Circuit cortical préfrontal pour les comportements liés à la dépression et à l'anxiété induits par la cholécystokinine: rôle de ΔFosB (2014)

Abstrait

Une diminution de l'activité neuronale du cortex préfrontal médian (mPFC) est associée à des comportements analogues à la dépression et à l'anxiété induits par la défaite sociale chez la souris. Cependant, les mécanismes moléculaires sous-tendant la diminution de l'activité de la mPFC et son rôle de précurseur du stress restent inconnus. Nous montrons ici que l’induction du facteur de transcription ΔFosB dans la mPFC, en particulier dans la région prélagique (PrL), induit une susceptibilité au stress. L'induction de ΔFosB dans PrL s'est produite de manière sélective chez les souris sensibles après un stress de défaite sociale chronique, et la surexpression de ΔFosB dans cette région, mais pas dans la zone infralimbique (IL) à proximité, a accru la sensibilité au stress. ΔFosB a produit ces effets en partie par l’induction du récepteur de la cholécystokinine (CCK) -B: le blocage du CCKB dans la mPFC induit un phénotype résistant, alors que l’administration de la CCK dans la mPFC imite les effets anxiogènes et dépresseurs du stress social. Nous avons précédemment constaté que la stimulation optogénétique des neurones mPFC chez des souris sensibles annule plusieurs anomalies comportementales observées après une contrainte de défaite sociale chronique. Par conséquent, nous avons émis l’hypothèse que la stimulation optogénétique des projections corticales permettrait de sauver les effets pathologiques de la CCK dans la mPFC. Après perfusion de CCK dans la mPFC, nous avons stimulé de manière optogénétique les projections de mPFC vers l’amygdale basolatérale ou le noyau accumbens, deux structures sous-corticales impliquées dans la régulation de l’humeur. La stimulation des projections de corticoamygdala a bloqué l'effet anxiogène de la CCK, bien qu'aucun effet n'ait été observé sur d'autres symptômes de défaite sociale. Inversement, la stimulation des projections de corticoaccumbens a inversé les effets de l'évitement social et des préférences préférentielles vis-à-vis du saccharose induits par la CCK, mais non des effets de type anxiogène. Ensemble, ces résultats indiquent que les déficits comportementaux induits par le stress social sont en partie induits par des adaptations moléculaires dans les mPFC impliquant ΔFosB et CCK par le biais de projections corticales vers une cible sous-corticale distincte.s.

Mots clés: accumbens, amygdala, anxiété, CCK, dépression, mPFC

Introduction

Plusieurs régions cérébrales limbiques interconnectées anatomiquement et fonctionnellement, notamment le cortex préfrontal médian, l'hippocampe, l'amygdale et le noyau accumbens (NAc), sont impliquées dans la médiation des symptômes clés de la dépression et de l'anxiété (; ; ; ; , ; ; ). Par exemple, l'absence de rétroaction corticale vers l'amygdale est en corrélation avec les émotions dysphoriques et revient à un niveau normal après un traitement réussi. Les effets antidépresseurs de la stimulation cérébrale profonde du cortex cingulaire sous-sexuel, une zone de mPFC, sont associés à la restauration de l'activité cérébrale corticale et sous-corticale à des niveaux normaux (; ). De même, la stimulation cérébrale profonde de la NAc est un antidépresseur et anxiolytique et est corrélée à une altération du métabolisme de la NAc, de l'amygdale et de la mPFC (; ; ). Ces données confirment l'hypothèse d'un réseau neuronal de troubles de l'humeur dans laquelle les traitements antidépresseurs, quels que soient les mécanismes, normalisent l'activité dans les circuits sous-corticaux corticaux et hyperactifs (; ; ; ; ; ).

Les modèles animaux impliquant une exposition chronique à un stress physique ou psychologique altèrent la structure et la fonction des neurones dans la mPFC (), amygdale (), hippocampe () et NAc (; ). Stress de défaite sociale chronique, un modèle de dépression éthologiquement valide (), diminue l'activité neuronale de la mPFC, comme l'indique la réduction de l'expression de Zif268 et de c-Fos (; ). En outre, la stimulation optogénétique de la mPFC corrige ces déficits et exerce des effets analogues à ceux des antidépresseurs (), confirmant l’importance de la mPFC dans les phénomènes liés à l’humeur. TLes mPFC de rongeurs, comme chez les primates, contrôlent le comportement émotionnel en partie par le biais de projections sur l'amygdale basolatérale (BLA) et sur l'ANc (; ; ). Néanmoins, les mécanismes moléculaires qui interviennent dans ce rôle de mPFC restent inconnus.

La présente étude portait initialement sur ΔFosB, un facteur de transcription stable qui est induit dans le NAc par le stress de défaite sociale chronique où il s’oppose à la susceptibilité au stress. (). Nous avons effectué une cartographie à l’échelle du cerveau de l’induction du ΔFosB après le stress de la défaite et avons trouvé, de manière similaire aux études précédentes; ; ), induction robuste en mPFC. De manière surprenante, nous avons constaté qu'une telle induction de ΔFosB dans les mPFC favorise la sensibilité au stress. Nous avons identifié le récepteur de la cholécystokinine (CCK) -B en tant que cible moléculaire de ΔFosB dans la mPFC, où la neurotransmission de CCKergic a été impliquée dans les effets anxiogènes et dépressogènes du stress social (, ). Nous avons constaté que l'activité de CCK dans la mPFC est à la fois nécessaire et suffisante pour atténuer les effets du stress social sur l'anxiété et la dépression. De plus, en utilisant des approches optogénétiques, nous démontrons des actions spécifiques de la CCK dans les sous-circuits de mPFC: CCK dans les projections de mPFC-BLA médie les symptômes d'anxiété, tandis que la CCK dans les projections de mPFC-NAc médie les symptômes de dépression.

Matériels et méthodes

Expérience 1: cartographie à l'échelle du cerveau de l'induction de ΔFosB par le stress de défaite sociale chronique.

Des souris mâles C57BL / 6J âgées de huit semaines ont été soumises à un stress de défaite sociale chronique pendant 10 jours consécutifs, comme décrit précédemment (; ; ) (voir Tableau 1; Fig. 1A). En résumé, chaque souris a été exposée à une souris reproductrice retraitée mâle CD1 agressive et inconnue pendant 5 min par jour. Après interaction directe avec l'agresseur CD1 (5 min), les animaux ont été placés dans un compartiment adjacent de la même cage pour le prochain 24 h avec un contact sensoriel, mais non physique. Les animaux témoins ont été hébergés dans des cages équivalentes mais avec des membres de la même souche. Les tests d’interaction sociale ont été réalisés 24 h après le dernier jour de la défaite. L'évitement social envers une souris mâle CD1 inconnue a été évalué selon les protocoles publiés. Le temps passé dans la «zone d'interaction» (un couloir large de 8 autour de la cage) a été mesuré. La séparation des souris vaincues en sous-populations sensibles et résilientes a été réalisée comme décrit précédemment (; ). Étant donné que la majorité des souris témoins passent plus de temps à interagir avec une cible sociale qu'avec une enceinte cible vide, un rapport d'interaction de 100 (temps égal passé dans la zone d'interaction en présence vs absence d'une cible sociale) est utilisé comme seuil: les souris avec des scores <100 sont étiquetées comme «sensibles» et celles avec des scores ≥ 100 comme «résilientes». Des analyses comportementales, biochimiques et électrophysiologiques approfondies appuient la validité de ces sous-populations distinctes sensibles et résilientes (; ; ).

Tableau 1.  

Nombre moyen (± SEM) de noyaux immunoréactifs au FosB par mm2 dans les zones cérébrales contrôlées, sensibles et résilientes 24 h après un stress de défaite sociale chronique (10 d)
Figure 1.  

L'induction de ΔFosB dans les mPFC favorise la sensibilité au stress. A, Microphotographies représentatives de l’immunohistochimie de ΔFosB dans la mPFC 24 h après le dernier épisode de défaite sociale 10. B, L'induction de ΔFosB ne se produit pas chez GABAergic ...

Juste après le test d'interaction sociale, les souris ont été anesthésiées et perfusées par voie intracardique avec 4% paraformaldéhyde / PBS. Nombre de cellules pour ΔFosB+ neurones dans NAc ont été réalisés comme décrit précédemment (). Les cerveaux ont été cryoprotégés avec 30% saccharose et des coupes coronales (30 µm) ont été découpées sur un microtome à congélation et traitées pour immunohistochimie. Les sections flottantes ont été préincubées dans un tampon de blocage contenant 0.3% Triton et 3% sérum de chèvre normal. ΔFosB a été détecté à l'aide d'anticorps polyclonaux de lapin dirigés contre la partie N-terminale de la protéine (1 / 1000 Santa Cruz Biotechnology, catalogue n ° sc-48) dans le même tampon, puis traités avec des anticorps IgG anti-lapin de chèvre biotinylés et de l'avidine-biotine méthode du complexe peroxydase avec DAB comme substrat (Vector Laboratories). Les temps d'incubation de la diaminobenzidine ont été maintenus constants pour toutes les conditions (100). Les tranches ont été montées, déshydratées et recouvertes d'une lamelle. Les cellules immunopositives ΔFosB présentaient une coloration brune spécifique dans le noyau et étaient quantifiées par un observateur aveugle des conditions de traitement à l'aide d'un microscope (grossissement 20). Trois sections du cerveau sélectionnées couvrant chaque zone du cerveau ont été choisies par souris pour la quantification. La ségrégation anatomique de chaque région cérébrale a été réalisée en comparant la section avec l'atlas cérébral de souris Paxinos. Les conditions d'immunohistochimie ont été optimisées pour réduire les niveaux de fond au minimum permettant l'identification correcte des cellules ΔFosB positives. Les valeurs moyennes ont été calculées pour chaque animal et considérées comme une observation individuelle pour l'analyse statistique. Bien que l'anticorps utilisé reconnaisse à la fois ΔFosB et FosB de longueur complète, nous savons par Western blot que seul ΔFosB est détectable dans les conditions étudiées (; ).

Expérience 2: identification du phénotype neuronal ΔFosB induit par le stress social dans la mPFC.

Pour examiner l’expression de ΔFosB dans les neurones GABAergiques corticaux, nous avons utilisé des tissus de souris GAD2-tdTomato exposées à un stress de défaite sociale chronique et colorées pour ΔFosB comme décrit ci-dessus (voir plus haut). Fig. 1B). Les souris ont été générées par reproduction de souris GAD2-Cre knock (Gad2tm2 (cre) Zjh / J; numéro d’action JAX 010802) () avec (B6.Cg-Gt (ROSA) 26Sortm9 (CAG-tdTomato) Hze / J; numéro d’action JAX 007908) portant un tdTomato à contrôle de floxed-stop (variante RFP).

Expérience 3: effets sur le comportement de la surexpression de ΔFosB dans le cortex pré-limique (PrL) et infralimbique (IL).

Une chirurgie stéréotaxique a été réalisée sur des souris mâles adultes (semaines 8) pour injecter HSV-AFOSB-GFP ou HSV-GFP dans les régions PrL ou ​​IL de mPFC. En bref, les souris ont été anesthésiées en utilisant un mélange de kétamine (10 mg / kg) et de xylazine (1 mg / kg), et les coordonnées stéréotaxiques suivantes ont été utilisées pour la délivrance virale de PrL: 1.8 mm (antérieur / postérieur), 0.65 mm (latéral). ), -2.2 mm (dorsal / ventral); et pour IL: 1.9 mm (antérieur / postérieur), 0.75 mm (latéral), −2.8 mm (dorsal / ventral) à un angle de 10 ° par rapport à la ligne médiane (par rapport au bregma). Un total de 0.5 μl de virus purifié a été administré bilatéralement sur une période 5 min (0.1 μl / min), suivie de 5 min de repos. Les sites d’injection virale ont été confirmés par les méthodes histologiques standard (voir Fig. 1C). Bien qu’il ne soit pas possible de cibler sélectivement PrL versus IL chez la souris avec une précision parfaite, les données dans Figure 1C illustrer qu'il est très possible de cibler principalement une région ou une autre. En effet, les effets comportementaux distincts obtenus en ciblant les deux régions (voir Résultats) confirment cette approche. Le premier lot de souris a été utilisé exclusivement dans une expérience de défaite sociale sous-maximale (voir Fig. 1D). Trois jours après l'opération, les souris ont subi deux défaites consécutives le même jour, puis testées pour l'interaction sociale 24 h plus tard. Cette procédure de défaite sous-maximale a été validée précédemment pour révéler des phénotypes de prosusceptibilité suite à des manipulations génétiques (; ).

Un second lot de souris a été utilisé pour tester les comportements angoissants et dépressifs basaux (voir Fig. 1E – J). Un jour après l'opération, les souris ont été habituées à une solution de saccharose 1% (p / v). Le jour suivant, les souris pouvaient choisir entre une bouteille d’eau et une bouteille de solution 1% saccharose, commutée quotidiennement. La consommation de solution de saccharose pour 24 h a été mesurée les quatrième et cinquième jours après la chirurgie et exprimée en pourcentage de la quantité totale de liquide ingérée. Les souris ont été testées dans le champ libre (jour 3), le labyrinthe élevé plus (jour 4), les interactions sociales (jour matin 5) et la nage forcée (jour 5 après-midi) sur la base de protocoles publiés (). Nous avons constaté qu'avec cet ordre de tests, les résultats des tests suivants ne sont pas affectés par les tests précédents () L'activité des souris en champ libre a été enregistrée pour 5 min à l'aide d'un système de vidéotraquage (Ethovision) dans des conditions de lumière rouge. Le labyrinthe surélevé et composé de deux pistes droites se croisant placées à une hauteur de 60 cm au-dessus du sol et divisées en deux bras ouverts et deux bras fermés. Les souris ont été individuellement placées au centre du labyrinthe et autorisées à explorer librement chaque bras pendant une période de 5 min. Dans les tests en champ ouvert et en élévation avec labyrinthe, le temps passé respectivement au centre et aux bras ouverts a été utilisé comme indice inverse des réponses liées à l’anxiété. Un test de nage forcée d'une journée a été réalisé pendant une période de 5 min. L’augmentation du temps d’immobilité au cours de l’essai de natation forcée a été interprétée comme un comportement semblable à celui d’une prodepression. Ce test quotidien 1 a été largement utilisé chez la souris et validé comme mesure de validité prédictive, dans la mesure où les antidépresseurs réduisent les temps d'immobilité.

Enfin, un groupe distinct de souris a été injecté du HSV-ΔFosB au sein de mFCO et testé pour l’interaction sociale après une défaite sous-maximale (voir Fig. 1K).

Les vecteurs HSV ont été obtenus auprès de Rachael Neve (Massachusetts Institute of Technology). Les gènes d'intérêt (ΔFosB et GFP) sont sous un promoteur CMV. Ces vecteurs ont été largement validés dans des publications antérieures (par exemple, ).

Expérience 4: effets du stress social chronique sur les niveaux de récepteurs CCKB dans les mPFC.

À 24 h après le test d’interaction sociale, les cerveaux ont été rapidement retirés et tranchés en série, et la mPFC a été rapidement disséquée et congelée sur de la neige carbonique (voir Fig. 2A,B) L’isolement de l’ARN, la qPCR et l’analyse des données ont été réalisés comme décrit précédemment (; ) L'ARN a été isolé avec le réactif TriZol (Invitrogen) et a été ensuite purifié avec les micro-kits RNAeasy de QIAGEN. Il a été déterminé que tous les échantillons d’ARN avaient des valeurs 260 / 280 et 260 / 230 ≥1.8. La transcription inverse a été réalisée avec iScript (Bio-Rad). La qPCR utilisant SYBR Green (Quanta) a été réalisée avec un système PCR PCR 7900HT Applied Biosystems avec les paramètres de cycle suivants: 2 min à 95 ° C; Cycles 40 de 95 ° C pour 15, 59 ° C pour 30 et 72 ° C pour 33; et le chauffage gradué à 95 ° C pour générer des courbes de dissociation pour la confirmation de produits PCR simples. Les données ont été analysées en comparant Ct valeurs de la condition de traitement (souris sensibles ou résilientes vs contrôle, ou HSV-AFOSB vs HSV-GFP) avec le ΔΔCt méthode () Les amorces qPCR sont les suivantes: ΔFosB, avant, AGGCAGAGCTGGAGTCGGAGAT et inverse, GCCGAGGACTTGAACTTCACTCG; CCKB, avant, ACCCTTTATGCGGTGATCTTTC et inverse, ATGAGCACGTTTCCGCCAA; CCK, avant, AGCGCGATACATCCAGCAG et inverser, ACGATGGGTATTCGTAGTCCTC; GAPDH, avant, AGGTCGGTGTGAACGGATTTG et inverse, TGTAGACCATGTAGTTGAGGTCA.

Figure 2.  

Le blocage du récepteur CCKB a un effet semblable à un antidépresseur, proresilience. A, La défaite sociale diminue les niveaux de récepteurs de la CCKB dans la mPFC uniquement chez des souris résilientes (n = 8 – 10). *p <0.05, par rapport au contrôle (ANOVA à un facteur). **p <0.05 ...
Expérience 5: effets de ΔFosB sur les taux de récepteurs CCKB et de cFos.

Des souris ont reçu une injection intra-PrL de HSV-AFOSB. À 72 h après la chirurgie, au plus fort de la surexpression virale, les sites d’injection ont été disséqués au microscope à fluorescence (voir Fig. 2C) L'isolement de l'ARN, la qPCR et l'analyse des données ont été effectués comme décrit ci-dessus. Les amorces qPCR sont les suivantes: c-fos, avant, AATCCGAAGGGAACGGAATAAGA et inverse, TGCAACGCAGACTTCTCATCT.

Expérience 6: effets du blocage de ΔFosB sur les niveaux et la résilience des récepteurs CCKB induits par le stress.

Des souris adultes ont reçu une injection bilatérale de HSV-GFP ou de HSV-ΔJunD dans PrL (voir Fig. 2D – F) ΔJunD est un mutant tronqué N-terminal de JunD qui agit comme un antagoniste dominant-négatif de ΔFosB. Les souris ont subi une défaite sociale deux fois par jour pour 5 d. Ce protocole de défaite sociale accélérée, raccourci pour coïncider avec la période d’expression maximale du transgène du HSV, a déjà été utilisé et a induit des niveaux maximaux d’évasion sociale (). À 24 h après le dernier épisode de stress, les souris ont été décapitées sans anesthésie pour éviter les effets des anesthésiques sur les niveaux de protéines neuronales. Le tissu infecté a été retiré dans des inhibiteurs de protéase (Roche) et de phosphatase (Sigma-Aldrich) contenant du PBS en utilisant un poinçon de calibre 15 et immédiatement congelé sur de la glace sèche. Les échantillons ont été homogénéisés par sonication légère dans un tampon RIPA modifié: 10 mm Tris base, 150 mm de chlorure de sodium, 1 mm EDTA, 0.1% SDS, 1% de Triton X-100, 1% de désoxycholate de sodium, pH 7.4 et des inhibiteurs de protéase et de phosphatase comme au dessus. Après addition du tampon de Laemmli, les protéines ont été séparées sur des gels à gradient de polyacrylamaide à 4-15% (Criterion System; Bio-Rad), et le Western blot a été réalisé en utilisant le système Odyssey (Li-Cor) selon les protocoles du fabricant. Les membranes ont été tamponnées avec un anticorps anti-récepteur CCKB (1/1000, Acris, catalogue # AP01421PU-N). Un autre groupe de souris a été injecté avec AAV-ΔJunD ou AAV-GFP dans PrL puis, 5 semaines après la chirurgie pour permettre l'expression maximale du transgène, les souris ont été soumises au protocole de défaite sous-maximale. Ils ont été testés pour l'interaction sociale 24 h après la dernière défaite.

Expérience 7: effets de CI-988, un antagoniste du CCKB intra-mPFC, sur l'évitement social induit par le stress social et l'anhédonie.

Canule bilatérale (distance mm 1.0 / distance canule, mm 1.8 antérieur, injecteur −2.2 mm dorsal / ventral) ciblant la mPFC ont été implantés chez des souris sensibles (voir Fig. 2G,H) Une semaine après la chirurgie, 10 ng de CI-988 a été perfusé directement dans le mPFC, ciblant principalement la PrL. Les souris ont ensuite été testées pour leur comportement en interaction sociale. La préférence pour le saccharose a été mesurée pour le 24 h restant. CI-988 (Tocris Bioscience) a été dissous dans une solution saline, en aliquotes et à l'état congelé. La dilution finale a été préparée le jour de l'expérience. Une expérience supplémentaire a été réalisée chez des souris sensibles avec du CI-988 administré par voie intrapéritonéale (2 en mg / kg) 30 min avant le test d’interaction sociale.

Expérience 8: effets de l'agoniste du CCKB sur la susceptibilité au stress social et l'inversion par stimulation optogénétique des projections de mPFC par le biais de BLA ou de NAc.

AAV-CaMKII-ChR2-EYFP ou AAV-CaMKII-EYFP a été injecté dans le mPFC droit, ciblant à nouveau principalement la PRL (voir Fig. 3A – G) Cinq semaines plus tard, des fibres optiques ont été implantées dans la NAc droite (1.4 antérieur / postérieur, 2.6 latérale, −4.7 dorsale / ventrale à un angle de 25 ° de la ligne médiane) ou dans le BLA (−1.6 antérieur / postérieur, 3.1 latéral, −4.7 latérale / ventral sans angle à partir de la ligne médiane). Au cours de la même intervention chirurgicale, des canules bilatérales ont été implantées dans du mPFC (voir ci-dessus). Des canules et des fibres ont été fixées au crâne avec du ciment dentaire. Les souris ont ensuite été autorisées à récupérer 1 une semaine avant le début des expériences comportementales. Les souris ont été soumises à une défaite sous-maximale, puis testées 24 h plus tard pour déterminer leur interaction sociale, directement suivies d'un labyrinthe élevé plus et d'une préférence au saccharose pour le 24 h restant. À la minute 30 avant le test d'interaction sociale, la moitié des souris ont été perfusées avec CCK-8 (10 ng) dans du mPFC, tandis que l'autre moitié a reçu un véhicule (solution saline). Les souris ont été testées par paires (une souris traitée avec le véhicule et une CCK-8, avec AAV-GFP ou AAV-ChR2). CCK-8 (Sigma) a été dissous dans une solution saline, divisé en aliquotes et congelé. La dilution finale a été préparée le jour de l'expérience.

Figure 3.  

La sensibilité au stress induite par CCK-8 dépend de projections corticales spécifiques. AÀ 24 h après la défaite sociale sous-maximale et à 30 min après la perfusion de CCK-8, les régions de projection de mPFC ont été stimulées au laser lors d’un test d’interaction sociale. Infusion CCK-8 ...

Les stimulations optiques ont été effectuées selon les protocoles publiés () Les fibres optiques (Thor Laboratories) ont été implantées de manière chronique et connectées via un adaptateur FC / PC à une diode laser bleue 473 nm (Crystal Lasers, BCL-473 – 050-M). Un stimulateur (Agilent, #33220A) a été utilisé pour générer des impulsions de lumière bleue. Au cours de toutes les stimulations, des rafales ms 40 d’impulsions de lumière bleue 100 Hz (largeur de pic 9.9 ms) ont été émises tous les 3 vers les régions terminales de BLA ou NAc pendant la durée du test d’interaction sociale uniquement activité. L'intensité de la lumière de la fibre optique a été vérifiée avant chaque utilisation à l'aide d'un capteur de lumière (Thor Laboratories, S130A), et l'intensité de la lumière était égale à 15 mW. Ce protocole de stimulation, précédemment validé électrophysiologiquement (), n’a pas provoqué de convulsions fondées sur des observations comportementales et sur l’absence d’expression de c-Fos en dehors des régions stimulées optogénétiquement ().

Expérience 9: effets de l'agoniste du CCKB sur l'activité neuronale de la mPFC, mesurée par les taux d'ARNm de c-Fos.

Des canules bilatérales ont été implantées sur des souris adultes ciblant le mPFC (voir Fig. 3H) Après une semaine de repos, les souris ont subi une défaite sous-maximale et ont été perfusées avec CCK-8 24 h plus tard. Des poinçons de mPFC ont été prélevés 30 min après la perfusion du médicament et des échantillons ont été préparés pour l'analyse d'ARNm comme décrit ci-dessus.

Logement pour animaux.

Des souris mâles C57BL / 6J âgées de huit semaines (The Jackson Laboratory) ont été utilisées. Toutes les souris ont été habituées à l'animalerie pendant au moins 1 une semaine avant les manipulations expérimentales et ont été maintenues à 23 ° C – 25 ° C selon un cycle lumière / obscurité 12 h (la lumière était allumée à 7: 00 AM) avec ad libitum accès à la nourriture et à l'eau. Les expériences ont été menées conformément aux directives de la Society for Neuroscience et du comité de protection et d'utilisation des animaux en établissement de la faculté de médecine Icahn du mont Sinaï.

Analyses statistiques.

Les données affichées sont exprimées en moyenne ± SEM (représentées par des barres d'erreur). Des ANOVA unidirectionnelles ont été utilisées pour comparer les moyennes entre les souris témoins, les souris sensibles et les souris résilientes dans les analyses immunohistochimiques, biochimiques et comportementales. Des ANOVA unidirectionnelles ont été utilisées pour comparer les moyennes entre la surexpression de GFP-contrôles et ΔFosB dans PrL ou ​​IL dans les tests de préférences en champ ouvert, labyrinthe surélevé et élevé, la nage forcée et le saccharose. Des ANOVA à deux voies ont été utilisées pour comparer les moyennes entre les contrôles GFP, ΔFosB-PrL et ΔFosB-IL dans le test d'interaction sociale. Des ANOVA à deux voies ont été utilisées pour comparer les effets de CCK-8 avec ou sans stimulation optogénétique dans toutes les expériences comportementales, ainsi que l'effet de la surexpression de ΔFosB ou de la perfusion de CI-988 sur l'évitement social. Le cas échéant, post hoc les analyses ont été effectuées à l'aide d'un appareil Bonferroni post hoc tester. Élèves t des tests ont été utilisés pour comparer les effets moyens de la perfusion de CI-988 sur les tests de préférence au saccharose et à la nage forcée, et de CCK-8 sur c-Fos niveaux d'ARNm. Les différences entre les conditions expérimentales ont été considérées comme statistiquement significatives lorsque p ≤ 0.05.

Resultats

Cartographie à l'échelle du cerveau de l'induction de ΔFosB par le stress de défaite sociale chronique

Nous avons d’abord étudié l’induction de ΔFosB par immunohistochimie chez des souris témoins, sensibles et résilientes, après un stress chronique (10 d) de défaite sociale, en mettant l’accent sur les régions du cerveau antérieur et du cerveau moyen impliquées précédemment dans les réponses au stress. Les animaux ont été analysés 24 h après le dernier épisode de défaite. Le stress social chronique induit ΔFosB dans de nombreuses zones du cerveau avec des profils distincts observés entre les souris résilientes et les souris sensibles. Comme représenté sur la Tableau 1 et Figure 1A, IL, BLA, gyrus denté de l'hippocampe, striatum dorsal et noyau NAc ont montré une activation préférentielle chez des souris résilientes; ces résultats dans NAc sont cohérents avec les résultats publiés () En contraste frappant, les souris sensibles ont montré une plus grande induction dans PrL, le septum latéral et le noyau de stria terminalis au lit. Plusieurs régions du cerveau ont montré une induction comparable de ΔFosB chez des souris sensibles et résilientes; ceux-ci comprenaient le cortex orbitofrontal (OFC, une autre zone de PFC), la coquille de NAc, le raphé dorsal et le gris périaqueducal (PAG).

Pour identifier le sous-type neuronal affichant l'induction de ΔFosB dans les régions corticales, les souris GAD2-tdTomato ont été soumises à un stress de défaite sociale chronique. L’immunoréactivité de ΔFosB chez les souris sensibles était indétectable dans les neurones GABAergiques (Fig. 1B), qui confirme des résultats antérieurs d’induction spécifique de ΔFosB dans les neurones pyramidaux corticaux après d’autres formes de stress chronique () Chez les souris témoins non infestées, Les valeurs initiales de ΔFosB dans les régions du cerveau étaient similaires à celles rapportées dans les études précédentes (, ) avec des niveaux basaux beaucoup plus élevés dans le NAc et le striatum dorsal par rapport à toute autre région, à l'exception du gyrus denté qui présente des niveaux comparables à ceux des régions striatales (Tableau 1).

ΔFosB dans les mPFC favorise la sensibilité au stress

Pour donner suite à ces résultats, nous nous sommes concentrés sur PrL car nous avions montré précédemment que l'activation optogénétique de cette région exerçait des effets analogues à ceux des antidépresseurs dans le paradigme de la défaite sociale (). Pour tester les conséquences fonctionnelles de l'induction du ΔFosB dans cette région du cerveau, nous avons surexprimé le ΔFosB sur le plan viral dans le PrL de souris témoins. (Fig. 1C) et les a soumis à un stress sous-maximal de défaite sociale, qui n’induit pas l’évitement social chez les animaux normaux. Les souris surexprimant ΔFosB dans PrL étaient plus susceptibles de subir une défaite sociale que les souris témoins injectées avec GFP, en ce sens qu'elles présentaient un comportement d'évitement social après une défaite sociale sous-maximale (interaction, F(2,38) = 2.847, p > 0.05, effet principal du virus, F(2,38) = 6.013, p <0.05; Post-test de Bonferroni t = 2.447, p <0.05) (Fig. 1D) Ces souris ont également montré une immobilité accrue lors d’un test de nage forcée par jour 1 (F(2,31) = 6.448, p <0.05; Post-test de Bonferroni t = 3.518, p <0.05) (Fig. 1E), un effet opposé à celui produit par les antidépresseurs. En revanche, la surexpression de ΔFosB dans PrL n’a pas modifié plusieurs mesures de base du comportement analogue à l’anxiété, de la préférence en saccharose, des interactions sociales ou de l’activité locomotrice (Fig. 1F – J) Ensemble, ces résultats confortent l'hypothèse selon laquelle l'induction sélective de ΔFosB dans PrL de souris sensibles contribue à la vulnérabilité au stress et à ses conséquences néfastes. En revanche, la surexpression de ΔFosB dans une autre région de mPFC, IL, n’a eu aucun effet sur les comportements émotionnels de base ni sur les réponses au stress de défaite sociale (Fig. 1D – J), considérant que la surexpression de ΔFosB dans l'OFC médian tendait à favoriser la résilience à la défaite sociale chronique, bien que cet effet n'ait pas atteint une signification statistique (interaction, F(1,31) = 1.741, p > 0.05, effet principal du temps d'interaction, F(1,31) = 14.170, p <0.05; Post-test de Bonferroni t = 3.860, p <0.05 dans le groupe GFP; t = 1.960, p <0.05 dans le groupe ΔFosB; effet du virus, t = 2.447, p <0.05) (Fig. 1K).

ΔFosB favorise l'induction de CCKB dans les mPFC

Un grand nombre de preuves soutient la notion selon laquelle la CCK, un neuropeptide abondant dans le cerveau, joue un rôle essentiel dans les mécanismes neurobiologiques du stress et de l'anxiété. () En particulier, la libération de CCK dans la mPFC pendant le stress social chez le rat est associée à des comportements liés à l’anxiété () Bien que l'implication de la CCK dans la dépression humaine reste incertaine, des preuves récentes laissent supposer son rôle dans le comportement de type dépression provoqué par la défaite sociale chez le rat () Nous avons donc émis l'hypothèse que des altérations des niveaux de CCK ou de son récepteur CCKB (également appelé CCK2) dans la mPFC pourraient contribuer aux différences entre les souris sensibles et les souris résilientes. À 48 h après le dernier épisode de défaite, les niveaux d’ARNm de CCKB ont été réduits dans les mPFC de souris résilientes uniquement (F(2,18) = 8.084, p <0.01; Test post Bonferroni, t = 3.104, p <0.05 vs contrôle; t = 5.113, p <0.01 vs sensible) (Fig. 2A) Aucune différence n'a été observée dans les niveaux d'ARNm de la CCK chez les souris sensibles ou résilientes (données non présentées). Nous avons observé une augmentation de ΔFosB niveaux d'ARNm chez les souris sensibles compatibles avec les données protéiques rapportées ci-dessus (F(2,18) = 5.246, p <0.01; Post-test de Bonferroni t = 3.336, p <0.05 vs sensible; t tester t(12) = 2.138, p <0.05 vs contrôle) (Fig. 2B) Parce que ΔFosB régule la transcription de nombreux gènes (; ), nous avons envisagé la possibilité de réguler l’expression de l’ARNm de la CCKB. Pour répondre à cette question, nous avons d’abord surexprimé ΔFosB dans PrL et avons découvert que cette manipulation régulait positivement les niveaux d’ARNm de CCKB dans cette région (t(12) = 2.012, p <0.05 par rapport à GFP) (Fig. 2C) Fait intéressant, nous avons également constaté une diminution de c-Fos Niveaux d'ARNm après surexpression de ΔFosB (t(11) = 3.382, p <0.01) (Fig. 2C). TCes découvertes suggèrent en outre que l'induction de ΔFosB dans la PrL de souris sensibles est un mécanisme actif de susceptibilité en empêchant la suppression de CCKB observée chez des souris résilientes.

Pour renforcer encore ces observations, nous avons surexprimé ΔJunD, un partenaire de liaison ΔFosB dépourvu de son domaine de transactivation et agissant ainsi comme un antagoniste négatif dominant, et déterminé son effet sur l’expression de CCKB induite par le stress. Nous avons confirmé que le stress de défaite sociale chronique augmentait les niveaux de protéine CCKB dans la PrL de souris sensibles (t tester t(12) = 2.289, p <0.05 vs contrôle) (Fig. 2D,E) De plus, cette induction était complètement bloquée par la surexpression de ΔJunD dans cette région (F(2,20) = 6.306, p <0.01, post-test de Bonferroni t = 3.615, p <0.01) (Fig. 2D,E), soutenant l'hypothèse que ΔFosB médie l'expression de CCKB induite par le stress. De plus, le blocage de l'activité ΔFosB dans PrL, via l'expression locale de ΔJunD, a également favorisé la résilience au stress de la défaite (t tester t(16) = 2.114, p = 0.05 vs contrôle) (Fig. 2F) Le mécanisme sous-jacent à la régulation à la baisse de CCKB chez des souris résilientes reste à élucider.

Rôle de la CCKB dans la résilience et la vulnérabilité au stress

Pour tester directement le rôle de la régulation de la CCKB dans la PrL dans la médiation de la susceptibilité par rapport à la résilience, nous avons perfusé l'antagoniste sélectif des récepteurs de la CCKB, CI-988 (10 ng) directement dans cette région cérébrale de souris sensibles. CI-988 antagonise efficacement les récepteurs CCKB in vivo car il présente une affinité nanomolaire et une sélectivité élevée pour le sous-type de récepteur du CCKB (). Le blocus de l'activité de la CCKB a fortement augmenté l'interaction sociale (Fig. 2G) (interaction, F(1,20) = 7.795, p <0.05; médicament F(1,20) = 5.38, p <0.05, post-test de Bonferroni t = 3.615, p <0.01). La perfusion de CI-988 a également inversé le déficit de préférence de saccharose observé chez les souris sensibles (t(8) = 2.681, p <0.05) (Fig. 2H). Les deux résultats comportementaux indiquent que le blocage de l'action de la CCK dans PrL exerce de puissants effets analogues à ceux des antidépresseurs. Fait intéressant, lorsqu’il était administré par voie intrapéritonéale, CI-988 n’était pas efficace pour inverser la tendance à éviter la société (données non présentées).

Pour tester l'inverse, que l'activation de CCKB dans PrL pourrait médier l'évitement social et la diminution de la préférence au saccharose induite par le stress de défaite sociale chronique, nous avons examiné l'effet de la perfusion locale de CCK-8 (10 ng), la forme prédominante de CCK dans le cerveau , sur les comportements liés à la dépression et à l’anxiété. La dose du médicament a été choisie en fonction des résultats précédents dans la littérature (; ; ). Les souris ont été exposées au stress de la défaite sociale sous-maximale 24 h avant les tests comportementaux (Fig. 3A). CCK-8, infusé 30 min avant le test, était suffisant pour induire un évitement social dans le test d’interaction sociale ainsi qu’une diminution du temps passé dans les bras ouverts dans le labyrinthe élevé plus (SI: BLA, interaction, F(1,22) = 0.79, p > 0.05; effet principal de la drogue, F(1,22) = 11.75, p <0.05; Post-test de Bonferroni t = 2.957, p <0.05; NAc: interaction, F(1,26) = 6.688, p <0.05, post-test de Bonferroni t = 2.816, p <0.05; EPM: BLA, interaction, F(1,22) = 8.0, p <0.01; Post-test de Bonferroni t = 2.509, p <0.05 effet médicamenteux; t = 2.528, p <0.05 effet viral; NAc, t tester t(17) = 1.961; p <0.05 effet médicamenteux dans le groupe eYFP) (Fig. 3ÊTRE, la gauche). Aucune différence n'a été observée dans la préférence pour le saccharose (Fig. 3F,G, la gauche). Enfin, la perfusion de CCK-8 n'a ​​eu aucun effet sur le comportement (interaction sociale et élévation plus labyrinthe) de souris naïves non défaites dans ces essais (données non présentées). TCes résultats démontrent que l'augmentation de l'activité du CCKB induite par le ΔFosB chez les souris sensibles au PrL, par rapport aux souris résilientes, contribue à certains des déficits comportementaux induits par le stress présentés par ces animaux.

Blocage de la susceptibilité au stress induite par la CCK par l'activation des projections corticales de BLA versus NAc

Une diminution de l'activité neuronale de la mPFC est corrélée à des comportements analogues à la dépression chez la souris, avec une stimulation optogénétique des neurones mPFC de souris sensibles produisant des effets analogues à ceux d'un antidépresseur (). Nous avons donc émis l’hypothèse que la CCK pourrait agir dans la PrL en inhibant l’activité neuronale et en provoquant ainsi un comportement de type dépression. Conformément à cette hypothèse, nous avons observé une diminution de c-Fos niveaux d'ARNm dans PrL en réponse à la perfusion de CCK dans cette région du cerveau (t(13) = 2.235, p <0.05) (Fig. 3H).

Nous avons ensuite émis l'hypothèse que la stimulation optogénétique de la mPFC exerce ses actions antidépressives en s'opposant aux effets de la CCK sur l'activité neuronale. En testant cette hypothèse, nous avons étudié les structures sous-corticales médiant les effets anxiogéniques et de type prodépression de la CCK. Les neurones pyramidaux du projet mPFC sont fortement liés à la NAc et à la BLA, deux structures limbiques impliquées dans les réponses comportementales au stress. Il a été démontré que l’activité altérée des deux régions cérébrales joue un rôle essentiel dans l’expression des comportements analogues à l’anxiété et à la dépression (; ). Nous avons donc testé si la stimulation des projections glutamatergiques de PrL à NAc ou à BLA s'opposerait aux effets délétères de la microinfusion CCK dans PrL (Fig. 3A). Nous avons injecté AAV-CaMKII-ChR2-EYFP, ou AAV-CaMKII-EYFP en tant que contrôle, dans PrL. Le promoteur CaMKII est connu pour cibler l’expression virale vers les neurones pyramidaux glutamatergiques dans les régions corticales. Nous avons ensuite laissé suffisamment de temps (semaines 6) pour que les transgènes soient transportés aux terminaisons nerveuses de ces neurones pyramidaux dans NAc et BLA (Fig. 3I). Les souris ont subi une défaite sociale sous-maximale; 24 h plus tard, nous avons injecté CCK-8 dans PrL et, après cela, l’interaction sociale a été mesurée au cours de la stimulation optogénétique des terminaux glutamatergiques dans NAc ou BLA. Immédiatement après le test d'interaction sociale, les souris ont été évaluées dans le labyrinthe élevé plus pour évaluer le comportement lié à l'anxiété, puis pour déterminer la préférence en saccharose pour évaluer l'anhédonie.

La stimulation optogénétique des projections glutamatergiques de PrL sur NAc a complètement inversé l’évitement social induit par la CCL-8 intra-PrL (interaction, F(1,26) = 6.688, p <0.05, aucun effet du médicament dans le groupe ChR2) (Fig. 3C). En revanche, une telle stimulation de PrL à NAc n’a aucun effet sur le comportement de type anxiété tel que mesuré dans le labyrinthe élevé plus (Fig. 3E) Cependant, une telle stimulation augmentait la préférence pour le saccharose par rapport aux souris non stimulées (interaction, F(1,20) = 5.77, p <0.05; Post-test de Bonferroni t = 2.998, p <0.05 effet de stimulation chez les animaux traités par CCK-8) (Fig. 3G).

Un schéma comportemental très différent a été observé avec la stimulation optogénétique des projections de glutamatergic de PrL vers BLA. Une telle stimulation n'a pas empêché l'évitement social induit par la perfusion intra-PrL CCK-8 (interaction, F(1,22) = 0.79, p > 0.05; effet principal de la drogue, F(1,22) = 11.75, p <0.05; aucun effet dans le groupe stimulé, t tester t(12) = 2.054, p <0.05) (Fig. 3B). Cependant, la stimulation des afférences de la BLA a exercé un effet de type anxiolytique, comme en témoigne le temps prolongé passé dans les bras ouverts du labyrinthe élevé plus (interaction, F(1,22) = 8.0, p <0.01; Post-test de Bonferroni t = 2.528, p <0.05 effet du virus dans les groupes traités par CCK-8) (Fig. 3D). La stimulation des projections glutamatergiques de la BLA n’a eu aucun effet significatif sur la préférence pour le saccharose (interaction, F(1,22) = 2.08, p > 0.05) (Fig. 3F).

Discussion

Les résultats de la présente étude fournissent des preuves des adaptations moléculaires survenant dans la PrL qui sous-tendent la susceptibilité au stress social. Nous montrons l'induction de ΔFosB dans cette sous-région mPFC après un stress de défaite sociale chronique, où la surexpression de ΔFosB favorise la susceptibilité au stress. Nous avons identifié le récepteur CCKB comme étant un gène cible régulé par ΔFosB dans PrL, induisant apparemment la protéine CCKB chez les souris sensibles et empêchant la régulation à la baisse de l'expression de CCKB qui survient de manière sélective chez des souris résilientes. Nous avons également montré que la perfusion d'un agoniste de la CCK dans la PrL favorise des anomalies comportementales analogues à la dépression et à l'anxiété en réponse au stress social, alors que le blocage de l'activité des récepteurs du CCKB dans cette région de souris sensibles bloque ces effets. Nous avons ensuite utilisé des outils optogénétiques pour identifier le microcircuit impliqué dans les actions similaires à la pro-anxiété par rapport à la prodépression de la CCK dans la PRL. Bien que les projections glutamatergiques cortico-NAc compensent les déficits en récompense mis en évidence par l'évitement social et la préférence réduite en saccharose, ce microcircuit n'influence pas les effets anxiogéniques de la CCK infusée dans la PrL. Inversement, les projections corticales de BLA agissent comme médiateurs dans la manifestation de comportements liés à l'anxiété mais n'ont aucun effet sur l'évitement social induit par le stress social ou les déficits de préférences en saccharose. Ensemble, ces données montrent que les altérations de la fonction PrL après un stress de défaite sociale chronique provoquent de nombreux déficits comportementaux via des projections sous-corticales spécifiques.

ΔFosB: cartographie d'un réseau de stress limbique et rôle dans mPFC

L'immunohistochimie ΔFosB identifie les neurones affectés par le stress chronique avec une résolution monocellulaire et a été utilisée pour cartographier les circuits neuronaux régulés par le stress (; ; ). Nous avons utilisé cette méthodologie pour montrer que le stress de défaite sociale chronique induit ΔFosB dans plusieurs zones cérébrales présentant des schémas distincts entre les groupes résilients et les groupes prédisposés, certaines régions ne provoquant qu'une induction chez les souris résilientes, d’autres uniquement chez les souris sensibles, et encore dans les deux cas (Tableau 1). Des travaux antérieurs ont démontré que l’induction de ΔFosB dans le NAG ou le PAG ventral favorise la résilience au stress chronique et contribue aux réponses des antidépresseurs (; ).

Induction de ΔFosB dans PrL de souris sensibles, couplée à des découvertes antérieures selon lesquelles une stimulation optogénétique de cette région exerce des effets antidépresseurs (), nous a incités à étudier l’influence de ΔFosB dans cette région corticale. Contrairement aux résultats de NAc et de PAG ventral, nous avons constaté que ΔFosB dans PrL favorise la susceptibilité au stress de défaite sociale chronique et produit un effet de type prodepression dans le test de nage forcée, sans affecter le comportement de type anxiété ou préférence au saccharose. Contrairement à PrL, nous n’avons trouvé aucun effet de la surexpression de ΔFosB dans l’IL voisine. Une étude récente a révélé des niveaux élevés de ΔFosB dans l’IL chez des souris résilientes et a impliqué cette sous-région dans la résilience au stress social (). Des études complémentaires sont donc nécessaires pour traiter les rôles différentiels de ces deux sous-régions de mPFC, qui se sont avérés produire des effets opposés dans d’autres domaines comportementaux (; ; ). Nous avions précédemment signalé que les êtres humains déprimés présentaient des niveaux inférieurs de ΔFosB dans le cancer après l'accident examiné post mortem (), wDes taux plus élevés de ΔFosB ont été mis en évidence dans les PFC dorsolatérales (zone de Brodmann 46) chez des humains déprimés (). Les autres régions corticales n'ont pas été examinées dans cette dernière étude. Quoi qu'il en soit, ces résultats corroborent les anomalies spécifiques à la région de l'expression de ΔFosB dans la dépression humaine, où le facteur de transcription exerce des effets très différents sur la vulnérabilité au stress. Dans de futures études, il serait intéressant d’examiner l’influence de ΔFosB dans de nombreuses autres régions du cerveau où il est induit (Tableau 1) sur les réponses au stress.

Un mécanisme par lequel l'induction de ΔFosB dans la PrL pourrait contribuer à un comportement de type dépression est via la suppression de l'activité de la PrL. Il a été démontré que ΔFosB supprime les réponses au glutamate de AMPA, et c-Fos expression, dans les neurones épineux moyens de NAc (; ; ). De même, nous avons constaté une diminution de c-Fos expression après surexpression de ΔFosB dans PrL. Ainsi, l’induction de ΔFosB dans PrL pourrait être responsable de la réduction de l’activité neuronale observée dans cette région après un stress de défaite sociale chronique. Une diminution du tonus de la PrL par rapport à ses cibles sous-corticales, telles que BLA et NAc, devrait renforcer l'expression de la peur et l'impossibilité d'éteindre les réactions émotionnelles au stress (, ). De plus, les lésions mPFC induisent des réactions de stress sensibilisées et des déficits d'extinction de la peur (; ; ; ), suggérant qu'une déficience induite par le stress de mPFC, médiée en partie par l'induction du ΔFosB, pourrait contribuer à la dépression et à d'autres troubles liés au stress ().

Rôle de la CCK dans la vulnérabilité au stress

Nous apportons la preuve que le récepteur CCKB est une cible de ΔFosB, de sorte que l’induction de ΔFosB dans PrL de souris sensibles est l’un des mécanismes par lequel ΔFosB exerce ses effets analogues à la prodépression dans cette région. Bien que les actions spécifiques de la CCK dans les circuits mPFC restent floues, chez les rongeurs, la CCK est localisée dans les interneurones GABAergiques (). On pense qu'il supprime l'activité des neurones pyramidaux corticaux en augmentant la libération locale de GABA et en agissant directement sur les récepteurs du CCKB exprimés par les neurones pyramidaux (; ; ; ). Ainsi, la neurotransmission CCKergic pourrait contribuer à l'activité réduite de la PrL mentionnée ci-dessus.

La CCK est un agent anxiogène, l'administration systémique d'agonistes de la CCKB induisant des attaques de panique chez des volontaires en bonne santé. Les patients prédisposés aux attaques de panique deviennent hypersensibilisés après une exposition à la CCK (; ). Plusieurs études ont confirmé les effets anxiogènes de CCK chez les rongeurs (). La libération de CCK dans la mPFC au cours de la défaite chez le rat est associée à des comportements liés à l’anxiété () Les sous-régions PrL et IL n'ont pas été différenciées dans cette étude. Plus récemment, un blocage systémique et chronique de CCKB avec CI-988 a exercé des effets analogues aux antidépresseurs chez le rat (). Le temps d'immobilité normalisé par CI-988 lors du test de nage forcée. Il a également empêché l'hyperactivité de l'axe hypothalamo-hypophyso-surrénalien, réduit le volume de l'hippocampe et la prolifération cellulaire et réduit la préférence en saccharose normalement provoquée par la défaite sociale. Ici, nous confirmons ces résultats en montrant un effet analogue à un antidépresseur de CI-988 perfusé dans le PrL de souris sensibles, bien qu'une seule injection systémique ne mime pas cet effet.

En plus des actions aiguës de CCK dans PrL, nous avons identifié des niveaux réduits d'ARNm de CCKB chez des souris résilientes, ce qui pourrait constituer une adaptation moléculaire sous-jacente à la résilience. En effet, les altérations du tonus CCKergic, en particulier les niveaux de CCKB, constituent un mécanisme important pour l'expression de l'anxiété. Des souris transgéniques surexprimant CCKB dans le cerveau antérieur présentent des réactions d'anxiété et de peur accrues (). Notre découverte des niveaux modifiés de CCKB entre les souris résilientes et sensibles pourrait contribuer aux différences phénotypiques dans l'anxiété et le comportement dépressif. Ici, nous démontrons la PrL en tant que substrat anatomique critique pour les effets anxiogènes et prodépresseurs de CCK dans le contexte du stress social. Néanmoins, plusieurs autres régions du cerveau sont impliquées dans les actions comportementales de CCK, y compris BLA, hippocampe, NAc et PAG (; ; ; ; ). Nous avons également constaté une augmentation des niveaux de protéine CCKB, mais pas d’ARNm, dans les mPFC d’animaux sensibles. Ces résultats soulignent que, bien que les niveaux d'ARNm soient souvent en corrélation avec les niveaux de protéines, ce n'est pas nécessairement le cas ().

Nos expériences optogénétiques démontrent que l’activité croissante des projections glutamatergiques de PrL à NAc ou à BLA antagonise les effets de la CCK dans PrL. D'autres études sont nécessaires pour établir que cet effet de la stimulation optogénétique est transmis par les mêmes neurones PrL qui sont contrôlés par la CCK. Il est intéressant de noter que nos données révèlent les rôles distincts de ces deux microcircuits dans la médiation de différents domaines d’anomalies comportementales. La projection cortico-NAc contrôle l'anhédonie et la récompense; le fait qu'il réglemente l'évitement social confirme que ce symptôme est davantage le reflet d'une diminution de la motivation et de la récompense pour un comportement social et non d'une anxiété sociale accrue. Cette conclusion est compatible avec l'incapacité des benzodiazépines à corriger cette anomalie (), et avec la récente démonstration que la stimulation par les mPFC de la NAc augmente la récompense et la motivation des toxicomanes (). En revanche, la projection de cortico-BLA contrôle les symptômes liés à l’anxiété, ce qui est conforme à une littérature abondante sur les rongeurs et les humains (voir ci-dessus).

En conclusion, Les résultats de la présente étude identifient un schéma de régions du cerveau limbique impliquées chez des animaux sensibles et résilients, et démontrent des altérations de la PrL qui favorisent la susceptibilité. Ces altérations impliquent l'induction de ΔFosB et son induction du récepteur CCKB. En revanche, le blocage des actions de la CCK dans la PrL favorise des effets analogues aux antidépresseurs et aux anxiolytiques. Nous établissons également les cibles sous-corticales de ces neurones pyramidaux corticaux à l'origine de ces actions, avec un circuit cortico-NAc essentiel aux comportements liés à la dépression et un circuit cortico-BLA essentiel aux comportements liés à l'anxiété. Alors que les études cliniques sur les antagonistes du CCKB chez les patients déprimés sous 1990 n'ont pas donné de résultats prometteurs, les présents résultats suggèrent l'intérêt de revoir le potentiel thérapeutique de ces agents chez des sous-ensembles de patients exposés à des niveaux de stress élevés.

Notes

 

Ce travail a été soutenu par le National Institute of Mental Health (RJE) et la Brain & Behavior Research Foundation National Alliance for Research on Schizophrenia and Depression Young Investigator Award à VV

 

 

Les auteurs déclarent une absence d'intérêts financiers en compétition.

 

Références

  • Akirav I, Maroun M. Le rôle du circuit cortex-amygdale préfrontal médian dans les effets de stress sur l'extinction de la peur. Neural Plast. 2007; 2007: 30873. doi: 10.1155 / 2007 / 30873. [Article gratuit PMC] [PubMed] [Croix Ref]
  • Barbas H, Blatt GJ. Les projections hippocampiques topographiquement spécifiques ciblent des zones préfrontales fonctionnellement distinctes chez le singe rhésus. Hippocampe 1995; 5: 511 – 533. doi: 10.1002 / hipo.450050604. [PubMed] [Croix Ref]
  • Becker C, Thièbot MH, Touitou Y, Hamon M, Cesselin F, Benoliel JJ. Niveaux corticaux extracellulaires améliorés de matériel analogue à la cholécystokinine dans un modèle d'anticipation de la défaite sociale chez le rat. J Neurosci. 2001; 21: 262 – 269. [PubMed]
  • Becker C, Zeau B, Rivat C, Blugeot A, Hamon M, Les juges Benoliel Altérations comportementales et biologiques répétées, analogues à une dépression, induites par une défaite sociale chez le rat: implication de la cholécystokinine. Psychiatrie Mol. 2008; 13: 1079 – 1092. doi: 10.1038 / sj.mp.4002097. [PubMed] [Croix Ref]
  • Belcheva I, S Belcheva, Petkov VV, Petkov VD. Asymétrie des réponses comportementales à la cholécystokinine microinjectée dans le noyau accumbens et l'amygdale du rat. Neuropharmacologie. 1994; 33: 995 – 1002. Paramètres: 10.1016 / 0028-3908 (94) 90158-9. [PubMed] [Croix Ref]
  • JJ Benoliel, S. Bourgoin, A. Mauborgne, M. Pohl, J. Legrand, M. Hamon, Cesselin F. GABA, agissant à la fois sur les récepteurs GABAA et GABAB, inhibe la libération in vitro de matériel analogue à la cholécystokinine de la moelle épinière. Brain Res. 1992; 590: 255 – 262. Paramètres: 10.1016 / 0006-8993 (92) 91103-L. [PubMed] [Croix Ref]
  • Berton O, McClung CA, RJ Dileone, Krishnan V, W Renthal, Russo SJ, Graham D, Tsankova NM, Bolanos CA, M Rios, Monteggia LM, Self DW, Nestler EJ. Rôle essentiel du BDNF dans la voie de la dopamine mésolimbique dans le stress de la défaite sociale. Science. 2006; 311: 864 – 868. doi: 10.1126 / science.1120972. [PubMed] [Croix Ref]
  • Berton O, Covington HE, 3rd, Ebner K, NM Tsankova, Carle TL, Ulery P, Bhonsle A, M Barrot, Krishnan V, GM Singewald, Singewald N, Birnbaum S, Neve RL, Nestler EJ. L'induction de δFosB dans le gris périaqueducal par le stress favorise les réponses d'adaptation actives. Neurone. 2007; 55: 289 – 300. doi: 10.1016 / j.neuron.2007.06.033. [PubMed] [Croix Ref]
  • Bewernick BH, Hurlemann R, A Matusch, Kayser S, C Grubert, Hadrysiewicz B, Axmacher N, Lemke M, Cooper-Mahkorn D, Cohen MX, Brockmann H, Lenartz D, Sturm V et Schlaepfer TE. La stimulation cérébrale profonde de Nucleus accumbens diminue les scores de dépression et d’anxiété dans les cas de dépression réfractaire au traitement. Biol Psychiatry. 2010; 67: 110 – 116. doi: 10.1016 / j.biopsych.2009.09.013. [PubMed] [Croix Ref]
  • Bradwejn J, Koszycki D, Shriqui C. Amélioration de la sensibilité au tétrapeptide de la cholécystokinine dans le trouble panique: résultats cliniques et comportementaux. Arch Gen Psychiatry. 1991; 48: 603 – 610. doi: 10.1001 / archpsyc.1991.01810310021005. [PubMed] [Croix Ref]
  • Bremner JD. Le stress endommage-t-il le cerveau? Biol Psychiatry. 1999; 45: 797 – 805. Paramètres: 10.1016 / S0006-3223 (99) 00009-8. [PubMed] [Croix Ref]
  • Bremner JD. Stress traumatique: effets sur le cerveau. Dialogues Clin Neurosci. 2006; 8: 445 – 461. [Article gratuit PMC] [PubMed]
  • Bremner JD. Neuroimagerie dans le trouble de stress post-traumatique et d'autres troubles liés au stress. Neuroimaging Clin North Am. 2007; 17: 523 – 538. doi: 10.1016 / j.nic.2007.07.003. [Article gratuit PMC] [PubMed] [Croix Ref]
  • Britt JP, F Benaliouad, RA McDevitt, GD Stuber, PR Wise, Bonci A. Profil synaptique et comportemental de multiples entrées glutamatergiques du noyau accumbens. Neurone. 2012; 76: 790 – 803. doi: 10.1016 / j.neuron.2012.09.040. [Article gratuit PMC] [PubMed] [Croix Ref]
  • Burgos-Robles A, Bravo-Rivera H, Quirk GJ. Les neurones prébimbiques et infralimbiques signalent des aspects distincts du comportement instrumental appétitif. PLoS One. 2013; 8: e57575. doi: 10.1371 / journal.pone.0057575. [Article gratuit PMC] [PubMed] [Croix Ref]
  • Chen Q, Nakajima A, C Meacham, Tang YP. Le tonus cholécystokininergique élevé constitue un mécanisme moléculaire / neuronal important pour l'expression de l'anxiété chez la souris. Proc Natl Acad Sci US A. 2006; 103: 3881 – 3886. doi: 10.1073 / pnas.0505407103. [Article gratuit PMC] [PubMed] [Croix Ref]
  • Choi DC, SL Gourley, Ressler KJ. La signalisation pré-bimique BDNF et TrkB régule la consolidation des apprentissages émotionnels appétits et aversifs. Traduire psychiatrie. 2012; 2: e205. doi: 10.1038 / tp.2012.128. [Article gratuit PMC] [PubMed] [Croix Ref]
  • Christoffel DJ, Golden SA, Dumitriu D, Robison AJ, Janssen WG, Ahn HF, Krishnan V, Reyes CM, Han MH, Ables JL, Eisch AJ, Dietz DM, Ferguson D, Neve RL, Greengard P, Kim Y, Morrison JH Russo SJ. La kinase IκB régule la défaite sociale, la plasticité comportementale et synaptique induite par le stress. J Neurosci. 2011; 31: 314 – 321. doi: 10.1523 / JNEUROSCI.4763-10.2011. [Article gratuit PMC] [PubMed] [Croix Ref]
  • Covington HE, 3rd, Kikusui T, Goodhue J, Nikulina EM, Marteau RP, Jr, Miczek KA. Brève stress de la défaite sociale: effets durables sur la consommation de cocaïne au cours d'une frénésie et expression de l'ARNm de zif268 dans l'amygdale et le cortex préfrontal. Neuropsychopharmacologie. 2005; 30: 310 – 321. doi: 10.1038 / sj.npp.1300587. [PubMed] [Croix Ref]
  • Covington HE, 3rd, MK Lobo, Maze I, Vialou V, Hyman JM, Zaman S, LaPlant Q, Mouzon E, Ghose S, Tamminga CA, Neve RL, Deisseroth K, Nestler EJ. Effet antidépresseur de la stimulation optogénétique du cortex préfrontal interne. J Neurosci. 2010; 30: 16082 – 16090. doi: 10.1523 / JNEUROSCI.1731-10.2010. [Article gratuit PMC] [PubMed] [Croix Ref]
  • Covington HE, 3rd, Maze I, Sun H, Bomze HM, DeMaio KD, Wu EY, Dietz DM, Lobo MK, Ghose S, Mouzon E, Neve RL, Tamminga CA, Nestler EJ. Rôle de la méthylation répressive des histones dans la vulnérabilité au stress induite par la cocaïne. Neurone. 2011; 71: 656 – 670. doi: 10.1016 / j.neuron.2011.06.007. [Article gratuit PMC] [PubMed] [Croix Ref]
  • Le tétrapeptide de Cholecystokinin de Montigny C. provoque des attaques de type panique chez des volontaires sains: résultats préliminaires Arch Gen Psychiatry. 1989; 46: 511 – 517. doi: 10.1001 / archpsyc.1989.01810060031006. [PubMed] [Croix Ref]
  • De Witte P, Heidbreder C, Roques B, Juges Vanderhaeghen Effets opposés de l'octapeptide de cholécystokinine (CCK-8) et du tétrapeptide (CCK-4) après injection dans la partie caudale du noyau accumbens ou dans sa partie rostrale et les ventricules cérébraux. Neurochem Int. 1987; 10: 473 – 479. Paramètres: 10.1016 / 0197-0186 (87) 90074-X. [PubMed] [Croix Ref]
  • Diorio D, Viau V, Meaney MJ. Le rôle du cortex préfrontal médian (gyrus cingulaire) dans la régulation des réponses hypothalamo-hypophyso-surrénaliennes au stress. J Neurosci. 1993; 13: 3839 – 3847. [PubMed]
  • Drevets WC. Neuroimagerie et études neuropathologiques de la dépression: implications pour les caractéristiques cognitives-émotionnelles des troubles de l'humeur. Voir Opin Neurobiol. 2001; 11: 240 – 249. Paramètres: 10.1016 / S0959-4388 (00) 00203-8. [PubMed] [Croix Ref]
  • Fales CL, Barch DM, MM Rundle, Mintun MA, Snyder AZ, Cohen JD, Mathews J, Sheline YI. Traitement altéré des interférences émotionnelles dans les circuits cérébraux de contrôle affectif et cognitif dans la dépression majeure. Biol Psychiatry. 2008; 63: 377 – 384. doi: 10.1016 / j.biopsych.2007.06.012. [Article gratuit PMC] [PubMed] [Croix Ref]
  • Fales CL, Barch DM, MM Rundle, Mintun MA, Mathews J, Snyder AZ, Sheline YI. Le traitement antidépresseur normalise l'hypoactivité dans le cortex préfrontal dorsolatéral lors du traitement d'interférences émotionnelles dans la dépression majeure. J Affect Disord. 2009; 112: 206 – 211. doi: 10.1016 / j.jad.2008.04.027. [Article gratuit PMC] [PubMed] [Croix Ref]
  • Feder A, Nestler EJ, Charney DS. Psychobiologie et génétique moléculaire de la résilience. Nat Rev Neurosci. 2009; 10: 446 – 457. doi: 10.1038 / nrn2649. [Article gratuit PMC] [PubMed] [Croix Ref]
  • Gallopin T, Geoffroy H, Rossier J, Lambolez B. Sources corticales de CRF, NKB et CCK et leurs effets sur les cellules pyramidales du néocortex. Cereb Cortex. 2006; 16: 1440 – 1452. doi: 10.1093 / cercor / bhj081. [PubMed] [Croix Ref]
  • Grubert C, R Hurlemann, Bewernick BH, Kayser S, Hadrysiewicz B, Axmacher N, Sturm V, Schlaepfer TE. Sécurité neuropsychologique de la stimulation cérébrale profonde du noyau accumbens en cas de dépression majeure: effets de la stimulation au mois de 12. World J Biol Psychiatry. 2011; 12: 516 – 527. doi: 10.3109 / 15622975.2011.583940. [PubMed] [Croix Ref]
  • Grueter BA, AJ Robison, Neve RL, Nestler EJ, Malenka RC. ΔFosB module différentiellement la fonction de voie directe et indirecte du noyau accumbens. Proc Natl Acad Sci US A. 2013; 110: 1923 – 1928. doi: 10.1073 / pnas.1221742110. [Article gratuit PMC] [PubMed] [Croix Ref]
  • Gygi SP, Y Rochon, Franza BR, Aebersold R. Corrélation entre l'abondance des protéines et de l'ARNm dans la levure. Mol Cell Biol. 1999; 19: 1720 – 1730. [Article gratuit PMC] [PubMed]
  • CA Heidbreder, Groenewegen HJ. Le cortex préfrontal médial chez le rat: mise en évidence d'une distinction dorso-ventrale basée sur des caractéristiques fonctionnelles et anatomiques. Neurosci Biobehav Rev. 2003; 27: 555 – 579. doi: 10.1016 / j.neubiorev.2003.09.003. [PubMed] [Croix Ref]
  • Holson RR. Lésions corticales préfrontales mésiales et timidité chez le rat: I. Réactivité aux stimuli aversifs. Physiol Behav. 1986; 37: 221 – 230. Paramètres: 10.1016 / 0031-9384 (86) 90224-6. [PubMed] [Croix Ref]
  • Keedwell PA, Andrew C, Williams SC, Brammer MJ, Phillips ML. Les corrélats neuraux de l'anhédonie dans le trouble dépressif majeur. Biol Psychiatry. 2005; 58: 843 – 853. doi: 10.1016 / j.biopsych.2005.05.019. [PubMed] [Croix Ref]
  • Kennedy SH, Giacobbe P. Dépression réfractaire au traitement: avancées dans les thérapies somatiques. Ann Clin Psychiatry. 2007; 19: 279 – 287. doi: 10.1080 / 10401230701675222. [PubMed] [Croix Ref]
  • Kennedy SH, Evans KR, S Krüger, HS Mayberg, Meyer JH, McCann S, AI Arifuzzman, Houle S, Vaccarino FJ. Modifications du métabolisme régional du glucose cérébral mesurées par tomographie à émission de positrons après traitement par paroxétine de la dépression majeure. Suis J psychiatrie. 2001; 158: 899 – 905. doi: 10.1176 / appi.ajp.158.6.899. [PubMed] [Croix Ref]
  • Krishnan V, Han MH, Graham DL, O Berton, Renthal W, Russo SJ, Laplant Q, Graham A, Lutter M, Lagace DC, Ghose S, Reister R, Tannous P, TA Vert, Neve RL, Chakravarty S, Kumar A , Eisch AJ, Self DW, Lee FS et al. Adaptations moléculaires sous-tendant la susceptibilité et la résistance à la défaite sociale dans les régions de récompense du cerveau. Cellule. 2007; 131: 391 – 404. doi: 10.1016 / j.cell.2007.09.018. [PubMed] [Croix Ref]
  • Krishnan V, Nestler EJ. La neurobiologie moléculaire de la dépression. La nature. 2008; 455: 894 – 902. doi: 10.1038 / nature07455. [Article gratuit PMC] [PubMed] [Croix Ref]
  • Lehmann ML, Herkenham M. L'enrichissement de l'environnement confère une résistance au stress à la défaite sociale par le biais d'une voie neuroanatomique dépendante du cortex infralimbique. J Neurosci. 2011; 31: 6159 – 6173. doi: 10.1523 / JNEUROSCI.0577-11.2011. [Article gratuit PMC] [PubMed] [Croix Ref]
  • Leistedt SJ, Linkowski P. Brain, réseaux, dépression, etc. Eur Neuropsychopharmacol. 2013; 23: 55 – 62. doi: 10.1016 / j.euroneuro.2012.10.011. [PubMed] [Croix Ref]
  • HS Mayberg, AM Lozano, Voon V, SE McNeely, D. Seminowicz, C. Hamani, JM Schwalb, SH Kennedy. Stimulation cérébrale profonde en cas de dépression résistante au traitement. Neurone. 2005; 45: 651 – 660. doi: 10.1016 / j.neuron.2005.02.014. [PubMed] [Croix Ref]
  • Maze I, Covington HE, 3rd, DM Dietz, LaPlant Q, Renthal W, Russo SJ, Mécanicien M, Mouzon E., Neve RL, Haggarty SJ, Ren Y, Sampath SC, Hurd YL, Greengard P, Tarakhovsky A, Schaefer A, Nestler EJ. Rôle essentiel de l'histone méthyltransférase G9a dans la plasticité induite par la cocaïne. Science. 2010; 327: 213 – 216. doi: 10.1126 / science.1179438. [Article gratuit PMC] [PubMed] [Croix Ref]
  • McClung CA, Nestler EJ. Régulation de l'expression des gènes et de la récompense de la cocaïne par CREB et DeltaFosB. Nat Neurosci. 2003; 6: 1208 – 1215. doi: 10.1038 / nn1143. [PubMed] [Croix Ref]
  • Milad MR, Quirk GJ. Les neurones du cortex préfrontal médian signalent la mémoire pour l'extinction de la peur. La nature. 2002; 420: 70 – 74. doi: 10.1038 / nature01138. [PubMed] [Croix Ref]
  • Nahas Z, Anderson BS, Borckardt J, Arana AB, George MS, Reeves ST et Takacs I. Stimulation corticale préfrontale épidurale bilatérale pour la dépression réfractaire au traitement. Biol Psychiatry. 2010; 67: 101 – 109. doi: 10.1016 / j.biopsych.2009.08.021. [Article gratuit PMC] [PubMed] [Croix Ref]
  • Nikulina EM, Arrillaga-Romany I, Miczek KA, Hammer RP., Jr Altération durable des structures mésocortico-limbiques après stress de défaite sociale répétée chez le rat: évolution temporelle de l'ARNm du récepteur mu-opioïde et de l'immunoréactivité de FosB / DeltaFosB. Eur J Neurosci. 2008; 27: 2272 – 2284. doi: 10.1111 / j.1460-9568.2008.06176.x. [Article gratuit PMC] [PubMed] [Croix Ref]
  • Noble F, Roques BP. Récepteur CCK-B: chimie, biologie moléculaire, biochimie et pharmacologie. Prog Neurobiol. 1999; 58: 349 – 379. Paramètres: 10.1016 / S0301-0082 (98) 00090-2. [PubMed] [Croix Ref]
  • Noble F, SA Wank, Crawley JN, J Bradwejn, KB Seroogy, M Hamon, Roques BP. Union internationale de pharmacologie: XXI. Structure, distribution et fonctions des récepteurs de la cholécystokinine. Pharmacol Rev. 1999; 51: 745 – 781. [PubMed]
  • Pérez de la Mora M, Hernandez-Gómez AM, Méndez-Franco J, Fuxe K. Cholecystokinin-8 augmente K (+) - évoqué [3Dégagement d'acide H] gamma-aminobutyrique dans des tranches de différentes régions du cerveau. Eur J Pharmacol. 1993; 250: 423 – 430. Paramètres: 10.1016 / 0014-2999 (93) 90029-H. [PubMed] [Croix Ref]
  • Perrotti LI, Y Hadeishi, PG Ulery, M. Barrot, L Monteggia, Duman RS, EJ Nestler. Induction de δFosB dans les structures cérébrales liées à la récompense après un stress chronique. J Neurosci. 2004; 24: 10594 – 10602. doi: 10.1523 / JNEUROSCI.2542-04.2004. [PubMed] [Croix Ref]
  • Perrotti LI, RR tisserand, Robison B, Renthal W, Maze I, S Yazdani, Elmore RG, DJ Knapp, Selley DE, Martin BR, Sim-Selley L, Bachtell RK, Self DW, Nestler EJ. Schémas distincts d’induction de DeltaFosB dans le cerveau par des drogues d’abus. Synapse. 2008; 62: 358 – 369. doi: 10.1002 / syn.20500. [Article gratuit PMC] [PubMed] [Croix Ref]
  • Radley JJ, AB Rocher, Miller M, groupe Janssen, C Liston, PR Hof, BS McEwen, JH Morrison. Un stress répété induit une perte de la colonne dendritique dans le cortex préfrontal médial du rat. Cereb Cortex. 2006; 16: 313 – 320. doi: 10.1093 / cercor / bhi104. [PubMed] [Croix Ref]
  • Renthal W, Carle TL, Maze I, HE Covington, 3rd, Truong HT, Alibhai I, Kumar A, Montgomery RL, Olson EN, Nestler EJ. Delta FosB intervient dans la désensibilisation épigénétique du gène c-fos après une exposition chronique à l'amphétamine. J Neurosci. 2008; 28: 7344 – 7349. doi: 10.1523 / JNEUROSCI.1043-08.2008. [Article gratuit PMC] [PubMed] [Croix Ref]
  • Rezayat M, Roohbakhsh A, MR Zarrindast, R Massoudi, Djahanguiri B. Cholécystokinine et GABA dans l’hippocampe dorsal de rats dans le test d’anxiété élevé. Physiol Behav. 2005; 84: 775 – 782. doi: 10.1016 / j.physbeh.2005.03.002. [PubMed] [Croix Ref]
  • Richard JM, Berridge KC. Le cortex préfrontal module le désir et la crainte générés par la perturbation du glutamate par le noyau accumbens. Biol Psychiatry. 2013; 73: 360 – 370. doi: 10.1016 / j.biopsych.2012.08.009. [Article gratuit PMC] [PubMed] [Croix Ref]
  • Rotzinger S, Vaccarino FJ. Sous-types de récepteurs de la cholécystokinine: rôle dans la modulation des comportements liés à l'anxiété et à la récompense dans des modèles animaux. J Psychiatry Neurosci. 2003; 28: 171 – 181. [Article gratuit PMC] [PubMed]
  • Schlaepfer TE, Cohen MX, Frick C, M Kosel, Brodesser D, Axmacher N, Joe AY, Kreft M, Lenartz D, Sturm V. Une stimulation cérébrale profonde pour récompenser les circuits atténue l'anhédonie dans une dépression majeure réfractaire. Neuropsychopharmacologie. 2008; 33: 368 – 377. doi: 10.1038 / sj.npp.1301408. [PubMed] [Croix Ref]
  • Sierra-Mercado D, Padilla-Coreano N, Quirk GJ. Rôles dissociables des cortex pré-limbiques et infralimbiques, de l'hippocampe ventral et de l'amygdale basolatérale dans l'expression et l'extinction de la peur conditionnée. Neuropsychopharmacologie. 2011; 36: 529 – 538. doi: 10.1038 / npp.2010.184. [Article gratuit PMC] [PubMed] [Croix Ref]
  • Silva MG, MA Boyle, Finger S, Numan B, AA AA de Bouzrara, CR Almli. Effets comportementaux des petites et grandes lésions du cortex frontal médial du rat. Exp Brain Res. 1986; 65: 176 – 181. [PubMed]
  • Somogyi P, AJ Hodgson, AD Smith, MG Nunzi, A Gorio, JY Wu. Différentes populations de neurones GABAergiques dans le cortex visuel et l'hippocampe du chat contiennent un matériel immunoréactif à la somatostatine ou à la cholécystokinine. J Neurosci. 1984; 4: 2590 – 2603. [PubMed]
  • Surget A, Tanti A, Leonardo ED, Laugeray A, Rainer Q, C Touma, R Palme, Griebel G, Y Ibarguen-Vargas, R Hen, Belzung C. Les antidépresseurs recrutent de nouveaux neurones pour améliorer la régulation de la réponse au stress. Psychiatrie Mol. 2011; 16: 1177 – 1188. doi: 10.1038 / mp.2011.48. [Article gratuit PMC] [PubMed] [Croix Ref]
  • Taniguchi H, He M, Wu P, Kim S, R Paik, K Sugitsiani, D Kvitsiani, Fu Y, Lu J, Lin Y, Miyoshi G, Shima Y, Fishell G, Nelson SB, Huang ZJ. Une ressource de lignes de conducteur Cre pour le ciblage génétique de neurones GABAergiques dans le cortex cérébral. Neurone. 2011; 71: 995 – 1013. doi: 10.1016 / j.neuron.2011.07.026. [Article gratuit PMC] [PubMed] [Croix Ref]
  • Teyssier JR, Ragot S, JC Chauvet-Gélinier, Trojak B, Bonin B. Activation d'un modèle d'expression génique dépendant de DeltaFOSB dans le cortex préfrontal dorsolatéral de patients présentant un trouble dépressif majeur. J Affect Disord. 2011; 133: 174 – 178. doi: 10.1016 / j.jad.2011.04.021. [PubMed] [Croix Ref]
  • Tsankova NM, O Berton, Renthal O, Kumar A, Neve RL, Nestler EJ. Régulation soutenue de la chromatine hippocampique dans un modèle murin de dépression et d’action antidépressive. Nat Neurosci. 2006; 9: 519 – 525. doi: 10.1038 / nn1659. [PubMed] [Croix Ref]
  • Tye KM, Prakash R, Kim SY, Fenno LE, Grosenick L, Zarabi H, Thompson KR, Gradinaru V, Ramakrishnan C, Deisseroth K. Amygdala contrôlant le contrôle réversible et bidirectionnel de l'anxiété. La nature. 2011; 471: 358 – 362. doi: 10.1038 / nature09820. [Article gratuit PMC] [PubMed] [Croix Ref]
  • Vialou V, AJ Robison, Laplant QC, HE Covington, 3rd, DM Dietz, Ohnishi YN, Mouzon E, Rush AJ, X Watts EL, Wallace DL, Iñiguez SD, Ohnishi YH, Steiner MA, Warren BL, Krishnan V, Bolaños CA, Neve RL, Ghose S., Berton O, Tamminga CA et al. DeltaFosB dans les circuits de récompense du cerveau assure la résilience au stress et aux réponses des antidépresseurs. Nat Neurosci. 3; 2010: 13 – 745. doi: 752 / nn.10.1038. [Article gratuit PMC] [PubMed] [Croix Ref]
  • Vogt BA, DM Finch, Olson CR. Hétérogénéité fonctionnelle dans le cortex cingulaire: les régions de l'exécutif antérieur et de l'évaluation postérieure. Cereb Cortex. 1992; 2: 435 – 443. doi: 10.1093 / cercor / 2.6.435-a. [PubMed] [Croix Ref]
  • Wilkinson MB, Xiao G, Kumar A, LaPlant Q, Renthal W, Sikder D, Kodadek TJ, Nestler EJ. Le traitement à l'imipramine et la résilience présentent une régulation de la chromatine similaire dans le noyau de la souris accumbens dans les modèles de dépression. J Neurosci. 2009; 29: 7820 – 7832. doi: 10.1523 / JNEUROSCI.0932-09.2009. [Article gratuit PMC] [PubMed] [Croix Ref]
  • Winstanley CA, LaPlant Q, Theobald DE, Green TA, Bachtell RK, Perrotti LI, DiLeone RJ, Russo SJ, Garth WJ, Self DW, Nestler EJ. L'induction de DeltaFosB dans le cortex orbitofrontal induit une tolérance au dysfonctionnement cognitif induit par la cocaïne. J Neurosci. 2007; 27: 10497 – 10507. doi: 10.1523 / JNEUROSCI.2566-07.2007. [PubMed] [Croix Ref]
  • Yaksh TL, Furui T, Kanawati IS, Go VL. Libération in vivo de cholécystokinine par le cortex cérébral de rat: rôle des systèmes de récepteurs GABA et glutamate. Brain Res. 1987; 406: 207 – 214. Paramètres: 10.1016 / 0006-8993 (87) 90784-0. [PubMed] [Croix Ref]
  • Zanoveli JM, Netto CF, Guimarães FS, Zangrossi H., Jr Des injections grises peraqueductales systémiques et intra-dorsales de l'octapeptide sulfaté de cholécystokinine (CCK-8) induisent une réponse de type panique chez les rats soumis au T-maze élevé. Peptides. 2004; 25: 1935 – 1941. doi: 10.1016 / j.peptides.2004.06.016. [PubMed] [Croix Ref]