(HUMAIN) Les réponses comportementales et structurelles à la cocaïne chronique nécessitent une boucle de feedforward impliquant la protéine kinase II dépendante du calcium / de la calmoduline dans la coquille de Nucleus Accumbens (2013)

J Neurosci. 2013 Mar 6;33(10):4295-4307.

Robison AJ, Vialou V, Mazei-Robison M, Feng J, Kourrich S, Collins M, Wee S, Koob G, Turecki G, Jamais, Thomas M, Nestler EJ.

Source

Fishberg Department of Neuroscience et Friedman Brain Institute, École de médecine du Mont Sinaï, New York, New York, 10029, Départements de neuroscience et de psychologie, Institut de génétique humaine, Université du Minnesota, Minneapolis, Minnesota 55455, Comité de la neurobiologie des troubles de dépendance , Institut de recherche Scripps, La Jolla, Californie, Programme 92037 sur les troubles dépressifs, Institut universitaire en santé mentale Douglas et Université McGill, Montréal, Québec, Canada, H4H 1R3, et Département des sciences du cerveau et de la cognition, Institut de technologie du Massachusetts, Cambridge, Massachusetts 02139 .

Abstrait

Le facteur de transcription AFosB et la protéine kinase II (CaMKIIα-dépendante calcium / calmoduline-dépendante enrichie au cerveau) sont induits dans le noyau accumbens (NAc) par une exposition chronique à la cocaïne ou à d'autres drogues psychostimulantes, dans lesquelles les deux protéines induisent des réactions médicamenteuses sensibilisées . Bien que ΔFosB et CaMKIIα régulent tous deux l’expression et la fonction des récepteurs du glutamate AMPA dans le NAc, la formation d’épine dendritique sur les neurones épineux (MSN) et la sensibilisation locomotrice à la cocaïne n’a pas encore été expliquée. Ici, nous démontrons que ΔFosB est phosphorylé par CaMKIIα au niveau de Ser27, un stabilisateur de protéines, et que CaMKII est nécessaire à l’accumulation de ΔFosB induite par la cocaïne dans l’ANac du rat.

Inversement, nous montrons que ΔFosB est à la fois nécessaire et suffisant pour l’induction in vivo par la cocaïne de l’expression du gène CaMKIIα, un effet sélectif de D1de type MSN dans la sous-région de shell NAc.

En outre, l'induction des épines dendritiques sur les MSN NAc et la réactivité comportementale accrue à la cocaïne après la surexpression de NAc de ΔFosB dépendent toutes deux de la CaMKII.

Fait important, nous démontrons pour la première fois l’induction de ΔFosB et CaMKII dans le NAc de toxicomanes humains, en suggérant des cibles possibles pour une intervention thérapeutique future. Ces données établissent que ΔFosB et CaMKII s’engagent dans une boucle de rétroaction positive spécifique au type de cellule et au cerveau en tant que mécanisme clé pour la régulation des circuits de récompense du cerveau en réponse à la cocaïne chronique.

Introduction

De plus en plus de preuves corroborent l'opinion selon laquelle les changements dans l'expression des gènes contribuent aux mécanismes de la toxicomanie (Robison et Nestler, 2011). Un important médiateur de ces changements est ΔFosB, un facteur de transcription de la famille Fos (Nestler, 2008). L'administration chronique de pratiquement n'importe quelle drogue d'abus induit l'accumulation durable de ΔFosB dans le noyau accumbens (NAc), une région limbique essentielle aux comportements de récompense. SL'induction uch semble spécifique à la classe de neurone épineux moyen (NAc) qui exprime les récepteurs D1 de la dopamine. La surexpression inductible de ΔFosB dans ces MSN NAc de type D1 augmente les réponses locomotrices et enrichissantes à la cocaïne et à la morphine (Kelz et al., 1999; Zachariou et al., 2006), y compris une auto-administration accrue de cocaïne (Colby et al., 2003). En outre, le blocage génétique ou viral de l'activité transcriptionnelle de ΔFosB réduit les effets gratifiants de ces médicaments (Zachariou et al., 2006), indiquant que cette induction prolongée de ΔFosB est un médiateur essentiel des modifications durables induites dans le NAc par l'administration chronique d'un médicament.

La stabilité inhabituelle de ΔFosB (par rapport à toutes les autres protéines de la famille Fos) est à la fois une propriété intrinsèque de la molécule, en raison de la troncature des domaines de degron présents dans la protéine FosB complète (Carle et al., 2007) et un processus réglementé. ΔFosB est phosphorylé in vitro et de la in vivo sur Ser27, et cette réaction stabilise davantage ΔFosB, ~ 10-fold, en culture cellulaire et NAc in vivo (Ulery-Reynolds et al., 2009). Bien que Ser27-ΔFosB se soit révélé être un substrat pour la caséine kinase-2 in vitro (Ulery et al., 2006), son mécanisme de in vivo la phosphorylation reste inconnue.

La protéine kinase II dépendant du calcium / calmoduline (CaMKII) est une sérine / thréonine kinase hautement exprimée dont les isoformes α et β forment des homo- et hétéroholoenzymes dodécamères. in vivoet sont essentiels pour de multiples formes de neuroplasticité (Lisman et al., 2002; Colbran et Brown, 2004). CaMKIIα est induit sélectivement dans la coquille de NAc par une amphétamine chronique (Loweth et al., 2010), et le blocage pharmacologique de l'activité CaMKII dans la coquille de NAc réduit la sensibilisation comportementale à l'amphétamine (Loweth et al., 2008) et la cocaïne (Pierce et al., 1998), alors que la surexpression virale de CaMKIIα dans cette sous-région NAc améliore la sensibilisation locomotrice et l’auto-administration de l’amphétamine (Loweth et al., 2010). CaMKIIα peut affecter les comportements de récompense par la modulation des sous-unités du récepteur AMPA du glutamate (Pierce et al., 1998), l’activité de CaMKIIα étant depuis longtemps associée à la fonction du récepteur AMPA et au ciblage synaptique dans plusieurs formes de neuroplasticité (Malinow et Malenka, 2002).

Cette littérature démontre plusieurs parallèles entre ΔFosB et CaMKII: les deux sont nécessaires et suffisants pour les effets comportementaux multiples des drogues d'abus, les deux régulant positivement les épines dendritiques dans divers types de cellules neuronales in vivo (Jourdain et al., 2003; Maze et al., 2010) et tous deux exercent au moins une partie de leurs effets sur le comportement en modulant les récepteurs AMPA (Kelz et al., 1999; Malinow et Malenka, 2002; Vialou et al., 2010). Malgré ces parallèles, aucun lien fonctionnel entre ΔFosB et CaMKII n'est connu. Ici, nous établissons une régulation réciproque entre ΔFosB et CaMKII, et démontrons que les deux protéines forment une boucle de feed-forward spécifique à MSN de type D1 dans un shell NAc induite par la cocaïne et régulant une gamme de réponses à la cocaïne in vivo.

Allez à:

Matériels et méthodes

Expérience 1: Analyse protéomique iTRAQ de la coque et du noyau de NAc après traitement à la cocaïne (Fig 1A)

Des rats mâles adultes (semaines 8) ont reçu 20 mg / kg de cocaïne ou une solution saline IP une fois par jour pendant sept jours. 24 heures après la dernière injection, la coquille et le noyau de NAc ont été microdissectés (Fig 1A) et flash gelé. Les analyses iTRAQ ont été effectuées comme décrit précédemment (Ross et al., 2004; Davalos et al., 2010).

Figure 1

Figure 1

Induction spécifique de Shell de CaMKII dans NAc par la cocaïne

Expérience 2: Quantification des modifications apportées aux protéines dans les carottes et les carottes de NAc de rat après traitement à la cocaïne (Figue 1B – D)

Des rats mâles adultes (semaines 8) ont reçu 10 mg / kg de cocaïne ou une solution saline IP une fois par jour pendant sept jours dans des chambres d’enregistrement locomoteur. Des réponses locomotrices à une seule injection de cocaïne (5 en mg / kg IP) ont été enregistrées chez les animaux traités antérieurement avec de la cocaïne (dite «chronique») et une partie de ceux traités avec une solution saline (dite «aiguë»), ainsi que des réponses locomotrices à la solution saline. seul a été enregistré chez les animaux traités avec une solution saline chronique (appelée «solution saline»). Les dosages de l'activité locomotrice ont été effectués comme décrit (Hiroi et al., 1997). Brièvement, des rats mâles adultes ont été placés dans des boîtiers d’enregistrement en plein champ 18 «× 24» PAS (San Diego Instruments) afin que 30 min s’habitue, ont reçu une injection unique de solution saline par voie IP et ont été contrôlés pendant une période supplémentaire. injection IP unique de 30 mg / kg de cocaïne et surveillance de 5 min.

24 heures après cette dernière injection, les rats ont été décapités sans anesthésie pour éviter les effets des anesthésiques sur les taux de protéines neuronales et les états phospho-électriques. Les cerveaux ont été coupés en série dans une matrice 1.2 mm (Braintree Scientific) et le tissu cible a été prélevé dans une solution saline tamponnée au phosphate contenant de la protéase (Roche) et des inhibiteurs de la phosphatase (Sigma Aldrich) à l'aide d'un poinçon 14 pour le noyau NAc et d'un poinçon 12 du tissu pour coquille NAc (voir Fig 1A) et immédiatement congelés sur de la neige carbonique. Les échantillons ont été homogénéisés par sonication légère dans un tampon RIPA modifié: 10 mM Tris base, 150 mM chlorure de sodium, 1 mM EDTA, 0.1% sodium dodécyl sulfate, 1% Triton X-100, 1% désoxycholate de sodium, pH 7.4, protease et phosphatase. comme ci-dessus. Après addition du tampon de Laemmli, les protéines ont été séparées sur des gels à gradient de polyacrylamaide 4 – 15% (Criterion System, BioRad) et un transfert de Western a été effectué à l'aide du système Odyssey (Li-Cor) selon les protocoles du fabricant.

Expérience 3: Quantification des modifications apportées aux protéines dans les carottes et les coques de Shell après un retrait de cocaïne (Fig 1E)

Des rats mâles adultes (semaines 8) ont reçu 10 mg / kg de cocaïne ou une solution saline IP une fois par jour pendant sept jours. 14 jours après la dernière injection, les animaux traités avec une solution saline ont reçu une autre injection de solution saline (appelée «solution saline)», et les animaux traités avec de la cocaïne ont reçu une autre injection de solution saline (appelée «retrait de jour 14» ou «14d WD») ou une seule injection de cocaïne ( appelé “14d WD Chal” pour le challenge). Une heure après la dernière injection, les animaux ont été décapités et un Western blot réalisé comme dans Expérience 2.

Expérience 4: Quantification des modifications apportées aux protéines dans le noyau et le shell de NAc de rat après l’auto-administration de cocaïne (Figue 2A – C)

Les rats ont été entraînés à s'auto-administrer 0.5 en mg / kg / perfusion de cocaïne par séances d'une heure, selon un calendrier de traitement par 1 à rapport fixe, pendant neuf jours. Après neuf séances de base, les rats ont été divisés en deux groupes équilibrés par la consommation de cocaïne lors des deux dernières séances. Un groupe de rats a été autorisé à s'auto-administrer de la cocaïne (0.5 en mg / kg / perfusion) en une heure (accès court, ShA), tandis que l'autre groupe de rats s'est auto-administré en six heures (accès de longue durée, LgA). ) pendant dix jours supplémentaires (sessions d'escalade).

Des sections de cerveau ont été traitées pour l'immunohistochimie comme décrit (Perrotti et al., 2004). Après la dernière exposition au médicament, 18 – 24 hr a été perfusé dans les cerveaux, ce qui a entraîné la dégradation de la protéine FosB complète résiduelle, de sorte que toute l’immunoréactivité restante reflète le ΔFosB. Cette dégradation a été confirmée par Western blot, qui n'a montré aucune coloration significative avec un anticorps dirigé contre l'extrémité C-terminale de FosB de longueur complète qui ne reconnaît pas le ΔFosB (données non présentées). Après avoir découpé des sections 35 en µm, le nombre de cellules immuno-positives ΔFosB a été quantifié par un observateur en aveugle dans deux sections de la NAc de chaque rat, puis les valeurs moyennes par champ 40 × ont été calculées par région pour chaque animal. Chaque animal était considéré comme une observation individuelle pour l'analyse statistique. Les régions d’intérêt ont été identifiées à l’aide de Paxinos et Watson (Paxinos et Watson, 2007).

La quantification de l’immunoréactivité de CaMKIIα a été réalisée en utilisant un système Licor tel que décrit (Covington et al., 2009). Les intensités intégrées de CaMKII et de GAPDH ont été déterminées avec le logiciel Odyssey. Les résultats sont présentés en valeurs d'intensité intégrées par mm.2 et sont présentés sous forme de moyenne ± sem (n = 4 – 10 par groupe). Les valeurs de GAPDH ont été utilisées comme référence pour normaliser l'intensité de CaMKII en fonction de l'épaisseur et des conditions de la tranche.

Figure 2

Figure 2

Induction de CaMKII dans la coquille NAc de rats auto administrés et de toxicomanes humains à la cocaïne

Expérience 5: Quantification des niveaux de protéines chez l’homme dépendant de la cocaïne (Fig 2D)

Procédure

Des tissus cérébraux humains post mortem ont été obtenus de la Banque de cervidés du suicide au Québec (Institut universitaire en santé mentale Douglas, Montréal, Québec, Canada). La conservation du tissu s’est déroulée essentiellement comme décrit (Quirion et al., 1987). En bref, une fois extrait, le cerveau est placé sur une glace humide dans une boîte en polystyrène et se précipite aux installations de la banque de cervidés Suicide au Québec. Les hémisphères sont immédiatement séparés par une coupure sagittale au milieu du cerveau, du tronc cérébral et du cervelet. Les vaisseaux sanguins, la glande pinéale, le plexus choroïde, le demi-cervelet et le demi-tronc cérébral sont généralement disséqués de l'hémisphère gauche, qui est ensuite découpé coronalement en tranches de 1 d'une épaisseur de 1 cm avant d'être congelé. Le dernier demi-cervelet est coupé sagittalement en tranches de 1cm-épais avant la congélation. Les tissus sont surgelés dans du 2-méthylbutane à -40 ° C pendant ~ 60 sec. Tous les tissus congelés sont conservés séparément dans des sacs en plastique à -80 ° C pour un stockage à long terme. Des régions spécifiques du cerveau sont disséquées à partir de tranches coronales congelées sur une plaque en acier inoxydable recouverte de neige carbonique afin de contrôler la température de l'environnement. Western blot a été réalisée comme décrit dans Expérience 2.

Cohorte

La cohorte était composée de sujets 37 de sexe masculin et de femmes de type 3 dont l'âge variait entre 15 et 66. Tous les sujets sont décédés subitement sans état agonal prolongé ni maladie prolongée.. Dans chaque cas, la cause du décès a été déterminée par le bureau du coroner du Québec et un examen toxicologique a été effectué sur des échantillons de tissus afin d'obtenir des informations sur les médicaments et l'usage de substances illicites au moment du décès. Le groupe de sujets était composé d'individus 20 répondant aux critères SCID-I pour la dépendance à la cocaïne. Le groupe témoin était composé de sujets 20 sans antécédents de dépendance à la cocaïne ni de diagnostics psychiatriques majeurs. Tous les sujets sont décédés subitement de causes n'ayant aucune influence directe sur les tissus cérébraux. Les groupes ont été appariés pour l'âge moyen du sujet, le délai de réfrigération et le pH. Des autopsies psychologiques ont été effectuées comme décrit précédemment (Dumais et al., 2005), nous permettant d’avoir accès à des informations de cas détaillées sur les antécédents psychiatriques et médicaux, ainsi que d’autres données cliniques et sociodémographiques pertinentes. En bref, un enquêteur qualifié a mené la Entretien clinique structuré pour le DSM-IV Troubles psychiatriques (SCID-I) avec un ou plusieurs informateurs du défunt. Un groupe de cliniciens a examiné les évaluations SCID-I, les rapports de cas, les notes du coroner et les dossiers médicaux pour obtenir des diagnostics psychiatriques consensuels.

Expérience 6: Immunoprécipitation à la chromatine pour le NAc de rat (Figue 3A – C)

Des rats mâles adultes (semaines 8) ont reçu 10 mg / kg de cocaïne ou une solution saline IP une fois par jour pendant sept jours. 24 heures après la dernière injection, la coquille et le noyau de NAc ont été microdissectés. Une immunoprécipitation de chromatine (ChIP) a été réalisée en regroupant des poinçons NAC bilatéraux de coquille ou de noyau de sept rats par groupe dans les groupes totaux 14 (total d'animaux 98, pools de cocaïne 7, pools de solution saline 7). Les tissus ont été réticulés, lavés et stockés à -80 ° C jusqu'au cisaillement de la chromatine par sonication. La chromatine cisaillée a été incubée pendant une nuit avec des anticorps préalablement liés à des billes magnétiques (Dynabeads M-280, Invitrogen). Des IgG non immunes ont été utilisées comme contrôle. Après réticulation inverse et purification de l'ADN, la qPCR a été utilisée pour mesurer les niveaux d'ADN du promoteur CaMKIIα. Les amorces ont été conçues pour amplifier une région contenant une séquence consensus AP-1 située ~ 450 pb avant le site de départ de la transcription (Forward: ACTGACTCAGGAAGAGGGATA; Reverse: TGTGCTCCTCAGAATCCACAA).

Figure 3

Figure 3

Induction ΔFosB De CaMKIIα spécifique au type cellulaire et à la région in vivo

Expérience 7: Mesure de l’expression du transcrit et de la protéine CaMKII avec une surexpression de ΔFosB spécifique au type de cellule (Fig 3D)

Souris bitransgéniques mâles dérivées de NSE-tTA (ligne A) × TetOp-ΔfosB (ligne 11) et NSE-tTA (ligne B) × TetOp-FLAG-ΔfosB (line 11) souris (Chen et al., 1998; Kelz et al., 1999; Werme et al., 2002; Zachariou et al., 2006) ont été conçus et élevés sur de la doxycycline 100, µg / ml, pour supprimer l’expression de ΔFosB au cours du développement. Les compagnons de litière ont été divisés au sevrage: la moitié est restée sous doxycycline et l'autre moitié est passée à l'eau, et les animaux ont été utilisés 8 à 11 quelques semaines plus tard, lorsque les effets transcriptionnels de ΔFosB sont maximaux (Kelz et al., 1999; McClung et Nestler, 2003). Pour les analyses transcriptionnelles, les souris ont été rapidement décapitées et les cerveaux ont été prélevés et placés sur de la glace. Les dissections de NAc ont été prises avec un poinçon 14 et rapidement congelées sur de la neige carbonique jusqu'à extraction de l'ARN. L’isolement de l’ARN, la qPCR et l’analyse des données ont été effectués comme décrit précédemment (LaPlant et al., 2009). En bref, l'ARN a été isolé avec le réactif TriZol (Invitrogen), puis purifié avec le micro-kit RNAeasy de Qiagen et sa qualité a été contrôlée avec le bioanalyseur d'Agilent. La transcription inverse a été réalisée avec iScript (BioRad). La qPCR a été réalisée avec un système RT-PCR Applied Biosystems 7900HT avec les paramètres de cycle suivants: 10 min à 95 ° C; Cycles 40 de 95 ° C pour 1 min, 60 ° C pour 30 sec, 72 ° C pour 30 sec; chauffage gradué à 95 ° C pour générer des courbes de dissociation permettant de confirmer des produits de PCR individuels. Des analyses immunohistochimiques de l’expression des protéines ΔFosB et CaMKIIα ont été effectuées comme décrit dans Expérience 4.

Expérience 8: Effets des antagonistes des récepteurs de la dopamine D1 et D2 intra-NAc sur les modifications des protéines induites par la cocaïne (Fig 3H)

Des rats mâles adultes (semaines 8) ont reçu 10 mg / kg de cocaïne ou véhicule salin (groupe «véhicule») IP une fois par jour pendant sept jours. 30 min avant chaque injection de cocaïne, les rats ont reçu par voie IP soit l'antagoniste du récepteur D1, SCH 23390 (0.5 mg / kg, groupe «D1 Ant»), soit l'antagoniste du récepteur D2, l'éticlopride (0.5 mg / kg, groupe «D2 Ant»). ou une injection de solution saline témoin (groupe «cocaïne»). 24 heures après la dernière injection, les animaux ont été décapités et les protéines quantifiées par Western blot conformément au Expérience 2.

Expérience 9: Effets de la surexpression de ΔFosB à médiation par un AAV sur l’expression protéique (Figue 4 A – C)

Une chirurgie stéréotaxique a été réalisée sur des rats mâles adultes (semaines 8) afin d’injecter AAV-GFP (protéine fluorescente verte) ou AAV-GFP-AFOSB (Maze et al., 2010). Des aiguilles de calibre 33 (Hamilton) ont été utilisées pour toutes les chirurgies, au cours desquelles X µL de virus à titre élevé purifié ont été perfusés de manière bilatérale sur une période de temps 0.5 min, suivie d'une période de repos supplémentaire de 5 min après la perfusion. Toutes les distances sont mesurées par rapport à Bregma: angle 5 °, AP = + 10 mm, Lat = 1.7 mm, DV = −2.5 mm. 6.7 jours après la chirurgie, les animaux ont reçu une seule injection IP de 14 en mg / kg de cocaïne dans des chambres de surveillance locomotrice afin d'évaluer les effets comportementaux de la surexpression de ΔFosB. 10 après la dernière injection, les rats ont été décapités conformément au Expérience 2microdissection tissulaire a été réalisée sous guidage microscopique de fluorescence pour obtenir un tissu NAc GFP-positif. Le Western blot a ensuite été réalisé conformément à Expérience 2.

Figure 4

Figure 4

ΔFosB est à la fois nécessaire et suffisant pour l’induction de CaMKIIα dépendante du récepteur D1 induite par la cocaïne dans la coquille de NAc

Expérience 10: Effets de la surexpression de ΔJunD à médiation par un AAV sur l’expression protéique dépendante de la cocaïne (Fig 4 D – F)

L’injection stéréotaxique d’AAV-GFP ou d’AAV-GFP-ΔJunD a été réalisée conformément au Expérience 8. 14 jours après la chirurgie, on a administré aux animaux 10 mg / kg de cocaïne ou de solution saline IP une fois par jour pendant sept jours dans des chambres d’enregistrement locomoteur. Les réponses locomotrices à une seule injection de cocaïne (5 mg / kg IP) ou de solution saline ont été enregistrées. 24 heures après cette dernière injection, les rats ont été décapités, les tissus ont été récoltés et les transferts de Western ont été effectués comme indiqué précédemment. Expérience 9.

Expérience 11: In vitro Tests de protéine kinase (Figue 5A – D)

CaMKIIα et ΔFosB recombinants ont été purifiés à partir de cellules d’insecte (Brickey et al., 1990; Jorissen et al., 2007) et des dosages de protéine kinase ont été réalisés (Colbran, 1993), comme décrit précédemment. En bref, CaMKII a été préincubé sur de la glace avec 2.5 µM ​​(ou la concentration indiquée) de ΔFosB, 1 mM Ca2+, 40 mM Mg2+, 15 µM ​​calmoduline et 200 mM HEPES pH 7.5. La phosphorylation a été déclenchée par addition d’ATP 200 µM ​​avec ou sans [γ-32P] ATP et autorisé à continuer pendant 10 min à température ambiante (Fig 5A et B) ou 2 min sur glace (Fig 5C et D). Les produits ont été résolus par Western blot (Fig 5A et B) ou par autoradiogramme et comptage de scintillation (Fig B – D).

Figure 5

Figure 5

ΔFosB est un puissant substrat pour CaMKIIα

Expérience 12: Identification de la phosphorylation de Ser27 ΔFosB (Fig 5E)

In vitro Les dosages de kinases ont été effectués conformément à Expérience 11, les protéines ont été séparées par SDS-PAGE et des bandes correspondant à AFOSB ont été découpées et soumises à une spectrométrie de masse en tandem. Les assignations m / z des fragments d'ions correspondants dans tous les panneaux sont marquées au-dessus des pics d'ions. Tous les ions de fragment ne sont pas étiquetés en raison de contraintes d'espace. En règle générale, le texte des marqueurs d'ions de fragment est coloré en noir, sauf lorsqu'ils confirment directement ou ajoutent des éléments de preuve à la présence des sites de phosphorylation intéressants, auquel cas ils sont marqués en rouge. La preuve de la présence de produits de fragmentation de l'épine dorsale est présentée dans la lecture séquentielle du phosphopeptide avec le site détecté du résidu de phosphorylation indiqué en rouge avec la désignation d'une lettre à un acide aminé. La description numérique des fragments fragmentés observés est également marquée sur la séquence peptidique sous forme d'ions b et y. Les facteurs de zoom pour les sections de l'axe m / z montrant les ions de fragments d'intensité inférieure sont marqués en haut du spectre de masse de chaque fragment. Les fragments fragmentés dans le panneau H confirment la présence d'isoforme phosphorylée Ser27, mais dans un mélange d'autres isoformes phosphorylées aux sites Ser28, Ser31, Ser34 et Thr37. La présence des ions pa5, pa5-P, pb5 et pb5-P confirme de manière unique la phosphorylation du résidu Ser27.

Expérience 13: Quantification de la phosphorylation de Ser27 (Figue 5F)

Les peptides standards ont été conçus en imitant les formes phospho et non phospho de Ser27 ΔFosB. Après synthèse et purification, chaque peptide idiotypique «lourd» a été dissous dans un tampon acétonitrile / eau 50 / 50 et envoyé pour analyse des acides aminés afin de déterminer la concentration absolue sur la solution mère de peptide synthétique. Chaque peptide «lourd» a ensuite été directement injecté dans le spectromètre de masse (MS) 4000 QTRAP afin de déterminer la meilleure énergie de collision pour la fragmentation MS / MS et deux à quatre transitions MRM. Ensuite, les peptides «lourds» purs ont été soumis à une LCMS sur le 4000 QTRAP pour assurer la séparation des peptides. L'instrument a été exécuté en mode triple quadripôle, avec Q1 défini sur la valeur spécifique du précurseur m / z (Q1 n'est pas en cours d'analyse) et Q3 défini sur la valeur spécifique m / z correspondant à un fragment spécifique de ce peptide. En mode MRM, une série de réactions simples (transitions d’ions précurseurs / fragments dans lesquelles l’énergie de collision est ajustée pour optimiser l’intensité des ions fragments d’intérêt) a été mesurée de manière séquentielle et le cycle (généralement 1 – 2 sec) a été bouclé. la durée totale de la séparation par HPLC. Les transitions MRM ont été déterminées à partir des spectres MS / MS des peptides existants. Deux transitions par peptide, correspondant à des ions fragments de haute intensité, ont ensuite été sélectionnées et l'énergie de collision optimisée pour maximiser la force du signal des transitions MRM à l'aide d'un logiciel d'automatisation. Les pics résultant des peptides standards et des échantillons de ΔFosB exposés à la CaMKII ou à un témoin ont ensuite été comparés pour déterminer l'abondance absolue de chaque forme de peptide dans la réaction. L'analyse des données sur les données LC-MRM est effectuée à l'aide du logiciel AB Multiquant 1.1.

Expérience 14: Induction de ΔFosB chez des souris surexprimant CaMKII (Fig 5G et H)

Souris transgéniques surexprimant T286D CaMKII (Mayford et al., 1996; Kourrich et al., 2012) et des compagnons de litière de type sauvage ont été élevés en l'absence de doxycycline pour permettre l'expression du transgène. Des souris adultes ont reçu 20 en mg / kg de cocaïne ou de solution saline IP une fois par jour pendant 14 jours. 24 heures après la dernière injection, les animaux ont été décapités et l'immunohistochimie et la quantification de l'expression de ΔFosB ont été effectuées comme dans Expérience 4.

Expérience 15: Effets de la surexpression de ΔFosB induite par le HSV et de l’inhibition de la CaMKII sur les épines dendritiques de NAc (Figue 6A – E)

Des souris mâles adultes (semaines 8) ont reçu une injection stéréotaxique de NAc avec HSV-GFP, HSV-GFP-AFOSB (Olausson et al., 2006), HSV-GFPAC3I ou HSV-GFPAC3I-AFOSB. Dans ces constructions, AC3I, un inhibiteur de l'activité de la CaMKII à base de peptide, est fusionné à l'extrémité C-terminale de la GFP. GFPAC3I a été cloné par PCR en utilisant le vecteur pMM400 contenant GFPAC3I en tant que modèle avec les amorces suivantes: GFP-AC3I-F: 5 'CC GCTAGC GCCGCCACC ATGGTGAGGAGGAGGAGGAGGGGCTGNGHGNGHG GFP-AC3I-R: 3 'CC TCCGGA TTACAGGCAGTCCACGGCCT 5' (clampBspEIstop). Le produit de PCR résultant a été inséré dans les vecteurs p3 + et p1005 + -A FosB en utilisant les sites Nhel et BspEI. La construction a été validée par séquençage. Les coordonnées stéréotaxiques étaient: angle 1005 °, AP = + 10 mm, Lat = + 1.6 mm, DV = −1.5 mm (Barrot et al., 4.4). La perfusion et la section du cerveau ont été effectuées conformément à Expérience 4.

L’analyse de la colonne vertébrale a été réalisée comme décrit (Christoffel et al., 2011). En bref, les segments dendritiques distants du soma 50 – 150 ont été choisis au hasard parmi les cellules infectées par le VHS qui expriment la GFP. Les images ont été acquises sur un LSM confocal 710 (Carl Zeiss) pour une analyse morphologique en utilisant NeuronStudio avec l’algorithme Rayburst. NeuronStudio classe les épines comme fines, en champignon ou en épi, en fonction des valeurs suivantes: rapport hauteur / largeur (1), rapport tête / cou (2) et diamètre de la tête (3). Les épines avec un cou peuvent être classées comme minces ou champignons, et celles sans cou important sont classées comme épaisses. Les épines avec un cou sont étiquetées comme minces ou champignons en fonction du diamètre de la tête.

Figure 6

Figure 6

Le blocage de l'activité CaMKII empêche les effets morphologiques et comportementaux de ΔFosB dans NAc

Expérience 16: effets de la surexpression de ΔFosB induite par le HSV et de l’inhibition de la CaMKII sur les réponses de la cocaïne (Figue 6F)

Des souris mâles adultes ont reçu une injection de virus conformément à Expérience 15et les réponses locomotrices à une injection unique de 5 mg / kg de cocaïne ont été mesurées selon Expérience 9. Les données locomotrices sont exprimées en coupures de faisceau totales sur 30 min après l’injection de cocaïne.

Informations complémentaires,

Logement pour animaux

Des rats mâles Sprague Dawley (250 – 275 g; Charles River Laboratories) ont été hébergés par paires. Des souris mâles C57BL / 6J âgées de huit semaines (The Jackson Laboratory) ont été hébergées en groupe avec un maximum de cinq animaux par cage. Tous les animaux ont été habitués à l'animalerie pendant une semaine ≥1 avant les manipulations expérimentales et ont été hébergés dans des chambres à température contrôlée (23 – 25 ° C) selon un cycle lumière / obscurité 12 hr (éclairage allumé à 7: 00 AM) avec accès à des aliments. et de l'eau ad libitum. Les expériences ont été menées conformément aux directives de la Society for Neuroscience et du comité institutionnel de protection et d'utilisation des animaux (IACUC) au mont Sinaï.

Médicaments

Les médicaments ont été administrés par voie intraveineuse et dissous dans une solution saline stérile, notamment de la cocaïne (5 – 20 en mg / kg par 10 en ml pour les souris, par 1 en ml pour les rats, NIDA) et du chlorhydrate de SCH 23390 ou de l'éticlopride (0.5 en mg / kg pour 1 en mg, Tocris) . Pour la chirurgie stéréotaxique, les souris ont été anesthésiées avec un «cocktail» de kétamine (100 mg / kg) et de xylazine (10 mg / kg) (Henry Schein) dans une solution saline stérile.

Anticorps

CaMKIIα (total): Upstate 05 – 532, 1: 5,000

CaMKII phospho-Thr286: Promega V111A, 1: 1,000

ΔFosB (total): signalisation cellulaire 5G4, 1: 250

ΔFosB phospho-Ser27: Phosphosolutions, 1: 500

GluA1 (total): Abcam, Ab31232, 1: 1,000

GluA1 phospho-Ser831: Millipore N453, 1: 1,000

GluA1 phospho-Ser845: Chemicon Ab5849, 1: 2,000

GluA2: Millipore 07 – 598, 1: 2,000

NR2A: Sigma HPA004692, 1: 2,500

NR2B: Millipore Ab1557P, 1: 1,000

Analyses statistiques

Toutes les analyses statistiques ont été effectuées à l'aide du progiciel Prism 6 (GraphPad). Les tests t de Student ont été utilisés pour toutes les comparaisons par paires (indiqué dans Résultats où la valeur t est donnée) et une ANOVA unidirectionnelle a été utilisée pour toutes les comparaisons multiples (indiquée dans la section des résultats où la valeur F est donnée).

Allez à:

Resultats

La cocaïne chronique induit le CaMKII dans la coquille NAc

De nombreuses études ont montré que les MSN dans la coquille et le noyau de l’ANac avaient des réactions biochimiques et physiologiques différentes à l’exposition chronique à des drogues faisant l’abus de drogues (Kourrich et Thomas, 2009; Loweth et al., 2010) et que les deux sous-régions réglementent différemment les comportements de recherche de drogues (Ito et al., 2004). Déterminer les effets différentiels de la cocaïne sur les constituants protéiques de la coquille de NAc vs. Nous avons utilisé le marquage isobare multiplexé (iTRAQ) et la spectroscopie de masse en tandem (MS / MS). Des rats mâles adultes ont reçu une injection IP de cocaïne (20 mg / kg) ou de solution saline quotidiennement pendant les jours 7; 24 heures après la dernière injection, la coquille et le noyau de NAc ont été microdissectés (Fig 1A) et flash gelé. Les protéines de ces échantillons ont ensuite été quantifiées à l'aide de iTRAQ. Les quatre isoformes de CaMKII ont présenté une forte augmentation de l'expression après traitement à la cocaïne, spécifique à la coquille de NAc par rapport au noyau. Plusieurs protéines phosphatases, notamment les sous-unités catalytiques et régulatrices de PP1 et PP2A, qui ont déjà été associées à divers substrats de CaMKII dans d’autres systèmes (Colbran, 2004), suivait un schéma similaire. Ces résultats ont fourni de nouvelles preuves non biaisées selon lesquelles la voie de signalisation de CaMKII est régulée de manière évidente par la cocaïne dans NAc d'une manière spécifique à la coquille.

Pour valider cette découverte de manière plus quantitative, nous avons traité les rats comme ci-dessus avec de la cocaïne (à des doses variables) ou une solution saline et avons mesuré les réponses locomotrices à une cocaïne (5 mg / kg) ou à une dose de provocation saline. Une exposition répétée à 10 mg / kg de cocaïne a entraîné le schéma typique de sensibilisation locomotrice (Fig 1B). Des études ultérieures avec ce schéma posologique ont révélé, en utilisant un transfert Western, que la cocaïne répétée induit CaMKIIα de manière sélective dans Xc XCX Hr après sa dernière injection de cocaïne (Fig 1C et D; p = 0.0019; F = 7.943; df = 29). De plus, la phosphorylation du substrat canonique CaMKII Ser831 de la sous-unité GluA1 du récepteur AMPA était significativement augmentée dans la coquille de NAc et non dans le noyau (p = 0.0261; F = 4.208; df = 28), alors que la CaMKIIα Thr286 avait une forte autonomie tendance significative à l’induction en coquille uniquement (Fig 1D). Plusieurs autres récepteurs du glutamate n'ont pas été affectés. Contrairement à ces mesures de CaMKII, les mêmes échantillons de tissus ont montré une induction de ΔFosB dans les deux coquilles (p = 0.0260; F = 4.189; df = 29) et le noyau (p = 0.0350; F = 3.807; df = 29) du NAc (Fig 1C et D), conformément aux constatations antérieures (Perrotti et al., 2008).

Plusieurs études antérieures sur la régulation de la cocaïne par les récepteurs AMPA ayant analysé des animaux après environ 14 jours d'arrêt de consommation de cocaïne chronique (voir la section Discussion), nous avons répété ces analyses biochimiques à ce stade. Nous avons trouvé que, 14 jours après la dernière injection de cocaïne, ΔFosB reste élevé dans le NAc (p = 0.0288; F = 4.258; df = 22), alors que ni CaMKII ni la phosphorylation de GluA1 Ser831 ne sont augmentés (Fig 1E). Cependant, 1 h après une dose unique de cocaïne mg / kg 10, les niveaux de CaMKII total (p = 0.0330; F = 3.947; df = 26) et de GluA1 Ser831 (p = 0.0213; F = 4.509; d = 27) phosphorylation sont à la fois plus élevées et similaires à celles observées après une exposition chronique initiale à la cocaïne (Fig 1E). Ces données indiquent que les neurones en couches de NAc sont amorcés pour l'induction de CaMKII pendant de longues périodes d'abstinence, éventuellement via l'amorçage direct du promoteur du gène CaMKII (voir la discussion). De plus, le fait que l’induction de ΔFosB soit plus persistante que l’induction de CaMKII suggère l’existence de mécanismes supplémentaires, qu’ils soient basés sur la chromatine ou non, qui «freinent» la régulation de la CaMKII, comme indiqué dans la discussion.

Pour renforcer encore ces observations, nous avons exploré des modèles d’auto-administration de cocaïne, qui impliquent l’ingestion volontaire de drogues. Les rats adultes mâles ont eu un accès court ou long à la cocaïne; comme prévu (Ahmed et Koob, 1998), seules des conditions d'accès prolongées ont entraîné une auto-administration croissante du médicament (Fig 2A). ΔFosB a été induit dans une plus grande mesure par le long vs. accès court à la cocaïne dans les deux coquilles NAc (p = 0.0011; F = 11.12; df = 17) et le noyau (p = 0.0004; F = 13.86; df = 17). Au contraire, CaMKIIα n’a été induit dans la coquille de NAc que par un long accès à la cocaïne (Fig 2B et C; p = 0.0236; F = 4.957; df = 16). Il est intéressant de comparer la consommation quotidienne moyenne de cocaïne chez les animaux à accès restreint (~ 12 en mg / kg IV), les animaux à accès prolongé (~ 70 en mg / kg IV) et les animaux administrés par l'expérimentateur (10 en mg / kg), et demandez pourquoi cette dernière provoque une induction robuste de ΔFosB et de CaMKII alors que l’accès court ne le fait pas. Cet écart est probablement dû aux différences entre les niveaux maximaux de cocaïne (la cocaïne administrée par l'expérimentateur est administrée sous forme d'un bolus unique, alors que la cocaïne auto-administrée est administrée via plusieurs doses intraveineuses), ou par la durée d'exposition aux médicaments (jours 7 pour l'expérimentateur administration, 19 jours pour l’auto-administration).

Malgré la littérature abondante sur ΔFosB et CaMKII dans l'action de la cocaïne, il n'y a aucune étude de ces protéines chez les consommateurs de cocaïne. Ici, nous présentons la première preuve que les niveaux de ΔFosB (p = 0.0316; t = 1.921; df = 34) et de CaMKII (p = 0.0444; t = 1.755; df = 32) sont augmentés dans le NAc des humains dépendants de la cocaïne (Fig 2D, Tableau 1). Ces données indiquent que notre examen de l'induction de ΔFosB et de CaMKII par la cocaïne chez les NAc de rongeurs est cliniquement pertinent pour la dépendance humaine à la cocaïne.

Tableau 1

Tableau 1

Caractérisation d'échantillons de toxicomanes humains et d'un groupe témoin apparié

AFOSB régule la transcription CaMKII de manière sélective dans les MSN de type D1 du shell NAc

La découverte que CaMKII et ΔFosB sont régulés positivement par la cocaïne chez le rongeur NAc nous a amenés à déterminer si ΔFosB pourrait réguler la transcription du gène CaMKII. Nous avions précédemment signalé CaMKIIα comme cible possible de ΔFosB dans une analyse de puces à ADN non biaisée de NAc (McClung et Nestler, 2003), mais cette conclusion n’a pas été validée davantage dans cette étude. Nous avons d’abord utilisé une puce quantitative (qChIP - ChIP suivie d’une PCR quantitative) pour déterminer si ΔFosB se liait au promoteur du gène CaMKIIα dans le NAc de rats mâles adultes et nous avons constaté de manière frappante que cette liaison était considérablement accrue par une administration chronique de cocaïne dans la coquille ( p = 0.0133; t = 2.901; df = 12), mais pas la sous-région de base (Fig 3A). Pour mieux comprendre les mécanismes liés à cette différence spécifique de sous-région dans la liaison de ΔFosB au promoteur CaMKIIα, nous avons utilisé qChIP pour caractériser l’état de la modification des histones dans cette région génomique. Des études antérieures ont démontré l’induction d’acétylation de H3 par la cocaïne au niveau du promoteur CaMKIIα dans le NAc total de souris (Wang et al., 2010). En revanche, nous avons constaté que la cocaïne diminue sélectivement l’acétylation de H3 au niveau du promoteur CaMKIIα dans le noyau NAc (Fig 3B; p = 0.0213; t = 2.726; df = 10), sans changement apparent dans la coque, en accord avec les altérations de la chromatine spécifiques à la sous-région au-delà de la liaison à ΔFosB. qChIP pour la marque répressive, H3 lysine 9 diméthylée (H3K9me2), a révélé des tendances à la baisse dans les sous-régions principale et inférieure (coques)Fig 3C).

Déterminer si ΔFosB régule la transcription de CaMKIIα in vivo, nous avons utilisé deux lignées de souris bitransgéniques surexprimant ΔFosB de manière inductible, en particulier dans D1 vs. MSN de type D2 d’une manière contrôlée par l’administration de doxycycline dans l’eau de boisson (Chen et al., 1998; Kelz et al., 1999; Werme et al., 2002). Des souris mâles adultes surexprimant ΔFosB uniquement dans des MSN de type D1 présentaient des niveaux significativement augmentés d'ARNm de CaMKIIα dans NAc (p = 0.0337; t = 1.996; df = 13), effet non observé chez les souris de type MSN.Fig 3D). L'augmentation de l'ARNm de CaMKIIα, induite par l'expression de ΔFosB dans des MSN de type D1, était accompagnée d'une augmentation concomitante de la protéine CaMKIIα dans les deux couches de NAc (p = 0.0030; t = 3.578; df = 14) et centrale (p = 0.0392; t = 2.275; t = 14; df = XNUMX); = XNUMX; df = XNUMX; Figues 3E et F). Ces données démontrent que ΔFosB est capable de diriger l’expression du gène CaMKIIα dans les MSN de type D1 dans les deux sous-régions, bien que Figure 3B suggère que les changements de chromatine induits par la cocaïne au niveau du promoteur CaMKIIα (par exemple, une acétylation réduite) empêchent ΔFosB de réguler positivement la CaMKII dans la sous-région centrale après la cocaïne.

Parce que nos données de souris transgéniques ont indiqué que l'induction ΔFosB de l'expression du gène CaMKII est spécifique aux MSN de type D1 dans NAc, nous avons ensuite cherché à déterminer si la régulation à la hausse dépendante de la cocaïne de CaMKII nécessite l'activation du récepteur de dopamine D1. Des rats mâles adultes ont reçu de la cocaïne chronique ou une solution saline comme auparavant, mais 30 minutes avant chaque injection, les rats du groupe cocaïne ont reçu une injection IP de solution saline, l'antagoniste D1 SCH 23390 (0.5 mg / kg) ou l'antagoniste du récepteur D2 l'éticlopride (0.5 mg / kg). Les animaux ont été analysés 24 heures après la dernière injection de cocaïne. Le Western blot a révélé que l'antagoniste D1, mais pas D2, bloquait complètement l'augmentation médiée par la cocaïne de ΔFosB (p <0.0001; F = 18.96; df = 18), comme indiqué précédemment (Nye et al., 1995), ainsi que dans CaMKII (p = 0.0005; F = 10.99; df = 18; Fig 3G et H). Ces données corroborent l'hypothèse selon laquelle la cocaïne induirait une augmentation de l'expression du gène CaMKII induite spécifiquement par ΔFosB dans les MSN de type D1 de la coquille NAc. Il serait important dans les études futures de démontrer directement cet effet spécifique de type cellulaire de la cocaïne sur l'expression de la CaMKII dans cette région du cerveau.

Le ΔFosB est à la fois nécessaire et suffisant pour l’induction de la CaMKII par la cocaïne dans un shell NAc

Pour compléter l'utilisation de souris bitransgéniques, nous avons ensuite étudié le rôle de ΔFosB dans la médiation de l'induction de CaMKIIα par la cocaïne par l'utilisation d'un transfert de gène à médiation virale chez le rat. Nous avons injecté bilatéralement des particules virales adéno-associées (AAV) dans la coquille de NAc de rats mâles adultes (où la coquille peut être ciblée de manière sélective) pour surexprimer ΔFosB plus GFP ou GFP seule. Les animaux ont ensuite reçu une seule injection IP de 10 mg / kg de cocaïne. Les animaux surexprimant ΔFosB / GFP ont présenté une réponse locomotrice accrue par rapport aux animaux surexprimant la GFP seule (Fig 4A). 24 heures après l'injection d'une seule cocaïne, le tissu NAc positif à la GFP a été excisé de ces animaux par dissection sous une source de lumière fluorescente. Western blot de ce tissu (Fig 4B et C) a révélé une forte surexpression de ΔFosB ainsi qu’une augmentation significative de la protéine CaMKIIα totale par rapport aux animaux GFP (p = 0.0070; t = 2.894; df = 30), similaire à l’induction observée avec l’administration chronique de cocaïne. En outre, l'autophosphorylation de CaMKIIα au niveau de Thr286 (indicateur de l'activation de l'enzyme) était augmentée par la surexpression de ΔFosB (p = 0.0330; t = 2.243; df = 28), de même que la phosphorylation du substrat CaMKII, Ser831 de GluA1 (p = 0.0540), p. 2.012; df = 28), imitant à nouveau les actions de la cocaïne chronique (Fig 1C et D). TEnsemble, ces données fournissent une preuve supplémentaire que l’expression de ΔFosB dans l’enveloppe de NAc est suffisante pour la sensibilisation locomotrice à la cocaïne et pour l’induction et l’activation de CaMKII dans cette sous-région.

Nous avons utilisé une approche similaire pour déterminer si ΔFosB est également nécessaire pour l'induction de CaMKIIα induite par la cocaïne dans la coquille de NAc. AAV a été utilisé pour surexprimer une protéine JunD tronquée, appelée ΔJunD, qui est un régulateur négatif de l’activation de la transcription de ΔFosB (Winstanley et al., 2007) plus GFP ou GFP seul. Deux semaines plus tard, lorsque l'expression du transgène est maximale, les animaux reçoivent de la cocaïne (10 en mg / kg) ou une solution saline quotidiennement pendant 7, et sont testés pour déterminer leur réponse locomotrice à une provocation à la cocaïne (5 en mg / kg) après la dernière injection chronique (Fig 4D). La surexpression de ΔJunD a empêché la sensibilisation locomotrice à la cocaïne, ainsi que l’induction et l’activation de CaMKIIα dans la coquille de NAc (Fig 4E et F; p = 0.0437; F = 2.997; total df = 38), indiquant que l'activité transcriptionnelle de ΔFosB est nécessaire pour l'induction de CaMKIIα médiée par la cocaïne dans cette sous-région. De manière intéressante, nous avons constaté que ΔJunD réduisait les niveaux de ΔFosB dans des conditions salines et traitées avec de la cocaïne (p = 0.0004; F = 8.110; df = 35), augmentant la possibilité nouvelle que ΔFosB dépend de l’activité de l’AP-1 pour ses propres niveaux d’expression.

CaMKII Phosphorylates ΔFosB chez Ser27

En utilisant in vitro Nous avons déterminé que le ΔFosB purifié est un substrat robuste pour la CaMKIIα. Incubation de son6-AFosB avec CaMKIIα et ATP a provoqué une augmentation de la mobilité électrophorétique de ΔFosB (Fig 5A) les nombreuses bandes résultantes ont suggéré plusieurs sites de phosphorylation. Similaire in vitro tests de kinase utilisant [γ-32P] ATP a montré l’incorporation de phosphate radiomarqué dans les bandes décalées de ΔFosB (Fig 5B), démontrant la phosphorylation directe de la protéine. Nous avons généré un anticorps phospho-spécifique du Ser27 de ΔFosB (précédemment décrit)Ulery et al., 2006). Bien que cet anticorps ne produise pas de signal contre les extraits de cerveau contenant du ΔFosB phosphorylé par Ser27 (données non présentées), nous avons pu détecter la phosphorylation de Ser27 dans le in vitro dosage de kinase à l'aide de CaMKII (Fig 5B). Les analyses cinétiques de la phosphorylation de ΔFosB par CaMKII indiquent qu’il s’agit d’un puissant substrat pour la kinase (Fig 5C), avec un K apparentM de 5.7 ± 2.0µM et KCHAT de 2.3 ± 0.3min-1. Ces résultats sont comparables à ceux de nombreuses études bien caractérisées. in vivo substrats de CaMKII (Colbran et Brown, 2004). De plus, nous avons déterminé que la CaMKII phosphorylait la ΔFosB avec une stoechiométrie de 2.27 ± 0.07 mol / mol (Fig 5D), indiquant qu'il existe au moins trois sites de phosphorylation de CaMKII dans la6-AfosB, en accord avec Fig 5A.

Pour étudier les sites individuels de phosphorylation, nous avons utilisé des analyses MS d’échantillons de notre in vitro tests de kinase. Fig 5E démontre la phosphorylation de ΔFosB sur le Ser27 précédemment caractérisé et sur plusieurs sites supplémentaires (données non présentées). Compte tenu de la caractérisation fonctionnelle antérieure de Ser27, nous nous sommes concentrés sur ce site en générant des peptides synthétiques marqués imitant les états phospho et non phospho de Ser27. Nous avons ensuite utilisé des quantités connues de ces peptides comme normes dans les analyses MRM de ΔFosB avant et après. in vitro phosphorylation par CaMKII. Quantification ultérieure (Figue 5F) confirme que Ser27 est un puissant substrat pour CaMKII. Ces résultats indiquent que, parmi les multiples résidus phosphorylés au sein de ΔFosB, Ser27 est un substrat particulièrement efficace pour CaMKII.

CaMKII médie l'accumulation de ΔFosB dans la coquille de NAc dans la cocaïne

CaMKII pouvant phosphoryler ΔFosB in vitro sur un site qui améliore considérablement sa stabilité in vitro et de la in vivo (Ulery et al., 2006; Ulery-Reynolds et al., 2009), nous avons déterminé si l’activité CaMKII contrôlait les taux de ΔFosB dans NAc in vivo. Pour répondre à cette question, nous avons d’abord utilisé une lignée de souris surexprimant un mutant de CaMKIIα (T286D) indépendant du calcium dans plusieurs régions du cerveau, y compris la NAc (Mayford et al., 1996; Kourrich et al., 2012). Nous avons injecté 20 mg / kg de cocaïne ou de solution saline une fois par jour à des adultes du même sexe et du type sauvage adultes du même âge pendant deux jours, puis nous avons analysé les animaux un jour après la dernière injection. Nous avons constaté que les taux basaux de ΔFosB étaient augmentés chez les animaux mutants dans la coquille de NAc (p = 14; F = 0.0001; df = 9.207), mais pas dans le noyau (Fig 5G et H). Étonnamment, l'induction dépendante de la cocaïne de ΔFosB a été bloquée chez les animaux mutants à la fois dans la coquille et le noyau, ce qui suggère que, bien que CaMKII puisse réguler directement la stabilité de ΔFosB dans la coquille de NAc, il pourrait également se trouver en amont de ΔFosB dans des voies activées par la cocaïne dans les deux sous-régions de NAc .

Activité CaMKII Est Requise Pour Plasticité Structurale Et Comportementale Médiée Par ΔFosB

L’induction d’épines dendritiques par la cocaïne sur les ACNn est l’une des meilleures adaptations établies dans cette région du cerveau, induite par un médicament, et cette induction a été corrélée à des réactions comportementales sensibilisées à la drogue (Robinson et Kolb, 2004; Russo et al., 2010) et déclaré sélectif pour les MSN de type D1 (Lee et al., 2006). Nous avons récemment démontré que l’induction d’épines dendritiques à la cocaïne dans NAc dépend de ΔFosB et de son programme de transcription en aval (Maze et al., 2010). Bien qu'il existe une littérature abondante concernant l'implication de CaMKII dans la morphologie de la colonne vertébrale dendritique et l'induction dans d'autres régions du cerveau et systèmes expérimentaux (Jourdain et al., 2003; Penzes et al., 2008; Okamoto et al., 2009), son rôle dans la formation de la colonne vertébrale NAc MSN n’a pas été étudié. Par conséquent, nous avons déterminé si l’activité CaMKII était nécessaire pour l’induction d’épines dendritiques MSN induite par le médian ΔFosB en utilisant la surexpression induite par le HSV du peptide AC3I inhibiteur de la CaMKII fusionnée à la GFP, une construction précédemment montrée dans l’inhibition de l’activité de la CaMKII. in vivo (Zhang et al., 2005; Klug et al., 2012). La surexpression virale de ΔFosB dans la coquille NAc de souris adultes a induit une augmentation significative de la densité d'épine dendritique MSN (p <0.0001; F = 8.558; df = 59; Fig 6A et B) comme indiqué précédemment (Maze et al., 2010), et cette augmentation est principalement due aux types d'épines minces (p = 0.0027; F = 5.319; df = 59) et stubby (p = 0.0378; F = 2.988; df = 59) (supposées être des épines immatures) (Figue 6C – E). Aucun effet n'a été observé sur les épines plus matures en forme de champignon. Cependant, lorsque GFP-AC3I était co-exprimé, l’induction d’épines par ΔFosB était complètement abrogée (Figue 6A – E), indiquant que l'activité CaMKII est requise pour l'induction ΔFosB d'épines dendritiques dans la coquille de NAc.

Nous avons ensuite utilisé les mêmes outils viraux pour déterminer si une activité de la CaMKII était requise pour les effets de ΔFosB sur la sensibilité comportementale à la cocaïne. 72 h après l’injection virale dans la coquille de Nac, une seule injection de 5 en mg / kg de cocaïne a été administrée aux animaux et leur activité locomotrice a été enregistrée. Comme indiqué précédemment avec une surexpression de AAFosB (AAV) plus étendueFig 4A), La surexpression de ΔFosB médiée par le HSV a augmenté la sensibilité locomotrice à la cocaïne (p = 0.0002; F = 8.823; df = 37; Figue 6F). Comme avec l'induction des épines dendritiques, l'inhibition de l'activité de CaMKII par la coexpression de GFP-AC3I a complètement bloqué l'augmentation de la sensibilité à la cocaïne induite par ΔFosB, indiquant que l'activité de CaMKII est requise pour les altérations induites par ΔFosB dans les effets comportementaux de la cocaïne.

Allez à:

Discussion

La présente étude décrit un nouveau mécanisme à rétroaction avancée dans lequel la cocaïne induit un ΔFosB dans le NAc, qui régule de manière sélective la transcription du gène CaMKIIα dans la coquille de NAc.. Ensuite, CaMKIIα phosphoryle et stabilise ΔFosB, ce qui conduit à une plus grande accumulation de ΔFosB et à une induction accrue de CaMKIIα (Figue 6G). Les niveaux de co-escalade des deux protéines lors d'une exposition chronique à la cocaïne contribuent alors de manière essentielle aux réactions comportementales sensibilisées à la drogue. Cette hypothèse est particulièrement séduisante, car il a été démontré que ΔFosB et CaMKII étaient tous deux nécessaires pour augmenter les réponses comportementales à la cocaïne. (Pierce et al., 1998; Peakman et al., 2003), et nous reproduisons cette constatation pour ΔFosB dans la coquille de NAc en utilisant spécifiquement une approche virale (Figues 4 et de la Et66).

Bien que la surexpression de ΔFosB transgénique dans les MSN de type D1 puisse conduire à l’induction de CaMKII dans les coquilles et le noyau d’animaux naïfs de cocaïne, dans le contexte de la cocaïne, l’accumulation de ΔFosB endogène, qui se produit dans les deux sous-régions, entraîne l’induction de CaMKII spécifiquement dans la coquille . Cette différence pourrait être liée aux niveaux plus élevés de ΔFosB induite dans notre modèle bitransgénique. Toutefois, elle pourrait aussi refléter la capacité de la cocaïne à modifier de manière différentielle le promoteur CaMKIIα dans les couches vs. MSN centraux pour promouvoir la liaison ΔFosB dans la première ou pour l’exclure de la seconde sous-région. En fait, nos données de puce, qui révèlent une désacétylation d'histones induite par la cocaïne au niveau du promoteur du gène CaMKIIα dans le noyau NAc uniquement, appuient la possible implication d'un mécanisme de la chromatine. Conformément à cette hypothèse, la surexpression de ΔFosB dans les MSN de type D1 a été en mesure de déclencher l’induction de CaMKIIα dans le noyau de l’acide NAc en l’absence de cocaïne (Figue 3F), suggérant qu'il existe des modifications actives du promoteur CaMKIIα qui empêchent cette induction lors d'une exposition chronique à la cocaïne. La régulation du paysage chromatinien au niveau du promoteur CaMKII pourrait également expliquer pourquoi la CaMKII est induite par une dose de provocation de cocaïne dans la coquille de Nac de rats sevrés de cocaïne chroniques (Fig 1E) mais non d'animaux naïfs de drogue (Fig 1D). Cela pourrait représenter un effet épigénétique de «priming gene» de ΔFosB (Robison et Nestler, 2011), et pourrait donc être un mécanisme moléculaire de l’incubation du besoin de cocaïne (Pickens et al., 2011). Cependant, pour que ce changement de chromatine soit lié de manière causale à l'incubation de l'état de manque, il devrait augmenter avec le temps. Il sera intéressant de déterminer si tel est le cas et d’étudier si d’autres gènes présentent une régulation dépendante de ΔFosB, spécifique à la sous-région, par la cocaïne. Il est également important de noter que la boucle de feed-forward que nous décrivons ne conduit pas à une accumulation sans fin de CaMKII ou de ΔFosB (Fig 1E) La découverte du «frein» moléculaire responsable de ce phénomène est un objectif important des futures études.

Les fonctions connues de ΔFosB et CaMKII dans plusieurs systèmes expérimentaux et régions du cerveau convergent à plusieurs niveaux (Figue 6F). Les deux molécules sont intimement liées à la croissance de la colonne dendritique: CaMKII interagit avec le cytosquelette d'actine (Okamoto et al., 2009), régule la taille de la colonne vertébrale (Matsuzaki et al., 2004), et est à la fois nécessaire et suffisante pour l’augmentation du nombre de filopodes et de synapses induite par la plasticité dans les cultures de coupes organotypiques de l’hippocampe (Jourdain et al., 2003), wCependant, ΔFosB est à la fois nécessaire et suffisant pour la formation d’épine dendritique induite par la cocaïne dans les MSN NAc (Maze et al., 2010). De plus, les deux molécules ont été associées à la régulation des récepteurs AMPA du glutamate. CaMKII ne régule pas les niveaux totaux des sous-unités du récepteur AMPA, mais commande l’insertion des récepteurs AMPA dans les synapses et augmente la conductance du canal AMPA en phosphorylant GluA1 chez Ser831 dans les neurones pyramidaux de l’hippocampe en culture in vivo (examiné dans (Malinow et Malenka, 2002; Colbran et Brown, 2004)). Ce trafic accru de GluA1 vers la synapse a également été impliqué dans l'action chronique de la cocaïne (Boudreau et Wolf, 2005). De plus, les réponses comportementales à l'activation des récepteurs AMPA dans la NAc sont améliorées par la surexpression de CaMKIIα d'une manière dépendante du récepteur D1 (Singer et al., 2010). Il a été démontré que la surexpression de ΔFosB spécifique à D1 induisait la transcription de GluA2 dans NAc (Kelz et al., 1999), qui atténue les réponses AMPA médiées par GluA1, alors que nous montrons ici que la surexpression de ΔFosB à court terme - ainsi que l’exposition à la cocaïne à court terme - n’ont aucun effet sur cette sous-unité (Fig 1). Néanmoins, nous avons récemment constaté que la surexpression de ΔFosB à court terme réduisait néanmoins les réponses AMPA dans les MSN de type D1 dans NAc (Grueter et al., 2013). Ces données suggèrent des mécanismes temporellement distincts qui pourraient constituer une série de neuroadaptations à la cocaïne dépendantes du temps qui sous-tendent différents aspects de la progression de la toxicomanie encore mal compris. Sur le plan comportemental, CaMKII et ΔFosB sont nécessaires pour la sensibilisation locomotrice à la cocaïne (voir ci-dessus), et les deux sont nécessaires pour une auto-administration prolongée de cocaïne chez les rongeurs (Colby et al., 2003; Wang et al., 2010), suggérant que les deux protéines jouent un rôle important dans l'adaptation comportementale à l'exposition aux médicaments à court et à long terme, bien que via des mécanismes sous-jacents partiellement distincts. On présume que ΔFosB et CaMKII régulent de telles adaptations comportementales complexes en modifiant la fonction synaptique de NAc, bien qu'il reste encore beaucoup à faire pour lier directement les phénomènes synaptiques au changement de comportement.

L’holoenzyme CaMKII interagit simultanément avec diverses protéines associées à la synapse (Robison et al., 2005), dont on pense qu’ils régulent son ciblage sur la densité post-synaptique (PSD), un phénomène considéré comme important pour la plasticité synaptique. En particulier, l’interaction de CaMKII avec la sous-unité GluN2B du récepteur du glutamate de type NMDA s’est récemment avérée réguler à la fois la plasticité synaptique et l’apprentissage (Halt et al., 2012). Alors que le peptide AC3I imite le domaine auto-inhibiteur de la CaMKII et inhibe ainsi l’activité catalytique de l’enzyme, il bloque également de multiples interactions protéine-protéine (Strack et al., 2000; Robison et al., 2005). Ainsi, les effets comportementaux et morphologiques de HSV-GFP-AC3I rapportés ici pourraient être dus à une phosphorylation réduite des protéines cibles de CaMKII, à des modifications du ciblage de CaMKII ou à une modification du rôle structurel proposé par CaMKII au niveau des synapses (Lisman et al., 2002).

La restriction de la boucle ΔFosB-CaMKII proposée à la coquille de NAc est particulièrement intéressante, car des travaux récents ont mis en évidence plusieurs différences physiologiques entre la coquille et le noyau de NAc en réponse à l'administration de cocaïne, notion confirmée par nos données non biaisées iTRAQ (tableau S1). . Les MSN en coquille NAc montrent une diminution de la capacité de tir après une consommation chronique de cocaïne pendant des semaines, tandis que les MSN principaux des mêmes animaux présentent une augmentation transitoire (jour 1-3) de la capacité de tir qui revient aux niveaux de base au cours des semaines 2 (Kourrich et Thomas, 2009). En outre, de nombreuses protéines synaptiques sont régulées de manière différentielle dans les couches de coque de NAc. vs. noyau d'animaux exposés à la cocaïne chronique, y compris GluA2 (Knackstedt et al., 2010). Comme l’amphétamine chronique induit la CaMKIIα spécifiquement dans la coquille de NAc (Loweth et al., 2010), il n’est pas surprenant que nous retrouvions un effet similaire avec la cocaïne. Cependant, comme ΔFosB est induit à la fois dans la coquille et dans le noyau de Nac par la cocaïne chronique (Perrotti et al., 2008), et puisque nous montrons que l'induction de CaMKIIα dans la coquille est dépendante de ΔFosB, nos résultats fournissent de nouvelles preuves de mécanismes de transcription distincts au niveau du promoteur CaMKIIα entre ces deux sous-régions, responsables de l'induction sélective de CaMKIIα dans la coquille.

Un grand nombre de travaux récents ont été consacrés à la délimitation des différences entre les MSN NAc de type D1 et D2. Bien que les récepteurs D1 et D2 soient tous deux impliqués dans les effets gratifiants de la cocaïne (Soi-même, 2010), Des travaux récents démontrent que l'activation optogénétique de MSN de type D1 augmente les réponses comportementales à la cocaïne, alors que l'activation de MSN de type D2 a l'effet inverse (Lobo et al., 2010). Conformément à ces découvertes, les souris knock-out du récepteur D1 présentent un déficit d’acquisition de l’auto-administration de cocaïne (Caine et al., 2007), alors que les knockouts D2 ne sont pas (Caine et al., 2002). L'administration directe d'agonistes D1 dans l'ANc déclenche un comportement de recherche de cocaïne dans les paradigmes de réintégration (Soi-même, 2010). Fait intéressant, cet effet nécessite des augmentations de l’activité de la CaMKII dépendantes du récepteur D1 dans la coquille de NAc, mais pas du cœur (Anderson et al., 2008), résultat qui se marie bien avec la boucle ΔFosB-CaMKII spécifique à D1 et à l’enveloppe proposée ici.

Nous avons précédemment signalé que Ser27 dans ΔFosB peut être phosphorylé par la caséine kinase-2 (Ulery et al., 2006), cependant, nous établissons ici que CaMKII phosphoryle ΔFosB sur ce site et sur d’autres avec une cinétique et une stoechiométrie bien plus grandes et peut reproduire le M apparent supérieurr observé pour ΔFosB (Fig 5A) avec exposition à la cocaïne in vivo (Nestler, 2008). Nous savons déjà que la phosphorylation de Ser27 augmente la stabilité et l'activité transcriptionnelle de ΔFosB (Ulery et al., 2006; Ulery et Nestler, 2007; Ulery-Reynolds et al., 2009) Les travaux futurs porteront maintenant sur l'identification et les conséquences fonctionnelles de nouveaux sites de phosphorylation de ΔFosB indiqués dans la présente étude.

La boucle de feed-forward décrite ici fournit un nouveau mécanisme plausible par lequel une administration répétée de cocaïne entraîne des anomalies progressives dans le NAc. En tant que telle, cette voie biochimique peut constituer une cible importante pour une future intervention thérapeutique dans les troubles de dépendance. La CaMKII étant omniprésente et nécessaire à de nombreuses fonctions neuronales et comportementales de base, l’utilisation directe d’inhibiteurs de la CaMKII a été évitée en tant que traitement de la toxicomanie. Nos données suggèrent qu'un ciblage plus subtil du mécanisme d'induction de CaMKII, qui est spécifique à un type de cellule individuel et à une sous-région du circuit de récompense du cerveau, pourrait fournir une cible thérapeutique qui éviterait les complications de l'inhibition systémique de CaMKII.

Allez à:

Remerciements

Ce travail a été financé par des subventions de l'Institut national de lutte contre l'abus des drogues (RJE), du Centre de protéomique NIDA-Yale DA018343 (AJR et RJE) et de la Fondation Hartwell (AJR). Les auteurs souhaitent remercier Gabby Rundenko pour le généreux don de ΔFosB purifié et Roger Colbran pour le généreux don de CaMKIIα purifié.

Allez à:

Références

  1. Ahmed SH, Koob GF. Passage d'un apport modéré à un excès de médicament: modification du point de consigne hédonique. Science. 1998; 282: 298 – 300. [PubMed]
  2. Anderson SM, célèbre KR, Sadri-Vakili G, Kumaresan V, Schmidt HD, Basse CE, Terwilliger EF, Cha JH, Pierce RC. CaMKII: un pont biochimique reliant les systèmes de dopamine et de glutamate d'Accumbens à la recherche de cocaïne. Nat Neurosci. 2008; 11: 344 – 353. [PubMed]
  3. Boudreau AC, Wolf ME. La sensibilisation comportementale à la cocaïne est associée à une expression accrue de la surface du récepteur AMPA dans le noyau accumbens. J Neurosci. 2005; 25: 9144 – 9151. [PubMed]
  4. DA Brickey, RJ Colbran, Fong YL, TR Soderling. Expression et caractérisation de la sous-unité alpha de la protéine kinase II dépendante de Ca2 + / calmoduline à l'aide du système d'expression du baculovirus. Biochem Biophys Res Commun. 1990; 173: 578 – 584. [PubMed]
  5. Caine SB, SS Negus, Mello NK, S Patel, L Bristow, J Kulagowski, D Vallone, Saiardi A, Borrelli E. Rôle des récepteurs dopaminergiques de type D2 dans l'auto-administration de cocaïne: études sur les souris mutantes du récepteur D2 et le nouveau récepteur D2 antagonistes. J Neurosci. 2002; 22: 2977 – 2988. [PubMed]
  6. Caine SB, Thomsen M., Gabriel KI, Berkowitz JS, Or LH, Koob GF, Tonegawa S, Zhang J, Xu M. Absence d'auto-administration de cocaïne chez des souris knock-out du récepteur de la dopamine D1. J Neurosci. 2007; 27: 13140 – 13150. [Article gratuit PMC] [PubMed]
  7. Carle TL, Ohnishi YN, Ohnishi YH, Alibhai IN, Wilkinson MB, Kumar A, Nestler EJ. Mécanismes dépendants et indépendants du protéasome pour la déstabilisation de FosB: identification des domaines de FonB degron et implications pour la stabilité de DeltaFosB. Eur J Neurosci. 2007; 25: 3009 – 3019. [PubMed]
  8. Chen J, MB Kelz, G Zeng, N Sakai, C Steffen, PE Shockett, MR Picciotto, RS Duman, EJ Nestler. Animaux transgéniques à expression génique ciblée et inductible dans le cerveau. Mol Pharmacol. 1998; 54: 495 – 503. [PubMed]
  9. Christoffel DJ, Golden SA, Dumitriu D, Robison AJ, Janssen WG, Ahn HF, Krishnan V, Reyes CM, Han MH, Ables JL, Eisch AJ, Dietz DM, Ferguson D, Neve RL, Greengard P, Kim Y, Morrison JH Russo SJ. La kinase IkappaB régule la défaite sociale, la plasticité comportementale et synaptique induite par le stress. J Neurosci. 2011; 31: 314 – 321. [Article gratuit PMC] [PubMed]
  10. Colbran RJ. Inactivation de la protéine kinase II dépendante de Ca2 + / calmoduline par autophosphorylation basale. J Biol Chem. 1993; 268: 7163 – 7170. [PubMed]
  11. Colbran RJ. Protéines phosphatases et plasticité synaptique dépendant de la protéine kinase II dépendante du calcium / calmoduline. J Neurosci. 2004; 24: 8404 – 8409. [PubMed]
  12. Colbran RJ, Brown AM. Protéine kinase II dépendante du calcium / calmoduline et plasticité synaptique. Voir Opin Neurobiol. 2004; 14: 318 – 327. [PubMed]
  13. Colby CR, Whisler K, C Steffen, Nestler EJ, Self DW. La surexpression de DeltaFosB spécifique au type de cellule striatale renforce l’incitation à la cocaïne. J Neurosci. 2003; 23: 2488 – 2493. [PubMed]
  14. Covington HE, 3rd, Maze I, LaPlant QC, Vialou VF, Ohnishi YN, Berton O, Fass DM, Renthal W, Rush AJ, XEUMXrd, Wu EY, Ghose S, Krishnan V, Russo SJ, Tamminga C, Hagmingy SJ, Nestler EJ. Actions antidépressives des inhibiteurs de l’histone déacétylase. J Neurosci. 3; 2009: 29 – 11451. [Article gratuit PMC] [PubMed]
  15. Davalos A, C Fernandez-Hernando, Sowa G, B Derakhshan, Lin MI, Lee JY, H Zhao, R Luo, C Colangelo, WC Sessa. Protéomique quantitative des protéines régulées par la cavéoline-1: caractérisation de la polymérase i et du facteur de libération du transcrit / cellules CAVIN-1 IN dans les cellules endothéliales. Protéomique des cellules de Mol. 2010; 9: 2109 – 2124. [Article gratuit PMC] [PubMed]
  16. Dumais A, AD Lesage, Alda M, Rouleau G, Dumont M, Chawky N, Roy M, JJ Mann, Benkelfat C et Turecki G. Facteurs de risque d'achèvement du suicide dans la dépression majeure: étude cas-témoins de comportements impulsifs et agressifs dans Hommes. Suis J psychiatrie. 2005; 162: 2116 – 2124. [PubMed]
  17. Grueter BA, AJ Robison, Neve RL, Nestler EJ, Malenka RC. ΔFosB module différentiellement la fonction de voie directe et indirecte du noyau accumbens. Proc Natl Acad Sci USA. 2013 sous presse. [Article gratuit PMC] [PubMed]
  18. Arrêt AR, Dallapiazza RF, Zhou Y, Stein IS, Qian H, S Juntti, S Wojcik, N Brose, Silva AJ, Hell JW. La liaison de CaMKII à GluN2B est critique lors de la consolidation de la mémoire. EMBO J. 2012; 31: 1203 – 1216. [Article gratuit PMC] [PubMed]
  19. Hiroi N, Brown JR, Haile CN, Ye H, Greenberg ME, Nestler EJ. Souris mutantes FosB: perte de l'induction chronique de la cocaïne des protéines liées à Fos et sensibilité accrue aux effets psychomoteurs et gratifiants de la cocaïne. Proc Natl Acad Sei US A. 1997; 94: 10397-10402. [Article gratuit PMC] [PubMed]
  20. Ito R, TW Robbins, Everitt BJ. Contrôle différentiel du comportement de recherche de cocaïne par le noyau accumbens et la coquille. Nat Neurosci. 2004; 7: 389 – 397. [PubMed]
  21. Jorissen HJ, Ulery PG, Henry L, Gourneni S, Nestler EJ, Rudenko G. Propriétés de dimérisation et de liaison à l'ADN du facteur de transcription DeltaFosB. Biochimie. 2007; 46: 8360 – 8372. [PubMed]
  22. Jourdain P, Fukunaga K, Muller D. La protéine kinase II dépendante du calcium / calmoduline contribue à la croissance des filopodes et à la formation de la colonne vertébrale dépendante de l'activité. J Neurosci. 2003; 23: 10645 – 10649. [PubMed]
  23. Kelz MB, Chen J, Carlezon WA, Jr, Whisler K, Gilden AM, Beckmann AM, Steffen C, Zhang YJ, L Marotti, Self DW, Tkatch T, Baranauskas G, DJ Surmeier, Neve RL, Duman RS, Duman RS, Picciotto MR, Nestler EJ. L'expression du facteur de transcription deltaFosB dans le cerveau contrôle la sensibilité à la cocaïne. La nature. 1999; 401: 272 – 276. [PubMed]
  24. Klug JR, BN Mathur, Kash TL, HD Wang, RT Matthews, AJ Robison, ME Anderson, AY Deutch, DM Lovinger, RJ Colbran, DG Winder. Inhibition Génétique De CaMKII Dans Les Neurones Épineux Moyens Striataux Dorsaux Réduit Les Synapses Excitatrices Fonctionnelles Et Améliore L'excitabilité Intrinsique. PLoS One. 2012; 7: e45323. [Article gratuit PMC] [PubMed]
  25. Knackstedt LA, K Moussawi, R Lalumiere, M Schwendt, M Klugmann, Kalivas PW. L'entraînement à l'extinction après une auto-administration de cocaïne induit une plasticité glutamatergique pour empêcher la recherche de cocaïne. J Neurosci. 2010; 30: 7984 – 7992. [Article gratuit PMC] [PubMed]
  26. Kourrich S, Thomas MJ. Neurones similaires, adaptations opposées: l’expérience psychostimulante modifie de façon différentielle les propriétés de mise à feu dans le noyau d’accumbens par rapport à la coque. J Neurosci. 2009; 29: 12275 – 12283. [Article gratuit PMC] [PubMed]
  27. Kourrich S, Klug JR, M Mayford, Thomas MJ. L'effet indépendant d'AMPAR de l'alphaCaMKII striatal favorise la sensibilisation de la cocaïne. J Neurosci. 2012; 32: 6578 – 6586. [Article gratuit PMC] [PubMed]
  28. LaPlant Q, Chakravarty S, Vialou V, Mukherjee S, Koo JW, G Kalahasti, Bradbury KR, Taylor SV, Maze I, Kumar A, Graham A, Birnbaum SG, Krishnan V, Truong HT, Neve RL, Neve RL, Nestler EJ, Russo SJ . Rôle du facteur nucléaire kappaB dans l'hypersensibilité au stress induite par les hormones ovariennes chez la souris femelle. Biol Psychiatry. 2009; 65: 874 – 880. [Article gratuit PMC] [PubMed]
  29. Lee KW, Kim Y, Kim AM, Helmin K, Nairn AC, Greengard P. Formation de la colonne vertébrale dendritique induite par la cocaïne dans les neurones à épine moyenne du récepteur dopaminergique D1 et D2 dans le noyau accumbens. Proc Natl Acad Sci US A. 2006; 103: 3399 – 3404. [Article gratuit PMC] [PubMed]
  30. Lisman J, Schulman H, Cline H. La base moléculaire de la fonction CaMKII dans la mémoire synaptique et comportementale. Nat Rev Neurosci. 2002; 3: 175 – 190. [PubMed]
  31. Lobo MK, Covington HE, 3rd, Chaudhury D, Friedman AK, Sun H, Damez-Werno D, Dietz DM, Zaman S, Koo JW, PJ Kennedy, Mouzon E, Mogri M, Neve RL, Deisseroth K, Han MH, Nestler EJ. La perte de signalisation de BDNF spécifique à un type de cellule imite le contrôle optogénétique de la récompense de la cocaïne. Science. 2010; 330: 385 – 390. [Article gratuit PMC] [PubMed]
  32. Loweth JA, Baker LK, T Guptaa, Guillory AM et Vezina P. L'inhibition de la CaMKII dans la coque du noyau accumbens diminue l'ingestion accrue d'amphétamine chez les rats sensibilisés. Neurosci Lett. 2008; 444: 157 – 160. [Article gratuit PMC] [PubMed]
  33. Loweth JA, chanteur BF, Baker LK, Wilke G, Inamine H, Bubula N, Alexander JK, Carlezon WA, Jr, Neve RL, Vezina P. Surexpression transitoire d'alpha-Ca2 + / protéine dépendante de la calmoduline dans la coque du noyau accumbens améliore la réponse comportementale à l'amphétamine. J Neurosci. 2010; 30: 939 – 949. [Article gratuit PMC] [PubMed]
  34. Malinow R, Malenka RC. Trafic des récepteurs AMPA et plasticité synaptique. Annu Rev Neurosci. 2002; 25: 103 – 126. [PubMed]
  35. Matsuzaki M, Honkura N, GC Ellis-Davies, Kasai H. Base structurelle de la potentialisation à long terme des épines dendritiques simples. La nature. 2004; 429: 761 – 766. [PubMed]
  36. Mayford M, Bach ME, Huang YY, Wang L, RD Hawkins, ER Kandel. Contrôle de la formation de la mémoire par l'expression régulée d'un transgène CaMKII. Science. 1996; 274: 1678 – 1683. [PubMed]
  37. Maze I, Covington HE, 3rd, DM Dietz, LaPlant Q, Renthal W, Russo SJ, Mécanicien M, Mouzon E., Neve RL, Haggarty SJ, Ren Y, Sampath SC, Hurd YL, Greengard P, Tarakhovsky A, Schaefer A, Nestler EJ. Rôle essentiel de l'histone méthyltransférase G9a dans la plasticité induite par la cocaïne. Science. 2010; 327: 213 – 216. [Article gratuit PMC] [PubMed]
  38. McClung CA, Nestler EJ. Régulation de l'expression des gènes et de la récompense de la cocaïne par CREB et DeltaFosB. Nat Neurosci. 2003; 6: 1208 – 1215. [PubMed]
  39. Nestler EJ. La revue. Mécanismes transcriptionnels de la dépendance: rôle de DeltaFosB. Philos Trans R Soc Lond B Biol Sci. 2008; 363: 3245 – 3255. [Article gratuit PMC] [PubMed]
  40. Nye HE, espoir BT, Kelz MB, Iadarola M, Nestler EJ. Études pharmacologiques sur la régulation de l'induction chronique de l'antigène lié au FOS par la cocaïne dans le striatum et le noyau accumbens. J Pharmacol Exp Ther. 1995; 275: 1671 – 1680. [PubMed]
  41. Okamoto K, Bosch M, Hayashi Y. Les rôles de la CaMKII et de la F-actine dans la plasticité structurale des épines dendritiques: une identité moléculaire potentielle d'une étiquette synaptique? Physiologie (Bethesda) 2009; 24: 357 – 366. [PubMed]
  42. Olausson P, Jentsch JD, Tronson N, Neve RL, Nestler EJ, Taylor JR. DeltaFosB dans le noyau accumbens régule le comportement instrumental renforcé et la motivation. J Neurosci. 2006; 26: 9196 – 9204. [PubMed]
  43. Paxinos G, Watson C. Le cerveau de rat en coordonnées stéréotaxiques. 6th Edition. Amsterdam Boston: Academic Press / Elsevier; 2007.
  44. Peakman MC, Colby C, Perrotti LI, Tekumalla P, Carle T, Ulery P, Chao J, Duman C, Steffen C, Monteggia L, Allen MR, Stock JL, Duman RS, McNeish JD, Barrot M, Self DW, Nestler EJ , Schaeffer E. L'expression inductible, spécifique à la région cérébrale, d'un mutant négatif dominant de c-Jun chez des souris transgéniques diminue la sensibilité à la cocaïne. Brain Res. 2003; 970: 73 – 86. [PubMed]
  45. Penzes P, ME Cahill, Jones KA, DP Srivastava. Les signaux convergents CaMK et RacGEF contrôlent la structure et la fonction dendritiques. Trends Cell Biol. 2008; 18: 405 – 413. [PubMed]
  46. Perrotti LI, Y Hadeishi, PG Ulery, M. Barrot, L Monteggia, Duman RS, EJ Nestler. Induction de deltaFosB dans les structures cérébrales liées aux récompenses après un stress chronique. J Neurosci. 2004; 24: 10594 – 10602. [PubMed]
  47. Perrotti LI, RR tisserand, Robison B, Renthal W, Maze I, S Yazdani, Elmore RG, DJ Knapp, Selley DE, Martin BR, Sim-Selley L, Bachtell RK, Self DW, Nestler EJ. Schémas distincts d’induction de DeltaFosB dans le cerveau par des drogues d’abus. Synapse. 2008; 62: 358 – 369. [Article gratuit PMC] [PubMed]
  48. Pickens CL, Airavaara M, Theberge F, S Fanous, Hope BT, Shaham Y. Neurobiologie de l'incubation de la soif de drogue. Tendances Neurosci. 2011; 34: 411 – 420. [Article gratuit PMC] [PubMed]
  49. Pierce RC, EA rapide, Reeder DC, Morgan ZR et Kalivas PW. Les seconds messagers médiés par le calcium modulent l'expression de la sensibilisation comportementale à la cocaïne. J Pharmacol Exp Ther. 1998; 286: 1171 – 1176. [PubMed]
  50. Quirion R, Y Robitaille, Martial J, Chabot JG, Lemoine P, Pilapil C, Dalpe M. Autoradiographie des récepteurs du cerveau humain utilisant des sections d'hémisphère entier: méthode générale permettant de minimiser les artefacts tissulaires. Synapse. 1987; 1: 446 – 454. [PubMed]
  51. Robinson TE, Kolb B. Plasticité structurelle associée à l'exposition à des drogues d'abus. Neuropharmacologie. 2004; 47 (Suppl. 1): 33 – 46. [PubMed]
  52. Robison AJ, Nestler EJ. Mécanismes transcriptionnels et épigénétiques de la dépendance. Nat Rev Neurosci. 2011; 12: 623 – 637. [Article gratuit PMC] [PubMed]
  53. Robison AJ, Bass MA, Jiao Y, MacMillan LB, Carmody LC, Bartlett RK, Colbran RJ. Interactions multivalentes de la protéine kinase II dépendant du calcium / calmoduline avec les protéines de densité postsynaptiques NR2B, densin-180 et alpha-actinine-2. J Biol Chem. 2005; 280: 35329 – 35336. [PubMed]
  54. Ross PL, Huang YN, Marchese JN, Williamson B, Parker K, S Hattan, Khainovski N, Pillai S, Dey S, Daniels S, Purkayastha S, Juhasz P, Martin S, Bartlet-Jones M, He F, Jacobson A, DJ Pappin. Quantification de protéines multiplexées dans Saccharomyces cerevisiae à l'aide de réactifs de marquage isobare réactifs aux amines. Protéomique des cellules de Mol. 2004; 3: 1154 – 1169. [PubMed]
  55. Russo SJ, DM Dietz, D Dumitriu, JH Morrison, RC Malenka, EJ Nestler. La synapse dépendante: mécanismes de plasticité synaptique et structurale du noyau accumbens. Tendances Neurosci. 2010; 33: 267 – 276. [Article gratuit PMC] [PubMed]
  56. Self DW. Dans: Les récepteurs de la dopamine. Neve KA, éditeur. New York: Humana Press; 2010. pp. 479 – 524.
  57. Singer BF, Loweth JA, Neve RL, Vezina P. La surexpression transitoire, à médiation virale, de la protéine kinase II dépendante de l'alpha-calcium / de la calmoduline dans l'enveloppe du noyau accumbens conduit à une régulation positive à long terme de l'alpha-amino-3-hydroxyl-5 -méthyl-4-isoxazole-propionate: récepteur du type dopamine 1 et dépendance à la protéine kinase A. Eur J Neurosci. 2010; 31: 1243 – 1251. [Article gratuit PMC] [PubMed]
  58. Strack S, RB McNeill, RJ Colbran. Mécanisme et régulation de la protéine kinase II calcium / calmoduline-dépendante ciblant la sous-unité NR2B du récepteur N-méthyl-D-aspartate. J Biol Chem. 2000; 275: 23798 – 23806. [PubMed]
  59. Ulery-Reynolds PG, MA Castillo, Vialou V, Russo SJ, Nestler EJ. La phosphorylation de DeltaFosB détermine sa stabilité in vivo. Neuroscience. 2009; 158: 369 – 372. [Article gratuit PMC] [PubMed]
  60. Ulery PG, Nestler EJ. Régulation de l'activité de transcription de DeltaFosB par la phosphorylation de Ser27. Eur J Neurosci. 2007; 25: 224 – 230. [PubMed]
  61. Ulery PG, Rudenko G, Nestler EJ. Régulation de la stabilité du DeltaFosB par phosphorylation. J Neurosci. 2006; 26: 5131 – 5142. [PubMed]
  62. Vialou V, et al. DeltaFosB dans les circuits de récompense du cerveau assure la résilience au stress et aux réponses des antidépresseurs. Nat Neurosci. 2010; 13: 745 – 752. [Article gratuit PMC] [PubMed]
  63. Wang L, Z Z, Hu Z, Sheng J, Hui B, Sun J, Ma L. L'acétylation H3 induite par la cocaïne et l'activation de la transcription de CaMKIIalpha dans le noyau accumbens sont essentielles à la motivation pour le renforcement de la drogue. Neuropsychopharmacologie. 2010; 35: 913 – 928. [Article gratuit PMC] [PubMed]
  64. Werme M, Messer C, Olson L, Gilden L, Thoren P, Nestler EJ, Brene S. Delta FosB régule la roue. J Neurosci. 2002; 22: 8133 – 8138. [PubMed]
  65. Winstanley CA, LaPlant Q, Theobald DE, Green TA, Bachtell RK, Perrotti LI, DiLeone RJ, Russo SJ, Garth WJ, Self DW, Nestler EJ. L'induction de DeltaFosB dans le cortex orbitofrontal induit une tolérance au dysfonctionnement cognitif induit par la cocaïne. J Neurosci. 2007; 27: 10497 – 10507. [PubMed]
  66. Zachariou V, CA Bolanos, DE Selley, D. Theobald, député de Cassidy, MB Kelz, T Shaw-Lutchman, O Berton, LJ Sim-Selley, RJ Dileone, Kumar A, EJ Nestler. Un rôle essentiel pour DeltaFosB dans le noyau accumbens dans l’action de la morphine. Nat Neurosci. 2006; 9: 205 – 211. [PubMed]
  67. Zhang R, Khoo MS, Wu Y, Yang Y, Grueter CE, Ni G, Prix EE, Jr, Thiel W, Guatimosim S, Chanson LS, Madu EC, Shah AN, Vishnivetskaya TA, Atkinson JB, Gurvich VV, Salaman G, Salama G, Lederer WJ, Colbran RJ, Anderson ME. L'inhibition de la calmoduline kinase II protège contre les maladies cardiaques structurelles. Nat Med. 2005; 11: 409 – 417. [PubMed]