Läkemedelsupplevelse primer primärt Fosb-geninducerbarhet i råttkärnans accumbens (2012)

KOMMENTARER: Bevis för att deltafosb lämnar spår långt efter återhämtning från beroende. Specifikt missbruk orsakar epigenetiska förändringar, vilket resulterar i mycket snabbare induktion av deltafosb vid återfall. Detta förklarar hur återfall, även efter år, kan snabbt eskalera till ett fullblåst beroende tillstånd.



J Neurosci. Författarens manuskript; tillgänglig i PMC 2013 januari 25.

 

Abstrakt

ΔFosB, a FosB genprodukt induceras i Nucleus Accumbens (NAc) och Caudate Putamen (CPu) genom upprepad exponering för missbruksmedel som kokain. Denna induktion bidrar till avvikande mönster av genuttryck och beteendeavvikelser ses med upprepad läkemedelsexponering.

Här bedömde vi huruvida en avlägsen historia av drogexponering hos råttor skulle kunna förändra inducerbarheten hos FosB gen som framkallas av efterföljande kokainexponering. Vi visar att tidigare kronisk kokainadministration, följt av förlängd uttag, ökar inducerbarheten hos FosB i NAc, vilket framgår av ökad akut induktion av FFB-mRNA och snabbare ackumulering av ΔFosB-protein efter upprepad kokainreexponering. Ingen sådan grundad FosB induktion observerades i CPu, i själva verket undertrycktes efterföljande akut induktion av ΔFosB mRNA i CPu.

Dessa onormala mönster av FosB uttryck är associerade med kromatin modifieringar vid FosB genpromotor. Tidigare kronisk kokainadministration inducerar en långvarig ökning av RNA-polymeras II (Pol II) bindning vid FosB promotor i NAc, vilket tyder på att Pol II "stalling" primer FosB för induktion i denna region vid återexponering för kokain. En kokainutmaning utlöser sedan frisättningen av Pol II från genpromotorn, vilket möjliggör snabbare FosB transkription. En kokainutmaning minskar också repressiva histonförändringar vid FosB promotor i NAc, men ökar sådana repressiva märken och minskar aktiveringsmärken i CPu.

Dessa resultat ger ny inblick i kromatindynamiken vid FosB promotor och avslöja en ny mekanism för primed FosB induktion i NAc vid återexponering mot kokain.

Beskrivning

Narkotikamissbruk kännetecknas av tvångssökande läkemedel och tar trots allvarliga, skadliga konsekvenser (Kalivas et al., 2005; Hyman et al., 2006). Kronisk drogexponering orsakar ständiga förändringar i genuttryck i ventralstriatum (eller kärnan accumbens, NAc) och dorsalstriatum (eller caudate putamen, CPu), striatalstrukturer som är inblandade i läkemedelsbelöning och beroende (Freeman et al., 2001; Robinson och Kolb, 2004; Shaham och Hope, 2005; Maze and Nestler, 2011). ΔFosB, ett stympat och stabilt protein kodat av den omedelbara tidiga genen, FosB, är en väl kännetecknad transkriptionsfaktor inducerad i NAc och CPu genom kronisk exponering för praktiskt taget alla missbrukande medel, där det medierar sensibiliserat beteendemässigt svar på upprepad läkemedelsadministration (Nestler, 2008). Huruvida tidigare kronisk exponering för missbrukande läkemedel förändrar efterföljande induktion av ΔFosB förblir okänd.

Vi förutspådde nyligen att kromatinmodifieringar som svar på kronisk drogexponering kan förändra inducerbarheten hos specifika gener i målhjärnregioner (Robison och Nestler, 2011). Ökande bevis har visat att missbruk av läkemedel efter kronisk administrering förändrar kromatins struktur och transkriptionella tillgänglighet genom många typer av modifieringar, inklusive fosforylering, acetylering och metylering av histonhaler. Nyare arbete i cellodlingssystem har fokuserat på rekrytering av RNA-polymeras II (Pol II) till promotorn av "inducerbara" gener före deras uttryck, med Pol II bunden permanent för proximala promotorområden och runt transkriptionsstartplatsen (TSS ) i ett "stoppat" tillstånd (Core och Lis, 2008; Nechaev och Adelman, 2008). Aktivering av den stalled Pol II anses sedan vara ansvarig för sin flykt från promotor- och TSS-regioner och dess transkription av dessa "primerade" gener (Zeitlinger et al., 2007; Saha et al., 2011; Bataille et al., 2012).

Här visar vi att tidigare kronisk exponering för kokain, följt av en förlängd uttagsperiod, förändrar inducerbarheten hos FosB gen för efterföljande kokainadministration, med NAc som grundas för induktion medan CPu inte är. Vi identifierar sedan separata kromatin signaturer på FosB genpromotorn i NAc och CPu som är associerade med sådan avvikande inducerbarhet hos FosB gen, inklusive rekrytering av stalled Pol II vid FosB proximal promotor endast i NAc samt förändringar i flera aktiverande eller repressiva histon-modifikationer i båda hjärnregionerna. Dessa resultat ger en ny inblick i kromatindynamiken vid FosB genpromotorn och indikerar för första gången en mekanism genom vilken stalling av Pol II-primer FosB för större aktivering i NAc vid återexponering för kokain.

Material och metoder

djur

Manliga Sprague Dawley-råttor (250-275 g; Charles River Laboratories), som användes i alla experiment, var parhus i ett klimatstyrt rum på en 12 hr ljus / mörk cykel (lampor på 7 AM) med tillgång till mat och vatten AD libitum. Alla djur injicerades två gånger om dagen i tio dagar med kokain (15 mg / kg, ip) eller saltlösning (ip) i sina hemburar. Djurförsök godkändes av Institutional Animal Care and Use Committee (IACUC) vid Mount Sinai.

Lokomotoriska mätningar

Djur habituerades i den lokomotoriska kammaren den första dagen för 1h och övervakades därefter för lokomotorisk aktivitet efter en saltlösningsinjektion med användning av Photobeam Activity System (San Diego Instruments). Efter 1-timmarsättning i lokomotoriska kamrar dagligen administrerades kokain (15 mg / kg, ip) dagligen under 2-dagar och djur övervakades återigen för lokomotorisk aktivitet för 1-timmar.

immunohistokemi

Djur perfusionerades 24-tim efter deras senaste läkemedelsexponering. ΔFosB / FosB immunreaktivitet detekterades som beskrivet (Perrotti et al., 2004). Western blotting bekräftade att alla ΔFosB / FosB-liknande immunreaktivitet observerade 24 timmar eller längre efter kokaininjektioner reflekterade ΔFosB, med FosB odetekterbar (ej visad).

RNA-isolering, omvänd transkription och PCR

Bilaterala 12-mätstansar av NAc och dorsolateral / dorsomedial CPu erhölls som beskrivet (Perrotti et al., 2004), fryst på torris och bearbetas enligt publicerade protokoll (Covington et al., 2011). ΔFosB och FosB mRNA uppmättes med användning av kvantitativ PCR (qPCR) med isoformspecifika FFosB- och FosB-primers (Alibhai et al., 2007). ΔFosB- och FosB-mRNA-nivåerna normaliserades till GAPDH-mRNA-nivåer, vilka inte påverkades av kokainexponering (ej visad).

Western blotting

NAc- och CPu-stans uppsamlades som ovan och bearbetades för Western blotting enligt beskrivningen (Covington et al., 2011) med hjälp av antikroppar mot ERK44 / 42 [extracellulär signalreglerad kinase-44 / 42] och fosforKERKNUMX / 44 (pERK), AKT [tymomviralproto-onkogen] och p-AKT, SRF (serumresponsfaktor) och pSRF, CREB [cAMP-responselementbindande protein] och pCREB. Mängden protein som blottades på varje bana normaliserades till nivåer av aktin eller tubulin, vilka inte påverkades av kokainexponering.

Kromatinimmunutfällning (ChIP)

Färskt dissekerade NAc- och CPu-stansar framställdes för ChIP såsom beskrivits (Maze et al., 2010). Varje experimentellt tillstånd analyserades i tre exemplar från oberoende djurgrupper. För varje ChIP-prov samlades bilaterala NAc- och CPu-stansar från fem råttor (10-stansar). Antikropparna som används för specifika histonmodifikationer är lika med de som publicerats (Maze et al., 2010); antikroppar mot Pol II fosforylerad vid Ser5 i sin karboxylterminala domän (CTD) -reaktionsregion (Pol II-pSer5) erhölls från abcam 5131. Fyra uppsättningar av ChIP-primers konstruerades för FosB (Lazo et al., 1992; Mandelzys et al., 1997): 1F: GTACAGCGGAGGTCTGAAGG, 1R: GAGTGGGATGAGATGCGAGT; 2F: CATCCCACTCGGCCATAG, 2R: CCACCGAAGACAGGTACTGAG; 3F: GCTGCCTTTAGCCAATCAAC, 3R: CCAGGTCCAAAGAAAGTCCTC; 4F: GGGTGTTTGTGTGTGAGTGG, 4R: AGAGGAGGCTGGACAGAACC. Nivåer av kromatinmodifieringar jämförs med de för ingående DNA som beskrivits (Maze et al., 2010).

Statistisk analys

Alla rapporterade värden är medelvärde ± sem Data för rörelseaktivitet och cellräkning analyserades med tvåvägs ANOVA med behandling och injektion som faktorer. qPCR-experiment analyserades per tidpunkt med envägs ANOVA med behandling som en faktor. När signifikanta huvudeffekter observerades (p <0.05) utfördes post-hoc-test från Bonferroni för jämförelser med läkemedelsnaiva saltvattenbehandlade djur (^ i figurer) och läkemedelsnaiva kokainbehandlade djur (* i figurer). Oparade tvåsidiga Student-t-test användes för Western blotting och ChIP-data, med korrigeringar för flera jämförelser.

Resultat

Större Fosb-inducerbarhet i NAc, men inte CPu, av kokain-erfarna råttor

Att undersöka påverkan av en tidigare kronisk kurs av kokain, följt av en förlängd uppsägningstid, på inducerbarheten hos FosB gen som svar på en efterföljande kokainutmaning, gav råttor som tidigare injicerats ip två gånger dagligen med saltlösning eller kokain (15 mg / kg) för 10-dagar utmaningsdoser av läkemedlet efter 28-dagars återtagande (Fig 1A). Vi mättes först lokomotoriska svar i en grupp djur för att bekräfta induktion av lokomotorisk sensibilisering vid tidigare kokainexponering, en förväntad varaktig konsekvens av läkemedelsadministration. Kokain-erfarna och -naiva råttor visade ekvivalent baslinjär lokomotorisk aktivitet, med en kokainutmaning för narkotika-naiva djur som ökar deras rörelse (Fig 1B. Upprepade åtgärder tvåvägs ANOVA, behandling: F1,66 = 30.42, p <0.0001; kokainutmaning: F2,66= 58.39, p <0.0001; behandling x kokainutmaning: F2,66= 8.56, p = 0.0005, Bonferroni efter test ^p <0.001). Denna kokainutmaning inducerade signifikant större rörelseaktivitet, dvs sensibilisering, hos kokainerfarna råttor (Bonferroni posttest * p <0.001).

Figur 1  

Effekt av tidigare kronisk kokainexponering på lokomotorisk aktivitet och FosB induktion i NAc och CPu vid återexponering för läkemedlet

För att utvärdera effekterna av denna kokainbehandlingsregim på ΔFosB-uttryck i NAc och CPu mättes ΔFosB-protein med immunohistokemiska metoder 24 hr efter att kokain-naiva och kokainerfarenheter behandlades med 0, 1, 3 eller 6 daglig kokainutmaning injektioner (15 mg / kg; se Fig 1A). Som tidigare fastställts (Nye et al., 1995), Var 3-kokaininjektioner tillräckliga för att signifikant inducera ΔFosB-protein i NAc och CPu hos narkotika-naiva djur och dess ackumulation förblev signifikant efter 6-dagar av kokaininjektioner (Fig 1C. Upprepade åtgärder tvåvägs ANOVA, NAc-kärna, behandling: F1,28= 23.5, p <0.0001; kokainutmaning: F3,28= 49.16, p <0.0001; behandling x kokainutmaning: F3,28= 6.83, p = 0.0014; NAc-skal, behandling: F1,28= 18.69, p <0.0001; kokainutmaning: F3,28= 31.52, p <0.0001; behandling x kokainutmaning: F3,28= 3.21, p <0.05; CPu, behandling: F1,28= 9.47, p <0.001; kokainutmaning: F3,28= 19.74, p <0.0001; behandling x kokainutmaning: F3,28= 0.94, p> 0.05. I NAc kärna, skal och CPu, Bonferroni eftertest ^p <0.05). Hos kokainerfarna djur fanns inga bevis för bestående ΔFosB-induktion i NAc eller CPu efter 28 dagars uttag, i överensstämmelse med tidigare rapporter om att ΔFosB-signalen försvinner helt vid denna tidpunkt (Nye et al., 1995), anledningen till att denna tidpunkt användes i denna studie. Påtagligt visade dock att kokain-erfarna råttor som fick 3- eller 6-kokain-utmaningsinjektioner visade signifikant högre ΔFosB-proteininduktion i NAc, en effekt som uppenbarades i både kärn- och skal-subregioner (Fig 1C. Bonferroni eftertest * p <0.05). Däremot observerades ingen sådan större induktion av ΔFosB-protein i CPu; i stället sågs ekvivalent ΔFosB-induktion i denna region efter 3 eller 6 dagars kokainutmaninginjektioner i kokainnaiva och -erfarna råttor (Fig 1C).

För att få insikt i de transkriptionsförändringar som uppstod i NAc och CPu som svar på en kokainutmaning studerade vi tidskursen (45, 90 och 180 min) av inducerbarheten av ΔFosB- och FosB-mRNA-transkript på en enda kokain- eller saltlösningsinjektion ges till kokain-naiva och -experiencerade råttor efter 28-dagars tillbakadragande (se Fig 1A). I förhållande till en saltlösning utmanade en kokainutmaning en snabb ökning av ΔFosB- och FosB-mRNA-nivåerna vid alla tre tidpunkter i både NAc och CPu hos kokainnaida djur (Fig 1D. Upprepade åtgärder envägs ANOVA per tidpunkt Bonferroni efter test ^p <0.05). I NAc observerade vi större ΔFosB- och FosB-mRNA-induktion hos kokainupplevda djur jämfört med kokainnaiva djur efter kokainutmaningen, effekten var signifikant vid 90 minuter medan, däremot, inducerbarheten av ΔFosB och FosB mRNA i CPu var signifikant minskat hos kokainerfarna djur (Fig 1D. Bonferroni efter test %p = 0.08, * p <0.05).

Karakterisering av uppströms signaleringsvägar i NAc och CPu hos kokainerfarna råttor

En möjlig förklaring till förändrad inducerbarhet hos FosB gen i NAc och CPu efter en tidigare kronisk kurs av kokain är att en avlägsen historia av kokainexponering kan inducera varaktiga förändringar i signalvägar som är uppströms om FosB geninduktion så att en kokainutmaning sedan inducerar genen i avvikande grad. För att studera denna hypotes analyserades de två transkriptionsfaktorerna, SRF och CREB, som nyligen visats vara nödvändiga för kokaininduktion av FosB i dessa hjärnregioner (Vialou et al., 2012) tillsammans med uppströms proteinkinaser, ERK och AKT, också inblandade i kokainverkan (Valjent et al., 2000; Lu et al., 2006; Boudreau et al., 2009). Vi kunde inte upptäcka några förändringar i totala eller fosforylerade nivåer av dessa olika proteiner som kunde förklara den förändrade inducerbarheten hos FosB observerade, inklusive inga ändringar i SRF, CREB eller AKT (Fig 2B, C). Bristen på förändring av pSRF och pCREB i NAc som svar på en kokainutmaning överensstämmer med en nyligen rapporterad rapport, vilken båda visade sig signifikant orsakad av endast kronisk kokain (Vialou et al., 2012).

Figur 2  

Effekt av tidigare kronisk kokainexponering på uppströms molekylära signalkaskader i NAc och CPu

I NAc och CPu hos narkotika-naiva djur, 20 min efter en första läkemedelsexponering (Fig 2A), en enda kokainutmaning minskade nivåerna av pERK42 / 44 (Fig 2B, C. Två-tailed Student t-test: * p <0.05). Det finns tidigare rapporter om ökade pERK-nivåer i dessa regioner efter akut kokainadministrering (Valjent et al., 2000). Detta är svårt att jämföra med andra papper som undersöker ERK-fosforylering i NAc under avdrag från upprepade kokaininjektioner (Boudreau et al., 2007; Shen et al., 2009), som i vår studie kvantifierades PERK efter 28-dagars tillbakadragande och efter en kokain- eller saltlösningsutmaning. I förhållande till narkotika-naiva djur som upplever kokain för första gången, återexponering för kokain hos erfarna råttor, efter 28-dagar av uttag, orsakade en signifikant ökning av pERK42 / 44-nivåerna i CPu (Fig 2B, C. Två-svans student t-test: * p <0.05).

Kromatin landskap vid Fosb-genpromotorn i NAc och CPu av kokain-erfarna råttor

Vi undersökte därefter om förändringar i FosB geninducerbarhet associeras med förändringar i dess kromatinstruktur. ChIP utfördes på NAc och CPu med användning av antikroppar riktade mot tre väl karakteriserade former av histon-modifikationer: trimetylering av Lys4 av histon H3 (H3K4me3) associerad med genaktivering och H3K27me3 och H3K9me2 associerad med genrepression. Vi analyserade kokain-naiva och -experiencerade råttor efter 28-dagars tillbakadrag antingen utan eller med en utmaning injektion av kokain, med djur som undersöktes 1 timmar senare (Fig 3A). I NAc fann vi inga signifikanta förändringar i bindningen av någon av dessa tre histonmodifieringar till FosB genpromotorn i avsaknad av en kokainutmaning, även om det fanns en trend för reducerade nivåer av H3K9me2 (Fig 3B-D. Två-tailed Student t-test. #p = 0.2 jämfört med respektive drognaiva kontroller). Denna effekt blev signifikant efter en kokainutmaning och var specifik för genens proximala promotorregion (Fig 3C. * p <0.05). Medan nivåerna av H3K9me2 är mycket låga för vissa gener, är FosB genpromotorn visar märkbara nivåer av detta märke i NAc under kontrollbetingelser (Maze et al., 2010, data ej visad). Däremot fann vi i CPu små men signifikanta minskningar av H3K4me3-bindning och ökning av H3K27me3-bindning vid FosB promotor i avsaknad av kokainutmaning, effekter som förlorats efter utmaningen (Fig 3D. * p <0.05).

Figur 3  

Effekt av tidigare kronisk kokainexponering vid epigenetisk priming av FosB gen i NAc och CPu

Vi undersökte därefter Pol II bindande till FosB genen, baserad på senaste fynd i cellodling som stalling av Pol II vid TSS, som kännetecknas av dess fosforylering vid Ser 5 i sin CTD-repetitionsregion, är associerad med priming av gener (se Introduktion). Vi analyserade sålunda Pol II-pSer5-bindning till FosB vid fyra distinkta regioner av genen (Fig 3B). Denna analys avslöjade en signifikant anrikning av Pol II-pSer5 vid FosB gen i sin proximala promotorregion och kring dess TSS i NAc av kokainerfarna djur efter långvarig återtagning, i avsaknad av en kokainutmaning jämfört med kontroller (Fig 3E. * p <0.05). Denna anrikning var inte uppenbar vid två genkroppsregioner i FosB, i överensstämmelse med Pol II-stalling beskrivet i enklare experimentella system. Intressant, efter en kokainutmaning, visade Pol II-pSer5-bindning fortfarande tecken på anrikning, men inte längre signifikant, vid FosB proximala promotorregionen (Fig 3E. %p = 0.1), men återvände till kontrollnivåer vid TSS. Resultaten i CPu var mer variabla, utan att ett tydligt mönster av Pol II-pSer5-bindning observerades.

Diskussion

Den här studien ger en ny inblick i den hållbara reglering av FosB veckor efter upprepad upprepad exponering för kokain. Vi visar att tidigare kronisk kokainadministration gör FosB gen mer inducerbar i NAc, vilket resulterar i snabbare ackumulering av ΔFosB vid återexponering för läkemedlet. Med tanke på övervägande bevis för att ΔFosB induktion i NAc medierar sensibiliserat beteendehantering mot kokain (Nestler, 2008) visar våra resultat en ny mekanism för snabbare återinförande av sådana sensibiliserade responser efter långvarig återtagning.

Vi visar att den förbättrade induktionen av ΔFosB i NAc är associerad med kromatinförändringar vid FosB gen som skulle förväntas förstärka den för större induktion. Således visar vi ökad Pol II-bindning till proximal promotorn och TSS-regionerna i genen som är närvarande efter 4-veckor av tillbakadragande från tidigare kronisk kokainadministration. En sådan Pol II-anrikning vid TSS förloras snabbt vid kokainutmaning och FosB induktion, i överensstämmelse med en modell i cellodling som stallad Pol II frigörs från TSSs vid genaktivering (se Introduktion). En kokainutmaning inducerar också en snabb minskning av bindningen av H3K9me2-ett märke av genrepression-till FosB promotor. Däremot upptäckte vi ingen varaktig induktion av flera transkriptionsfaktorer eller av deras uppströms kinaser, som är kända för att mediera FosB induktion av kokain. Dessa resultat stöder vår hypotes att den förbättrade induktionen av ΔFosB i NAc medieras via epigenetisk priming av FosB genen och inte via uppreglering av uppströms händelser.

Mycket olika resultat erhölls för CPu. Det fanns inga bevis för Pol II stalling vid FosB hos kokainerfarna råttor före en kokainutmaning, även om det fanns små men signifikanta histonförändringar i överensstämmelse med genrepression: ökad H3K27me3-bindning och minskad H3K4me3-bindning. Det fanns också ingen förändring i uppströms transkriptionsfaktorer eller kinaser i överensstämmelse med reducerad FosB induktion. Dessa resultat tyder på att epigenetiska modifieringar efter en kronisk kokainadministration tjänar till att dämpas FosB geninducerbarhet i CPu, i motsats till priming ses i NAc. Emellertid, medan dessa effekter undertrycker ΔFosB-mRNA-induktion vid återexponering för kokain, finns det ingen förlust i ackumulering av ΔFosB-protein. Mekanismen som ligger till grund för denna paradox kräver nu ytterligare undersökning.

Mer generellt stödjer våra resultat en modell där förändringar i kromatinlandskapet vid specifika gener som svar på kronisk kokainadministration tjänar till att primära eller stampa dessa gener för efterföljande induktion vid återexponering för läkemedlet. Sådana kromatinförändringar, som kan ses som "epigenetiska ärr", skulle saknas i analyser av steady state mRNA-nivåer av gener. På detta sätt lovar karaktärisering av missbrukets epigenom att avslöja ny information om sjukdomsmolekylpathogenesen, som kan brytas ut för utveckling av nya behandlingar.

Tack

Detta arbete stöddes av bidrag från National Institute on Drug Abuse.

referenser

  • Alibhai IN, Green TA, Potashkin JA, Nestler EJ. Reglering av fosB- och DeltafosB-mRNA-uttryck: in vivo och in vitro studier. Brain Res. 2007;1143: 22-33. [PMC gratis artikel] [PubMed]
  • Bataille AR, Jeronimo C, Jacques PE, Laramee L, Fortin ME, Forest A, Bergeron M, Hanes SD, Robert F. En universell RNA-polymeras II CTD-cykel är orkestrerad genom komplexa interplays mellan kinas, fosfatas och isomerasenzym längs gener. Mol Cell. 2012;45: 158-170. [PubMed]
  • Boudreau AC, Reimers JM, Milovanovic M, Wolf ME. Cell-AMPA-receptorer i råttkärnans accumbens ökar under kokainuttag men internaliseras efter kokainutmaning i samband med förändrad aktivering av mitogenaktiverade proteinkinaser. J Neurosci. 2007;27: 10621-10635. [PMC gratis artikel] [PubMed]
  • Boudreau AC, Ferrario CR, Glucksman MJ, Wolf ME. Signalvägsanpassningar och nya proteinkinas A-substrat relaterade till beteendessensibilisering mot kokain. J Neurochem. 2009;110: 363-377. [PMC gratis artikel] [PubMed]
  • Core LJ, Lis JT. Transkriptionsreglering genom promotor-proximal pausning av RNA-polymeras II. Science. 2008;319: 1791-1792. [PMC gratis artikel] [PubMed]
  • Covington HE, 3rd, Maze I, Sun H, Bomze HM, DeMaio KD, Wu EY, Dietz DM, Lobo MK, Ghose S, Mouzon E, Neve RL, Tamminga CA, Nestler EJ. En roll för repressiv histon-metylering i kokain-inducerad sårbarhet mot stress. Neuron. 2011;71: 656-670. [PMC gratis artikel] [PubMed]
  • Freeman WM, Nader MA, Nader SH, Robertson DJ, Gioia L, Mitchell SM, Daunais JB, Porrino LJ, Friedman DP, Vrana KE. Kroniska kokainmedierade förändringar i icke-human primatkärnor accumbens genuttryck. J Neurochem. 2001;77: 542-549. [PubMed]
  • Hyman SE, Malenka RC, Nestler EJ. Neurala mekanismer för missbruk: rollen som belöningsrelaterad inlärning och minne. Annu Rev Neurosci. 2006;29: 565-598. [PubMed]
  • Kalivas PW, Volkow N, Seamans J. Omanövrerad motivation i beroende: en patologi i prefrontal-accumbens glutamatöverföring. Neuron. 2005;45: 647-650. [PubMed]
  • Lazo PS, Dorfman K, Noguchi T, Mattei MG, Bravo R. Struktur och kartläggning av fosB-genen. FosB downregulerar aktiviteten hos fosB-promotorn. Nukleinsyror Res. 1992;20: 343-350. [PMC gratis artikel] [PubMed]
  • Lu L, Koya E, Zhai H, Hopp BT, Shaham Y. Roll av ERK i kokainberoende. Trender Neurosci. 2006;29: 695-703. [PubMed]
  • Mandelzys A, Gruda MA, Bravo R, Morgan JI. Frånvaro av ett ständigt förhöjt 37 kDa fosrelaterat antigen och AP-1-liknande DNA-bindande aktivitet i hjärnorna av kaininsyrabehandlade fosB null-möss. J Neurosci. 1997;17: 5407-5415. [PubMed]
  • Maze I, Nestler EJ. Det epigenetiska landskapet av missbruk. Ann NY Acad Sci. 2011;1216: 99-113. [PMC gratis artikel] [PubMed]
  • Maze I, Covington HE, 3rd, Dietz DM, LaPlant Q, Renthal W, Russo SJ, Mekaniker M, Mouzon E, Neve RL, Haggarty SJ, Ren Y, Sampath SC, Hurd YL, Greengard P, Tarakhovsky A, Schaefer A, Nestler EJ. Viktig roll för histon-metyltransferas G9a i kokaininducerad plasticitet. Science. 2010;327: 213-216. [PMC gratis artikel] [PubMed]
  • Nechaev S, Adelman K. Promoter-proximal Pol II: när stalling snabbar upp saker. Cykelcykel. 2008;7: 1539-1544. [PubMed]
  • Nestler EJ. Recension. Transkriptionsmekanismer för missbruk: DeltaFosBs roll. Philos Trans R Soc Lond B Biol Sci. 2008;363: 3245-3255. [PMC gratis artikel] [PubMed]
  • Nye HE, Hopp BT, Kelz MB, Iadarola M, Nestler EJ. Farmakologiska studier av reglering av kronisk FOS-relaterad antigeninduktion av kokain i striatum och kärnan accumbens. J Pharmacol Exp Ther. 1995;275: 1671-1680. [PubMed]
  • Perrotti LI, Hadeishi Y, Ulery PG, Barrot M, Monteggia L, Duman RS, Nestler EJ. Induktion av deltaFosB i belöningsrelaterade hjärnstrukturer efter kronisk stress. J Neurosci. 2004;24: 10594-10602. [PubMed]
  • Robinson TE, Kolb B. Strukturell plasticitet i samband med exponering för missbruk. Neurofarmakologi 47 Suppl. 2004;1: 33-46. [PubMed]
  • Robison AJ, Nestler EJ. Transkriptionella och epigenetiska mekanismer för missbruk. Nat Rev Neurosci. 2011;12: 623-637. [PMC gratis artikel] [PubMed]
  • Saha RN, Wissink EM, Bailey ER, Zhao M, Fargo DC, Hwang JY, Daigle KR, Fenn JD, Adelman K, Dudek SM. Snabbaktivitetsinducerad transkription av Arc och andra IEGs är beroende av fördjupat RNA-polymeras II. Nat Neurosci. 2011;14: 848-856. [PMC gratis artikel] [PubMed]
  • Shaham Y, Hopp BT. Den roll som neuroadaptations i återfall till läkemedelssökande. Nat Neurosci. 2005;8: 1437-1439. [PubMed]
  • Shen HW, Toda S, Moussawi K, Bouknight A, Zahm DS, Kalivas PW. Ändrad dendritisk ryggradsplasticitet i kokainuttagna råttor. J Neurosci. 2009;29: 2876-2884. [PMC gratis artikel] [PubMed]
  • Valjent E, Corvol JC, Sidor C, Besson MJ, Maldonado R, Caboche J. Inblandning av den extracellulära signalreglerade kinaskaskaden för kokainbelöningsegenskaper. J Neurosci. 2000;20: 8701-8709. [PubMed]
  • Zeitlinger J, Stark A, Kellis M, Hong JW, Nechaev S, Adelman K, Levine M, Young RA. RNA-polymeras som stallar vid utvecklingskontrollgener i Drosophila melanogaster-embryot. Nat Genet. 2007;39: 1512-1516. [PMC gratis artikel] [PubMed]
  • Vialou VF, Feng J, Robison AJ, Ferguson D, Scobie KN, Mazei-Robison M, Mouzon E, Nestler EJ. Serumresponsfaktor och cAMP-responselementbindande protein erfordras båda för kokaininduktion av ΔFosB. J Neurosci. 2012 accepteras. [PMC gratis artikel] [PubMed]