80. Google Scholar
  81. Visa artikel
  82. PubMed / NCBI
  83. Google Scholar
  84. Visa artikel
  85. PubMed / NCBI
  86. Google Scholar
  87. Visa artikel
  88. PubMed / NCBI
  89. Google Scholar
  90. Visa artikel
  91. PubMed / NCBI
  92. Google Scholar
  93. Visa artikel
  94. PubMed / NCBI
  95. Google Scholar
  96. Visa artikel
  97. PubMed / NCBI
  98. Google Scholar
  99. Visa artikel
  100. PubMed / NCBI
  101. Google Scholar
  102. Visa artikel
  103. PubMed / NCBI
  104. Google Scholar
  105. Visa artikel
  106. PubMed / NCBI
  107. Google Scholar
  108. Visa artikel
  109. PubMed / NCBI
  110. Google Scholar
  111. Visa artikel
  112. PubMed / NCBI
  113. Google Scholar
  114. Visa artikel
  115. PubMed / NCBI
  116. Google Scholar
  117. Visa artikel
  118. PubMed / NCBI
  119. Google Scholar
  120. Visa artikel
  121. PubMed / NCBI
  122. Google Scholar
  123. Visa artikel
  124. PubMed / NCBI
  125. Google Scholar
  126. Visa artikel
  127. PubMed / NCBI
  128. Google Scholar
  129. Visa artikel
  130. PubMed / NCBI
  131. Google Scholar
  132. Visa artikel
  133. PubMed / NCBI
  134. Google Scholar
  135. Visa artikel
  136. PubMed / NCBI
  137. Google Scholar
  138. Visa artikel
  139. PubMed / NCBI
  140. Google Scholar
  141. Visa artikel
  142. PubMed / NCBI
  143. Google Scholar
  144. 3. Neve KA, Seamans JK, Trantham-Davidson H (2004) Dopaminreceptorsignalering. J Recept Signal Transdukt Res 24: 165-205. doi: 10.1081 / lrst-200029981
  145. 4. Amar S, Shaltiel G, Mann L, Shamir A, Dean B, et al. (2008) Eventuellt involverande av post-dopamin D2-receptorsignaleringskomponenter i patofysiologin av schizofreni. Int J Neuropsychopharmacol 11: 197-205. doi: 10.1017 / s1461145707007948
  146. 5. Caine SB, Negus SS, Mello NK, Patel S, Bristow L, et al. (2002) Roll av dopamin D2-liknande receptorer vid självkontroll av kokain: studier med D2-receptormutantmöss och nya D2-receptorantagonister. J Neurosci 22: 2977-2988.
  147. 6. Lee S, Jeong J, Park YU, Kwak Y, Lee SA, et al. (2012) Valproat ändrar dopamin-signaleringen i samband med induktion av Par-4-proteinuttryck. PLOS One 7: e45618. doi: 10.1371 / journal.pone.0045618
  148. 7. Fishburn CS, Elazar Z, Fuchs S (1995) Differentiell glykosylering och intracellulär handel för de långa och korta isoformerna av D2 dopaminreceptorn. J Biol Chem 270: 29819-29824. doi: 10.1074 / jbc.270.50.29819
  149. 8. Reader TA, Molina-Holgado E, Lima L, Boulianne S, Dewar KM (1992) Särskild [3H] raclopridbindning till neostriatala dopamin D2-receptorer: disulfid- och sulfhydrylgruppernas roll. Neurochem Res 17: 749-759. doi: 10.1007 / bf00969008
  150. 9. Ng GY, O'Dowd BF, Caron M, Dennis M, Brann MR, et al. (1994) fosforylering och palmitoylering av den humana D2L dopaminreceptorn i Sf9-celler. J Neurochem 63: 1589-1595. doi: 10.1046 / j.1471-4159.1994.63051589.x
  151. 10. Li M, Bermak JC, Wang ZW, Zhou QY (2000) Modulation av dopamin D (2) receptorsignalering av aktinbindande protein (ABP-280). Mol Pharmacol 57: 446-452.
  152. 11. Cho D, Zheng M, Min C, Ma L, Kurose H, et al. (2010) agonistinducerad endocytos och receptorfosforylering medierar resensibilisering av dopamin D (2) receptorer. Mol Endokrinol 24: 574-586. doi: 10.1210 / me.2009-0369
  153. 12. Tsai LH, Delalle I, Caviness VS Jr, Chae T, Harlow E (1994) p35 är en neuralspecifik regulatorisk subenhet av cyklinberoende kinas 5. Natur 371: 419-423. doi: 10.1038 / 371419a0
  154. 13. Dhavan R, Tsai LH (2001) Ett årtionde av CDK5. Nat Rev Molcell Biol 2: 749-759. doi: 10.1038 / 35096019
  155. 14. Fu AK, Ip NY (2007) Cyklinberoende kinas 5 länkar extracellulära signaler till aktincytoskelet under utveckling av dendritisk ryggrad. Cell Adh Migr 1: 110-112. doi: 10.4161 / cam.1.2.4617
  156. 15. Wang J, Liu S, Fu Y, Wang JH, Lu Y (2003) Cdk5-aktivering inducerar hippocampal CA1-celldöd genom direkt fosforylering av NMDA-receptorer. Nat Neurosci 6: 1039-1047. doi: 10.1038 / nn1119
  157. 16. Zhang S, Edelmann L, Liu J, Crandall JE, Morabito MA (2008) Cdk5 reglerar fosforyleringen av tyrosin 1472 NR2B och ytuttrycket av NMDA-receptorer. J Neurosci 28: 415-424. doi: 10.1523 / jneurosci.1900-07.2008
  158. 17. Moy LY, Tsai LH (2004) Cyklinberoende kinas 5 fosforylerar serin 31 av tyrosinhydroxylas och reglerar dess stabilitet. J Biol Chem 279: 54487-54493. doi: 10.1074 / jbc.m406636200
  159. 18. Bibb JA, Snyder GL, Nishi A, Yan Z, Meijer L, et al. (1999) Fosforylering av DARPP-32 av Cdk5 modulerar dopamin-signalering i neuroner. Natur 402: 669-671.
  160. 19. Bibb JA, Chen J, Taylor JR, Svenningsson P, Nishi A, et al. (2001) Effekter av kronisk exponering för kokain regleras av neuronproteinet Cdk5. Natur 410: 376-380.
  161. 20. Ohshima T, Ogawa M, Veeranna, Hirasawa M, Longenecker G, et al. (2001) Synergistiska bidrag av cyklinberoende kinas 5 / p35 och Reelin / Dab1 till positionering av kortikala neuroner i den utvecklande mushinen. Proc Natl Acad Sci USA 98: 2764-2769. doi: 10.1073 / pnas.051628498
  162. 21. Morabito MA, Sheng M, Tsai LH (2004) Cyklinberoende kinas 5 fosforylerar den N-terminala domänen för postsynaptisk densitetsprotein PSD-95 i neuroner. J Neurosci 24: 865-876. doi: 10.1523 / jneurosci.4582-03.2004
  163. 22. Park SK, Nguyen MD, Fischer A, Luke MP, Affar el B, et al. (2005) Par-4 kopplar dopamin signalerande och depression. Cell 122: 275-287. doi: 10.1016 / j.cell.2005.05.031
  164. 23. Niethammer M, Smith DS, Ayala R, Peng J, Ko J, et al. (2000) NUDEL är ett nytt Cdk5-substrat som associerar med LIS1 och cytoplasmatisk dynein. Neuron 28: 697-711. doi: 10.1016 / s0896-6273 (00) 00147-1
  165. 24. Kim KM, Valenzano KJ, Robinson SR, Yao WD, Barak LS, et al. (2001) Differentiell reglering av dopamin D2- och D3-receptorer med G-proteinkopplade receptorkinaser och beta-arrestiner. J Biol Chem 276: 37409-37414. doi: 10.1074 / jbc.m106728200
  166. 25. Waldhoer M, Bofill-Cardona E, Milligan G, Freissmuth M, Nanoff C (1998) Differentiell urkoppling av A1 adenosin och D2 dopaminreceptorer med suramin och didemetylerad suramin (NF037). Mol Pharmacol 53: 808-818.
  167. 26. Bofill-Cardona E, Kudlacek O, Yang Q, Ahorn H, Freissmuth M, et al. (2000) Bindning av kalmodulin till D2-dopaminreceptorn reducerar receptorsignalering genom att arrestera G-proteinaktiveringsomkopplaren. J Biol Chem 275: 32672-32680. doi: 10.1074 / jbc.m002780200
  168. 27. Lista SJ, Seeman P (1981) Upplösning av dopamin och serotoninreceptorkomponenter av [3H] spiperonbindning till råtthjälneområden. Proc Natl Acad Sci USA 78: 2620-2624. doi: 10.1073 / pnas.78.4.2620
  169. 28. Gardner B, konstig PG (1998) agonistverkan vid D2 (lång) dopaminreceptorer: ligandbindande och funktionella analyser. Br J Pharmacol 124: 978-984. doi: 10.1038 / sj.bjp.0701926
  170. 29. Dopaminförskjutningar [2003H] domperidon från högaffinitetsställen i dopamin D3-receptorn, men inte [2H] racloprid eller [3H] spiperon i isotoniskt medium: Implikationer för human positron-utsläppstomografi. Synapse 3: 49-209. doi: 215 / syn.10.1002
  171. 30. Obenauer JC, Cantley LC, Yaffe MB (2003) Scansite 2.0: Proteomöverskådlig prediktion av cellsignalinteraktioner med användning av kortföljdsmotiv. Nukleinsyror Res 31: 3635-3641. doi: 10.1093 / nar / gkg584
  172. 31. Liu H, Sadygov RG, Yates JR 3rd (2004) En modell för slumpmässig provtagning och uppskattning av relativ protein överflöd i hagelproteomics. Anal Chem 76: 4193-4201. doi: 10.1021 / ac0498563
  173. 32. Ito K, Haga T, Lameh J, Sadee W (1999) Sekventering av dopamin D2-receptorer beror på samuttryck av G-proteinkopplade receptorkinaser 2 eller 5. Eur J Biochem 260: 112-119. doi: 10.1046 / j.1432-1327.1999.00125.x
  174. 33. Namkung Y, Sibley DR (2004) Proteinkinas C medierar fosforylering, desensibilisering och handel med D2 dopaminreceptorn. J Biol Chem 279: 49533-49541. doi: 10.1074 / jbc.m408319200
  175. 34. Wong AS, Lee RH, Cheung AY, Yeung PK, Chung SK, et al. (2011) Cdk5-medierad fosforylering av endofilin B1 krävs för inducerad autofagi i modeller av Parkinsons sjukdom. Natcell Biol 13: 568-579. doi: 10.1038 / ncb2217
  176. 35. Kesavapany S, Lau KF, McLoughlin DM, Brownlees J, Ackerley S, et al. (2001) p35 / cdk5 binder och fosforylerar betakatenin och reglerar beta-katenin / presenilin-1-interaktion. Eur J Neurosci 13: 241-247. doi: 10.1046 / j.1460-9568.2001.01376.x
  177. 36. Kuhar MJ, Ritz MC, Boja JW (1991) Dopaminhypotesen av de förstärkande egenskaperna hos kokain. Trender Neurosci 14: 299-302. doi: 10.1016 / 0166-2236 (91) 90141-g
  178. 37. Volkow ND, Fowler JS, Wolf AP, Schlyer D, Shiue CY, et al. (1990) Effekter av kronisk kokainmissbruk på postsynaptiska dopaminreceptorer. Am J Psykiatri 147: 719-724.
  179. 38. Dalley JW, Fryer TD, Brichard L, Robinson ES, Theobald DE, et al. (2007) Nucleus accumbens D2 / 3 receptorer förutsäger egenskapsimpulsivitet och kokainförstärkning. Vetenskap 315: 1267-1270. doi: 10.1126 / science.1137073
  180. 39. Nader MA, Morgan D, Gage HD, Nader SH, Calhoun TL, et al. (2006) PET-bildbehandling av dopamin D2-receptorer under kronisk kokain självadministration hos apor. Nat Neurosci 9: 1050-1056. doi: 10.1038 / nn1737
  181. 40. Robinson TE, Kolb B (1997) Hållbara strukturella modifieringar i nukleär accumbens och prefrontal cortex neuroner producerad av tidigare erfarenhet av amfetamin. J Neurosci 17: 8491-8497.
  182. 41. Robinson TE, Kolb B (1999) Förändringar i morfologin för dendrit och dendritiska ryggrad i kärnan accumbens och prefrontal cortex efter upprepad behandling med amfetamin eller kokain. Eur J Neurosci 11: 1598-1604. doi: 10.1046 / j.1460-9568.1999.00576.x
  183. 42. McClung CA, Nestler EJ (2003) Reglering av genuttryck och kokainbelöning av CREB och DeltaFosB. Nat Neurosci 6: 1208-1215. doi: 10.1038 / nn1143
  184. 43. Feng J, Yan Z, Ferreira A, Tomizawa K, Liauw JA, et al. (2000) Spinofilin reglerar bildandet och funktionen av dendritiska spines. Proc Natl Acad Sci USA 97: 9287-9292. doi: 10.1073 / pnas.97.16.9287
  185. 44. Prange O, Murphy TH (2001) Modulär transport av postsynaptiska densitet-95-kluster och association med stabila ryggradsprekursorer under tidig utveckling av kortikala neuroner. J Neurosci 21: 9325-9333.
  186. 45. Muras S, Mosser E, Schuman EM (2002) Depolarisering driver beta-Catenin till neuronala spines som främjar förändringar i synaptisk struktur och funktion. Neuron 35: 91-105. doi: 10.1016 / s0896-6273 (02) 00764-x
  187. 46. Hayashi ML, Choi SY, Rao BS, Jung HY, Lee HK, et al. (2004) Ändrad kortikal synaptisk morfologi och försämrad minneskonsolidering i förekom-specifika dominant-negativa PAK-transgena möss. Neuron 42: 773-787. doi: 10.1016 / j.neuron.2004.05.003
  188. 47. Benavides DR, Quinn JJ, Zhong P, Hawasli AH, DiLeone RJ, et al. (2007) Cdk5 modulerar kokainbelöning, motivation och striatal neuron excitability. J Neurosci 27: 12967-12976. doi: 10.1523 / jneurosci.4061-07.2007
  189. 48. Meyer DA, Richer E, Benkovic SA, Hayashi K, Kansy JW, et al. (2008) Striatal dysregulation av Cdk5 förändrar lokomotoriska reaktioner mot kokain, motorinlärning och dendritisk morfologi. Proc Natl Acad Sci USA 105: 18561-18566. doi: 10.1073 / pnas.0806078105
  190. 49. Impey S, Obrietan K, Storm DR (1999) Göra nya förbindelser: rollen för ERK / MAP-kinasignalering i neuronal plasticitet. Neuron 23: 11-14. doi: 10.1016 / s0896-6273 (00) 80747-3