Prefrontal Cortical Circuit för depressions- och ångestrelaterade beteenden medierade av Cholecystokinin: Roll av ΔFosB (2014)

Abstrakt

Minskad medial prefrontal cortex (mPFC) neuronaktivitet är förknippad med sociala nederlagsinducerade depressions- och ångestliknande beteenden hos möss. De molekylära mekanismerna som ligger bakom den minskade mPFC-aktiviteten och dess prodepressiva roll förblir emellertid okända. Vi visar här att induktion av transkriptionsfaktorn ΔFosB i mPFC, speciellt i prelimbic (PrL) -området, medierar känslighet mot stress. ΔFosB induktion i PrL inträffade selektivt i mottagliga möss efter kronisk social nederlagsspänning och överuttryck av FosB i denna region, men inte i det närliggande infralimbiska (IL) området, ökad stresskänslighet. ΔFosB producerade dessa effekter delvis genom induktion av cholecystokinin (CCK) -B-receptorn: CCKB-blockad i mPFC inducerar en fjädrande fenotyp, medan CCK-administrering i mPFC efterliknar de anxiogena och depressiva liknande effekterna av social stress. Vi har tidigare funnit att optogenetisk stimulering av mPFC-neuroner hos mottagliga möss reverserar flera beteendemässiga abnormiteter som ses efter kronisk social nederlagsspänning. Därför antog vi att optogenisk stimulering av kortikala projiceringar skulle rädda CCK: s patologiska effekter i mPFC. Efter CCK-infusion i mPFC stimulerade vi optogenetiskt mPFC-projiceringar till basolaterala amygdala eller kärnan accumbens, två subkortiska strukturer inblandade i humörreglering. Stimulering av kortikamygdalaprojektioner blockerade CCK: s anxiogena effekt, även om ingen effekt observerades på andra symtom på socialt nederlag. Omvänt reverserade stimulering av corticoaccumbensprojektioner CCK-inducerad social undvikande och sackarospreferensunderskott men inte anxiogenliknande effekter. Tillsammans indikerar dessa resultat att sociala stressinducerade beteendeunderskott förmedlas delvis av molekylära anpassningar i mPFC som involverar ΔFosB och CCK genom kortikala projiceringar till distinkt subkortiskt måls.

Nyckelord: accumbens, amygdala, ångest, CCK, depression, mPFC

Beskrivning

Flera anatomiskt och funktionellt sammanlänkade limbiska hjärnregioner, inklusive medial prefrontal cortex (mPFC), hippocampus, amygdala och nucleus accumbens (NAc), är inblandade i att mediera viktiga symtom på depression och ångest (; ; ; ; , ; ; ). Till exempel är frånvaron av kortikal återkoppling till amygdala korrelerad med dysforiska känslor och återgår till normala nivåer efter framgångsrik behandling. De antidepressiva effekterna av djup hjärnstimulering av subgeneral cingulär cortex, ett område av mPFC, är associerade med återställande av både kortikal och subkortisk hjärnaktivitet till normala nivåer (; ). På liknande sätt är djup hjärnstimulering av NAc antidepressiv och anxiolytisk och korrelerar med förändrad metabolism i NAc, amygdala och mPFC (; ; ). Dessa data stöder en neuralt nätverkshypotes av humörstörningar där antidepressiva behandlingar, oavsett mekanismer, normaliserar aktivitet i både underaktiva kortikala och överaktiva subkortiska kretsar (; ; ; ; ; ).

Djurmodeller som involverar kronisk exponering för fysisk eller psykisk stress försämrar neurons struktur och funktion i mPFC (), amygdala (), hippocampus () och NAc (; ). Kronisk social nederlagsspänning, en etologiskt giltig modell för depression () minskar mPFC-neuronaktiviteten som härledd från reducerat uttryck av Zif268 och c-Fos (; ). Dessutom reverserar optogenetisk stimulering av mPFC dessa underskott och utövar antidepressiva-liknande effekter (), vilket bekräftar vikten av mPFC i humörrelaterade fenomen. Than gnagare mPFC, som i primater, kontrollerar emotionellt beteende delvis genom prognoser mot basolateral amygdala (BLA) och NAc (; ; ). Trots det är molekylära mekanismer som medlar denna roll av mPFC fortfarande okända.

Den föreliggande studien fokuserade initialt på ΔFosB, en stabil transkriptionsfaktor som induceras i NAc genom kronisk social nederlagsspänning där den motverkar stresskänslighet (). Vi utförde hjärntäckande kartläggning av ΔFosB-induktion efter nederlagsspänning och fann, liknande tidigare studier (; ; ), robust induktion i mPFC. Överraskande fann vi att sådan ΔFosB induktion i mPFC främjar stresskänslighet. Vi identifierade cholecystokinin (CCK) -B-receptorn som ett molekylärt mål för FosB i mPFC, där CCKergic neurotransmission har blivit implicerad i både anxiogena och depressiva effekter av social stress (, ). Vi fann att CCK-aktivitet i mPFC är både nödvändig och tillräcklig för de ångest- och depressionsliknande effekterna av social stress. Vidare visar vi med hjälp av optogenetiska metoder att vi visar specifika åtgärder hos CCK i mPFC-subkretsar: CCK i mPFC-BLA-projiceringar medierar ångestsymtom, medan CCK i mPFC-NAc-projektioner medierar depressionssymptom.

Material och metoder

Experiment 1: Hjärnomfattande kartläggning av ΔFosB induktion genom kronisk social nederlagsspänning.

Åtta veckor gamla C57BL / 6J hanmöss utsattes för kronisk social nederlagsspänning i 10-konsekutiva dagar såsom beskrivits tidigare (; ; ) (se Tabell 1; Fig 1A). Kort sagt var varje mus utsatt för en obekant, aggressiv manuell CD1-pensionerad uppfödarmus för 5-min per dag. Efter direkt interaktion med CD1-aggressorn (5 min) placerades djuren i ett intilliggande fack i samma bur för nästa 24 h med sensorisk men inte fysisk kontakt. Kontrolldjur hölls i ekvivalenta burar men med medlemmar av samma stam. Sociala interaktionstest utfördes 24 h efter den sista dagen i nederlaget. Social undvikande till en okänd CD1 manlig mus bedömdes enligt publicerade protokoll. Den tid som spenderades i "interaktionszonen" (en 8-cm-bred korridor som omger buren) mättes. Segregering av besegrade möss i mottagliga och fjädrande subpopuleringar utfördes såsom beskrivits tidigare (; ). Eftersom majoriteten av kontrollmössen spenderar mer tid på att interagera med ett socialt mål än med ett tomt målhölje, används ett interaktionsförhållande på 100 (lika mycket tid i interaktionszonen i närvaro mot frånvaro av ett socialt mål) som avbrott: möss med poäng <100 är märkta som "mottagliga" och de med poäng ≥100 som "motståndskraftiga". Omfattande beteendemässiga, biokemiska och elektrofysiologiska analyser stöder giltigheten av dessa distinkta mottagliga och elastiska delpopulationer (; ; ).

Tabell 1.  

Medelantal (± SEM) av FosB-immunoreaktiva kärnor per mm2 i hjärnområden av kontroll, mottagliga och fjädrande möss 24 h efter kronisk (10 d) social nederlagsspänning
Figur 1.  

ΔFosB induktion i mPFC främjar känslighet för stress. A, Representativa fotomikrografer av ΔFosB immunohistokemi i mPFC 24 h efter det sista av 10 sociala nederlagspisoderna. BInduktion av ΔFosB förekommer inte i GABAergic .

Strax efter det sociala interaktionsprovet bedövades möss och perfusionerades intrakardiellt med 4% paraformaldehyd / PBS. Cellantalet för ΔFosB+ neuroner i NAc utfördes som beskrivits tidigare (). Hjärnor var kryoprotekterade med 30% sackaros och koronala sektioner (30 ^ im) skars på en frysande mikrotom och behandlades för immunhistokemi. Frittflytande sektioner förinkuberades i en blockeringsbuffert innehållande 0.3% Triton och 3% normalt gettserum. ΔFosB detekterades med användning av kaninpolyklonala antikroppar upptagna mot den N-terminala delen av proteinet (1 / 1000 Santa Cruz Biotechnology, katalog # sc-48) i samma buffert, sedan behandlad med biotinylerade get anti-kanin-IgG-antikroppar och avidin-biotin peroxidas-komplex metod med DAB som ett substrat (Vector Laboratories). Diaminobenzidininkubationstiderna hölls konstanta för alla betingelser (100 s). Skivorna monterades, dehydrerades och täcktes. ΔFosB-immunopositiva celler visade en specifik brunfärgning i kärnan och kvantifierades av en observatör blind för behandlingsbetingelserna med användning av ett mikroskop (20 × förstoring). Tre valda hjärnsektioner som spänner över varje hjärnområde valdes per mus för kvantifiering. Anatomisk segregering av varje hjärnregion utfördes genom att jämföra sektionen med Paxinos mus hjärnatlaset. Villkor för immunhistokemi optimerades för att reducera bakgrundsnivåerna till ett minimum vilket möjliggjorde korrekt identifiering av FFB-positiva celler. Medelvärdena beräknades för varje djur och betraktades som en individuell observation för statistisk analys. Även om antikroppen som används känner igen både ΔFosB och full längd FosB, vet vi genom Western blotting att endast ΔFosB är detekterbart under de undersökta förhållandena (; ).

Experiment 2: identifiering av social stressinducerad ΔFosB neuronal fenotyp i mPFC.

För att undersöka uttryck av ΔFosB i kortikala GABAerga neuroner, använde vi vävnader från GAD2-tdTomato-möss utsatta för kronisk social nederlagsspänning och färgad för FFosB såsom beskrivits ovan (se Fig 1B). Möss genererades genom avelknopp GAD2-Cre-möss (Gad2tm2 (cre) Zjh / J; JAX-stamnummer 010802) () med (B6.Cg-Gt (ROSA) 26Sortm9 (CAG-tdTomato) Hze / J; JAX-nummer 007908) som har Flox-Stop-kontrollerad tdTomato (RFP-variant).

Experiment 3: beteendeeffekter av ΔFosB-överuttryck i prelimbisk (PrL) och infralimbisk (IL) cortex.

Stereotaxisk kirurgi utfördes på vuxna manliga möss (8 veckor) för att injicera HSV-AFosB-GFP eller HSV-GFP i PrL- eller IL-regionerna av mPFC. I korthet anesteserades möss med användning av en blandning av ketamin (10 mg / kg) och xylazin (1 mg / kg) och följande stereotaxiska koordinater användes för virusavgivning för PrL: 1.8 mm (främre / bakre), 0.65 mm (lateral ), -2.2 mm (dorsal / ventral); och för IL: 1.9 mm (främre / bakre), 0.75 mm (lateral), -2.8 mm (dorsal / ventral) vid en vinkel av 10 ° från mittlinjen (i förhållande till bregma). Totalt 0.5 pl av renat virus levererades bilateralt över en 5 min-period (0.1 μl / min) följt av 5 min vilo. Virala injektionsställen bekräftades med användning av standardhistologiska metoder (se Fig 1C). Även om det inte är möjligt att selektivt rikta PrL mot IL i möss med perfekt noggrannhet, kommer data i Figur 1C illustrera att det är mycket möjligt att överväga främst en region eller den andra. Faktum är att de distinkta beteendeeffekterna som erhållits genom inriktning på de två regionerna (se resultat) underbygger detta tillvägagångssätt. Den första gruppen möss användes exklusivt i ett submaximalt socialt nederlagsexperiment (se Fig 1D). Tre dagar efter operationen utsattes möss för två på varandra följande nederlag samma dag och testades därefter för social interaktion 24 h senare. Denna submaximal nederlagsprocedur har tidigare validerats för att avslöja fenusprocesser efter fenomenen efter genetiska manipuleringar (; ).

En andra sats möss användes för att testa för basal ångest- och depressiv-liknande beteenden (se Fig 1E-J). En dag efter operationen möttes möss med en 1% (vikt / volym) sackaroslösning. Följande dag kunde möss välja mellan en vattenflaska och en 1% sackaroslösningsflaska som byttes dagligen. Sackaroslösning för 24 h uppmättes under den fjärde och femte dagen efter operationen och uttrycktes som en procentandel av den totala mängden vätska som intagits. Möss testades i öppen fält (dag 3), förhöjd plus labyrint (dag 4), social interaktion (dag 5 morgon) och tvingad simning (dag 5 eftermiddag) tester baserat på publicerade protokoll (). Vi har funnit att, med denna testordning, resultat på efterföljande test inte påverkas av tidigare (). Aktiviteten hos möss i det öppna fältet registrerades för 5 min med ett videotrackningssystem (Ethovision) under röda ljusförhållanden. Den förhöjda plus labyrinten bestod av två raka korsningsbanor placerade 60 cm ovanför golvet och uppdelad i två öppna och två slutna armar. Möss placerades individuellt i mitten av labyrinten och fick fritt utforska varje arm i en period av 5 min. I de öppna och fria plus-labyrinten användes tid i respektive centrum och öppna armar som ett inverst index av ångestrelaterade svar. Ett enstaka tvångstest utfördes under en period av 5 min. Ökad immobilitetstid under det tvångsvimmade testet tolkades som ett prodepressionsliknande beteende. Detta 1-dagstest har använts i stor utsträckning hos möss och validerats som ett mått på prediktiv validitet, eftersom antidepressiva läkemedel minskar immobilitetstider.

Slutligen injicerades en separat grupp möss intra-mOFC med HSV-FosB och testades för social interaktion efter ett submaximal nederlag (se Fig 1K).

HSV-vektorer erhölls från Rachael Neve (Massachusetts Institute of Technology). Generna av intresse (ΔFosB och GFP) är under en CMV-promotor. Dessa vektorer har i hög grad validerats i tidigare publikationer (t.ex. ).

Experiment 4: effekter av kronisk social stress på CCKB-receptornivåer i mPFC.

Vid 24 h efter det sociala interaktionsprovet togs hjärnorna snabbt bort och serieklippades, och mPFC dissocierades snabbt och frystes på torris (se Fig 2A,B). RNA-isolering, qPCR och dataanalys utfördes såsom beskrivits tidigare (; ). RNA isolerades med TriZol-reagens (Invitrogen) och renades ytterligare med RNAeasy-mikrosatser från QIAGEN. Alla RNA-prover bestämdes att ha 260 / 280- och 260 / 230-värden ≥1.8. Omvänd transkription utfördes med användning av iScript (Bio-Rad). qPCR med användning av SYBR Green (Quanta) utfördes med ett Applied Biosystems 7900HT RT PCR-system med följande cykelparametrar: 2 min vid 95 ° C; 40-cykler av 95 ° C för 15 s, 59 ° C för 30 s och 72 ° C för 33 s; och graderad uppvärmning till 95 ° C för att generera dissociationskurvor för bekräftelse av enskilda PCR-produkter. Data analyserades genom att jämföra Ct värden av behandlingsförhållandet (mottagligt eller fjädrande mot kontrollmöss eller HSV-FosB vs HSV-GFP) med AACt metod (). qPCR-primers är följande: ΔFosB, framåt, AGGCAGAGCTGGAGTCGGAGAT och omvänd, GCCGAGGACTTGAACTTCACTCG; CCKB, framåt, ACCCTTTATGCGGTGATCTTTC och omvänd, ATGAGCACGTTTCCGCCAA; CCK, framåt, AGCGCGATACATCCAGCAG och omvänd, ACGATGGGTATTCGTAGTCCTC; GAPDH, framåt, AGGTCGGTGTGAACGGATTTG och omvänd, TGTAGACCATGTAGTTGAGGTCA.

Figur 2.  

Blockad av CCKB-receptorn har en proresilience, antidepressiv-liknande effekt. A, Socialt nederlag minskar CCKB-receptornivåer i mPFC endast i fjädrande möss (n = 8-10). *p <0.05, jämfört med kontroll (enkelriktad ANOVA). **p <0.05 .
Experiment 5: effekter av ΔFosB på CCKB-receptor och cFos nivåer.

Möss injicerades intra-PrL med HSV-AFosB. Vid 72 h efter operationen, vid toppen av virusöveruttryck, dissekerades injektionsställen under ett fluorescerande mikroskop (se Fig 2C). RNA-isolering, qPCR och dataanalys utfördes såsom beskrivits ovan. qPCR-primers är följande: c-fos, framåt, AATCCGAAGGGAACGGAATAAGA och omvänd, TGCAACGCAGACTTCTCATCT.

Experiment 6: effekter av ΔFosB-blockad på stressinducerad CCKB-receptornivåer och motståndskraft.

Vuxna möss injicerades bilateralt med HSV-GFP eller HSV-AJunD till PrL (se Fig 2D-F). ΔJunD är en N-terminal trunkerad mutant av JunD som verkar som en dominant-negativ antagonist av FFosB. Möss utsattes för social nederlag två gånger dagligen för 5 d. Detta accelererade sociala nederlagsprotokoll, förkortat att sammanfalla med perioden med maximalt HSV-transgenuttryck, har tidigare använts och visat sig framkalla maximal nivå av social undvikning (). Vid 24 timmar efter den senaste stressepisoden halshöggades möss utan anestesi för att undvika effekter av anestetika på neuronal proteinnivåer. Infekterad vävnad avlägsnades i PBS-innehållande proteas (Roche) och fosfatas (Sigma-Aldrich) -inhibitorer med användning av en 15 gauge stans och frystes omedelbart på torris. Prover homogeniserades genom lätt ultraljudsbehandling i modifierad RIPA-buffert: 10 mm Tris-bas, 150 mm natriumklorid, 1 mm EDTA, 0.1% SDS, 1% Triton X-100, 1% natriumdeoxikolat, pH 7.4 och proteas- och fosfatashämmare som ovan. Efter tillsats av Laemmlis buffert separerades proteiner på 4-15% polyakrylamaidgradientgeler (Criterion System; Bio-Rad) och Western-blotting utfördes med Odyssey-systemet (Li-Cor) enligt tillverkarens protokoll. Membran torkades med CCKB-receptorantikropp (1/1000, Acris, katalog nr AP01421PU-N). En annan grupp möss injicerades med AAV-ΔJunD eller AAV-GFP i PrL och sedan, 5 veckor efter operationen för att möjliggöra maximal transgenuttryck, underkastades mössen det submaximala nederlagsprotokollet. De testades för social interaktion 24 timmar efter det senaste nederlaget.

Experiment 7: effekter av intra-mPFC CI-988, en CCKB-antagonist, på social stressinducerad social undvikning och anhedoni.

Bilateral kanyl (1.0 mm kanyl till kanylavstånd, 1.8 mm främre, injektor -2.2 mm dorsal / ventral) riktade mPFC implanterades i mottagliga möss (se Fig 2G,H). En vecka efter operationen injicerades 10 ng av CI-988 direkt i mPFC, riktade primärt PrL. Möss testades sedan för deras sociala interaktionsbeteende. Sackarospreferensen mättes för återstående 24 h. CI-988 (Tocris Bioscience) löstes i saltlösning, alikvoterades och frystes. Slutlig utspädning bereddes på experimentens dag. Ett ytterligare experiment utfördes i mottagliga möss med CI-988 administrerad intraperitonealt (2 mg / kg) 30 min före socialt interaktionstest.

Experiment 8: effekter av CCKB-agonist på mottaglighet för social stress och reversering genom optogenisk stimulering av mPFC-projektioner till BLA eller NAc.

AAV-CaMKII-ChR2-EYFP eller AAV-CaMKII-EYFP injicerades i rätt mPFC, som återigen inriktades primärt PrL (se Fig 3A-G). Fem veckor senare implanterades optiska fibrer i rätt NAc (1.4 anterior / posterior, 2.6 lateral, -4.7 dorsal / ventral i en vinkel av 25 ° från mittlinjen) eller BLA (-1.6 anterior / posterior, 3.1 lateral, -4.7 dorsal / ventral utan vinkel från mittlinjen). Under samma kirurgiska ingrepp implanterades bilateral kanyl i mPFC (se ovan). Kanyler och fibrer fästes i skallen med dentalcement. Möss fick sedan 1-veckan att återhämta sig före starten av beteendexperimenten. Möss utsattes för submaximal nederlag, sedan testade 24 h senare för social interaktion, direkt följd av förhöjd plus labyrint och för sackarospreferens för återstående 24 h. Vid 30 min före testet för social interaktion infuerades hälften av mössen med CCK-8 (10 ng) i mPFC medan den andra hälften mottog vehikel (saltlösning). Möss testades i par (en vehikel- och en CCK-8-behandlad mus, med AAV-GFP eller AAV-ChR2). CCK-8 (Sigma) löstes i saltlösning, alikvoterades och frystes. Slutlig utspädning bereddes experimentens dag.

Figur 3.  

CCK-8-inducerad stresskänslighet beror på specifika kortikala prognoser. AVid 24 h efter submaximal social nederlag och 30 min efter CCK-8 infusion, mPFC projektionsregioner laserstimulerades under ett test för social interaktion. CCK-8-infusion .

Optiska stimuleringar utfördes enligt publicerade protokoll (). Optiska fibrer (Thor Laboratories) implanterades kroniskt och kopplades via en FC / PC-adapter till en 473 nm-blålaserdiod (Crystal Lasers, BCL-473-050-M). En stimulator (Agilent, #33220A) användes för att generera blå ljuspulser. Under alla stimulanser levererades 40 ms-burst av 100 Hz (9.9 ms spikbredd) blå ljuspulser varje 3 s till terminalregioner i BLA eller NAc under tiden för det sociala interaktionstestet, för att efterlikna ett bristliknande mönster av cortikala aktivitet. Intensiteten hos optikfiberljuset verifierades före varje användning, med användning av en ljussensor (Thor Laboratories, S130A) och ljusintensiteten var ~15 mW. Detta stimuleringsprotokoll, vilket validerades elektrofysiologiskt tidigare () inducerade inte anfall baserat på beteendeobservationer och frånvaron av c-Fos-uttryck utanför optogenetiskt stimulerade regioner ().

Experiment 9: effekter av CCKB-agonist på mPFC-neuronaktivitet, mätt med c-Fos-mRNA-nivåer.

Bilaterala kanyler implanterades på vuxna möss riktade mot mPFC (se Fig 3H). Efter en veckors vila utsattes möss för submaximal nederlag och infunderades med CCK-8 24 h senare. mPFC-stansar togs 30 min efter läkemedelsinfusionen och prover beredda för mRNA-analys som beskrivits ovan.

Djurhus.

Åtta veckor gamla C57BL / 6J manliga möss (The Jackson Laboratory) användes. Alla möss habituerade till djuranläggningen under minst 1 vecka före experimentella manipuleringar och hölls vid 23 ° C-25 ° C i en 12 h ljus / mörk cykel (lyser vid 7: 00 AM) med AD libitum tillgång till mat och vatten. Experiment utfördes i enlighet med riktlinjerna för Society for Neuroscience och den institutionella Animal Care and Use Committee vid Icahn School of Medicine på Mount Sinai.

Statistiska analyser.

Data som visas är uttryckt som medelvärde ± SEM (representerad som felstänger). Envägs ANOVAs användes för att jämföra medel mellan kontroll, mottagliga och fjädrande möss i immunhistokemiska, biokemiska och beteendeanalyser. Envägs-ANOVA-värden användes för att jämföra medel mellan GFP-kontroller och ΔFosB-överuttryck i PrL eller IL i öppet fält, förhöjt plus labyrint, tvångsvimning och sackarospreferenstest. Tvåvägs ANOVAs användes för att jämföra medel mellan GFP-kontroller, ΔFosB-PrL och FosB-IL i socialt interaktionstestet. Tvåvägs ANOVAs användes för att jämföra CCK-8-effekter med eller utan optogenisk stimulering i alla beteendexperiment, liksom effekten av ΔFosB-överuttryck eller CI-988-infusion vid social undvikning. När det passar, post hoc analyser utfördes med användning av en Bonferroni post hoc testa. Studentens t tester användes för att jämföra medel för effekten av CI-988-infusion på sackarospreferens och tvångsundersökningar och av CCK-8 på c-Fos mRNA-nivåer. Skillnader mellan experimentella förhållanden ansågs statistiskt signifikanta när p ≤ 0.05.

Resultat

Hjärnomfattande kartläggning av ΔFosB induktion genom kronisk social nederlagsspänning

Vi undersökte först ΔFosB-induktion genom immunhistokemi i kontroll, mottagliga och fjädrande möss efter en kronisk (10 d) social nederlagsspänning, med fokus på förehjärn- och midbrainregioner som tidigare var inblandade i stressresponser. Djur analyserades 24 h efter det sista nederlagssegmentet. Kronisk social stress inducerar ΔFosB i många hjärnområden med distinkta mönster observerade mellan fjädrande och mottagliga möss. Som visas i Tabell 1 och Figur 1A, IL, BLA, dentate gyrus av hippocampus, dorsalstriatum och NAc-kärna visade preferentiell aktivering i fjädrande möss; Sådana resultat i NAc överensstämmer med publicerade resultat (). I slående kontrast visade mottagliga möss större induktion i PrL, lateral septum och bed-kärnan av stria terminalis. Flera hjärnregioner visade jämförbar FFosB-induktion i mottagliga och fjädrande möss; Dessa inkluderade orbitofrontal cortex (OFC, ett annat område av PFC), NAc-skal, dorsal raphé och periaqueducal grå (PAG).

För att identifiera den neuronala subtyp som uppvisar FFB-induktion i kortikala regioner utsattes GAD2-tdTomato-möss för kronisk social nederlagsspänning. ΔFosB immunreaktivitet hos mottagliga möss var odetekterbar i GABAerga neuroner (Fig 1B), vilket bekräftar tidigare fynd av specifik induktion av FFosB i kortikala pyramidala neuroner efter andra former av kronisk stress (). I icke nedsläckta kontrollmöss, baslinjen ΔFosB-nivåer över hjärnområdena var liknande de som rapporterats i tidigare studier (, ) med mycket högre basala nivåer i NAc och dorsalstriatum jämfört med någon annan region, med det enda undantaget för dentat gyrus, vilka visade nivåer jämförbara med de i striatala regionerna (Tabell 1).

ΔFosB i mPFC främjar känslighet för stress

För att följa upp dessa fynd fokuserade vi på PrL eftersom vi tidigare visat att optogenetisk aktivering av denna region utövade antidepressiva effekter i det sociala nederlagsparadigmet (). För att testa de funktionella följderna av ΔFosB induktion i denna hjärnregion överuttryckte vi viralt ΔFosB i PrL av kontrollmöss (Fig 1C) och utsattes för en submaximal kurs av social nederlagsspänning, vilket inte medför social undvikning hos normala djur. Möss som överuttryckte ΔFosB i PrL var mer mottagliga för social nederlag än GFP-injicerade kontrollmöss genom att de visade social undvikningsbeteende efter submaximal social nederlag (interaktion, F(2,38) = 2.847, p > 0.05, huvudeffekt av virus, F(2,38) = 6.013, p <0.05; Bonferroni posttest t = 2.447, p <0.05) (Fig 1D). Dessa möss visade också ökad immobilitet i ett 1-dygnstvingat prov (F(2,31) = 6.448, p <0.05; Bonferroni posttest t = 3.518, p <0.05) (Fig 1E), en motsats mot den som produceras av antidepressiva läkemedel. I motsats härmed förändrade ΔFosB-överuttryck i PrL inte flera baslinjeåtgärder av ångestliknande beteende, sackarospreferens, social interaktion eller lokomotorisk aktivitet (Fig 1F-J). Tillsammans stöder dessa fynd hypotesen att den selektiva induceringen av ΔFosB i PrL av mottagliga möss bidrar till sårbarhet mot stress och dess skadliga konsekvenser. I motsats till detta hade ΔFosB-överuttryck i en annan region av mPFC, IL, ingen effekt på baslinjens emotionella beteenden eller på svar på social nederlagsspänning (Fig 1D-J), medan ΔFosB-överuttryck i medial OFC trenderade mot att främja motståndskraft mot kroniskt socialt nederlag, även om denna effekt inte nått statistisk signifikans (interaktion, F(1,31) = 1.741, p > 0.05, huvudeffekt av interaktionstid, F(1,31) = 14.170, p <0.05; Bonferroni posttest t = 3.860, p <0.05 inom GFP-gruppen; t = 1.960, p <0.05 inom ΔFosB-gruppen; effekt av virus, t = 2.447, p <0.05) (Fig 1K).

ΔFosB främjar CCKB induktion i mPFC

En stor del av bevisen stöder tanken att CCK, en riklig neuropeptid i hjärnan, spelar en viktig roll i neurobiologiska mekanismer av stress och ångest (). I synnerhet är frisättning av CCK i mPFC under social stress hos råttor associerad med ångestrelaterade beteenden (). Trots att CCK: s involvering i mänsklig depression fortfarande är oklart pekar nya bevis på sin roll i socialt nederlagsinducerat depressionliknande beteende hos råttor (). Vi förmodade sålunda att förändringar i CCK eller dess CCKB-nivåer (även känd som CCK2) -receptor i mPFC kan bidra till skillnader mellan mottagliga och fjädrande möss. Vid 48 h efter den slutliga nederlagssekvensen minskade CCKB-mRNA-nivåerna i mPFC endast av fjädrande möss (F(2,18) = 8.084, p <0.01; Bonferroni posttest, t = 3.104, p <0.05 kontra kontroll; t = 5.113, p <0.01 mot känslig) (Fig 2A). Ingen skillnad observerades i CCK-mRNA-nivåer i antingen mottagliga eller fjädrande möss (data ej visade). Vi observerade en ökning av ΔFosB mRNA-nivåer endast i mottagliga möss som överensstämmer med de ovan angivna proteindata (F(2,18) = 5.246, p <0.01; Bonferroni posttest t = 3.336, p <0.05 mot känslig; t testa t(12) = 2.138, p <0.05 mot kontroll) (Fig 2B). Eftersom ΔFosB reglerar transkriptionen av flera gener (; ), ansåg vi möjligheten att det skulle kunna reglera CCKB mRNA-uttryck. För att ta itu med denna fråga överprövade vi först ΔFosB i PrL och fann att denna manipulation uppregulerar CCKB mRNA-nivåer i denna region (t(12) = 2.012, p <0.05 mot GFP) (Fig 2C). Intressant, vi hittade också en minskning i c-Fos mRNA-nivåer efter ΔFosB-överuttryckning (t(11) = 3.382, p <0.01) (Fig 2C). TDessa fynd föreslår vidare att ΔFosB-induktion i PrL av mottagliga möss är en aktiv mottagningsmekanism genom att förhindra undertryckandet av CCKB ses i fjädrande möss.

För att ytterligare stärka dessa observationer överskattade vi ΔJunD, en ΔFosB bindande partner som saknar sin transaktiveringsdomän och därmed verkar som en dominant negativ antagonist och bestämde dess effekt på stressinducerat CCKB-uttryck. Vi bekräftade att kronisk social nederlag stress ökade CCKB protein nivåer i PrL av mottagliga möss (t testa t(12) = 2.289, p <0.05 mot kontroll) (Fig 2D,E). Dessutom var sådan induktion fullständigt blockerad av AJunD-överuttryck i denna region (F(2,20) = 6.306, p <0.01, Bonferroni-posttest t = 3.615, p <0.01) (Fig 2D,E), som stöder hypotesen att ΔFosB medierar stressinducerat CCKB-uttryck. Vidare främjar blockad av ΔFosB-aktivitet i PrL, via lokalt ΔJunD-uttryck, även motståndskraft för att besegra stress (t testa t(16) = 2.114, p = 0.05 vs kontroll) (Fig 2F). Mekanismen som ligger till grund för nedreglering av CCKB i fjädrande möss återstår att belysas.

CCKB: s roll i motståndskraft och känslighet för stress

För att direkt testa rollen av CCKB-reglering i PrL för att förmedla mottaglighet mot motståndskraft, infuserade vi den selektiva CCKB-receptorantagonisten CI-988 (10 ng) direkt i denna hjärnområde av mottagliga möss. CI-988 antagoniserar effektivt CCKB-receptorer in vivo- eftersom den uppvisar nanomolär affinitet och hög selektivitet för CCKB-receptorsubtypen (). Blockad av CCKB-aktivitet ökade starkt social interaktion (Fig 2G) (interaktion, F(1,20) = 7.795, p <0.05; läkemedel F(1,20) = 5.38, p <0.05, Bonferroni-posttest t = 3.615, p <0.01). CI-988-infusion reverserade också underskottet i sackarospreferens som observerades hos mottagliga möss (t(8) = 2.681, p <0.05) (Fig 2H). Båda beteendemässiga resultaten indikerar att blockad av CCK-verkan i PrL utövar potenta antidepressiva-liknande effekter. Intressant, när det administrerades intraperitonealt, var CI-988 ineffektivt vid reversering av social undvikning (data ej visad).

För att testa den motsatta kan den aktiveringen av CCKB i PrL förmedla den sociala undvikningen och minskad sackarospreferens inducerad av kronisk social nederlagsspänning, vi undersökte effekten av lokal infusion av CCK-8 (10 ng), den dominerande formen av CCK i hjärnan , på depression och ångestrelaterade beteenden. Dosen av läkemedlet valdes baserat på tidigare resultat i litteraturen (; ; ). Möss utsattes för submaximal social nederlagsspänning 24 h före beteendestestning (Fig 3A). CCK-8, infunderad 30 min före testning, var tillräcklig för att inducera social undvikande i det sociala interaktionstestet samt en minskning av tiden som spenderas i de öppna armarna i den förhöjda plus labyrinten (SI: BLA, interaktion, F(1,22) = 0.79, p > 0.05; huvudeffekt av läkemedel, F(1,22) = 11.75, p <0.05; Bonferroni posttest t = 2.957, p <0.05; NAc: interaktion, F(1,26) = 6.688, p <0.05, Bonferroni-posttest t = 2.816, p <0.05; EPM: BLA, interaktion, F(1,22) = 8.0, p <0.01; Bonferroni posttest t = 2.509, p <0.05 läkemedelseffekt; t = 2.528, p <0.05 viruseffekt; NAc, t testa t(17) = 1.961; p <0.05 läkemedelseffekt inom eYFP-gruppen) (Fig 3VARA, vänster). Inga skillnader observerades vid sackarospreferens (Fig 3F,G, vänster). Slutligen hade CCK-8-infusion ingen effekt på beteendet (social interaktion och förhöjd plus labyrint) hos naiva icke-utsatta möss i dessa analyser (data ej visade). TDessa resultat visar att den ΔFosB-medierade ökningen i CCKB-aktivitet i PrL av mottagliga möss, jämfört med fjädrande möss, bidrar till några av de stressinducerade beteendeunderskotten som uppvisas av dessa djur.

Blockad av CCK-inducerad känslighet mot stress genom aktivering av kortikala prognoser mot BLA kontra NAc

Minskad mPFC-neural aktivitet korrelerar med depressionliknande beteenden hos möss, med optogenisk stimulering av mPFC-neuroner av mottagliga mössproducerande antidepressiva-liknande effekter (). Vi förmodade sålunda att CCK skulle kunna fungera i PrL genom att hämma neuronaktivitet och därigenom orsaka depressionliknande beteende. I överensstämmelse med denna hypotes upplevde vi en minskning i c-Fos mRNA-nivåer i PrL som svar på CCK-infusion i denna hjärnområde (t(13) = 2.235, p <0.05) (Fig 3H).

Vi förutsåg att den optogeniska stimuleringen av mPFC utövar dess antidepressiva åtgärder genom att motverka effekterna av CCK på neuronaktivitet. Vid testning av denna hypotes undersökte vi de subkortiska strukturerna som medierar CCKs anxiogena och propresionsliknande effekter. Pyramidala neuroner i mPFC-projektet sträcker sig kraftigt mot NAc och BLA, två limbiska strukturer som är inblandade i beteendemässiga reaktioner på stress. Ändrad aktivitet hos båda hjärnregionerna har visat sig spela en väsentlig roll vid uttryck av ångest- och depressionliknande beteende (; ). Vi testade därför huruvida stimulering av glutamatergiska utsprång från PrL till NAc eller till BLA skulle motverka de skadliga effekterna av CCK-mikroinfusion i PrL (Fig 3A). Vi injicerade AAV-CaMKII-ChR2-EYFP eller AAV-CaMKII-EYFP som en kontroll i PrL. CaMKII-promotorn är känd för att rikta viralt uttryck på glutamatergiska pyramidala neuroner i kortikala regioner. Vi fick sedan tillräckligt med tid (6 veckor) för transgenerna att transporteras till nervterminalerna för dessa pyramidala neuroner i NAc och BLA (Fig 3I). Möss fick submaximal social nederlag; 24 h senare infiltrerade vi CCK-8 till PrL och, 30 min efter det, mättes social interaktion under optogenisk stimulering av glutamatergiska terminaler i NAc eller BLA. Omedelbart efter det sociala interaktionstestet utvärderades möss i den förhöjda plus labyrinten för att bedöma ångestrelaterat beteende och sedan för sackarospreferens för att bedöma anedoni.

Optogenetisk stimulering av PrL glutamatergiska projicer till NAc reverserade fullständigt den sociala undvikningen inducerad av intra-PrL CCK-8 (interaktion, F(1,26) = 6.688, p <0.05, ingen läkemedelseffekt i ChR2-gruppen) (Fig 3C). I motsats härtill hade sådan PrL till NAc-stimulering ingen effekt på ångestliknande beteende som mätt i den förhöjda plus labyrinten (Fig 3E); emellertid ökade sådan stimulering av sackarospreferensen jämfört med ostimulerade möss (interaktion, F(1,20) = 5.77, p <0.05; Bonferroni posttest t = 2.998, p <0.05 stimuleringseffekt hos CCK-8-behandlade djur) (Fig 3G).

Ett mycket annat beteendemönster ses med optogenetisk stimulering av PrL glutamatergiska projiceringar till BLA. Sådan stimulering hindrade inte den sociala undvikningen inducerad genom intra-PrL CCK-8-infusion (interaktion, F(1,22) = 0.79, p > 0.05; huvudeffekt av läkemedel, F(1,22) = 11.75, p <0.05; ingen effekt i stimulerad grupp, t testa t(12) = 2.054, p <0.05) (Fig 3B). Stimulering av BLA-afferenter utövade emellertid en anxiolytiskliknande effekt som indikeras av ökad tid som spenderades i de öppna armarna hos den förhöjda plus labyrinten (interaktion, F(1,22) = 8.0, p <0.01; Bonferroni posttest t = 2.528, p <0.05 viruseffekt inom CCK-8-behandlade grupper) (Fig 3D). Stimulering av glutamatergiska projiceringar mot BLA hade ingen signifikant effekt på sackarospreferensen (interaktion, F(1,22) = 2.08, p > 0.05) (Fig 3F).

Diskussion

Resultaten av föreliggande studie visar på molekylära anpassningar som förekommer i PrL som ligger till grund för känslighet för social stress. Vi visar induktion av ΔFosB i detta mPFC-subregion efter kronisk social nederlagsspänning, där ΔFosB-överuttryckning främjar stresskänslighet. Vi identifierade CCKB-receptorn som en målgen som regleras av FFosB i PrL, vilket tydligen inducerar CCKB-protein i mottagliga möss och förhindrar nedreglering av CCKB-uttryck som sker selektivt i fjädrande möss. Vi visade vidare att infusion av en CCK-agonist i PrL främjar depressions- och ångestliknande beteendeavvikelser som svar på social stress, medan blockering av CCKB-receptoraktivitet i denna region av mottagliga möss blockerar dessa effekter. Vi använde därefter optogenetiska verktyg för att identifiera mikrokretsloppet involverat i proanxiety-vs prodepressionsliknande åtgärder hos CCK i PrL. Även om cortico-NAc-glutamatergiska prognoser medger belöningsunderskott som framgår av social undvikning och minskad sackarospreferens, påverkar denna mikrokrets inte de anxiogena effekterna av CCK infunderad i PrL. Omvänt medierar kortikala prognoser mot BLA manifestationen av ångestrelaterade beteenden men har ingen inverkan på sociala stressinducerade sociala undvikande eller sackarospreferensunderskott. Tillsammans visar dessa data att förändringar i PrL-funktionen efter kronisk social nederlagspress medierar många beteendeunderskott via specifika subkortiska prognoser.

ΔFosB: kartläggning av ett limbiskt stressnätverk och roll i mPFC

ΔFosB immunhistokemi identifierar neuroner som påverkas av kronisk stress med encellsupplösning och har använts för kartläggning av spänningsreglerad neuronkrets (; ; ). Vi använde denna metod för att visa att kronisk social nederlagsspänning inducerar ΔFosB i flera hjärnområden med olika mönster mellan fjädrande och mottagliga grupper, med vissa regioner som endast visar induktion i fjädrande möss, andra endast hos mottagliga möss och fortfarande andra under båda förhållandena (Tabell 1). Tidigare arbete visade att ΔFosB induktion i NAc eller ventral PAG främjar motståndskraft mot kronisk stress och bidrar till antidepressiva reaktioner (; ).

Induktion av ΔFosB i PrL av mottagliga möss, i kombination med tidigare upptäckter att optogenetisk stimulering av denna region utövar antidepressiva effekter (), uppmanade oss att studera påverkan av ΔFosB i denna kortikala region. Tvärt emot fynd i NAc och ventral PAG fann vi att ΔFosB i PrL främjar mottaglighet för kronisk social nederlagsspänning och producerar en prodepressionsliknande effekt i det tvångsvimmade testet, utan att påverka angstliknande beteende eller sackarospreferens. I motsats till PrL fann vi ingen effekt av ΔFosB-överuttryck i den närliggande IL. En ny studie visade förhöjda nivåer av FFosB i IL i fjädrande möss och medförde detta subregion i motståndskraft mot social stress (). Vidare behövs ytterligare studier för att åtgärda differentierade roller för dessa två mPFC-subregioner, vilka har visat sig producera motsatta effekter i andra beteendemässiga domäner (; ; ). Vi rapporterade tidigare att deprimerade människor uppvisar lägre nivåer av ΔFosB i NAc-undersökt postmortem (), whäri högre nivåer av ΔFosB har visats i dorsolateral PFC (Brodmann area 46) hos deprimerade människor (). Andra kortikala regioner undersöktes inte i den senare studien. Under alla omständigheter stödjer dessa fynd tillsammans regionspecifika abnormiteter i ΔFosB-uttryck vid human depression, där transkriptionsfaktorn utövar väldigt olika effekter på stressproblem. Det skulle vara intressant i framtida studier för att undersöka påverkan av ΔFosB i många andra hjärnregioner där det induceras (Tabell 1) på stressresponser.

En mekanism genom vilken ΔFosB-induktion i PrL kan bidra till depressionliknande beteende är via undertryckning av PrL-aktivitet. ΔFosB har visat sig undertrycka AMPA glutamatreaktioner, och c-Fos uttryck i NAc-medium snygga neuroner (; ; ). På samma sätt fann vi en minskning i c-Fos uttryck efter ΔFosB-överuttryck i PrL. Således kan ΔFosB-induktion i PrL vara ansvarig för reducerad neuronaktivitet som ses i denna region efter kronisk social nederlagsspänning. Sådan minskad ton av PrL över dess subkortiska mål, såsom BLA och NAc, skulle förväntas öka rädslets uttryck och oförmågan att släcka känslomässiga respons på stress (, ). Dessutom inducerar mPFC-lesioner sensibiliserade stressresponser och underskott i rädslautrotning (; ; ; ), vilket tyder på att stress-inducerad försämring av mPFC, som medieras delvis via FFB-induktion, kan bidra till depression och andra stressrelaterade störningar ().

CCK: s roll i stressproblem

Vi ger bevis för att CCKB-receptorn är ett mål för ΔFosB, så att ΔFosB-induktion i PrL av mottagliga möss bara är en mekanism genom vilken ΔFosB utövar sina prodepressionsliknande effekter i denna region. Trots att CCK: s specifika åtgärder i mPFC-kretsar är oklara, är gnagare CCK lokaliserad inom GABAergic interneurons (). Det anses att undertrycka aktiviteten hos kortikala pyramidala neuroner genom att förbättra lokal GABA-frisättning och verkande direkt på CCKB-receptorer uttryckta av pyramidala neuroner (; ; ; ). Således kan CCKergic neurotransmission bidra till den reducerade PrL-aktiviteten som noterats ovan.

CCK är ett anxiogent medel, med systemisk administrering av CCKB-agonister som inducerar panikattacker hos friska frivilliga. Patienter som är predisponerade för panikattacker blir överkänsliga efter CCK-exponering (; ). Flera studier har bekräftat CCK: s ångestdämpande effekter hos gnagare (). CCK-frisättning i mPFC under nederlagsspänning hos råttor är associerad med ångestrelaterade beteenden (); PrL och IL delregioner differentierades inte i denna studie. Mer sistnämnd utövade systemisk, kronisk blockad av CCKB med CI-988 antidepressiva-liknande effekter hos råtta (). CI-988 normaliserad immobilitetstid i tvångsvattentestet. Det förhindrade också hypotalamisk-hypofys-adrenal axel-hyperaktivitet, minskad hippocampalvolym och cellproliferation och minskad sackarospreferens som normalt framkallas av socialt nederlag. Här bekräftar vi dessa resultat genom att visa en antidepressiv-liknande effekt av CI-988 infunderad i PrL av mottagliga möss, fastän en enda systemisk injektion inte efterliknade denna effekt.

Förutom CCK: s akuta åtgärder i PrL identifierade vi minskade nivåer av CCKB-mRNA i fjädrande möss, vilket kan vara en molekylär anpassning underliggande motståndskraft. Faktum är att förändringar i CCKergic-tonen, specifikt CCKB-nivåer, utgör en viktig mekanism för uttryck av ångest. Transgena möss som överuttrycker CCKB i förekomst visar ökad ångest och rädslesvar (). Vår upptäckt av förändrade CCKB-nivåer mellan fjädrande och mottagliga möss kan bidra till de fenotypiska skillnaderna i ångest och depressivt beteende. Här demonstrerar vi PrL som ett kritiskt anatomiskt substrat för de ångestdämpande och prodepressiva effekterna av CCK i samband med social stress. Ändå är flera andra hjärnregioner involverade i CCK: s beteendemässiga handlingar, inklusive BLA, hippocampus, NAc och PAG (; ; ; ; ). Vi fann också en ökning av CCKB-proteinnivåer, men inte mRNA-nivåer, i mPFC hos mottagliga djur. Dessa resultat understryker att, även om mRNA-nivåer ofta korrelerar med proteinnivåer, är detta inte nödvändigtvis fallet ().

Våra optogenetiska experiment visar att ökad aktivitet av glutamatergiska utsprång från PrL till NAc eller BLA motverkar effekterna av CCK i PrL. Ytterligare studier behövs för att fastställa att denna effekt av optogenetisk stimulering medieras av samma PrL-neuroner som kontrolleras av CCK. Intressant är att våra data avslöjar olika roller hos dessa två mikrokretsar för att förmedla olika domäner av beteendeavvikelser. Cortico-NAc-projektionen kontrollerar anhedonia och belöning; Det faktum att det reglerar social undvikande bekräftar att detta symptom är mer avspegling av minskad motivation och belöning för socialt beteende och inte av ökad social ångest. Denna slutsats är förenlig med bensodiazepins oförmåga att korrigera denna abnormitet () och med den senaste demonstrationen att mPFC-stimulering av NAc ökar belöning och motivation för missbruksmissbruk (). I motsats härtill styr cortico-BLA-projektionen ångestrelaterade symptom, i överensstämmelse med en stor litteratur hos gnagare och människor (se ovan).

Sammanfattningsvis Resultaten av den föreliggande studien identifierar ett mönster av limbiska hjärnregioner som är inblandade i mottagliga och fjädrande djur och visar förändringar i PrL som främjar mottaglighet. Dessa förändringar involverar induktion av ΔFosB och dess induktion av CCKB-receptorn. I motsats härtill främjar blockad av CCK-åtgärder i PrL antidepressiva och anxiolytiska liknande effekter. Vi fastställer också de subkortiska målen för dessa kortikala pyramidala neuroner som medlar dessa åtgärder, med en cortico-NAc-krets som är väsentlig för depressionsrelaterade beteenden och en cortico-BLA-krets som är nödvändig för ångestrelaterade beteenden. Kliniska studier av CCKB-antagonister hos deprimerade patienter i 1990 gav inte lovande resultat. De föreliggande resultaten tyder på värdet av att återvända den terapeutiska potentialen hos sådana medel i delmängder av patienter utsatta för höga stressnivåer.

fotnoter

 

Detta arbete stöddes av National Institute of Mental Health (EJN) och Brain & Behavior Research Foundation National Alliance for Research on Schizophrenia and Depression Young Investigator Award to VV

 

 

Författarna förklarar inga konkurrerande ekonomiska intressen.

 

referenser

  • Akirav I, Maroun M. Rollen av den mediala prefrontala cortex-amygdala-kretsen i stresseffekter vid utrotning av rädsla. Neural Plast. 2007; 2007: 30873. doi: 10.1155 / 2007 / 30873. [PMC gratis artikel] [PubMed] [Cross Ref]
  • Barbas H, Blatt GJ. Topografiskt specifika hippokampala projicer riktar sig på funktionellt tydliga prefrontala områden i rhesusapa. Hippocampus. 1995; 5: 511-533. doi: 10.1002 / hipo.450050604. [PubMed] [Cross Ref]
  • Becker C, Thièbot MH, Touitou Y, Hamon M, Cesselin F, Benoliel JJ. Förhöjda kortikala extracellulära nivåer av kolecystokininliknande material i en modell av förväntan på social nederlag i råttan. J Neurosci. 2001; 21: 262-269. [PubMed]
  • Becker C, Zeau B, Rivat C, Blugeot A, Hamon M, Benoliel JJ. Upprepad social nederlag-inducerad depressionliknande beteendemässiga och biologiska förändringar hos råttor: involvering av cholecystokinin. Mol psykiatri. 2008; 13: 1079-1092. doi: 10.1038 / sj.mp.4002097. [PubMed] [Cross Ref]
  • Belcheva I, Belcheva S, Petkov VV, Petkov VD. Asymmetri i beteendemässiga reaktioner på cholecystokinin mikroinjicerade i råttkärnan accumbens och amygdala. Neuro. 1994; 33: 995-1002. doi: 10.1016 / 0028-3908 (94) 90158-9. [PubMed] [Cross Ref]
  • Benoliel JJ, Bourgoin S, Mauborgne A, Pohl M, Legrand JC, Hamon M, Cesselin F. GABA, som verkar vid både GABAA- och GABAB-receptorer, inhiberar frisättningen av kolecystokininliknande material från råttryggmärgen in vitro. Brain Res. 1992; 590: 255-262. doi: 10.1016 / 0006-8993 (92) 91103-L. [PubMed] [Cross Ref]
  • Berton O, McClung CA, Dileone RJ, Krishnan V, Renthal W, Russo SJ, Graham D, Tsankova NM, Bolanos CA, Rios M, Monteggia LM, Self DW, Nestler EJ. BDNF: s viktig roll i den mesolimbiska dopaminvägen i social nederlagsspänning. Vetenskap. 2006; 311: 864-868. doi: 10.1126 / science.1120972. [PubMed] [Cross Ref]
  • Berton O, Covington HE, 3rd, Ebner K, Tsankova NM, Carle TL, Ulery P, Bhonsle A, Barrot M, Krishnan V, Singewald GM, Singewald N, Birnbaum S, Neve RL, Nestler EJ. Induktion av 5FosB i periaqueductalgrået genom stress främjar aktiva coping-svar. Nervcell. 2007; 55: 289-300. doi: 10.1016 / j.neuron.2007.06.033. [PubMed] [Cross Ref]
  • Bewernick BH, Hurlemann R, Matusch A, Kayser S, Grubert C, Hadrysiewicz B, Axmacher N, Lemke M, Cooper-Mahkorn D, Cohen MX, Brockmann H, Lenartz D, Sturm V, Schlaepfer TE. Nucleus accumbens djup hjärnstimulering minskar graden av depression och ångest i behandlingsresistent depression. Biolpsykiatri. 2010; 67: 110-116. doi: 10.1016 / j.biopsych.2009.09.013. [PubMed] [Cross Ref]
  • Bradwejn J, Koszycki D, Shriqui C. Förhöjd känslighet för cholecystokinintetrapeptid i panikstörning: kliniska och beteendefynd. Arch Gen Psychiatry. 1991; 48: 603-610. doi: 10.1001 / archpsyc.1991.01810310021005. [PubMed] [Cross Ref]
  • Bremner JD. Störmer stressen hjärnan? Biolpsykiatri. 1999; 45: 797-805. doi: 10.1016 / S0006-3223 (99) 00009-8. [PubMed] [Cross Ref]
  • Bremner JD. Traumatisk stress: effekter på hjärnan. Dialoger Clin Neurosci. 2006; 8: 445-461. [PMC gratis artikel] [PubMed]
  • Bremner JD. Neuroimaging i posttraumatisk stressstörning och andra stressrelaterade störningar. Neuroimaging Clin North Am. 2007; 17: 523-538. doi: 10.1016 / j.nic.2007.07.003. [PMC gratis artikel] [PubMed] [Cross Ref]
  • Britt JP, Benaliouad F, McDevitt RA, Stuber GD, Wise RA, Bonci A. Synaptisk och beteendemässig profil för flera glutamatergiska ingångar till kärnan accumbens. Nervcell. 2012; 76: 790-803. doi: 10.1016 / j.neuron.2012.09.040. [PMC gratis artikel] [PubMed] [Cross Ref]
  • Burgos-Robles A, Bravo-Rivera H, Quirk GJ. Prelimbiska och infralimbiska neuroner signalerar olika aspekter av appetitivt instrumentalt beteende. PLOS One. 2013; 8: e57575. doi: 10.1371 / journal.pone.0057575. [PMC gratis artikel] [PubMed] [Cross Ref]
  • Chen Q, Nakajima A, Meacham C, Tang YP. Förhöjd cholecystokininergisk ton utgör en viktig molekylär / neuron mekanism för uttryck av ångest i musen. Proc Natl Acad Sci USA A. 2006; 103: 3881-3886. doi: 10.1073 / pnas.0505407103. [PMC gratis artikel] [PubMed] [Cross Ref]
  • Choi DC, Gourley SL, Ressler KJ. Prelimbisk BDNF och TrkB-signalering reglerar konsolidering av både aptit och aversiv känslomässig inlärning. Transl Psychiatry. 2012; 2: e205. doi: 10.1038 / tp.2012.128. [PMC gratis artikel] [PubMed] [Cross Ref]
  • Christoffel DJ, Golden SA, Dumitriu D, Robison AJ, Janssen WG, Ahn HF, Krishnan V, Reyes CM, Han MH, Ables JL, Eisch AJ, Dietz DM, Ferguson D, Neve RL, Greengard P, Kim Y, Morrison JH , Russo SJ. IκB-kinas reglerar socialt nedbrytande stressinducerad synaptisk och beteendetsplasticitet. J Neurosci. 2011; 31: 314-321. doi: 10.1523 / JNEUROSCI.4763-10.2011. [PMC gratis artikel] [PubMed] [Cross Ref]
  • Covington HE, 3rd, Kikusui T, Goodhue J, Nikulina EM, Hammer RP, Jr, Miczek KA. Kort social nedslagspänning: långvariga effekter på kokain som tas under ett binge och zif268 mRNA uttryck i amygdala och prefrontal cortex. Neuropsychopharmacology. 2005; 30: 310-321. doi: 10.1038 / sj.npp.1300587. [PubMed] [Cross Ref]
  • Covington HE, 3rd, Lobo MK, Maze I, Vialou V, Hyman JM, Zaman S, LaPlant Q, Mouzon E, Ghose S, Tamminga CA, Neve RL, Deisseroth K, Nestler EJ. Antidepressiv effekt av optogenetisk stimulering av medial prefrontal cortex. J Neurosci. 2010; 30: 16082-16090. doi: 10.1523 / JNEUROSCI.1731-10.2010. [PMC gratis artikel] [PubMed] [Cross Ref]
  • Covington HE, 3rd, Maze I, Sun H, Bomze HM, DeMaio KD, Wu EY, Dietz DM, Lobo MK, Ghose S, Mouzon E, Neve RL, Tamminga CA, Nestler EJ. En roll för repressiv histon-metylering i kokain-inducerad sårbarhet mot stress. Nervcell. 2011; 71: 656-670. doi: 10.1016 / j.neuron.2011.06.007. [PMC gratis artikel] [PubMed] [Cross Ref]
  • de Montigny C. Cholecystokinin tetrapeptid inducerar panikliknande attacker hos friska frivilliga personer: preliminära fynd. Arch Gen Psychiatry. 1989; 46: 511-517. doi: 10.1001 / archpsyc.1989.01810060031006. [PubMed] [Cross Ref]
  • De Witte P, Heidbreder C, Roques B, Vanderhaeghen JJ. Motsvarande effekter av cholecystokininkatapeptid (CCK-8) och tetrapeptid (CCK-4) efter injektion i den caudala delen av kärnans accumbens eller i dess rostral-del och cerebrala ventriklerna. Neurochem Int. 1987; 10: 473-479. doi: 10.1016 / 0197-0186 (87) 90074-X. [PubMed] [Cross Ref]
  • Diorio D, Viau V, Meaney MJ. Rollen av medial prefrontal cortex (cingulate gyrus) vid reglering av hypotalamus-hypofys-adrenal respons på stress. J Neurosci. 1993; 13: 3839-3847. [PubMed]
  • Drevets WC. Neuroimaging och neuropatologiska studier av depression: konsekvenser för de kognitiva känslomässiga egenskaperna hos humörsjukdomar. Curr Opin Neurobiol. 2001; 11: 240-249. doi: 10.1016 / S0959-4388 (00) 00203-8. [PubMed] [Cross Ref]
  • Fales CL, Barch DM, Rundle MM, Mintun MA, Snyder AZ, Cohen JD, Mathews J, Sheline YI. Ändrad känslomässig interferensbehandling i affektiv och kognitiv kontroll hjärnkrets i större depression. Biolpsykiatri. 2008; 63: 377-384. doi: 10.1016 / j.biopsych.2007.06.012. [PMC gratis artikel] [PubMed] [Cross Ref]
  • Fales CL, Barch DM, Rundle MM, Mintun MA, Mathews J, Snyder AZ, Sheline YI. Antidepressiv behandling normaliserar hypoaktivitet i dorsolateral prefrontal cortex under emotionell störning vid större depression. J Påverka Disord. 2009; 112: 206-211. doi: 10.1016 / j.jad.2008.04.027. [PMC gratis artikel] [PubMed] [Cross Ref]
  • Feder A, Nestler EJ, Charney DS. Psykobiologi och molekylär genetik av motståndskraft. Nat Rev Neurosci. 2009; 10: 446-457. doi: 10.1038 / nrn2649. [PMC gratis artikel] [PubMed] [Cross Ref]
  • Gallopin T, Geoffroy H, Rossier J, Lambolez B. Kortikala källor till CRF, NKB och CCK och deras effekter på pyramidala celler i neocortex. Cereb Cortex. 2006; 16: 1440-1452. doi: 10.1093 / cercor / bhj081. [PubMed] [Cross Ref]
  • Grubert C, Hurlemann R, Bewernick BH, Kayser S, Hadrysiewicz B, Axmacher N, Sturm V, Schlaepfer TE. Neuropsykologisk säkerhet av kärnan skapar djup hjärnstimulering för större depression: effekter av 12-månadstimulering. Världen J Biol Psykiatri. 2011; 12: 516-527. doi: 10.3109 / 15622975.2011.583940. [PubMed] [Cross Ref]
  • Grueter BA, Robison AJ, Neve RL, Nestler EJ, Malenka RC. ΔFosB modulerar differentiellt kärnan accumbens direkt och indirekt vägfunktion. Proc Natl Acad Sci USA A. 2013; 110: 1923-1928. doi: 10.1073 / pnas.1221742110. [PMC gratis artikel] [PubMed] [Cross Ref]
  • Gygi SP, Rochon Y, Franza BR, Aebersold R. Korrelation mellan protein och mRNA överflöd i jäst. Mol Cell Biol. 1999; 19: 1720-1730. [PMC gratis artikel] [PubMed]
  • Heidbreder CA, Groenewegen HJ. Den mediala prefrontala cortexen i råttan: Bevis för en dorso-ventral skillnad baserad på funktionella och anatomiska egenskaper. Neurosci Biobehav Rev. 2003; 27: 555-579. doi: 10.1016 / j.neubiorev.2003.09.003. [PubMed] [Cross Ref]
  • Holson RR. Mesiella prefrontala kortikala skador och rodnad hos råttor: I. Reaktivitet för aversiva stimuli. Physiol Behav. 1986; 37: 221-230. doi: 10.1016 / 0031-9384 (86) 90224-6. [PubMed] [Cross Ref]
  • Keedwell PA, Andrew C, Williams SC, Brammer MJ, Phillips ML. De neurala korrelaten av anhedonia vid större depressiv sjukdom. Biolpsykiatri. 2005; 58: 843-853. doi: 10.1016 / j.biopsych.2005.05.019. [PubMed] [Cross Ref]
  • Kennedy SH, Giacobbe P. Behandlingsresistent depression: framsteg i somatiska terapier. Ann Clin Psychiatry. 2007; 19: 279-287. doi: 10.1080 / 10401230701675222. [PubMed] [Cross Ref]
  • Kennedy SH, Evans KR, Krüger S, Mayberg HS, Meyer JH, McCann S, Arifuzzman AI, Houle S, Vaccarino FJ. Förändringar i regional glukosmetabolism i hjärnan mätt med positronemissionstomografi efter paroxetinbehandling av större depression. Am J Psykiatri. 2001; 158: 899-905. doi: 10.1176 / appi.ajp.158.6.899. [PubMed] [Cross Ref]
  • Krishnan V, Han MH, Graham DL, Berton O, Renthal W, Russo SJ, Laplant Q, Graham A, Lutter M, Lagace DC, Ghose S, Reister R, Tannös P, Grön TA, Neve RL, Chakravarty S, Kumar A Eisch AJ, Self DW, Lee FS, et al. Molekylära anpassningar som ligger bakom känslighet och motstånd mot socialt nederlag i hjärnbelöningsregioner. Cell. 2007; 131: 391-404. doi: 10.1016 / j.cell.2007.09.018. [PubMed] [Cross Ref]
  • Krishnan V, Nestler EJ. Den molekylära neurobiologin av depression. Natur. 2008; 455: 894-902. doi: 10.1038 / nature07455. [PMC gratis artikel] [PubMed] [Cross Ref]
  • Lehmann ML, Herkenham M. Miljöberikning ger spänningsförmåga till socialt nederlag genom en infralimbisk cortexberoende neuroanatomisk väg. J Neurosci. 2011; 31: 6159-6173. doi: 10.1523 / JNEUROSCI.0577-11.2011. [PMC gratis artikel] [PubMed] [Cross Ref]
  • Leistedt SJ, Linkowski P. Brain, nätverk, depression och mer. Eur Neuropsychopharmacol. 2013; 23: 55-62. doi: 10.1016 / j.euroneuro.2012.10.011. [PubMed] [Cross Ref]
  • Mayberg HS, Lozano AM, Voon V, McNeely HE, Seminowicz D, Hamani C, Schwalb JM, Kennedy SH. Djup hjärnstimulering för behandlingsresistent depression. Nervcell. 2005; 45: 651-660. doi: 10.1016 / j.neuron.2005.02.014. [PubMed] [Cross Ref]
  • Maze I, Covington HE, 3rd, Dietz DM, LaPlant Q, Renthal W, Russo SJ, Mekaniker M, Mouzon E, Neve RL, Haggarty SJ, Ren Y, Sampath SC, Hurd YL, Greengard P, Tarakhovsky A, Schaefer A, Nestler EJ. Viktig roll för histon-metyltransferas G9a i kokaininducerad plasticitet. Vetenskap. 2010; 327: 213-216. doi: 10.1126 / science.1179438. [PMC gratis artikel] [PubMed] [Cross Ref]
  • McClung CA, Nestler EJ. Reglering av genuttryck och kokainbelöning av CREB och DeltaFosB. Nat Neurosci. 2003; 6: 1208-1215. doi: 10.1038 / nn1143. [PubMed] [Cross Ref]
  • Milad MR, Quirk GJ. Neuroner i medial prefrontal cortex-signalminne för rädsla utrotning. Natur. 2002; 420: 70-74. doi: 10.1038 / nature01138. [PubMed] [Cross Ref]
  • Nahas Z, Anderson BS, Borckardt J, Arana AB, George MS, Reeves ST, Takacs I. Bilateral epidural prefrontal kortikal stimulering för behandlingsresistent depression. Biolpsykiatri. 2010; 67: 101-109. doi: 10.1016 / j.biopsych.2009.08.021. [PMC gratis artikel] [PubMed] [Cross Ref]
  • Nikulina EM, Arrillaga-Romany I, Miczek KA, Hammer RP., Jr Långvarig förändring i mesokortikolimbiska strukturer efter upprepad social nederlagsspänning hos råttor: tidsförlopp av mu-opioidreceptor mRNA och FosB / DeltaFosB immunreaktivitet. Eur J Neurosci. 2008; 27: 2272-2284. doi: 10.1111 / j.1460-9568.2008.06176.x. [PMC gratis artikel] [PubMed] [Cross Ref]
  • Noble F, Roques BP. CCK-B-receptor: kemi, molekylärbiologi, biokemi och farmakologi. Prog Neurobiol. 1999; 58: 349-379. doi: 10.1016 / S0301-0082 (98) 00090-2. [PubMed] [Cross Ref]
  • Noble F, Wank SA, Crawley JN, Bradwejn J, Seroogy KB, Hamon M, Roques BP. Internationella Unionen av Farmakologi: XXI. Struktur, fördelning och funktioner av cholecystokininreceptorer. Pharmacol Rev. 1999; 51: 745-781. [PubMed]
  • Pérez de la Mora M, Hernandez-Gómez AM, Méndez-Franco J, Fuxe K. Cholecystokinin-8 ökar K (+) - framkallade [3H] gamma-aminobutyrsyrafrisättning i skivor från olika hjärnområden. Eur J Pharmacol. 1993; 250: 423-430. doi: 10.1016 / 0014-2999 (93) 90029-H. [PubMed] [Cross Ref]
  • Perrotti LI, Hadeishi Y, Ulery PG, Barrot M, Monteggia L, Duman RS, Nestler EJ. Induktion av 5FosB i belöningsrelaterade hjärnstrukturer efter kronisk stress. J Neurosci. 2004; 24: 10594-10602. doi: 10.1523 / JNEUROSCI.2542-04.2004. [PubMed] [Cross Ref]
  • Perrotti LI, Weaver RR, Robison B, Renthal W, Maze I, Yazdani S, Elmore RG, Knapp DJ, Selley DE, Martin BR, Sim-Selley L, Bachtell RK, Self DW, Nestler EJ. Distinkta mönster av DeltaFosB induktion i hjärnan av missbruk. Synapse. 2008; 62: 358-369. doi: 10.1002 / syn.20500. [PMC gratis artikel] [PubMed] [Cross Ref]
  • Radley JJ, Rocher AB, Miller M, Janssen WG, Liston C, Hof PR, McEwen BS, Morrison JH. Upprepad stress inducerar dendritisk ryggradsförlust i råttmedial prefrontal cortex. Cereb Cortex. 2006; 16: 313-320. doi: 10.1093 / cercor / bhi104. [PubMed] [Cross Ref]
  • Renthal W, Carle TL, Maze I, Covington HE, 3rd, Truong HT, Alibhai I, Kumar A, Montgomery RL, Olson EN, Nestler EJ. Delta FosB medierar epigenetisk desensibilisering av c-fos-genen efter kronisk amphetaminexponering. J Neurosci. 2008; 28: 7344-7349. doi: 10.1523 / JNEUROSCI.1043-08.2008. [PMC gratis artikel] [PubMed] [Cross Ref]
  • Rezayat M, Roohbakhsh A, Zarrindast MR, Massoudi R, Djahanguiri B. Cholecystokinin och GABA-interaktion i råttans dorsala hippocampus i det förhöjda plus-labyrintet av ångest. Physiol Behav. 2005; 84: 775-782. doi: 10.1016 / j.physbeh.2005.03.002. [PubMed] [Cross Ref]
  • Richard JM, Berridge KC. Prefrontal cortex modulerar lust och skräck genererad av kärnan accumbens glutamat störning. Biolpsykiatri. 2013; 73: 360-370. doi: 10.1016 / j.biopsych.2012.08.009. [PMC gratis artikel] [PubMed] [Cross Ref]
  • Rotzinger S, Vaccarino FJ. Cholecystokininreceptorsubtyper: roll i moduleringen av ångestrelaterade och belöningsrelaterade beteenden i djurmodeller. J Psykiatri Neurosci. 2003; 28: 171-181. [PMC gratis artikel] [PubMed]
  • Schlaepfer TE, Cohen MX, Frick C, Kosel M, Brodesser D, Axmacher N, Joe AY, Kreft M, Lenartz D, Sturm V. Djup hjärnstimulering för att belöna kretsar lindrar anhedonia i eldfast huvuddepression. Neuropsychopharmacology. 2008; 33: 368-377. doi: 10.1038 / sj.npp.1301408. [PubMed] [Cross Ref]
  • Sierra-Mercado D, Padilla-Coreano N, Quirk GJ. Dissociable roller av prelimbic och infralimbic cortices, ventral hippocampus och basolateral amygdala i uttryck och utrotning av konditionerad rädsla. Neuropsychopharmacology. 2011; 36: 529-538. doi: 10.1038 / npp.2010.184. [PMC gratis artikel] [PubMed] [Cross Ref]
  • Silva MG, Boyle MA, Finger S, Numan B, Bouzrara AA, Almli CR. Beteendeeffekter av stora och små lesioner av råtta medial frontal cortex. Exp Brain Res. 1986; 65: 176-181. [PubMed]
  • Somogyi P, Hodgson AJ, Smith AD, Nunzi MG, Gorio A, Wu JY. Olika populationer av GABAerga neuroner i den visuella cortexen och hippocampusen av katten innehåller somatostatin- eller kolecystokininimmunreaktivt material. J Neurosci. 1984; 4: 2590-2603. [PubMed]
  • Surget A, Tanti A, Leonardo ED, Laugeray A, Rainer Q, Touma C, Palme R, Griebel G, Ibarguen-Vargas Y, Hen R, Belzung C. Antidepressiva rekryterar nya neuroner för att förbättra stressresponsreglering. Mol psykiatri. 2011; 16: 1177-1188. doi: 10.1038 / mp.2011.48. [PMC gratis artikel] [PubMed] [Cross Ref]
  • Taniguchi H, He M, Wu P, Kim S, Paik R, Sugino K, Kvitsiani D, Fu Y, Lu J, Lin Y, Miyoshi G, Shima Y, Fishell G, Nelson SB, Huang ZJ. En resurs av Cre drivrutiner för genetisk inriktning av GABAergic neuroner i hjärnbarken. Nervcell. 2011; 71: 995-1013. doi: 10.1016 / j.neuron.2011.07.026. [PMC gratis artikel] [PubMed] [Cross Ref]
  • Teyssier JR, Ragot S, Chauvet-Gélinier JC, Trojak B, Bonin B. Aktivering av ett DeltaFOSB-beroende genuttrycksmönster i den dorsolaterala prefrontala cortexen hos patienter med stor depressiv sjukdom. J Påverka Disord. 2011; 133: 174-178. doi: 10.1016 / j.jad.2011.04.021. [PubMed] [Cross Ref]
  • Tsankova NM, Berton O, Renthal W, Kumar A, Neve RL, Nestler EJ. Hållbar hippocampal kromatinreglering i en musmodell av depression och antidepressiv verkan. Nat Neurosci. 2006; 9: 519-525. doi: 10.1038 / nn1659. [PubMed] [Cross Ref]
  • Tye KM, Prakash R, Kim SY, Fenno LE, Grosenick L, Zarabi H, Thompson KR, Gradinaru V, Ramakrishnan C, Deisseroth K. Amygdala-kretsar som medierar reversibel och dubbelriktad kontroll av ångest. Natur. 2011; 471: 358-362. doi: 10.1038 / nature09820. [PMC gratis artikel] [PubMed] [Cross Ref]
  • Vialou V, Robison AJ, Laplant QC, Covington HE, 3rd, Dietz DM, Ohnishi YN, Mouzon E, Rush AJ, 3rd, Watts EL, Wallace DL, Iñiguez SD, Ohnishi YH, Steiner MA, Warren BL, Krishnan V, Bolaños CA, Neve RL, Ghose S, Berton O, Tamminga CA, et al. DeltaFosB i hjärnbelöningskretsar medierar motståndskraft mot stress och antidepressiva reaktioner. Nat Neurosci. 2010; 13: 745-752. doi: 10.1038 / nn.2551. [PMC gratis artikel] [PubMed] [Cross Ref]
  • Vogt BA, Finch DM, Olson CR. Funktionell heterogenitet i cingulär cortex: de främre verkställande och bakre utvärderande regionerna. Cereb Cortex. 1992; 2: 435-443. doi: 10.1093 / cercor / 2.6.435-a. [PubMed] [Cross Ref]
  • Wilkinson MB, Xiao G, Kumar A, LaPlant Q, Renthal W, Sikder D, Kodadek TJ, Nestler EJ. Imipraminbehandling och elasticitet uppvisar liknande kromatinreglering i muskelkärnan accumbens i depression modeller. J Neurosci. 2009; 29: 7820-7832. doi: 10.1523 / JNEUROSCI.0932-09.2009. [PMC gratis artikel] [PubMed] [Cross Ref]
  • Winstanley CA, LaPlant Q, Theobald DE, Green TA, Bachtell RK, Perrotti LI, DiLeone RJ, Russo SJ, Garth WJ, Self DW, Nestler EJ. DeltaFosB-induktion i orbitofrontal cortex medger tolerans mot kokaininducerad kognitiv dysfunktion. J Neurosci. 2007; 27: 10497-10507. doi: 10.1523 / JNEUROSCI.2566-07.2007. [PubMed] [Cross Ref]
  • Yaksh TL, Furui T, Kanawati IS, Go VL. Frisättning av cholecystokinin från råtta cerebral cortex in vivo: roll av GABA och glutamatreceptorsystem. Brain Res. 1987; 406: 207-214. doi: 10.1016 / 0006-8993 (87) 90784-0. [PubMed] [Cross Ref]
  • Zanoveli JM, Netto CF, Guimarães FS, Zangrossi H., Jr Systemiska och intra-dorsala periaqueduktala grå injektioner av cholecystokininsulfaterad oktapeptid (CCK-8) inducerar ett panikliknande svar hos råttor som lämnas till den förhöjda T-labyrinten. Peptider. 2004; 25: 1935-1941. doi: 10.1016 / j.peptides.2004.06.016. [PubMed] [Cross Ref]